cs-49-3-913

7/30/2019 cs-49-3-913

http://slidepdf.com/reader/full/cs-49-3-913 1/10

CROP SCIENCE, VOL. 49, MAY–JUNE 2009 913

RESEARCH

Canada wildrye (CWR, Elymus canadensis L.) Vg

(VWR, E . virginicus L.) coo-sso gsss tv

to Noth Amc (Htchcock Chs, 1971). Both spcs

g shot-v ps, hgh s-pot (Js t

., 1990), ttpo (2n = 4x = 28) th gomc costtu-

to o SSHH (D, 1982). Th S H goms Elymus

v om Pseudoroegneria Critesion (om Hordeum) spcs

spctv, bs o ctogtc (D, 1984), gomc DNA

(Su t ., 1997) choopst DNA vc (McM Su, 2004). Th s tst usg CWR VWR o o-

g poucto (Schust Lo Gc, 1973; Sso t

., 2004,b), cosvto puposs (Bush, 2002; USDA–NRCS

2003; Lo-R t ., 2003), cmto ptgs (Po

1979; No t ., 1996), s souc o gs o mpovmt

o oth spcs (Dh, 1996; Dh Jopp, 1992; Kum

Wto, 1992; Pk Wto, 1989).

Bg fots th CWR VWR hv b v m-

t. Th o ko cutv o CWR, ‘M’, s

1946 b th USDA th Noth Dkot Agcutu Exp-

mt Stto, s ct scto o cocto om Noth

Dkot (Aso Shp, 1994). I to, th VWR cutv

Genetic Variation within and among

Wildrye (Elymus canadensis and E . virginicus)Populations from the Southern Great Plains

M C. Sh, Co A. Youg, A A. Hopks*

ABSTRACT

There is interest in Canada wildrye (CWR, Ely-

mus canadensis L.) and Virginia wildrye (VWR,

E . virginicus L.) or conservation and orage

uses. Our objectives were to identiy a set o

molecular markers to assess genetic struc-

ture within and diversity among populations o

CWR and VWR rom the Southern Great Plains

and to determine i these populations had an

associated ungal endophyte. Nine CWR and

fve VWR populations and two barley ( Hor-

deum vulgare L.) cultivars were genotyped

using simple sequence repeat (SSR) markers

isolated rom tall escue [Lolium arundinaceum

(Schreb.) Darbysh.] expressed sequence tags

(TF ESTs). Scorable ragments were produced

by 31% o TF EST-SSRs tested, thus identiy-ing a set o SSR markers or wildrye. Popula-

tions grouped into three clusters consisting o

(i) three wild populations, one plant introduc-

tion, and two commercial sources o CWR;

(ii) all VWR populations and three CWR plant

introductions; and (iii) barley cultivars. Cluster-

ing indicated possible gene ow between CWR

and VWR. Genetic variation within popula-

tions was minimal and comparable to that o

the barley cultivars. Thus, unlike many ances-

tral cultivars and landraces o sel-pollinated

crops, CWR and VWR populations consisted

o essentially pure lines and can be handled assuch in a breeding program. Potentially sexual

and asexual epichloë endophytes were ound

in several populations, indicating the need to

account or endophytes in breeding and germ-

plasm conservation eorts o wildrye.

Fog Impovmt Dvso, Smu Robts Nob Fouto

Ic., Amo, OK 73401. Rcv 8 M 2008. *Cospog

utho ([email protected]).

Abbreviations: CWR, C ; PCR, poms ch

cto; SSR, smp squc pt; TF EST, t scu xpsssquc tg; UPGMA, ught p goup mtho th thm-

tc m; VWR, Vg .

Pubsh Cop Sc. 49:913–922 (2009).o: 10.2135/copsc2008.04.0239© Cop Scc Soct o Amc677 S. Sgo R., Mso, WI 53711 USA

F vb o though th utho-suppot op ccss opto.

A ghts sv. No pt o ths poc m b pouc o tsmt t om o b ms, ctoc o mchc, cug photocopg, cog,o omto stog tv sstm, thout pmsso tg omth pubsh. Pmsso o ptg o ptg th mt cot hhs b obt b th pubsh.

7/30/2019 cs-49-3-913


914 WWW.CROPS.ORG CROP SCIENCE, VOL. 49, MAY–JUNE 2009

Omh s mkt b Stock S Fms o Muock,

NE. Rct, th USDA–ARS gss bg pogm

Lco, NE, s th CWR cutv Hom-

st (K.P. Vog, pso commuctos, 2008). Sv

“souc t” o “sct” gmpsm coptps

o CWR VWR om th Mst (USDA–NRCS,

2000; Buckhof, 2002; Dug t ., 2006) Txs

(USDA–NRCS, ..) hv b s th pst c

b th USDA–NRCS. Um, osct gmpsmo CWR, to ths pot s “commc souc

poputos,” vb th s t.

Th ppcbt o t scu [Lolium arundinaceum

(Schb.) Dbsh.] xpss squc tg (TF EST)

smp squc pts (SSRs) spcs hs ot

b tm. Poms ch cto (PCR)–bs

mk sstms such s om mp pomophc

DNA SSR mks hv b pp to Elymus sp-

cs, cug CWR (Su t ., 1997), though ss

o gtc vto th mog popu-

tos bs o DNA pps to b ckg. Tscb

gos ot cosv coss spcs g, soSSR mks v om xpss squc tgs (EST-

SSRs) hv tc to b tsb. Tsbt

o SSR oc coss spcs (>50%) th gus (Th

t ., 2003) bt g (Euj t ., 2004; Sh

t ., 2004) hv b pot, suggstg tht TF EST-

SSRs cou b ppcb to CWR VWR.

Gtc stuctu s mpott tmg ho to

h poputos bg pogm. Fo stc,

cs o s-potg spcs such s ht (Triticum

aestivum L.) qut cosst o mxtu o gotps

(.g., Rbo-Cvho t ., 2004). As cosquc,

cutv vopmt fots ot succssut sotg supo s om sg c (A,

1987). Sm xmps xst oth s-pot cops

such s ot ( Avena sativa L.) (Bo Pttso, 1992)

sob [Glycine max (L.) M.] (Loz Sho-

mk, 1996; Fh, 1987). Bs o sozm o ozm

t, vto th poputos pps to b

mm m (Cgg t ., 1976; Ss t ., 1979;

Díz t ., 1998) though ot (Ss Hmck,

1980) css. It- tspcc vto o CWR

VWR poputos s v b ss o cho-

opst DNA mks (McM Su, 2004); v

mo fcs obsv bt th o th

ou CWR poputos xm.

Eophts c hv umb o mpctos h

vopg mpov gss cutvs. I Festuca Lolium

spp., Neotyphodium ophts c mpt toc to

botc (Pop Boos, 2005) botc (Mosk

t ., 2005) stsss, but th m so hv tm-

t fcts o gzg vstock (Thompso t ., 2001;

Ov, 2005). Nov, otoxc sts hv ct b

po og cutvs to mt m hth

pobms ssoct th ophts (Bouto t ., 2002;

Esto Tpp, 2005). Sxu spcs o ophts,

cug Epichloë spp., c pouc stom o th host,

hch sts vopmt o th pouctv cum,

coto ko s chok ss, thus gt ucg

s s (P Am, 2006). Th sxu

ug opht Epichloë elymi s commo ou

CWR (Wht Butm, 1987) VWR (Lucht-

m C, 1993), mo ct sxu Neo-typhodium spp. hv b ou poputos o

CWR (Vto t ., 2001; Bu t ., 2007) VWR

(Moo t ., 2004). Athough th mpcts o opht

cto CWR VWR o host tss gz-

g m hth ot ko, ogc sttg pot

cutv vopmt s to tm ophts

pst th pt gmpsm so, hth th

m b pott chok-omg sxu spcs.

Th gss bg pogm t th Nob Fouto

(Amo, OK) hs bgu fot to vop mpov

cutvs o CWR o th U.S. South Gt Ps o

og poucto cosvto uss. Coctos o CWR m om th South Ps vut

o psstc u hv gzg, th poputo

98CWR8 s t s pomsg o uth v-

opmt (Hopks Wst, 2002). W utook ths

sch pt to tm hth 98CWR8 oth

poputos cosst o sg pu s o um-

b o vs gotps. To o so, st out to t

st o TF EST-SSRs tht cou b us to chctz

gtc vto th mog sv possb gm-

psm soucs (.g., PIs, coctos om th , comm-

c vb s, Vg ) tht mght b us

th CWR bg pogm. F, bcus o th mp-ctos o th bg pogm, to tm

hth ths vous gmpsm soucs host o-

pht. Thus, th objctvs o ths sch to t

st o TF EST-SSRs to ssss gtc stuctu th

vst mog poputos o CWR VWR om th

South Gt Ps to tm ths poputos

h ssoct epichloë opht.

MATERIALS AND METHODS

Plant Materials

A tot o 70 gotps smp, cug vvus om ch o CWR v VWR popu-

tos. To gotps om ch o to b (Hordeum vulgare

L.) cutvs (Tb 1) cu s cotos o compso.

W poputos coct b A Hopks Txs

Okhom om oss o tv g sts; PIs, p-

sttv o pubc vb CWR VWR gmpsm

ogtg om th South Gt Ps, cv om

th USDA Nto Pt Gtc Sstm; th commc

souc poputos puchs om Stock S Fms, Ic.

(Muock, NE) Shp Boths S Co. (H, KS). Eght

gotps, o ch om t scu b th ch

7/30/2019 cs-49-3-913


CROP SCIENCE, VOL. 49, MAY–JUNE 2009 WWW.CROPS.ORG 915

DNs potoco s us th mo mocto: st o

to-stp DNA uto, oo o-stp DNA uto th

90 μ o AE buf ch tub. Th DNA cocttos

qut usg Ho D Qut 200 (Amshm Bosc-

cs, Psct, NJ) DNA uoomt. Tt ogms o

DNA us s tmpt o ch PCR cto. Th PCRctos u u st cotos o pms; PCR

poucts sov o 6% pocm tug gs

vsuz b sv stg, s scb Sh t . (2004).

SSR Amplification, Fragment Scoring,

and Evaluation of PolymorphismA tot o 157 pm ps obt om TF EST-SSRs

st sc th subst o pts (ght gotps) to stb-

sh pm sts tht ou pouc mpcto poucts cos

spcs. Sct pms th ss th th compt

om CWR VWR, us o th t scg o

th SSR pms. Th t scu gotp HD28-56 s us

s coto to v mpctos suts. Ss pt

to 5- b 5- b 5-cm pots th commc pottg

mx (SB 100 bg mx; SuGo Hotcutu, Bvu,

WA). A soub t z souto (Th Scotts Co., Msv,OH) s us s to mt vgoous goth. Pts

ts to 4-L pots o to go u st-

ghous cotos.

DNA Isolation and PCR AmplificationPt DNA s xtct usg Qg DNs Pt M Kt

(Qg, Vc, CA). Appoxmt 200 mg o oug

b om ch pt s coct 2.0-mL mcoctug

tubs. Fsh oz tssu s gou to po usg

Mx M Tp MM 300 (RETSCH, H, Gm). Th

Table 1. Wildrye populations, barley cultivars, and genotypes (in parenthesis), along with their origins and seed sources exam

ined for genetic diversity. Endophyte status of populations was determined using immunoblot and polymerase chain reaction

(PCR) techniques.

Population

(genotypes)Status

Origin

Seed source †‡

Endophyte status§

Species

Closestnonhybrid

ancestor ¶ImmunoblotPCRseed

PCRblade

Canada wildrye

Sharp’s (Sh 143, 145,

147, 149, 150)

Commercial

source population

Missouri Sharp Bros. Seed Co. – + + Epichloë amarillans Eam

Stock’s (St 154, 155,

156, 157, 159)

Commercial

source population

Iowa Stock Seed Farms -/+ + + ND

98CWR8 (CW 1, 2, 3,

5, 7)

Wild population North-central

Texas

NF collection + + + Neotyphodium sp. Eam × Eel

99CWR6 (CW 11, 12,

14, 16, 18)

Wild population Central Texas NF collection + + + Neotyphodium sp. Eam × Eel

99CWR7 (CW 21, 24,

25, 27, 29)

Wild population Central Texas NF collection -/+ + + Epichloë amarillans Eam

PI 436918 (CW 31, 33,

34, 36, 38)

PI West Texas NPGS – – –

PI 436933 (CW 41, 43,

45, 47, 49)

PI Central Texas NPGS – – –

PI 613134 (CW 51, 52,

54, 55, 56)

PI Southeast Texas NPGS + + – Epichloë elymi Eel

PI 436924 (CW 62, 63,65, 67, 70) PI North-centralOklahoma NPGS – ? –

Virginia wildrye

03VWR2 (VW 71, 73,

74, 76, 78)

Wild population South-central

Oklahoma

NF collection – ND# + Epichloë elymi Eel

PI 436945 (VW 83, 84,

85, 89, 90)

PI Northeast Texas NPGS – – –

PI 436955 (VW 93, 94,

96, 99, 100)

PI Central Texas NPGS -/+ – –

PI 436962 (VW 102,

103, 104, 105, 106)

PI East-central

Texas

NPGS – – –

PI 436968 (VW 113,

114, 115, 117, 118)

PI Southeast Texas NPGS – ND –

Barley

Steptoe (S 122, 123) Cultivar Washington NPGS – ND –

Morex (M 132, 133) Cultivar Minnesota NPGS – ND –

†NPGS = USDA National Plant Germplasm System.‡NF = Noble Foundation.§+ = endophyte infected; − = endophyte free.¶Eam = Epichloë amarillans; Eel = Epichloë elymi .#ND, not determined.

7/30/2019 cs-49-3-913



smp st o gotps. Th SSR bs sco s pst

o bst, o c, poucb bs sco. Pm-

s tht pouc m t, cut-to-sco bs co-

s ospcc mpctos. Th b sz s pot

o th most ts mp b o ch SSR o th vg

o th stutt th tst s th sm, usg 10-bp DNA

(Ivtog L Tchoogs, Csb, CA) s th -

c pot. Nu s, h gv pouct s ot mp-

, ssg to gotps oc com.

Determination of Genetic RelationshipMks obt om TF EST-SSRs z to co-

stuct smt mtcs mog th gotps usg

NTSYS-PC 2.10 (App Bosttstcs, Stukt, NY). Gtc

smt mog gotps s ccut usg th DICE

smt co ct (Dc, 1945) oog th SIMQUAL

pocu. Th squt ggomtv hchc

st custg gothm s us to costuct ogms

usg th smt co cts. Th ‘TM’ opto s st to

‘FIND’ to tct possb ts usg th ught p

goup mtho th thmtc m (UPGMA) mtho. Th

TREE pocu o th NTSYS pogm s us to ct

th ogm. Th PAUP* 4.0 pogm s us o boot-stp ss. Th ss s pom usg th bt po-

gm th 1000 pctos oog th ghbo jog

gothm (Sofo, 2002). Mmum t tto cto

s st t 50%.

Endophyte DetectionTh psc o epichloë ophts (th th sxu Epichloë

sp. o sxu Neotyphodium sp.) s tct ct pt

mt usg th Neotyphodium mmuobot tcto kt

(Htt t ., 1997; Htt t ., 1999) o PCR mtho th

pms spcc to epichloë ophts s scb bo.

Th mmuobot pocu (Agostcs, Ic., Wtks-

v, GA) s pom oog th muctu’s stuc-

tos th stm coss-sctos om ch gotp coct t

gou v. Th stm sctos sh th oub s-

t stz t bo th ss. Dvopmt o pk

coo o th mmuobot mmb s cos ctv

o opht psc.

Eophts cutu om suc-stz stm

sctos o to go out o potto xtos g m

(Dco Lbotos, Dtot, MI). Gomc DNA s sot

om pu cutu oog th potoco o Moo t . (1999)

th mo moctos: tht s, s t (1 M NC) pucto

stp o th mov o to poscchs s omt-

t. Eopht DNA s tst th th TF EST-SSR pmsto mk su o poucb bs pouc th ths

pt pms.

To xm th opht sttus o th s stocks,

gomc DNA s sot om 12 vu ss o ch

vb poputo usg th Mgttct 96 DNA pt co

kt (Qg) s p th muctu’s stuctos. Poms

ch cto s us to tct opht gomc DNA

squcs th tot DNA xtct om gss ss

om oug bs. Th PCR s bs o pms tht

to th opht tsto ogto cto 1-α (tef1)

(t1-xo1, GGGTAAGGACGAAAAGACTCA t1-

xo6u-1, CGGCAGCGATAATCAGGATAG) (Cv t .,

2001). Poms ch ctos pom th 25-

o 50-μL cto voums cotg 5 to 100 g o DNA, 1x

g cto buf (Pomg, Mso, WI), 200 M ch

NTPs, 200 M o ch pm, 1 U GoTq (Pomg). Th

PCR pogm cosst o 94°C o 2 m oo b 35 ccs

o 94°C o 15 s, 58°C o 30 s, 72°C o 1 m. Th PCR

poucts spt o 2% gos 1X Ts-bot-th-

mttctc c (Ivtog), st th thum

bom vsuz u UV ght. Eopht pscs tm bs o th psc o spcc PCR b.

To tm th epichloë opht spcs, th mp

PCR gmts obt om th s smps co

to pGEM-Ts (Pomg) us to tsom Escherichia

coli XL1 bu cs. DNA s sot (QIApp Sp Mpp

Kt, Qg) om 12 to 24 pt coos cotg

th tef1 gmt om ch pt–opht ssocto

squc. I th cs o 99CWR7 03VWR2, pts

obt om th og cocto st us to sot

pu cutus o opht om hch DNA s xtct

o phogtc ss. Th squc t t usg

Squch 4.8 (G Cos) to obt cossus squcs.

Th squcs comp to GBk o tcto, phogtc ss s pom s p Cv t .

(2001) usg mxmum psmo tht utz th bch

bou sch (Sofo, 2002).

RESULTS AND DISCUSSION

Microsatellite Profiling

I ou pm vutos o TF EST-SSR pms o

CWR VWR poputos, 49 (31%) o th pm ps

sho c scob SSR-tp bs. A tot o 235 g-

mts t 74 b gotps

usg 38 TF EST-SSR pm ps tht omsct om th 49 pm ps shog c mpc-

tos. Numb o gmts p pm p g om

2 (NFFA015) to 14 (NFFA092) th vg o 6.2

gmts p pm p (t ot sho). Tot um-

b o gmts ch gotp o ft poputos

g om 45 to 81 (Tb 2). Avg umb o g-

mts both th spcs (CWR 71.3 VWR

68.3) s much hgh th b (49.5). A gotp o

th CWR commc souc poputo Shp’s h th

gtst umb o gmts (81), hs gotp o

th VWR poputo 03VWR2 h th st (60).

Th v o mcostt pomophsm ou o CWR

VWR pts s compb to tht pot o oth

gss spcs (Vsh t ., 2005). Th pst -

gs suppot pvous suts tht TF EST-SSR mks

usu coss ft gss spcs (Sh t ., 2004).

Th mcostt mks thus vop o CWR

VWR (Suppmt Tb 1) ch th mt

SSR mk soucs vb ths spcs.

Dt omto o ths pms cug pm

squcs s pot b Sh t . (2004).

7/30/2019 cs-49-3-913



Genetic Variability

Th UPGMA ss bs o SSR mks ct

tht th b cutvs stct ft om -

th o 20% smt (t ot sho). Th -

ogm cust th gotps to to stct

goups t 64% smt. Th outmost goup cosst

o CWR gotps om th poputos, o PI,

to commc souc poputos. Th m goup

cot gotps om th CWR PIs VWRpoputos. Th suts om bootstp ss (Fg. 1)

g suppot th phogtc toshp uc

om UPGMA. I ths ss, custs suppot b ss

th 50% o bootstps cops to potoms.

Th b custs suppot b 100% o bootstps.

Custg o th poputos, o PI, to com-

mc souc poputos o CWR s suppot b hgh

bootstp vus (92%), hs custg o th CWR

PIs VWR poputos s ot s stog (58%). Th

to commc souc poputos o CWR om s-

tct os th th CWR cust, ctg th gtc

stctss o mts ogtg om Okhom Txs. Ovp bt som o th CWR VWR

poputos s phps ot supsg. Vog t . (2006)

pot compb ms gs o goomc tts

mog Mst poputos css s VWR CWR.

Mophoogc t, om poputos south Ok-

hom (Nso T, 1978), coup th to

ctoogc ozm t om Txs poputos

(Dvs, 1977) ct tht g o togsso

occus th bt CWR VWR poputos.

Gotps th poputo g cust o

o o. Esst tc gotps ou

th PI 436933 (pts CW 47 49) PI 436955(pts VW94 99). Such hgh g o smt

th poputos o s-pot Ttc gsss th

s ot ucommo (Nvo t ., 1982; Hg t .,

2000). Ou suts cotst th tht o Kpp Rc

(1996), ho ou substt vto, bs o sozm

ss, th poputos om th st Ut

Stts o bu (Elymus glaucus Buck), s-po-

tg, p ttpo th th sm gom costtu-

to s CWR VWR. A hgh pctg o smt

xst th CWR comp to VWR poputos (Fg.

1). Ths suts ct tht tu, coss-poto

hs occu mo qut VWR th CWR pop-

utos. Hov, gv tht vto th CWR

most VWR poputos s sm to tht th th b-

cutvs, poputos cou b h s pu

s bg pogm. Ths s cotst to s-po-

t cops h o cutvs cs hv b

ou to commo cot umous gotps (Russ

t ., 2003; Zhg t ., 2006). O cou spcut tht

m pctcs, such s s tg, scto, t-

to s mxg (Tshom t ., 2001), hv sut

cs o s-pot cops cosstg o vs

gotps th cutvt , hs th

tu scto t gv st hs to popu-

tos cosstg o tc gotps.

Sequence Variation

At hgh txoomc vs, SSR s tc b sz ot css tc b sct (Do t ., 1998)

A mcostt gmt, obt om th pm ps

NFFA113, hch s moomophc bs o gth cos

th b gotps, s om sct

o squcg to tm th s squc v-

to th . Th o th CGG pt

pst squcs o poputos b

cutvs (Fg. 2), cotst to sx pts th t s-

cu squc (t ot sho) om hch th pm

vop. Ov th 190 bp o squc t ths gmt

sx sg ucot substtutos spcc to b

o hch th s th CWR poputo

99CWR6 (Fg. 2). Most o ths pomophsms occu

kg squcs cos to th mcostt go

Dstct squc vto bt CWR VWR

poputos s ot vt coss th 190-bp squc

t ths mcostt ocus. Th gotp o 99CWR6

sho gt vto th sx bs substtutos, th

o hch sh th b (Fg. 2). Th

gotps cosst o SSHH goms o hch H gom

so ou Hordeum spcs. Ctogtc (D

Table 2. Number of microsatellite fragments obtained in gen

otypes of Canada wildrye and Virginia wildrye populations

and barley cultivars from 38 tall fescue expressed sequence

tag–simple sequence repeats.

Population Min. Max. Avg.

98CWR8 68 76 71.8

99CWR6 73 79 76.4

99CWR7 70 73 70.8

PI 613134 64 75 70.6

Sharp’s 74 81 77.2

Stock’s 66 75 70.7

PI 436918 63 70 67.2

PI 436924 65 71 68.4

PI 436933 66 72 68.8

CWR 63 81 71.3

03VWR2 60 71 68.0

PI 436945 64 72 66.8

PI 436955 60 75 67.4

PI 436962 68 71 69.0

PI 436968 66 75 70.4

VWR 60 75 68.3

Steptoe 45 50 47.5

Morex 51 52 51.5

Barley 45 52 49.5

SE 0.86 0.98 0.90

7/30/2019 cs-49-3-913



1984), gomc DNA (Su t ., 1997), choopst

DNA (McM Su, 2004) ss suppot ths cs-

scto, s os th squc vto t pst

h. Squcg o SSR poucts o spcc tst

b usu tg to SNPs.

Endophyte AnalysisImmuobot ss o ts th Neotyphodium-sp-

cc tbo s cut to tpt s t s om Ely-

mus pts ot th opht os ot ct

to th tbo. Tho, epichloë

opht cto s uth ch-

ctz usg sstv PCR-bs

sc to tm o th pt

mt s opht ct. Ass

o th s stocks b PCR ct tht

sv CWR poputos (98CWR8,

99CWR6, 99CWR7, PI 613164, Shp’s,

Stock’s) ct th Epichloë opht (Tb 1; Fg. 3). Ths ss

s ub to tm th opht

s vb ug gmto b to

b tsmtt to th sg, but PCR

o smps om oug b sho

tht som o th pts us ths stu

opht ct (Fg. 3). A-

ss o th ss om th VWR PIs -

ct th ot ct o ct

t v o pctg. Hov, PCR

ss o b DNA smps om

03VWR2 ct opht c-to t st to pts (Fg. 3); s

o ths poputo s ot vb o

PCR ss. Shp’s, Stock’s, o

th ct coctos o CWR om th

h ug ophts, hs PI

613134 s th o PI ou to b o-

pht ct.

To tm th phogtc o-

gs o th epichloë opht, th mp-

tef1 g s squc om

scto o opht-postv ss

comp to ko Epichloë spcs. Atst th ft epichloë ophts

ou th ths s stocks bs

o th sutg squc t (Tb

1). Epichloë elymi, ou PI 613134, s

commo s CWR (Wht

Butm, 1987) s ot uxpct.

Rct, VWR pt s ou

ct th sxu E. amarillans

(EVTG-1) (Moo t ., 2004). Ext-

sv squcg o th tef1 g mp

om th Shp’s s th opht

sot om 99CWR7 ct th psc o E.

amarillans –k squc, but ot tm th

opht s sxu. Th epichloë opht cot

98CWR8 s pvous chctz s hb o

E. amarillans E. elymi (Bu t ., 2007) sm to

sot ou Hordeum bogdanii HboTG-1 (Moo t

., 2004). 99CWR6 so pp to cot hb o

E. amarillans E. elymi . Th opht sot om

03VWR2 s chctz s E. elymi, but t s uko

th sot s stomt poucg. Th squc ss

Figure 1. An unrooted plot of consensus trees with a frequency greater than 50%

after bootstrap analysis with 1000 replications. Bootstrap values are indicated on the

trees. Genotypes represent 46 Canada wildrye (CW), 25 Virginia wildrye (VW), and

four barley genotypes. PAUP* 4.0 beta was used to run the Neighbor joining algorithm.

Genotypes correspond to the following populations: SH 143–150 = Sharp’s; ST 154–

159 = Stock’s; CW 1–7 = 98CWR8; CW 11–18 = 99CWR6; CW 21–29 = 99CWR7; CW 31–

38 = PI 436918; CW 41–49 = PI 436933; CW 51–56 = PI 613134; CW 62–70 = PI 436924;

VW 71–78 = 03VWR2; VW 83–90 = PI 436945; VW 93–100 = PI 436955; VW 102–

106 = PI 436962; VW 113–118 = PI 436968; S 122–123 = ‘Steptoe’ barley; M 132–

133 = ‘Morex’ barley. E+ indicates populations that were endophyte infected based on

polymerase chain reaction analysis.

7/30/2019 cs-49-3-913



o th tef1 g mp om th Stock’s

s cocusv but s ko to b

epichloë opht u to th spcct

th th tef1 pms. Uotut,

ub to cutu th ophts

om th s stock, hch m ct

th ophts o og vb.

Mk ss o th CWR

VWR poputos ct tht opht-ct mt, xcpt

03VWR2, cust togth (Fg. 1),

thus sg th qusto o hth som

SSR mks m hv b mp

om opht DNA, thus mpctg

subsqut cust ss. Ths ou

b hgh uk u to th v o

opht bomss th th b

tssu tht s smp (Youg t .,

2005; Pcco t ., 2001). DNA s

sot om pu opht sts

mp th TF EST-SSRs. O ghto th pm ps mp poucts th

opht DNA, ths k to

b ospcc poucts. Th opht

DNA gmts qut ft om

th pt bs ot vsb h

PCR s us to z DNA xtct

om opht-ct pts. Thus,

th ogm obt om th g-

mt ss s u to gtc vto

th mcostt oc o th

poputos s ot uc b

th opht DNA th smp.W hv stbsh tht v-

st o epichloë ophts s ssoc-

t th th poputos

sc, but hv t to tm

th mpct ths ophts hv

o th host gsss. Th ko pot-

t o ths ophts ou qu

xmto to tm tmm-

m compous such s got k-

os otms pouc

ths opht-ct pts. Mt-

ct th sxu sot hs th

pott to cus oss o s pouc-

to u to vopmt o stomt tht

stct (.., chok) mgg os-

ccs. Hov, th psc o hb

ophts, tho psumb

sxu Neotyphodium spcs, t st som CWR

gmpsm suggsts tht ths sots ou ot h-

s poucto. Futh ss b qu

to tm ths ophts pov th host

oth goomc quts, such s ought toc

psstc, s hs b ocumt th Neoty

phodium coenophialum –ct t scu (Bouto t .

1993; Mosk t ., 1997; Wst t ., 1993).

Figure 2. Sequences of fragments amplified by tall fescue expressed sequence tag–simple sequence repeat primer NFFA113 in barley cultivars and Canada wildrye and

Virginia wildrye populations. Primer sequences are italicized, base substitutions are

bold faced, and repeat sequences are in bold italics. The sequences represent a single

genotype from each of the cultivars/populations.

7/30/2019 cs-49-3-913



CONCLUSIONS

Sv TF EST-SSRs pov usu ssssg gtc

vto CWR VWR, thus tg uc-to st o mcostt mks o ths sp-

cs. Usg ths SSRs, mm gtc vto s

tct th CWR , to ss g, VWR

poputos om th South Gt Ps, ctg

tht gmpsm coct ct om th , PIs,

commc souc poputos o ths spcs commo

cosst o pu s. Pg, sg-s sct,

buk, oth bg mthos us o s-pot

spcs ou b ppopt o vopg mpov s

cutvs o CWR VWR. Bs to

b cogzt o th possb psc o pott sx-

u sxu ophts CWR VWR bg

gmpsm. Futh sch b to tm

th mpct o opht cto CWR VWR o

pt stss toc gzg m hth.

AcknowledgmentsTh uthos v thku to J Bck, Kostt

Chkhovsk, Shp Mtt o th tchc ssstc

ths sch. W gtu to Ds. Mk Sos, K Cv,

M Motos o ctc vg ths muscpt.

ReferencesAso, J., W.C. Shp. 1994. Gss vts th Ut Stts.

2 . USDA So Cosvto Svc, Wshgto, DC.

A, R.E. 1987. Wht. p. 699–748. In W.R. Fh (.) Pc-

ps o cutv vopmt. Vo. 2. Mcm, N Yok.

Bouto, J.H., R.N. Gts, D.P. Bsk, M. Os. 1993.

Y psstc o t scu th southst cost

p t mov o ts opht. Ago. J. 85:52–55.

Bouto, J.H., G.C.M. Ltch, N.S. H, C.S. Hov, M.A.

McC, R.H. Wtso, J.A. Psh, L.L. Hks, F.N.

Thompso. 2002. Rcto o t scu cutvs th o-got ko–poucg ophts. Ago. J. 94:567–574.

Bo, C.M., F.L. Pttso. 1992. Covto ot b-

g. p. 613–656. In H.G. Msh M.E. Sos (.) Ot

scc tchoog. Ago. Moog. 33. ASA, CSSA,

SSSA, Mso, WI.

Buckhof, S.B. 2002. Notc o s o ‘Cuv Rv gm-

psm’ Vg sct css o tu gmpsm.

Avb t http://pt-mts.cs.us.gov/pubs/mop-

mcv3cu .p (v 25 Fb 2009). USDA–NRCS

Mssou Dp. o Cosvto, Jfso Ct, MO.

Bu, K., S. Mtt, A. Hopks, C. Youg. 2007. Chcts-

to o ug ophts pst Elymus Canadensis (C

). In A.J. Pop E.R. Thom (.) Poc. o th 6thIt. Smp. o Fug Eophts o Gsss. Gss Rs.

Pctc Ss 13. N Z Gss Assoc., Du.

Bush, T. 2002. Pt ct sht: C . Avb t

http://pts.us.gov/ctsht/p/s_c4.p (v 25

Fb. 2009). USDA–NRCS, Wshgto, DC.

Cgg, M.T., C.R. Hoch, G.L. Chuch. 1976. Extm

gtc smt mog othst spcs o .

Gtcs 83:s15–s16.

Cv, K.D., P.T.W. Hsu, A. Luchtm, W. Ho, C.L.

Sch. 2001. Mutg phog o pchoë spcs, u-

g smbots o gsss. A. Ms. Bot. G. 88:14–34.

Dh, L.S. 1996. Mocu mk s s o hpopo g-

ts om cutus o b × C . Gom39:367–372.

Dh, L.S., L.R. Jopp. 1992. Hbzto tssu cutu

o Hordeum vulgare × Elymus canadensis. Gom 35:1045–1049.

Dvs, R.S. 1977. Evc o togssv hb zto Txs

poputos o , Elymus virginicus E. canadensis.

Gtcs 86:s15.

D, D.R. 1982. Gomc phogtc toshps

mog Noth Amc p Ttc. p. 51–88. In J.R.

Ests t . (.) Gsss gsss. Uv. o Okhom

Pss, Nom.

D, D.R. 1984. Th gomc sstm o c sscto s gu

to tgc hbzto th th p Ttc. p.

209–279. In J.P. Gustso (.) G mputo pt

mpovmt. 16th St Gtcs Smp., Coumb, MO.

Pum Pss, N Yok.

Díz, O., B. Somo, R. vo Bothm. 1998. Dscpto

o sozm pomophsms Elymus spcs usg stch g

ctophoss. p. 199–208 In A.A. Jt (.) Ttc III.

It. Ttc Smp., 3, Appo, S. 4–8 M 1997. Sc-

c Pubshs, E, NH.

Dc, L.R. 1945. Msus o th mout o coogc ssocto

bt spcs. Ecoog 26:297–302.

Do, J.J., M. Mogt, S.V. Tg, W. Po. 1998. Sz

homops choopst mcostts o p

Figure 3. Endophyte detection in seeds and leaf blades of Canada

wildrye and Virginia wildrye populations. Twelve individual seeds

from each population and DNA from leaf blades of each plant were

screened for the presence of the tef1 gene from epichloë endophytes

using endophyte-specific polymerase chain reaction primers.

7/30/2019 cs-49-3-913



tvs o sob (Glycine subgus Glycine ). Mo. Bo.

Evo. 15:215–218.

Dug, J.C., J.W. L, D.W. Bugo. 2006. Rgstto o

Ic Bu C gmp sm. Cop Sc. 46:2330–2331

[tum: 46:2736].

Esto, S., B. Tpp. 2005. Neotyphodium sch pp-

cto N Z. p. 35–42. In C.A. Robts t . (.)

Neotyphodium coo-sso gsss. Bck, Ams, IA.

Euj, I., M.K. Sg, L. Wg, G.D. M, K. Chkhovsk, J.C.

Zotz, M.A.R. M. 2004. Medicago truncatula EST-

SSRs v coss-spcs gtc mks o Medicago spp.Tho. App. Gt. 108:414–422.

Fh, W.R. 1987. Sob. p. 533–576. In W.R. Fh (.) P-

cps o cutv vopmt. Mcm , N Yok.

Hg, S.G., J. Vkou, J.G. Ws. 2000. Gtc vst

hts got gss. Tho. App. Gt. 101:309–316.

Htt, E.E., III, N.S. H, J.H. Bouto, C.W. Mms. 1997.

Mooco tbos o tcto o Neotyphodium coeno-

phialum. Cop Sc. 37:1265–1269.

Htt, E.E., III, N.S. H, J.H. Bouto, J.A. Stum.

1999. T scu opht tcto: Commc mmu-

obot tst kt comp th mcoscop ss. Cop Sc.

39:796–799.

Htchcock, A.S., A. Chs. 1971. Mu o th gsss o thUt Stts. 2 . Dov, N Yok.

Hopks, A.A., C.P. Wst. 2002. Psstc, gzg to-

c, cov o coo sso p gss ccssos

go th South Gt Ps. p. 4–8. In A.A. Hopks

(.) Gss Bs’ Wok Pg Co., 36th, Amo,

OK. 23–24 M 2000. Nob Fouto, Amo, OK.

Js, K.B., Y.F. Zhg, D.R. D. 1990. Mo o po-

to o p spcs o th Ttc to to

gomc g. C. J. Pt Sc. 70:215–225.

Kpp, E.E., K.J. Rc. 1996. Gtc stuctu g o

bu (Elymus glaucus): Impctos o tv gss-

stoto. Rsto. Eco. 4:1–10.

Kum, P.S., P.D. Wto. 1992. Itogsso o gs omC to s htgss: Ctoog tt

o bckcoss pog. Gom 35:894–896.

Luchtm, A., K. C. 1993. Nocpoc comptb-

t bt Epichloë typhina ou host gsss. Mcoog

85:157–163.

Lo-R, J., E. K, S.D. Mh. 2003. Pt ct

sht: Vg . Avb t http://pts.us.gov/

ctsht/oc/s_v3.oc (v 25 Fb. 2009). USDA–

NRCS, Wshgto, DC.

Loz, L.L., R.C. Shomk. 1996. Gtc toshps

th o U.S. sob cutv goups. Cop Sc. 36:743–752.

Mosk, D., A. Luchtm, D. Schmt, J. Nosbg.

1997. Goth t sttus mo scu s fct

b Neotyphodium Phialophora spcs ophts. Ago. J. 89:673–678.

Mosk, D.P., D.P. Bsk, G.C. Ls. 2005. Abotc

stsss ophtc gsss. p. 187–199. In C.A. Robts t .

(.) Neotyphodium coo-sso gsss. Bck, Ams, IA.

McM, E., G. Su. 2004. Gtc toshps o tt-

po Elymus spcs th gomc oo spcs

om poms ch cto-stcto gth pomo-

phsm ss o choopst g gos. Tho. App.

Gt. 108:535–542.

Moo, C.D., K.D. Cv, A. Luchtm, S.L. Cmt,

C.L. Sch. 2004. Pvc o tspcc hbs

mogst sxu ug ophts o gsss. Mo. Eco

13:1455–1467.

Moo, C.D., B.A. Tpp, B. Scott. 1999. Itcto o

pchoë ophts pt b mcostt-bs PCR

gptg ss th utomt ss. App. Evo

Mcobo. 65:1268–1279.

Nso, E.N., R.J. T. 1978. Hbzto togs-

so bt Elymus canadensis Elymus virginicus (Poc)

Poc. Ok. Ac. Sc. 58:32–34.

Nvo, E., E. Gobg, A. Bs, A.D.H. Bo, D. Zoh

1982. Gtc vst vomt ssoctos o ht Triticum dicoccoides Is. Tho. App. Gt

78:260–264.

No, R.K., F.L. Pg, M.R. No. 1996. F spos

to ogc mtt, buscu mcohz ug,

tz cmto o tcot o o tg. Pt So

179:89–97.

Ov, J.W. 2005. Pthophsoogc spos to opht toxs

p. 291–304. In C.A. Robts t . (.) Neotyphodium coo-

sso gsss. Bck, Ams, IA.

Pcco, D.G., J. Wg, C.A. Youg, C.L. Sch, B. Scott,

P. Dmogkoo. 2001. Emto o gov om gss–

Neotyphodium opht smboss b gtc mocto o

th opht. Poc. Nt. Ac. Sc. USA 98:12820–12825.Pk, C.H., P.D. Wto. 1989. Embo-cus-gt

hbs th cohchc-uc mphpos bt

Elymus canadensis Secale cereale . Tho. App. Gt

78:721–727.

P, W.F., S.C. Am. 2006. Rgo vopmt

o ochgss chok stmto o s oss. P

Ds. 90:240–244.

Po, F., J. 1979. Psc o omcohz ug ct

g co m spo. J. So Wt Cosv. 34:186–187.

Pop, A.J., S.A. Boos. 2005. Botc sposs ophtc

gsss. p. 163–185. In C.A. Robts t . (.) Neotyphodium

coo-sso gsss. Bck, Ams, IA.

Rbo-Cvho, C., H. Gus-Pto, G. Igjs, P. St-phso, T. Schzch, J.S. Hsop-H so. 2004

Hgh vs o gtc vst thoughout th g o

th Potugus ht c ‘Bb’. A. Bot. (Lo.

94:699–705.

Russ, J.R., A. Booth, J.D. Fu, M. Bum, S. Ccc, S

Go, W. Po. 2003. Ptts o pomophsm

tct th choopst uc goms o b -

cs smp om S Jo. Tho. App. Gt

107:413–421.

Sh, M.C., M.A.R. M, I. Euj, J.C. Zotz, L. Wg

G.D. M. 2004. T scu EST-SSR mks th

tsb t coss sv gss spcs. Tho. App. Gt

109:783–791.

Ss, T.B., J.L. Hmck. 1980. Vto th bgsstm o Elymus canadensis. Evouto 34:117–122.

Ss, T.B., J.L. Hmck, L.R. Ho. 1979. Aozm

vto Elymus canadensis om th tgss p go

Gogphc v to. Am. M. Nt. 101:1–12.

Sso, M.A., R.H. Sk, J. Kujsk, M. v

Gt. 2004. Vg vut s pott

tv coo-sso og th othst USA. Cop Sc

44:1379–1384.

Sso, M.A., R.H. Sk, M. v Gt, J. Kujsk

2004b. Nuttv vu o Vg , coo-sso gs

tv to th othst USA. Cop Sc. 44:1385–1390.

7/30/2019 cs-49-3-913



Schust, J.L., R.C. Lo Gc. 1973. Phoog o-

g poucto o coo sso gsss th South Ps.

J. Rg Mg. 26:336–339.

Su, G., B. Somo, R. vo Bothm. 1997. Ass o tt-

po Elymus spcs usg ht mcostt mks

RAPD mks. Gom 40:806–814.

Sofo, D.L. 2002. PAUP*: Phogtc ss usg p-

smo ( oth mthos) 4.0 Bt [CD-ROM]. Su

Assoc., Su, MA.

Tshom, A., A.H.D. Bo, T. Hogk. 2001. Dvst

cs o c gum cops. p. 221–261. In J. Jck(.) Pt bg vs. Vo. 21. AVI, Wstpot, CT.

Th, T., W. Mchk, R.K. Vsh, A. G. 2003.

Expotg EST tbss o th vopmt chc-

tzto o g-v SSR-mks b (Hordeum

vulgare L.). Tho. App. Gt. 106:411–422.

Thompso, F.N., J.A. Stum, N.S. H. 2001. At-

qut ctos ssoct th kos st tmpt

pstu. J. Rg Mg. 54:474–489.

USDA–NRCS. 2000. Io gmpsm C . Avb

t http://.pt-mt s.cs.us.gov/pubs/mopmcb-

c4gm.p, (v 25 Fb. 2009). USDA–NRCS, Wsh-

gto, DC.

USDA–NRCS. 2003. Wt ptgs o . Avb thttp://..cs.us.gov/tt/TchcNots/I-

_Tch_ot_3.p (v 25 Fb. 2009). I Bo-

og Tch. Not 3. USDA–NRCS, Wshg to, DC.

USDA–NRCS. .. Notc o s o Lvc C -

. Avb t http://pt-mts.cs.us.gov/pubs/

stpmc1373.p (v 5 M. 2009). USDA–NRCS,

Wshgto, DC.

Vsh, R.K., R. Sgmu, A. Bo, V. Kozu, N. St,

M.E. Sos, P. Lgg, A. G. 2005. Itsp-

cc tsbt comptv mppg o b EST-

SSR mks ht, c. Pt Sc. 168:195–202.

Vto, M.A., E.S. Ktho, K.P. Vog, A.A. Hopks. 2001.

Eophtc ug C tu gsss. J.

Rg Mg. 54:390–395.

Vog, K.P., A.A. Hopks, K.J. Moo, K.D. Johso, I.T.

Cso. 2006. Gtc vto mog C ccssos om Mst USA mt ps o bomss

oth t ts. Cop Sc. 46:2348–2353.

Wst, C.P., E. Izko, K.E. Tu, A.A. Em. 1993. Eo-

pht fcts o goth psstc o t scu og

t-supp gt. Ago. J. 85:264–270.

Wht, J.F., J., T.L. Butm. 1987. Eopht-host ssoc-

tos og gsss: VIII. Htothsm Epichloë typh-

ina. Am. J. Bot. 74:1716–1721.

Youg, C.A., M.K. Bt, M.J. Chsts, B.A. Tpp, G.T.

B, B. Scott. 2005. Mocu cog gtc

ss o smbos s-xpss g cust o otm bo-

sthss om mutustc opht o p gss.

Mo. Gt. Gomcs 274:13–29.Zhg, P., S. Dsgck, A. Bukt, S. Akhj, A.E. Mch-

g, M.L. Wbuto. 2006. Gtc vst -

toshps o ht cs om Om vstgt th

SSR mks. Gt. Rsou. Cop Evo. 53:1351–1360.

Documents

cs-49-3-913