View
9
Download
0
Category
Preview:
Citation preview
We will solve the Day to Day Life disease with this sensor
A
Project Report
On
Nano Bio Health Chip
In partial fulfillment of requirements for Final Project
In Course of Nanotechnology and Nanosensor
SUBMITTED TO: Technion(Israel institute of technology)
By: Vasvani Shyam Babiya Kaushik
Monapara Tushar
Nano-bio Chips: Genes to Disease
Table of contents
- Cover page
- Table of contents
- Abstract
- Introduction
- Literature review
- Project description (overall design method for fabrication, and application)
- Conclusions and recommendations
References
Abstract
In this type of nanosensor help us to sense the problem in our body and give the signal how to prevent
that type of problem is depend on human genes so all this type of sensor based on DNA structure so it
is also known as genechips,this type chip fix in our body to sense the disease. This type of sense is
depend on the touch of the body or other human value like hair, nail, etc.
In this project, new enabling micro/nano/bio-technologies toward the development of all-on-chip
systems for on-line bio-monitoring have been explored for applications in: diagnosis, treatment of
patients, cell cultures and environmental monitoring. The project comprises of three main research
tasks: Nano-Bio films for applications in stem cells monitoring, Nano-Bio films for drugs detection,
and innovative ideas in VLSI design for bio-applications.
Microarray activities can be easily integrated into secondary school biology units on genetics, cell
biology, DNA, or biotechnology. Since microarrays touch upon a variety of concepts (including
transcription, differences in gene expression, genetics, cell biology, biotechnology, DNA
hybridization, new technologies, cancer biology, and bioethics), a microarray unit can provide a
framework to help students understand the connections between these concepts. As described in this
laboratory, a complete microarray unit can be carried out in two short class periods.
Introduction
The purpose of this simulation activity is to teach the following:
• DNA microarrays are a powerful emerging technology that scientists use to measure the activity
(transcription) of thousands of genes at one time.
• Genes are “differentially regulated”: All cells in an organism contain the same genes*, but different
genes are expressed (transcribed) in different tissues under different conditions. This is what gives
different tissues their different phenotypes (appearance and function).
*Note: Gametes contain half of the genes that somatic cells do, and enucleated cells (such as
mature red blood cells) do not contain genes.
• Even genes that are not highly expressed (transcribed) may play an important role in the cell. The
lack of expression of a certain gene may also play an important role in the cell.
• Microarrays highlight important connections between genetics, cell biology, genes, DNA,
chromosomes, gene expression, transcription, cancer biology, proteins, technology, and bioethics.
Microarray analysis can also be used to integrate math into the biology curriculum.
Project Overview
Microarray Unit Overview
Detecting patterns or changes in transcription in cells is a way to understand both normal and abnormal
aspects of cell function. A researcher who wanted to look for changes in transcription in a specific
cancer tissue
Could use microarray analysis. As the first step in this process, a gene chip would be created. DNA
chip, microarray, gene chip, and genome chip are all terms that describe a solid matrix, such as a glass
slide, that is imprinted with a precisely arranged pattern of spots, each made up of many copies of a
specific oligonucleotide representing part of a genome (e.g., a human genome).
As the next step, the DNA chip would be used to analyze complementary DNAs (c DNAs) that were
made from mRNA isolated from cancerous and noncancerous parts of the same tissue. The cancerous
and noncancerous DNA samples are flagged with dyes and applied to the prepared chip. The extent to
which each flagged gene adheres to its complement on the chip directly indicates the extent to which
transcription occurred. Computer analysis of the DNA chip reveals which genes were transcribed in
the cancerous tissue and which in the normal tissue, and thus indicates which genes might be important
in the development of the cancer. The use of a microarray in this application allows suspect genes to
be identified years sooner that would have been possible with previous technologies that were unable
to analyze so many genes so precisely at one time.
Gene Expression = Transcription into RNA and Translation into Protein
Transcription Translation
DNA (gene) RNA Protein
(Phenotype / Appearance)
Induced (Expressed) Gene: Repressed (not Expressed) Gene:
Transcription
Gene X Lots of mRNA X Gene Z × no mRNA Z
Gene Expression and Cancer
A single microarray can contain more than 30,000 spots of DNA, each representing a different gene in
an organism. In this laboratory, you will use a DNA microarray (“gene chip”) to study the expression
of six different genes in normal lung cells and lung cancer cells. These results will show how these six
genes are transcribed in normal vs. cancerous lung cells.
Scientists have found that some genes are not transcribed as much in cancer cells as in normal cells.
These repressed genes may play an important role in allowing the cancer cells to spread and grow.
Other genes are transcribed more in cancer cells than normal cells. These genes may also play an
important role in making the cells cancerous. There are also many genes that are transcribed at the
same level in both cancer cells and normal cells. These genes probably do not play a significant role
in causing cells to become cancerous. There are also some genes that may not be expressed at all in
normal or cancerous lung cells. Can you think of any examples of these?
Expected Experimental Results
Gene 1 = deep pink (gene induced in cancerous cells)
Gene 2 = purple (mixed pink and blue; gene equally transcribed in both cancerous and noncancerous
cells)
Gene 3 = blue (gene repressed in cancerous cells)
Gene 4 = blank (gene not transcribed in either cancerous or noncancerous cells)
Gene 5 = light pink (gene slightly induced in cancerous cells)
Gene 6 = light blue (gene slightly repressed in cancerous cells)
Nanotechnology and Nasensor
1. We will study gene expression (transcription) in lung cancer cells as compared to that in normallung
cells. The DNA from lung cancer cells will be labeled pink, and the DNA from normal cells will be
labeled blue. We are using atypical colors for our simulated microarrays.
2. If the cDNAs made from the lung cancer cells’ mRNA are labeled red, and the cDNAs made from
thenormal cells’ mRNA are labeled green, for each of the situations below, describe what color you
expect the gene spot to be on a microarray:
GENE DESCRIPTION COLOR OF SPOT
A gene was expressed (transcribed) more in
lung cancer cells than in normal lung cells Red (Pink, in our lab)
A gene was transcribed the same in both cells Yellow (Purple, in our lab)
A gene wasn't transcribed at all in either cell Black (Colorless, in our lab)
A gene was expressed (transcribed) more in
normal lung cells than in lung cancer cells Green (Blue, in our lab)
Overdesign all method for Fabrication
A Committed Relationship
But somewhere, in the tagged sample
of RNA washing over the array, a
match will be made. If the sequence of
bases in the sample RNA matches
that of a DNA probe, then there will
be a perfect match and the sample will
stick to the probe.
Determining a Match
Let's assume that we have a match and
that RNA in our sample bound to
the probes built on the
array. We then rinse the array, so that any RNA that didn't
pair is washed away. The hybridized RNA is tagged with
molecular glue (biotin); it’s as if each hybridized square
on the array has been coated with sticky glue.
Making Glow in the Dark RNA
Because we can’t see RNA, we can’t directly figure out
how much has stuck to the DNA probe on the array. Did
only one strand attach? Or did 1,000,000 strands attach?
To work around this problem, scientists make the RNA glow in the dark by using a fluorescent
molecule that sticks to the biotin.
An Expressed Gene
Researchers wash the fluorescent stain over the array and the glow in the dark molecules (ball) stick
to the biotin glue (small cup). It’s like glitter painting in elementary school -- after pouring sparkle
glitter all over the paper, you shake it off and the glitter only sticks to the places where there was
glue. With microarrays, the fluorescent molecules are “shaken” away and laser light on the array,
causing the stain to fluoresce or “glow”. If a gene is highly expressed, many RNA molecules will
stick to the probe, and the probe location will shine brightly when the laser hits it. If a gene was
expressed at a lower level, less RNA will stick to the probe, and by comparison, that probe location
will be much dimmer when it is hit with the laser.
the stain only sticks to those places on the array wher e RNA has bound. After all of this, researchers shine a
No Match at All
If the sample RNA doesn’t match it will be rejected by the probe on the array. Scientists will know
that no match was made when they shine the laser on the probes and nothing glows.
Measuring All Gene Expression at Once
So far we’ve been looking at expression from
just one gene. And although GeneChip
expression arrays can simultaneously measure
tens of thousands of different genes, let’s
simplify it down
to looking at expression from just four: Gene
1
(2RUDE) Gene 2 (2LOUD) Gene 3
(GETOUT)
Gene 7 (Fat Met.) In this example, Gene1,
Gene2, and Gene3 are expressed because fluorescent RNA has hybridized to teach of the probes. In
their study, scientists find that these genes are only expressed by the loud speakers, and not at all by
normal speakers. Because nothing is known about these genes other than their expression in rude
people, scientists decide to call them 2RUDE,
2LOUD, and GETOUT – a RUDE pathway. Even though they aren’t 100% sure what the genes do,
they know they are consistently expressed by abusive cell phone talkers. Virtually everyone has these
three genes, but the difference is that they are not equally expressed by everyone. In wellmannered
individuals, the RUDE pathway sits idle and its genes are not transcribed into RNA. As a result, that
RNA doesn’t make proteins and those proteins don’t drive a person to unconscionably rude behavior.
The next step for the researchers is to use additional techniques showing that the proteins created by
the RUDE genes function to suppress activity in the politeness and common sense regions of the human
brain.
Comparing Gene Expression
The whole point of microarray gene expression
analysis is to compare expression levels between
two samples. In our example comparing loud
talkers and normal-volume talkers, expression
analysis found that 3 genes were more heavily
expressed in rude people than in normal people.
To represent this, researchers construct “heat
maps”, which are graphical displays that color
code gene expression. Increased expression is
color coded in dark grey while decreased
expression is in light grey. The heat map to the
right shows gene expression from 5 loud talkers
and 5 normal talkers. It makes it clear that
2RUDE, 2LOUD and GETOUT are highly
expressed in Loud Talkers, but not in Normal
Talkers. Other genes expression levels, like those
responsible for eye color or freckles, do not
correlate with rude talking behavior.
Classifying Disease
Having found genes responsible for rude behavior, our scientists explore if those same genes are
responsible for other forms of rude behavior. They compare gene expression from 3 people who are
loud cell phone talkers, 3 people with the rude behavior of talking at the movies, and 3 other people
that rudely use the express checkout lane with 25 items. In this example, the researchers might find
that expression of different genes can be used to classify the different types of rude behavior. In this
case, expression of Genes A, B, C are markers for loud movie talkers, whereas expression of Genes X,
Y, Z are markers for the checkout lane abusers. All these people suffer from seemingly identical rude
behavioral disorders, but the genetics of each disease is quite different. By genetically classifying
seemingly identical diseases, researchers can develop more targeted therapies to the distinct forms of
otherwise indistinguishable disease.
An Actual Gene Expression Image
In reality, human expression arrays have over1.3 million different probes used to detect nearly 50,000
different RNA sequences. The result, when translated into a graphic by a computer, looks like a fuzzy
television picture, but when viewed up close, looks just like an illuminated checker board. The
fluorescence coming from each checker square or probe location tells researchers whether a gene is
expressed or not. Some probes measure high concentrations of RNA (strong intensity, white and grey
features) and some do not (weak intensity, light grey and black features). By analyzing images like
this, scientists can measure how much of RNA was present in the sample. They can record that
information, store it, and then compare it to another sample analyzed at a later date. For instance, if a
scientist measures twice as much fluorescence for the 2RUDE gene in a second person, it’s possible
that person will be even more annoying than the first.
Content Standards
The concept of microarrays and their use integrates many different areas of science typically covered
in the high school curriculum, including genetics/heredity, cell biology, DNA/biotechnology,
technology and society, mathematics, and computer science. In addition to content knowledge, the
science skills addressed in the activities include applying scientific knowledge, analyzing and
interpreting data to solve problems, working together in a group with a common goal, and
communication skills. Additional extension activities could include ethical debates on the use of
microarray data. These concepts are the framework of most state science content standards and can be
aligned to the 1996 National Science Education Standards (NSES) for Science Content developed by
the National Research Council. The microarray activities align to the following NSES Science Content
Standards for grades 9–12: Science as Inquiry (A), Life Sciences (C), Science and Technology (E),
Science in Personal and Social Perspectives (F), and History and Nature of Science (G).
For this array to work it is necessary to already have access to sequence information determined through prior
research (that is why this is called “resequencing”). This way, when the DNA is sequenced it can be compared
to known sequences for identification. Also, knowing the sequence helps build specific probes. This way, if
you
are screening for malaria, you only need to look at sequences that are specific for malaria strains allowing for
quick identification. The actual resequencing array is very complicated, with each probe being slightly
different
than the one next to it. The main difference is that a set of four probes is used together to sequence one base.
There are four versions of each probe to test to see if an A, G, C or T is found at a specific position on the
DNA.
In the 25 base long probe, the middle base (#13 – in bold below) is the variable nucleotide that is actually used
to determine the actual base in that position of the target DNA (from the sample). Here is an example
to give
you a visual. Let’s call this probe set W.
Probe W1 - ATCGGGTAAACTAAAGGCTACTGCCT
Probe W2 - ATCGGGTAAACTCAAGGCTACTGCCT
Probe W3 – ATCGGGTAAACTGAAGGCTACTGCCT
Probe W4 – ATCGGGTAAACTTAAGGCTACTGCCT
Future Vision
This belt of cubic crystal pyramid is an example for an
innovative sensor that I would like to have in my everyday life.
This belt is creative and applicable, because,
1. In this belt every colours of cubic have its own important.
2Each colour denoted the level of toxin , glucose , red blood cells , vitamin, sugar , amino acids , proteins
, sodium , magnesium ,
calcium , wbc , lymphocytes etc.
3. Information of the colour
Yellow Lymphocytes
Red RBCs
White WBCs
Purple Magnesium
Pink proteins
Saffron Amino acids
Sky blue sugar
green glucose
Suppose that
Lymphocytes in your body are in loss or destroy in any percent that must colour of belt change
Because of property of nano particles.
RBCs OR WBCs in your body are decreasing & increasing in any percent that intensity of colour will
be change. vitmin in your body are decreasing & increasing in any percent that intensity of colour will
be change.
Like
L
y
m
p
h
o
s
i
t
e
s
R
B
C
s
W
B
C
s
M
e
g
n
e
s
i
u
m
p
r
o
t
i
n
s
A
m
i
n
o
a
c
i
d
s
s
u
g
e
r
g
l
u
c
o
s
e
s
o
d
i
u
m
m
a
g
n
e
s
i
u
m
L
y
m
p
h
o
c
y
t
e
s
L
y
m
p
h
o
c
y
t
e
s
First of all this belt like black
Suppose any change in our body colour of belt is change. As shown in figure 1
This belt is important in our life because
Suppose decrease red blood cell so change the colour of belt
So you can know which food eat for increase red blood cell and also know which type of disease
probability enter in our body.
We save our body form attack of disease.
Working
Whenever increase sugar level the nanoparticle gain energy from sugar atom and change the colour
stap by stap. `
So you can see the change of colour.
Application
Main Results on Nano-Bio-Chip for Stem Cells Monitoring
Nano-biosensing provides new tools to investigate cellular differentiation and proliferation. Among
the various metabolic compounds secreted by cells during their life cycle, glucose, lactate and
hydrogen peroxide (H2O2) are of main interest. Glucose is the “fuel” of cells while lactate and
hydrogen peroxide production is related to cell suffering. Nano-structured electrodes may enhance the
compound sensitivity in order to precisely detect cell cycle variation. In this research task, the detection
with electrodes structured by using multi-walled carbon nanotubes (CNT) have been investigated to
be considered for an amperometric biochip. A significant improvement in sensitivity has been
achieved, indicating that carbon nanotubes are the right candidates to improve biosensing,. Also, first
experiments on glucose and lactate detection in stem cells have been carried out. Future projects
originated by this study will be on the development of bio-chips to be integrated in petri dishes for
automatic stem cell culture monitoring.
Main Results on Nano-Bio-Chip for Drugs Detection
Personalized therapy requires accurate and frequent monitoring of drugs metabolic response in living
organisms during drug treatments. In case of high risk side effects, e.g. therapies with interfering anti-
cancer molecules cocktails, direct monitoring of the patient’s drug metabolism is essential as the
metabolic pathways efficacy is highly variable on a patient-by-patient basis. Moreover, anti-cancer
pharmacological treatments are often based on cocktails of different drugs. Currently, there are no fully
mature biochip systems to monitor multi-panel drug amounts in blood or in serum. The aim of this task
has been to investigate the complexity of multiple drugs detection for point-of-care and/or implantable
systems to be used in personalized therapy. Probes investigated for biochips are the P450 cytochromes
as they are key-role proteins in drugs metabolism. Multiple drugs detection has been carried out both
by simulations
References
http://www.bio.davidson.edu/courses/genomics/chip/chip.html
http://gcat.davidson.edu/Pirelli/index.htm
www.bio.davidson.edu/GCAT
http://www.bio.davidson.edu/projects/GCAT/HSChips/Hschips.html
http://gslc.genetics.utah.edu/units/biotech/microarray/
http://www.hinsdale86.org/staff/kgabric/labsOnline/Microarrayer2.doc
http://www.bio.davidson.edu/projects/GCAT/HSChips/hs_kit_math_module_v2.pdf
www.hhmi.org/biointeractive/genomics/genechipdata/index.html
Recommended