View
218
Download
0
Category
Preview:
Citation preview
8/14/2019 2005 EM
1/10
Environmental Microbiology (2005) 7(9), 1339 1348 doi:10.1111/j.1462-2920.2005.00821.x
2005 Society for Applied Microbiology and Blackwell Publishing Ltd
Blackwell Science, LtdOxford, UKEMIEnvironmental Microbiology 1462-2912Society for Applied Microbiology and Blackwell Publishing Ltd, 20057913391348Original ArticleAcinetobacter-based salicylate biosensorsW.E. Huang
et al.
Received 11 November, 2004; accepted 15 March, 2005. *Forcorrespondence. E-mail aswhi@ceh.ac.uk; Tel. (+44) 1865 281630;Fax (+44) 1865 281696.
Chromosomally located gene fusions constructed inAcinetobacter
sp. ADP1 for the detection of salicylate
Wei E. Huang,
1,2
Hui Wang,
3
Hongjun Zheng,
3
Linfeng Huang,
3
Andrew C. Singer,
2
Ian Thompson
2
and Andrew S. Whiteley
1
*
1
Molecular Microbial Ecology, 2
Environmental
Biotechnology and3
Plant Virology Sections, CEH-Oxford,
Mansfield Road, Oxford OX1 3SR, UK.
Summary
Acinetobacter
sp. ADP1 is a common soil-associated
bacterium with high natural competency, allowing it
to efficiently integrate foreign DNA fragments into itschromosome. This property was exploited to engineer
salicylate-inducible luxCDABE
and green fluorescent
protein (GFP) variants of Acinetobacter
sp. ADP1.
Specifically, Acinetobacter
sp. ADPWH
_lux
displayed
the higher sensitivity when comparing the two vari-
ants (minimum detection c
. 0.51 mmmm
M salicylate) and a
faster turnover of the lux marker gene, making it suit-
able for whole-cell luminescence assays of salicylate
concentration. In contrast, the longer maturation and
turnover times of the GFP protein make the Acineto-
bacter
sp. ADPWH
_gfp
variant more suited to appli-
cations involving whole-cell imaging of the presence
of salicylate. The sensitivity of the luxCDABE
variant
was demonstrated by assaying salicylate production
in naphthalene-degrading cultures. Assays using
ADPWH
_lux
specifically mapped the kinetics of sali-
cylate production from naphthalene and were similar
to that observed by high-performance liquid chroma-
tography (HPLC) data. However, ADPWH
_lux
exhib-
ited the higher sensitivity, when compared with HPLC,
for detecting salicylate production during the first
24 h of naphthalene metabolism. These data demon-
strate that the engineered Acinetobacter
variants
have significant potential for salicylate detection
strategies in laboratory and field studies, especiallyin scenarios where genetic stability of the construct
is required for in situ
monitoring.
Introduction
Naphthalene, phenanthrene and anthracene are mem-
bers of the class of polycyclic aromatic hydrocarbons
(PAHs), designated as priority pollutants, and which are
frequently identified in contaminated sites. Their aerobic
biodegradation pathways pass through salicylate (Yen and
Serdar, 1988; Harwood and Parales, 1996; Johri et al
.,
1999), which in turn induces the degradation of the parent
compound (Chen and Aitken, 1999; Loh and Yu, 2000).
Previous studies suggest secondary plant metabolites
such as salicylate may provide a range of compounds
capable of inducing PAH pollutant-degrading pathways(Singer et al
., 2003). Salicylate is also an important sig-
nalling compound in plants, inducing systemic acquired
resistance (SAR) against pathogens (Malamy et al
., 1990;
Gaffney et al
., 1993; Delaney et al
., 1994). In this article,
we present Acinetobacter
-based biosensors that specifi-
cally respond to salicylate and demonstrate their sensi-
tivity, specificity and application during naphthalene
degradation.
Bacterial-based biosensors with inducible reporter gene
fusions have been demonstrated for the detection of spe-
cific chemicals and monitoring of bioavailability in natural
environments (Errampalli et al
., 1999; Daunert et al
.,2000; Leveau and Lindow, 2002; Belkin, 2003; Jansson,
2003). The most commonly used reporter genes are
green fluorescent protein (GFP), originally from the jelly-
fish Aequorea victoria
(Tsien, 1998; Lippincott-Schwartz
and Patterson, 2003), and bioluminescent genes (
luxCD-
ABE
) from at least three bacterial genera (
Photobacte-
rium
, Vibrio
and Photorhabdus
; Meighen, 1994; Wilson
and Hastings, 1998). Many studies have utilized recombi-
nant methods where reporter genes are fused to the pro-
moters of degradation genes (Applegate et al
., 1998;
Willardson et al
., 1998; Stiner and Halverson, 2002). This
approach facilitates the identification of user-defined com-
pounds for a variety of matrices, such as biofilms (Moller
et al
., 1998), contaminated water, plant and soil research
(Belkin, 2003).
King and colleagues (1990) constructed the first naph-
thalene and salicyclate responsive biosensor using a plas-
mid-based luxCDABE
gene fusion derived from the NAH7
plasmid of Pseudomonas fluorescens
. This sensing
reagent subsequently found widespread use in laboratory
and field detection systems indicating the utility of the
8/14/2019 2005 EM
2/10
1340
W. E. Huanget al.
2005 Society for Applied Microbiology and Blackwell Publishing Ltd, Environmental Microbiology
, 7
, 13391348
plasmid-based reporter systems to provide good sensing
capabilities. However, the realization of the need for
genetic containment of recombinant constructs, especially
in field monitoring scenarios of contaminated sites, has
led to the increased interest in chromosomal engineering
of gene fusions. However, chromosomal integration of
gene fusions has been shown to be more technically
demanding than plasmid-based constructs due to the
requirement for homologous genetic modification systems
(e.g. the Tn systems), which tend to be group specific and
not applicable to all organisms. Moreover, appropriate
intermediate hosts (e.g. Lambda PIR
hosts for the Tn
5
systems) for subcloning are required before transfer by bi-
or triparental mating to specific hosts.
In terms of rapid and simple chromosome engineering
of gene fusions we selected Acinetobacter
sp. ADP1 (also
designated as BD413) as a potential host. Acinetobacter
sp. ADP1 in naturally widespread in the environment and
has an extremely high natural competency. It is capable
of taking up and integrating diverse sources of DNA into
the chromosome with little discrimination (Palmen et al
.,1993; Dubnau, 1999). Specifically, Acinetobacter
sp.
ADP1 integrates foreign DNA into the chromosome with
a high efficiency, requiring only a homologous region
greater than 183 base pairs for recombination (de Vries
and Wackernagel, 2002). Further, the presence of a sali-
cylate-degrading operon (Jones et al
., 2000) within the
host enables Acinetobacter
sp. ADP1 to grow on salicy-
late, while also providing the required homology for inte-
gration of recombinant gene fusions in order to generate
salicylate responsive biosensor constructs. It must be
noted, however, that the salicylate degradation pathway in
ADP1 (Jones et al
., 2000) is very different from thatobserved in other systems, such as the classical NAH7
system (Cebolla et al
., 1997), and hence these sensors
may also provide good comparative data for the operation
of similar pathways which are regulated by different
operon structures.
In this article, we demonstrate the utility of Acineto-
bacter
as a chromosomal engineering host through the
rapid and simple construction of gene fusions which are
specifically induced in the presence of salicylate. We engi-
neered both luxCDABE
and green fluorescent protein
(GFP) into the inducible salicylate operon in the chromo-
some of Acinetobacter
sp. ADP1, and characterize their
sensitivity and specificity to the target compound.
Results and discussion
Construction of chromosomal-based GFP and lux
Acinetobacter
sp. reporters for salicylate
Promoterless GFP and luxCDABE
were excised from
pRMJ2 and pSB417, respectively, and were inserted as
an Eco
R1 fragment into a recombinant partial salA/salR
fragment harbouring an engineered Eco
RI site (Fig. 1).
Partial salA/salR
fragments with Eco
R1 sites were con-
structed using Acinetobacter
strain ADP1 chromosomal
DNA as the template and overlap extension polymerase
chain reaction (PCR) protocols (Fig. 1) and cloned into
pGEM-T vectors. Green fluorescent protein or luxCDABE
were cloned into separate pGEM-T vectors harbouring
these partial salA/salR
constructs and the resulting plas-
mids were designated pSalAR_
gfp
and pSalAR_
lux
(Fig. 1) and transformed into Acinetobacter
ADPW67
(Fig. 2). Acinetobacter
strain ADPW67 harboured a
kanamycin-disrupted salA
copy and therefore the recom-
binant partial salA/salR
fragment in the transfer plasmids
allowed homologous recombination in a single step, utiliz-
ing the kanamycin-disrupted salA
chromosomal copy as
the cross-over region (Fig. 2). This single step produced
two events: the restoration of salA
in the parent chromo-
some and a concomitant insertion of non-homologous
GFP or luxCDABE
. Homologous recombination restored
the parent strains ability to utilize salicylate and was usedas the selection criteria for transformants. Simultaneously,
GFP and luxCDABE
fragments in plasmids pSalAR_
gfp
or pSalAR_
lux
were inserted between salA
and salR
(Fig. 2). The selected transformants were able to grow on
salicylate and also expressed GFP or bioluminescence
due to restored salA
expression, and were designated
ADPWH_
gfp
and ADPWH_
lux
, for GFP- and lux-
expressing strains respectively.
To confirm GFP and luxCDABE
integration to the chro-
mosome of Acinetobacter
sp. ADP1, eight colonies were
randomly chosen for each strain and PCR reactions
were performed using a chromosomal flanking primerand an internal GFP or luxCDABE
construct primer. Spe-
cifically, the chromosomal flanking primer salAR_rev_out
was used in conjunction with either salAR_fwd (GFP
transformants) or luxE_fwd (
luxCDABE
transformants)
(Fig. 2 and Table 2). The presence of a PCR product
from these reactions presumptively indicated a chromo-
somal integration for the constructs, which was subse-
quently confirmed by sequencing the PCR products to
demonstrate the chromosomal/construct junction (data
not shown).
These data indicated the ease with which naked
foreign DNA fragments could be inserted into the chro-
mosome of Acinetobacter
sp. ADP1 by homologous
recombination events. The transfer frequency is depen-
dent on the length of homologous DNA present in the
construct and non-homologous insert length (de Vries
and Wackernagel, 2002). In this study, the transfer effi-
ciency was approximately 10
-
4
to insert GFP (about
900 bp) and 10
-
6
for luxCDABE
(about 5800 bp) transfor-
mants, highlighting a lower efficiency for larger marker
gene constructs.
8/14/2019 2005 EM
3/10
Acinetobacter-
based salicylate biosensors
1341
2005 Society for Applied Microbiology and Blackwell Publishing Ltd, Environmental Microbiology
, 7
, 13391348
Fig. 1.
Construction of plasmids pSalAR_
lux
and pSalAR_
gfp
.AC. Schematic diagram of the creation of the fused salAR
fragment harbouring Eco
RI and Bam
HI sites by overlap extension PCR.D and E. Creation of pSalAR_BE by insertion of salAR
fragment into pGEM-T.
F. Generation of pSalAR_
lux
by introducing luxCDABE into the EcoRI site of pSalAR_BE.G. Generation of pSalAR_gfpby introducing the GFP fragment into the EcoRI site of pSalAR_BE.Note the maps are not to scale.
EcoR1/BamH1
EcoR1/BamH1
EcoR1/BamH1
EcoR1/BamH1
EcoR1/BamH1
A A
salA Partial salR Acinetobacter
genomic DNA
salA_fwd_out
salA_fwd_out
salAR_rev
salAR_revsalAR_BE_rev
salAR_BE_fwd
A
B
C
D E
F G
luxCDABE
from pSB417 gfpfrompRMJ2
Notl
Notl
PstlPstl
SallSall
Ndel
Ndel
Sacl
Sacl
salA
EcoRI
BamHI
partial salR
pSalAR_BE
5049 bpAmp
Notl
Notl
PstlSall
Sall
Ndel
Sacl
salA
EcoRI
EcoRl
Xbal
BamHl
BamHl
partial salR
pSalAR_gfp
5949 bp
Amp
promotless GFP
Notl
PstlSall
Sall luxE
luxB
luxA
luxC
luxD
Pstl
Ndel
Sacl
salA
EcoRl
EcoRl
BamHl
partial salR
pSalAR_lux
10891 bp
Amp
pGEM-T
3000 bp
Amp
8/14/2019 2005 EM
4/10
1342 W. E. Huanget al.
2005 Society for Applied Microbiology and Blackwell Publishing Ltd, Environmental Microbiology, 7, 13391348
Kinetics of salicylate induction for ADPWH_gfp and
ADPWH_lux
Acinetobacterstrain ADPWH_luxgrowth curve data indi-cated that lux expression was not induced in standard
LuriaBertani (LB) growth media (Fig. 3A), but strong
induction of luminescence was observed within the first
few minutes of subculturing to LB containing 100 mM sal-
icylate. Salicylate-induced lux expression peaked at 3 h
during mid-exponential growth (Fig. 3B) and subsequently
declined after 4 h of growth, demonstrating turnover of the
lux protein and reduced salA induction as salicylate was
degraded by the parent strain. In contrast, salicylate-
induced GFP expression continued throughout the growth
curve in LB containing 100 mM salicylate and peaked at
24 h (Fig. 3D), indicating a less sensitive response for the
GFP variant, more than likely associated with the require-
ments for GFP maturation and long half-life once the
protein is formed (Tsien, 1998; Errampalli et al., 1999).
Uninduced controls for strain ADPWH_gfp exhibited a
small amount of background GFP expression (approxi-
mately one-third of the induced cultures; Fig. 3C), sug-
gesting again that the long half-life of GFP allows some
of the protein to accumulate in the cell via background
uninduced expression of salA. The rapid and sensitive
response of ADPWH_luxsuggests it is suitable as a real-
time salicylate biosensor through whole-cell lumines-
cence assay. In contrast, the GFP variant is better suited
to in situmicroscopic visualization of salicylate presence
due to signal accumulation via longer turnover times of
the GFP protein. Alternatively, more sensitive responses
for salicylate-induced GFP expression and whole-cell
imaging could be obtained by replacing the stable GFP
with shorter half-life variants (Andersen et al., 1998).
Salicylate concentration andsalA induction relationship
forAcinetobacter sp. ADPWH_lux and ADPWH_gfp
Salicylate concentration and salA expression relation-
ships were derived for both lux- and GFP-based Acineto-
bacter biosensors (Fig. 4). In general, ADPWH_lux
exhibited a linear increase in lux expression for concen-
trations of salicylate between 1 mM and 100 mM. Above
100 mM salicylate the salA promoter response was satu-
rated and no concomitant increase in lux expression
occurred. In contrast, accumulation of GFP through back-
ground expression for ADPWH_gfpcaused little dynamic
response of GFP induction between 1 mM and 10 mM sal-
icylate, with concentrations between 10 mM and 100 mM
Acinetobacter sp.ADPW67
Acinetobacter sp.ADPWH_gfpor
ADPWH_lux
salAKm
ClaI
Whole salR
salAGFP orluxCDABE
EcoRI
Partial salR
BamHIEcoRI
pSalAR_gfpor
pSalAR_lux
salAGFP orluxCDABE
EcoRI
whole salR
BamHIEcoRI
salAR_rev_outluxE_fwdsalAR_fwd
Plasmid Chromosome
Fig. 2. Schematic representation of the inte-gration of salARcarrying promoterless GFP orluxCDABE into the chromosome of Acineto-bactersp. ADPW67. SalA fragments from
pSalAR_gfpor pSalAR_luxrestored the dis-rupted salA gene in ADPW67 by homologousrecombination with the kanamycin-disruptedsalA copy in the parent chromosome.
8/14/2019 2005 EM
5/10
Acinetobacter-based salicylate biosensors 1343
2005 Society for Applied Microbiology and Blackwell Publishing Ltd, Environmental Microbiology, 7, 13391348
causing an increase in expression of GFP (Fig. 4), rein-
forcing the conclusion that the lux-based sensor was the
more sensitive strain for determining salicylate concentra-
tion in the range of 1100 mM.
SalA expression specificity for salicylate and its analogues
The induction of bioluminescence in Acinetobacter sp.
strains ADPWH_lux and ADPWH_gfp was assessed
against salicylate and five structural analogues [4-hydrox-
ybenzoic acid (4HBA); 3-hydroxybenzoic acid (3HBA);
benzoate; catechol and acetylsalicylic acid (aspirin)] to
test the specificity of salA induction (Fig. 5). The
responses for both strains were identical, but for brevity,only these data for ADPWH_luxare discussed after a 2 h
induction.
For ADPWH_lux, inducer concentrations in the range of
50 pM to 50 mM were tested, a range that was found not
to affect the growth of the strains (W.E. Huang, unpubl.
obs.). Specifically, low levels of induction were found to
occur at 0.5 mM salicylate, with a threefo ld in crease in
expression being observed at 5 mM, reinforcing the lower
range of operational sensitivity of around 1 mM, as
observed above. Increasing the concentrations logarithmi-
cally for all analogues indicated strong induction only in
the presence of salicylate up to 500 mM, and a subse-quent decrease in response between 500 mM and 5 mM
(Fig. 5). However, for the analogues two exceptions to this
occurred. Acetylsalicyclic acid (aspirin) induced salA
expression at a level approximately one-third of that
observed for salicylate induction, and occurred between
inducer concentrations of 5 mM and 5 mM (Fig. 5). Sec-
ond, benzoate and catechol also induced biolumines-
cence, but only at a concentration of 5 mM (Fig. 5). For
catechol, this result is at odds with the NAH7 system,
where an absolute requirement for a carboxyl group exists
(Cebolla et al., 1997).
Significantly, 4HBA and 3HBA did not induce biolumi-
nescence even though they are positional isomers of sal-
icylic acid. Despite the structural similarities between
salicylate, 3HBA and 4HBA, their degradation are regu-
lated by different genes in Acinetobactersp. ADP1 (Collier
Fig. 3. Bioluminescence and green fluorescent protein (GFP) expres-sion in Acinetobactersp. ADPWH_luxand ADPWH_gfpinduced by100 mM salicylate in LB. Bioluminescence and OD600 of Acinetobacter
ADPWH_luxin the absence (A) and in the presence (B) of salicylate.Green fluorescent protein expression and OD600 of AcinetobacterADPWH_gfpin the absence (C) and in the presence (D) of salicylate.Error bars represent one standard deviation of the mean (n= 3).
B
0.1
1
0 2 4 6 8 100
5000
10000
15000
20000
25000
0.1
1
0 2 4 6 8 100
5000
10000
15000
20000
25000
A
OD600nm
(--)
Luminescencece
ll1
(AU)
GFPflu
orescencecell1
(AU)
ADPWH_lux
ADPWH_lux
+
salicylate
0.1
1
0 6 12 18 240
250
500
750
1000
ADPWH_gfpC
0.1
1
0 6 12 18 240
250
500
750
1000
ADPWH_gfp
+
salicylate
D
Time (h)
-
-
-
-
Fig. 4. Bioluminescence and GFP expression in Acinetobactersp.ADPWH_luxand ADPWH_gfpinduced by a range of salicylate con-centrations in LB after 2 h of induction. Error bars represent one
standard deviation of the mean (n= 3).
0
5000
10000
15000
20000
25000
30000
35000
40000
1 10 100 1000
0
300
600
900
Lumin
escencecell1
(AU)
-
-
GFPfluo
rescencecell1
(AU)
-
-
Salicylate concentration (M)
8/14/2019 2005 EM
6/10
1344 W. E. Huanget al.
2005 Society for Applied Microbiology and Blackwell Publishing Ltd, Environmental Microbiology, 7, 13391348
et al., 1998; Jones et al., 1999; Brzostowicz et al., 2003;
Parke and Ornston, 2003). Hence, the salicylate operon
should not be induced by 3HBA and 4HBA, and these
data confirm this observation. It remains unclear as to the
cause for the induction by aspirin, other than the presence
of a carboxyl group, but this did not cause induction from
many of the other analogue compounds containing it (e.g.
4HBA or 3HBA). However, true induction by acetylsalicy-
clic acid was observed for the NAH7 system (Cebolla
et al., 1997) where intermediate metabolite production
(e.g. salicylate) was blocked, suggesting that some com-
mon mechanisms may be acting with regard to this com-
pound, despite different salicylate pathways. However, for
future uses of the sensors, the presence of such com-
pounds at the required concentration in samples where
salicylate detection would be performed would more than
likely be negligible, and hence should not interfere with
the specificity of the developed sensors.
Applications during naphthalene degradation to
demonstrate intermediate metabolite production
As salicylate is a central metabolite of naphthalene deg-
radation by Pseudonomas putida NCIB9816 an experi-
ment was performed to detect salicylate by ADPWH_lux
within a naphthalene-degrading culture of P. putida
NCIB9816 (Yen and Serdar, 1988). Jones and colleagues
(2000) indicated that the parent strain Acinetobactersp.
ADP1 cannot utilize naphthalene and to confirm this naph-
thalene concentrations between 1 and 200 mM were
exposed to ADPWH_luxand no induction of biolumines-
cence was observed (data not shown).
For P. putida NCIB9816 cultures growing on naphtha-
lene, both high-performance liquid chromatography
(HPLC) and ADPWH_luxassays indicated that salicylate
was produced during naphthalene degradation (Fig. 6).
Over a 48 h period, the bioluminescence of ADPWH_lux
whole-cell assays increased, with salicylate being
0
500
1000
1500
2000
2500
3000
3500
4000
0.05 0.5 5 50 500 5000 50000
Analogue concentration (mM)
Luminescencecell1
(AU)
Salicylic acid 4-HBA 3-HBA Benzoate Catechol
Acetylsalicylic
acidO
C ONa
O
C
C
O
OCH3
OH
O
C OH
OH
O
CO
C ONaOH
OH
OH
OH
OH
Fig. 5. Bioluminescence expression in Acine-tobactersp. ADPWH_luxinduced by salicylateand five structurally similar analogues. Lumi-
nescence measurements were taken after 2 hof induction in LB containing salicylate or itsanalogues at concentrations ranging between50 pM and 50 mM. Error bars represent onestandard deviation of the mean (n= 3).
Fig. 6. Acinetobactersp. ADPWH_luxdetection of salicylate in cell-free extracts during Pseudomonas putidaNCIB9816 degradation of
naphthalene. Filled symbols represent the luminescence per cell (AU)produced after a 90 min incubation of the cell-free extracts withADPWH_lux, and represented visually in the composite image. Theopen symbols represent the absolute concentration of salicylate asmeasured by HPLC. Error bars represent one standard deviation of
the mean (n= 2).
0.1
1
10
100
1000
10000
0 20 40 60
1
10
100
1000
10000
Time (h)
SalicylateconcentrationbyHPLC
(mM)
-
-
ADPWH
_luxluminescencecell1
-
-
Control 0h 2h 24h 48h
8/14/2019 2005 EM
7/10
Acinetobacter-based salicylate biosensors 1345
2005 Society for Applied Microbiology and Blackwell Publishing Ltd, Environmental Microbiology, 7, 13391348
detected in the water phase by ADPWH_lux within 4 h.
As we concentrated on salicylate induction of the gene
fusions, and our previous data indicated napthalene deg-
radation intermediates such as catechol did not induce
the sensor unless at unrealistically high concentrations,
we specifically measured only the key inducer, salicylate,
in the degrading cultures by HPLC. While this may not fully
map the degradation kinetics of naphthalene and its inter-
mediates, we still observed discrepancies between the
sensor induction and those measures by HPLC. Specifi-
cally, the HPLC data indicated only appreciable salicylate
being formed after 20 h, indicating that the whole-cell
assay was more sensitive to the production of salicylate
than the HPLC method during the early stages of naph-
thalene degradation. Further, these data suggested an
accumulation of salicylate in the water phase over 48 h,
indicating that the salicylate production pathway from
naphthalene is probably acting faster than the salicylate
breakdown pathway (Yen and Serdar, 1988). As salicylate
is an intermediate metabolite for many poly-ring hydrocar-
bon degradation pathways (Yen and Serdar, 1988; Har-wood and Parales, 1996; Johri et al., 1999), these data
suggest that rapid and specific salicylate detection using
biosensors such as ADPWH_luxcould be used as a good
indicator of the activity of such degradation pathways in
complex degrading systems. However, as with all gene
fusion biosensors, rigorous calibration of the sensors
response to more complex pollutant mixtures and inter-
mediates is required before deploying such reagents to
complex in situsensing modes.
Experimental procedures
Bacterial strains, plasmids and culture media
The bacterial strains and plasmids used in this study are
listed in Table 1. Unless otherwise stated all chemicals were
Analar grade reagents. LuriaBertani medium (Oxoid) was
used for general cultivation of bacteria, induction and ana-
logue studies. However, minimal medium (MM) was used for
the selection of transformants. Minimal medium was pre-pared containing the following (l-1): Na2HPO4: 3.0 g; KH2PO4:
3.0 g; NH4Cl: 1.0 g; MgSO47H2O: 0.5 g; saturated CaCl2 and
FeSO4 solution: 35 drops. Salicylate agar (SAA) medium
was prepared using 2.5 mM salicylate (sodium salt) as a sole
carbon source and solidified within 1.4% noble agar contain-
ing MM. Where appropriate, ampicillin and kanamycin were
used at a final concentration of 100 and 50 mg ml-1,
respectively, for Escherichia coliand kanamycin at 10 mg ml-1
for Acinetobactersp.
General PCR amplification reagents
Primers were purchased from MWG Biotech and are listed
in Table 2. Polymerase chain reaction amplifications werecarried out in 50 ml reactions containing 1 reaction buffer,
200 mM of each deoxynucleoside triphosphate (Bioline),
0.5 mM of each primer, 12 unit Taq DNA polymerase
(Sigma).
Overlap extension PCR to createsalAR fusions with
required restriction sites
EcoRI and BamHI restriction sites were created between
salA and partial salR fragments by overlap extension PCR
Table 1. Bacterial strains and plasmids used in this study.
Bacterial strains Description Reference
AcinetobacterADP1(BD413) Wild type Juni and Janik (1969)
AcinetobacterADPW67 SalA::Kmr, Km gene is inserted into ClaI site of salA Jones et al. (2000)
AcinetobacterADPWH_lux luxCDABE (~5.8 kb) gene inserted between salA and salR,obtained by transformation of ADPW67 with pSalAR_lux
This study
AcinetobacterADPWH_gfp GFP gene inserted between salA and salR, obtained bytransformation of ADPW67 with pSalAR_gfp
This study
E. coliJM109 High-efficiency competent cells Promega
Pseudonomas putidaNCIB9816 Wild type Cane and Williams (1982)
Plasmids
pGEM-T Ampr, T7 and SP6 promoters, lacZ, vector Promega
pRMJ2 Source plasmid for GFP gene. Promoterless GFP gene (~900 bp)was cloned in pRMJ1 and replaced sacB
Jones and Williams (2003)
pSB417 luxCDABEsource plasmid containing luxCDABE fromPhotorhabdus (Xenorhabdus) luminescensATCC2999
Winson et al. (1998)
pSalAR_BE Whole salA and partial salR fragment cloned into pGEM-T. EcoRIand BamHI sites located between salA and salR
This study
pSalAR_lux luxCDABE (5846 bp) inserted into EcoRI site created betweensalA and salR of pSalAR_BE
This study
pSalAR_gfp GFP inserted into EcoRI site created between salA and salRofpSalAR_BE
This study
8/14/2019 2005 EM
8/10
1346 W. E. Huanget al.
2005 Society for Applied Microbiology and Blackwell Publishing Ltd, Environmental Microbiology, 7, 13391348
(Fig. 1) using a small amount of Acinetobacter sp. ADP1
bacterial colony (0.10.25 ml) as the template in the PCR
reaction. Polymerase chain reaction amplifications were per-
formed with initial denaturation at 95C for 5 min, followed by
35 cycles of 94C for 1 min, 50C for 1 min and 72C for
2 min, and a final additional 72C for 10 min extension. SalA
and partial salRfragments were separately amplified by col-
ony PCR using the primer pairs salA_fwd_out
salAR_BE_rev and salAR_BE_fwdsalAR_rev (Table 2).
Polymerase chain reaction products were isolated from a 1%
agarose gel and purified according to the manufacturersinstructions using a QIAquick gel extraction kit (Qiagen). To
fuse salA and salR fragments, a PCR amplification (using
the same reaction conditions above) was carried out contain-
ing 1 ml of 1:100 diluted salA (1314 bp) and partial salR
(735 bp) fragments and primers salA_fwd_out and
salAR_rev.
Plasmid construction
Standard molecular techniques were performed as previ-
ously described (Sambrook et al., 1989). Fused salARfrag-
ments containing EcoRI and BamHI restriction sites were
ligated into pGEM-T (Promega), and subsequently trans-formed into E. coli JM109. After transformation, cells were
selected on LB containing 100 mg ml-1 ampicillin and 2 mM
salicylate. Plasmids containing salAR insertions displayed
the salA phenotype, which encodes salicylate hydroxylase,
turning salicylate into catechol, generating brown halos
around the colonies. These colonies were subsequently
selected and the salA/salR fusion containing plasmids des-
ignated as pSalAR_BE.
Green fluorescent protein and luxCDABEfragments were
excised from pRMJ2 (generously donated by Dr Rheinallt
M. Jones) and pSB417 (generously donated by Dr Mike
Winson) by EcoRI digestion and subsequently gel purified
(Qiagen). The digested GFP and luxCDABE fragments
were ligated into pSalAR_BE as an EcoR1 fragment.
Ligated products were transformed into E. coli JM109 and
plated onto LB containing 100 mg ml-1 ampicillin and 2 mM
salicylate. Colonies expressing salicylate hydroxylase
together with GFP or lux were chosen and their plasmids
designated as pSalAR_gfp and pSalAR_lux respectively.
To confirm the construction, plasmids pSalAR_BE,
pSalAR_gfp and pSalAR_lux were purified (Qiagen), and
were sequenced around the sites of insertion by SP6/T7
promoter primers and salAR_fwd/salAR_rev primers
(Table 2).
Chromosomal integration of lux and GFP gene of
Acinetobacter sp.
Preparation of competent cells of Acinetobacter sp. ADP1
was performed as described previously (Palmen et al., 1993).
Acinetobactersp. strain ADPW67 served as the recipient and
was grown in 5 ml of LB (containing 10 mg ml-1 kanamycin)
at 30C overnight, with 200 r.p.m. shaking. Two hundred
microlitres of culture were then diluted into 5 ml of fresh LB
medium and incubated for 2 h to make the cells competent.
For transformation, 5 ml of the plasmid pSalAR_gfp orpSalAR_lux was added to 0.5 ml of competent cells (109
cells ml-1) and the cells were incubated for 2 h. The cultures
were subsequently plated onto SAA medium for selection of
transformants which has restored the salicylate degradation
function.
Polymerase chain reaction to testAcinetobacter
sp. mutants
To confirm the integration of GFP gene and luxCDABEgenes
to the chromosome of Acinetobactersp. ADP1, PCR ampli-
fications using salAR_fwd and salAR_rev_out for
ADPWH_gfp and luxE_for and salAR_rev_out (Table 2) forADPWH_lux were carried out (Fig. 2). Polymerase chain
reaction amplifications were performed with initial denatur-
ation at 95C for 5 min, following 35 cycles of 95C for 1 min,
60C for 1 min and 72C for 2 min 30 s, and then additional
72C for 10 min to finish extension. After amplification, PCR
products were run on a 1% agarose gel, band purified
(Qiagen) and sequenced.
Kinetic analysis GFP fluorescence and bioluminescence
induced by salicylate
Green fluorescent protein (GFP) fluorescence, biolumines-
cence and OD600 of Acinetobacter sp. strains ADPWH_gfp
and ADPWH_luxwere measured using a Synergy HT Multi-
Detection Microplate Reader (Bio-Tek). For growth curve,
induction and analogue studies, overnight cultures for each
strain were diluted in LB to 1:20 and incubated at 37C for
2 h with 150 r.p.m. shaking. Subsequently, triplicate cultures
of ADPWH_gfp or ADPWH_lux were initiated containing a
range of concentrations of salicylate or its analogues, at 37C
with 150 r.p.m. shaking. At specific time points, 200 ml of each
culture was placed in a 96-well microplate and samples were
immediately measured. Relative fluorescence intensity of
Table 2. Primers used in this study.
Primers Sequence (5 3) Note
salA_fwd_out CTCAAAGGAAATGAGTCGTGGGTAsalAR_BE_fwd CGCTAAGAATTCGGATCCAGAGTGTTTTGA Created EcoRI and BamHI sites
salAR_BE_rev TCAAAACACTCTGGATCCGAATTCTTAGCG Created EcoRI and BamHI sites
salAR_fwd CAGGACTGGAGCGAAAGCTGsalAR_rev GACCTGAGTATGCCCGGTAG
luxE_fwd TGGTTTACCAGTAGCGGCACG Internal to luxEgene
salAR_rev_out GCCCTCAGGTAATGGCGACTA Chromosomal flanking primer
8/14/2019 2005 EM
9/10
Acinetobacter-based salicylate biosensors 1347
2005 Society for Applied Microbiology and Blackwell Publishing Ltd, Environmental Microbiology, 7, 13391348
GFP and bioluminescence was obtained by dividing by the
OD600, to allow normalization. For GFP fluorescence mea-
surements, the Synergy HT Multi-Detection Microplate
Reader was set at an excitation wavelength of 480 nm and
an emission detection at 520 nm.
Detection of analogues of salicylic acid
To test the specificity of the biosensors, Acinetobacter sp.strains ADPWH_gfpand ADPWH_luxwere used to detect a
series of concentrations of five analogues of salicylic acid.
On the basis of their chemical structures and properties, 4-
hydroxybenzoic acid, 3-hydroxybenzoic acid, benzoate,
catechol and acetylsalicylic acid (aspirin) were chosen for
testing.
Nucleotide sequencing and sequence analysis
All DNA samples (PCR products or plasmids) were
sequenced using dye terminator sequencing on an Applied
Biosystems 3730 DNA analyser according to the manufac-
turers instructions. DNA sequence analysis was carried outusing BLASTN for confirmation of sequence homology and
these data were aligned and edited using BIOEDIT to confirm
correct insertions (Tom Hall, Department of Microbiology,
North Carolina State University).
Acinetobacter sp.ADPWH_lux and HPLC determination
of salicylate production in naphthalene-degrading
samples
To test the utility of the constructed biosensor in complex-
degrading scenarios, the kinetics of salicylate production in
the water phase of extracts from naphthalene-degrading cul-
tures was tested. Pseudomonas putida NCIB9816 (kindlyprovided by Professor Peter Williams) was inoculated into
replicate 30 ml universal tubes containing 5 ml of MM
medium and 1 mg of naphthalene and incubated at 30C with
150 r.p.m. shaking. At discreet intervals over 48 h, 100 ml of
each culture was removed and clarified by passing through
a 0.2 mm filter.
Acinetobactersp. ADPWH_luxcells were diluted in fresh
LB (1:20) after overnight growth at 37C with 150 r.p.m.
shaking. The cells were then incubated for 23 h before
performing the detection assays, with a final bacterial den-
sity in all cases of 109 ml-1. Fifty microlitres of Acinetobacter
sp. ADPWH_luxwere added to 50 ml of the clarified extract
obtained above, and the amount of salicylate in the water
phase was measured by the relative increase in biolumi-
nescence, versus salicylate free controls, after 90 min at
37C.
In tandem, absolute salicylate concentrations were moni-
tored by HPLC. Cell-free supernatants obtained above were
analysed on a Dionex liquid chromatograph (Camberley, UK)
equipped with a diode array detector with a Phenomenex C18
column (250 mm 3.25 mm, par ticle diameter 5 mm) and
appropriate standards for salicylate-specific calibration. An
isocratic program was applied with a mobile phase containing
30% acetonitrile and 2% orthophosphate.
Acknowledgements
We thank Dr Michael Winson for providing pSB417 and asso-
ciated information, Professor Peter Williams and Dr Rheinallt
M. Jones for providing plasmid pRMJ2, Acinetobacter sp.
ADPW67 and P. putidaNCIB9816.
References
Andersen, J.B., Sternberg, C., Poulsen, L.K., Bjrn, S.P.,
Givskov, M., and Molin, S. (1998) New unstable variants
of green fluorescent protein for studies of transient gene
expression in bacteria. Appl Environ Microbiol 64: 2240
2246.
Applegate, B.M., Kehrmeyer, S.R., and Sayler, G.S. (1998)
A chromosomally based tod-luxCDABEwhole-cell reporter
for benzene, toluene, ethybenzene, and xylene (BTEX)
sensing. Appl Environ Microbiol64: 27302735.
Belkin, S. (2003) Microbial whole-cell sensing systems of
environmental pollutants. Curr Opin Microbiol 6: 206
212.
Brzostowicz, P.C., Reams, A.B., Clark, T.J., and Neidle, E.L.
(2003) Transcriptional cross-regulation of the catechol andprotocatechuate branches of the beta-ketoadipate pathway
contributes to carbon source-dependent expression of the
Acinetobacter sp. strain ADP1 pobA gene. Appl Environ
Microbiol69: 15981606.
Cane, P.A., and Williams, P.A. (1982) The plasmid-coded
metabolism of naphthalene and 2-methylnaphthalene in
Pseudomonas strains phenotypic changes correlated
with structural modification of the plasmid Pww60-1. J Gen
Microbiol128: 22812290.
Cebolla, A., Sousa, C., and deLorenzo, V. (1997) Effector
specificity mutants of the transcriptional activator NahR of
naphthalene degrading Pseudomonasdefine protein sites
involved in binding of aromatic inducers. J Biol Chem272:
39863992.Chen, S.H., and Aitken, M.D. (1999) Salicylate stimulates the
degradation of high molecular weight polycyclic aromatic
hydrocarbons by Pseudomonas saccharophilaP15. Envi-
ron Sci Technol33: 435439.
Collier, L.S., Gaines, G.L., and Neidle, E.L. (1998) Regula-
tion of benzoate degradation in Acinetobacter sp. strain
ADP1 by BenM, a LysR-Type transcriptional activator. J
Bacteriol180: 24932501.
Daunert, S., Barrett, G., Feliciano, J.S., Shetty, R.S.,
Shrestha, S., and Smith-Spencer, W. (2000) Genetically
engineered whole-cell sensing systems: coupling biologi-
cal recognition with reporter genes. Chem Rev100: 2705
2738.
Delaney, T.P., Uknes, S., Vernooij, B., Friedrich, L., Wey-
mann, K., Negrotto, D., et al. (1994) A central role of
salicylic acid in plant disease resistance. Science 266:
12471250.
Dubnau, D. (1999) DNA uptake in bacteria. Ann Rev Micro-
biol53: 217244.
Errampalli, D., Leung, K., Cassidy, M.B., Kostrzynska, M.,
Blears, M., Lee, H., and Trevors, J.T. (1999) Applications
of the green fluorescent protein as a molecular marker in
environmental microorganisms. J Microbiol Methods 35:
187199.
8/14/2019 2005 EM
10/10
1348 W. E. Huanget al.
2005 Society for Applied Microbiology and Blackwell Publishing Ltd, Environmental Microbiology, 7, 13391348
Gaffney, T., Friedrich, L., Vernooij, B., Negrotto, D., Nye, G.,
Uknes, S., et al. (1993) Requirement of salicylic acid for
the induction of systemic acquired resistance. Science
261: 754756.
Harwood, C.S., and Parales, R.E. (1996) The beta-ketoadi-
pate pathway and the biology of self-identity. Ann Rev
Microbiol50: 553590.
Jansson, J.K. (2003) Marker and reporter genes: illuminating
tools for environmental microbiologists. Curr Opin Micro-
biol6: 310316.
Johri, A.K., Dua, M., Singh, A., Sethunathan, N., and Legge,
R.L. (1999) Characterization and regulation of catabolic
genes. Crit Rev Microbiol25: 245273.
Jones, R.M., and Williams, P.A. (2003) Mutational analysis
of the critical bases involved in activation of the AreR-
regulated sigma(54)-dependent promoter in Acinetobacter
sp. strain ADP1. Appl Environ Microbiol69: 56275635.
Jones, R.M., Collier, L.S., Neidle, E.L., and Williams, P.A.
(1999) areABC genes determine the catabolism of aryl
esters in Acinetobactersp. strain ADP1. J Bacteriol181:
45684575.
Jones, R.M., Pagmantidis, V., and Williams, P.A. (2000) sal
genes determining the catabolism of salicylate esters are
part of a supraoperonic cluster of catabolic genes in Acine-tobactersp. strain ADP1. J Bacteriol182: 20182025.
Juni, E., and Janik, A. (1969) Transformation of Acinetobacter
calcoaceticus (Bacterium anitratum). J Bacteriol98: 281
288.
King, J.M.H., Digrazia, P.M., Applegate, B., Burlage, R.,
Sanseverino, J., Dunbar, P., et al. (1990) Rapid, sensitive
bioluminescent reporter technology for naphthalene expo-
sure and biodegradation. Science249: 778781.
Leveau, J.H.J., and Lindow, S.E. (2002) Bioreporters in
microbial ecology. Curr Opin Microbiol5: 259265.
Lippincott-Schwartz, J., and Patterson, G.H. (2003) Develop-
ment and use of fluorescent protein markers in living cells.
Science300: 8791.
Loh, K.C., and Yu, Y.G. (2000) Kinetics of carbazole degra-dation by Pseudomonas putidain presence of sodium sal-
icylate. Water Res34: 41314138.
Malamy, J., Carr, J.P., Klessig, D.F., and Raskin, I. (1990)
Salicylic acid a likely endogenous signal in the resistance
response of tobacco to viral infection. Science250: 1002
1004.
Meighen, E.A. (1994) Genetics of bacterial bioluminescence.
Ann Rev Genet28: 117139.
Moller, S., Sternberg, C., Andersen, J.B., Christensen, B.B.,
Ramos, J.L., Givskov, M., and Molin, S. (1998) In situgene
expression in mixed-culture biofilms: evidence of metabolic
interactions between community members. Appl Environ
Microbiol64: 721732.
Palmen, R., Vosman, B., Buijsman, P., Breek, C.K.D., and
Hellingwerf, K.J. (1993) Physiological characterization of
natural transformation in Acinetobacter calcoaceticus. J
Gen Microbiol139: 295305.
Parke, D., and Ornston, L.N. (2003) Hydroxycinnamate (hca)
catabolic genes from Acinetobacter sp. strain ADP1 are
repressed by HcaR and are induced by hydroxycinnamoyl-
coenzyme a thioesters. Appl Environ Microbiol69: 5398
5409.
Sambrook, J., Fritsch, E.F., and Maniatis, T. (1989) Molecu-
lar Cloning: A Laboratory Manual. Cold Spring Harbor, NY
USA: Cold Spring Harbor Laboratory.
Singer, A.C., Crowley, D.E., and Thompson, I.P. (2003) Sec-
ondary plant metabolites in phytoremediation and biotrans-
formation. Trends Biotechnol21: 123130.
Stiner, L., and Halverson, L.J. (2002) Development and char-
acterization of a green fluorescent protein-based bacterial
biosensor for bioavailable toluene and related compounds.
Appl Environ Microbiol68: 19621971.Tsien, R.Y. (1998) The green fluorescent protein. Annu Rev
Biochem67: 509544.
de Vries, J., and Wackernagel, W. (2002) Integration of for-
eign DNA during natural transformation of Acinetobacter
sp. by homology-facilitated illegitimate recombination. Proc
Natl Acad Sci USA99: 20942099.
Willardson, B.M., Wilkins, J.F., Rand, T.A., Schupp, J.M., Hill,
K.K., Keim, P., and Jackson, P.J. (1998) Development and
testing of a bacterial biosensor for toluene based environ-
mental contaminants. Appl Environ Microbiol 64: 1006
1012.
Wilson, T., and Hastings, J.W. (1998) Bioluminescence.
Annu Rev Cell Dev Biol14: 197230.
Winson, M.K., Swift, S., Hill, P.J., Sims, C.M., Griesmayr, G.,Bycroft, B.W., et al. (1998) Engineering the luxCDABE
genes from Photorhabdus luminescensto provide a biolu-
minescent reporter for constitutive and promoter probe
plasmids and mini-Tn5 constructs. FEMS Microbiol Lett
163: 193202.
Yen, K.M., and Serdar, C.M. (1988) Genetics of naphthalene
catabolism in Pseudomonads. Crit Rev Microbiol15: 247
268.
Recommended