2005 EM

8/14/2019 2005 EM

1/10

Environmental Microbiology (2005) 7(9), 1339 1348 doi:10.1111/j.1462-2920.2005.00821.x

2005 Society for Applied Microbiology and Blackwell Publishing Ltd

Blackwell Science, LtdOxford, UKEMIEnvironmental Microbiology 1462-2912Society for Applied Microbiology and Blackwell Publishing Ltd, 20057913391348Original ArticleAcinetobacter-based salicylate biosensorsW.E. Huang

et al.

Received 11 November, 2004; accepted 15 March, 2005. *Forcorrespondence. E-mail [email protected]; Tel. (+44) 1865 281630;Fax (+44) 1865 281696.

Chromosomally located gene fusions constructed inAcinetobacter

sp. ADP1 for the detection of salicylate

Wei E. Huang,

1,2

Hui Wang,

3

Hongjun Zheng,

3

Linfeng Huang,

3

Andrew C. Singer,

2

Ian Thompson

2

and Andrew S. Whiteley

1

*

1

Molecular Microbial Ecology, 2

Environmental

Biotechnology and3

Plant Virology Sections, CEH-Oxford,

Mansfield Road, Oxford OX1 3SR, UK.

Summary

Acinetobacter

sp. ADP1 is a common soil-associated

bacterium with high natural competency, allowing it

to efficiently integrate foreign DNA fragments into itschromosome. This property was exploited to engineer

salicylate-inducible luxCDABE

and green fluorescent

protein (GFP) variants of Acinetobacter

sp. ADP1.

Specifically, Acinetobacter

sp. ADPWH

_lux

displayed

the higher sensitivity when comparing the two vari-

ants (minimum detection c

. 0.51 mmmm

M salicylate) and a

faster turnover of the lux marker gene, making it suit-

able for whole-cell luminescence assays of salicylate

concentration. In contrast, the longer maturation and

turnover times of the GFP protein make the Acineto-

bacter

sp. ADPWH

_gfp

variant more suited to appli-

cations involving whole-cell imaging of the presence

of salicylate. The sensitivity of the luxCDABE

variant

was demonstrated by assaying salicylate production

in naphthalene-degrading cultures. Assays using

ADPWH

_lux

specifically mapped the kinetics of sali-

cylate production from naphthalene and were similar

to that observed by high-performance liquid chroma-

tography (HPLC) data. However, ADPWH

_lux

exhib-

ited the higher sensitivity, when compared with HPLC,

for detecting salicylate production during the first

24 h of naphthalene metabolism. These data demon-

strate that the engineered Acinetobacter

variants

have significant potential for salicylate detection

strategies in laboratory and field studies, especiallyin scenarios where genetic stability of the construct

is required for in situ

monitoring.

Introduction

Naphthalene, phenanthrene and anthracene are mem-

bers of the class of polycyclic aromatic hydrocarbons

(PAHs), designated as priority pollutants, and which are

frequently identified in contaminated sites. Their aerobic

biodegradation pathways pass through salicylate (Yen and

Serdar, 1988; Harwood and Parales, 1996; Johri et al

.,

1999), which in turn induces the degradation of the parent

compound (Chen and Aitken, 1999; Loh and Yu, 2000).

Previous studies suggest secondary plant metabolites

such as salicylate may provide a range of compounds

capable of inducing PAH pollutant-degrading pathways(Singer et al

., 2003). Salicylate is also an important sig-

nalling compound in plants, inducing systemic acquired

resistance (SAR) against pathogens (Malamy et al

., 1990;

Gaffney et al

., 1993; Delaney et al

., 1994). In this article,

we present Acinetobacter

-based biosensors that specifi-

cally respond to salicylate and demonstrate their sensi-

tivity, specificity and application during naphthalene

degradation.

Bacterial-based biosensors with inducible reporter gene

fusions have been demonstrated for the detection of spe-

cific chemicals and monitoring of bioavailability in natural

environments (Errampalli et al

., 1999; Daunert et al

.,2000; Leveau and Lindow, 2002; Belkin, 2003; Jansson,

2003). The most commonly used reporter genes are

green fluorescent protein (GFP), originally from the jelly-

fish Aequorea victoria

(Tsien, 1998; Lippincott-Schwartz

and Patterson, 2003), and bioluminescent genes (

luxCD-

ABE

) from at least three bacterial genera (

Photobacte-

rium

, Vibrio

and Photorhabdus

; Meighen, 1994; Wilson

and Hastings, 1998). Many studies have utilized recombi-

nant methods where reporter genes are fused to the pro-

moters of degradation genes (Applegate et al

., 1998;

Willardson et al

., 1998; Stiner and Halverson, 2002). This

approach facilitates the identification of user-defined com-

pounds for a variety of matrices, such as biofilms (Moller

et al

., 1998), contaminated water, plant and soil research

(Belkin, 2003).

King and colleagues (1990) constructed the first naph-

thalene and salicyclate responsive biosensor using a plas-

mid-based luxCDABE

gene fusion derived from the NAH7

plasmid of Pseudomonas fluorescens

. This sensing

reagent subsequently found widespread use in laboratory

and field detection systems indicating the utility of the

8/14/2019 2005 EM

2/10

1340

W. E. Huanget al.

2005 Society for Applied Microbiology and Blackwell Publishing Ltd, Environmental Microbiology

, 7

, 13391348

plasmid-based reporter systems to provide good sensing

capabilities. However, the realization of the need for

genetic containment of recombinant constructs, especially

in field monitoring scenarios of contaminated sites, has

led to the increased interest in chromosomal engineering

of gene fusions. However, chromosomal integration of

gene fusions has been shown to be more technically

demanding than plasmid-based constructs due to the

requirement for homologous genetic modification systems

(e.g. the Tn systems), which tend to be group specific and

not applicable to all organisms. Moreover, appropriate

intermediate hosts (e.g. Lambda PIR

hosts for the Tn

5

systems) for subcloning are required before transfer by bi-

or triparental mating to specific hosts.

In terms of rapid and simple chromosome engineering

of gene fusions we selected Acinetobacter

sp. ADP1 (also

designated as BD413) as a potential host. Acinetobacter

sp. ADP1 in naturally widespread in the environment and

has an extremely high natural competency. It is capable

of taking up and integrating diverse sources of DNA into

the chromosome with little discrimination (Palmen et al

.,1993; Dubnau, 1999). Specifically, Acinetobacter

sp.

ADP1 integrates foreign DNA into the chromosome with

a high efficiency, requiring only a homologous region

greater than 183 base pairs for recombination (de Vries

and Wackernagel, 2002). Further, the presence of a sali-

cylate-degrading operon (Jones et al

., 2000) within the

host enables Acinetobacter

sp. ADP1 to grow on salicy-

late, while also providing the required homology for inte-

gration of recombinant gene fusions in order to generate

salicylate responsive biosensor constructs. It must be

noted, however, that the salicylate degradation pathway in

ADP1 (Jones et al

., 2000) is very different from thatobserved in other systems, such as the classical NAH7

system (Cebolla et al

., 1997), and hence these sensors

may also provide good comparative data for the operation

of similar pathways which are regulated by different

operon structures.

In this article, we demonstrate the utility of Acineto-

bacter

as a chromosomal engineering host through the

rapid and simple construction of gene fusions which are

specifically induced in the presence of salicylate. We engi-

neered both luxCDABE

and green fluorescent protein

(GFP) into the inducible salicylate operon in the chromo-

some of Acinetobacter

sp. ADP1, and characterize their

sensitivity and specificity to the target compound.

Results and discussion

Construction of chromosomal-based GFP and lux

Acinetobacter

sp. reporters for salicylate

Promoterless GFP and luxCDABE

were excised from

pRMJ2 and pSB417, respectively, and were inserted as

an Eco

R1 fragment into a recombinant partial salA/salR

fragment harbouring an engineered Eco

RI site (Fig. 1).

Partial salA/salR

fragments with Eco

R1 sites were con-

structed using Acinetobacter

strain ADP1 chromosomal

DNA as the template and overlap extension polymerase

chain reaction (PCR) protocols (Fig. 1) and cloned into

pGEM-T vectors. Green fluorescent protein or luxCDABE

were cloned into separate pGEM-T vectors harbouring

these partial salA/salR

constructs and the resulting plas-

mids were designated pSalAR_

gfp

and pSalAR_

lux

(Fig. 1) and transformed into Acinetobacter

ADPW67

(Fig. 2). Acinetobacter

strain ADPW67 harboured a

kanamycin-disrupted salA

copy and therefore the recom-

binant partial salA/salR

fragment in the transfer plasmids

allowed homologous recombination in a single step, utiliz-

ing the kanamycin-disrupted salA

chromosomal copy as

the cross-over region (Fig. 2). This single step produced

two events: the restoration of salA

in the parent chromo-

some and a concomitant insertion of non-homologous

GFP or luxCDABE

. Homologous recombination restored

the parent strains ability to utilize salicylate and was usedas the selection criteria for transformants. Simultaneously,

GFP and luxCDABE

fragments in plasmids pSalAR_

gfp

or pSalAR_

lux

were inserted between salA

and salR

(Fig. 2). The selected transformants were able to grow on

salicylate and also expressed GFP or bioluminescence

due to restored salA

expression, and were designated

ADPWH_

gfp

and ADPWH_

lux

, for GFP- and lux-

expressing strains respectively.

To confirm GFP and luxCDABE

integration to the chro-

mosome of Acinetobacter

sp. ADP1, eight colonies were

randomly chosen for each strain and PCR reactions

were performed using a chromosomal flanking primerand an internal GFP or luxCDABE

construct primer. Spe-

cifically, the chromosomal flanking primer salAR_rev_out

was used in conjunction with either salAR_fwd (GFP

transformants) or luxE_fwd (

luxCDABE

transformants)

(Fig. 2 and Table 2). The presence of a PCR product

from these reactions presumptively indicated a chromo-

somal integration for the constructs, which was subse-

quently confirmed by sequencing the PCR products to

demonstrate the chromosomal/construct junction (data

not shown).

These data indicated the ease with which naked

foreign DNA fragments could be inserted into the chro-

mosome of Acinetobacter

sp. ADP1 by homologous

recombination events. The transfer frequency is depen-

dent on the length of homologous DNA present in the

construct and non-homologous insert length (de Vries

and Wackernagel, 2002). In this study, the transfer effi-

ciency was approximately 10

-

4

to insert GFP (about

900 bp) and 10

-

6

for luxCDABE

(about 5800 bp) transfor-

mants, highlighting a lower efficiency for larger marker

gene constructs.

8/14/2019 2005 EM

3/10

Acinetobacter-

based salicylate biosensors

1341

2005 Society for Applied Microbiology and Blackwell Publishing Ltd, Environmental Microbiology

, 7

, 13391348

Fig. 1.

Construction of plasmids pSalAR_

lux

and pSalAR_

gfp

.AC. Schematic diagram of the creation of the fused salAR

fragment harbouring Eco

RI and Bam

HI sites by overlap extension PCR.D and E. Creation of pSalAR_BE by insertion of salAR

fragment into pGEM-T.

F. Generation of pSalAR_

lux

by introducing luxCDABE into the EcoRI site of pSalAR_BE.G. Generation of pSalAR_gfpby introducing the GFP fragment into the EcoRI site of pSalAR_BE.Note the maps are not to scale.

EcoR1/BamH1

EcoR1/BamH1

EcoR1/BamH1

EcoR1/BamH1

EcoR1/BamH1

A A

salA Partial salR Acinetobacter

genomic DNA

salA_fwd_out

salA_fwd_out

salAR_rev

salAR_revsalAR_BE_rev

salAR_BE_fwd

A

B

C

D E

F G

luxCDABE

from pSB417 gfpfrompRMJ2

Notl

Notl

PstlPstl

SallSall

Ndel

Ndel

Sacl

Sacl

salA

EcoRI

BamHI

partial salR

pSalAR_BE

5049 bpAmp

Notl

Notl

PstlSall

Sall

Ndel

Sacl

salA

EcoRI

EcoRl

Xbal

BamHl

BamHl

partial salR

pSalAR_gfp

5949 bp

Amp

promotless GFP

Notl

PstlSall

Sall luxE

luxB

luxA

luxC

luxD

Pstl

Ndel

Sacl

salA

EcoRl

EcoRl

BamHl

partial salR

pSalAR_lux

10891 bp

Amp

pGEM-T

3000 bp

Amp

8/14/2019 2005 EM

4/10

1342 W. E. Huanget al.

2005 Society for Applied Microbiology and Blackwell Publishing Ltd, Environmental Microbiology, 7, 13391348

Kinetics of salicylate induction for ADPWH_gfp and

ADPWH_lux

Acinetobacterstrain ADPWH_luxgrowth curve data indi-cated that lux expression was not induced in standard

LuriaBertani (LB) growth media (Fig. 3A), but strong

induction of luminescence was observed within the first

few minutes of subculturing to LB containing 100 mM sal-

icylate. Salicylate-induced lux expression peaked at 3 h

during mid-exponential growth (Fig. 3B) and subsequently

declined after 4 h of growth, demonstrating turnover of the

lux protein and reduced salA induction as salicylate was

degraded by the parent strain. In contrast, salicylate-

induced GFP expression continued throughout the growth

curve in LB containing 100 mM salicylate and peaked at

24 h (Fig. 3D), indicating a less sensitive response for the

GFP variant, more than likely associated with the require-

ments for GFP maturation and long half-life once the

protein is formed (Tsien, 1998; Errampalli et al., 1999).

Uninduced controls for strain ADPWH_gfp exhibited a

small amount of background GFP expression (approxi-

mately one-third of the induced cultures; Fig. 3C), sug-

gesting again that the long half-life of GFP allows some

of the protein to accumulate in the cell via background

uninduced expression of salA. The rapid and sensitive

response of ADPWH_luxsuggests it is suitable as a real-

time salicylate biosensor through whole-cell lumines-

cence assay. In contrast, the GFP variant is better suited

to in situmicroscopic visualization of salicylate presence

due to signal accumulation via longer turnover times of

the GFP protein. Alternatively, more sensitive responses

for salicylate-induced GFP expression and whole-cell

imaging could be obtained by replacing the stable GFP

with shorter half-life variants (Andersen et al., 1998).

Salicylate concentration andsalA induction relationship

forAcinetobacter sp. ADPWH_lux and ADPWH_gfp

Salicylate concentration and salA expression relation-

ships were derived for both lux- and GFP-based Acineto-

bacter biosensors (Fig. 4). In general, ADPWH_lux

exhibited a linear increase in lux expression for concen-

trations of salicylate between 1 mM and 100 mM. Above

100 mM salicylate the salA promoter response was satu-

rated and no concomitant increase in lux expression

occurred. In contrast, accumulation of GFP through back-

ground expression for ADPWH_gfpcaused little dynamic

response of GFP induction between 1 mM and 10 mM sal-

icylate, with concentrations between 10 mM and 100 mM

Acinetobacter sp.ADPW67

Acinetobacter sp.ADPWH_gfpor

ADPWH_lux

salAKm

ClaI

Whole salR

salAGFP orluxCDABE

EcoRI

Partial salR

BamHIEcoRI

pSalAR_gfpor

pSalAR_lux

salAGFP orluxCDABE

EcoRI

whole salR

BamHIEcoRI

salAR_rev_outluxE_fwdsalAR_fwd

Plasmid Chromosome

Fig. 2. Schematic representation of the inte-gration of salARcarrying promoterless GFP orluxCDABE into the chromosome of Acineto-bactersp. ADPW67. SalA fragments from

pSalAR_gfpor pSalAR_luxrestored the dis-rupted salA gene in ADPW67 by homologousrecombination with the kanamycin-disruptedsalA copy in the parent chromosome.

8/14/2019 2005 EM

5/10

Acinetobacter-based salicylate biosensors 1343


causing an increase in expression of GFP (Fig. 4), rein-

forcing the conclusion that the lux-based sensor was the

more sensitive strain for determining salicylate concentra-

tion in the range of 1100 mM.

SalA expression specificity for salicylate and its analogues

The induction of bioluminescence in Acinetobacter sp.

strains ADPWH_lux and ADPWH_gfp was assessed

against salicylate and five structural analogues [4-hydrox-

ybenzoic acid (4HBA); 3-hydroxybenzoic acid (3HBA);

benzoate; catechol and acetylsalicylic acid (aspirin)] to

test the specificity of salA induction (Fig. 5). The

responses for both strains were identical, but for brevity,only these data for ADPWH_luxare discussed after a 2 h

induction.

For ADPWH_lux, inducer concentrations in the range of

50 pM to 50 mM were tested, a range that was found not

to affect the growth of the strains (W.E. Huang, unpubl.

obs.). Specifically, low levels of induction were found to

occur at 0.5 mM salicylate, with a threefo ld in crease in

expression being observed at 5 mM, reinforcing the lower

range of operational sensitivity of around 1 mM, as

observed above. Increasing the concentrations logarithmi-

cally for all analogues indicated strong induction only in

the presence of salicylate up to 500 mM, and a subse-quent decrease in response between 500 mM and 5 mM

(Fig. 5). However, for the analogues two exceptions to this

occurred. Acetylsalicyclic acid (aspirin) induced salA

expression at a level approximately one-third of that

observed for salicylate induction, and occurred between

inducer concentrations of 5 mM and 5 mM (Fig. 5). Sec-

ond, benzoate and catechol also induced biolumines-

cence, but only at a concentration of 5 mM (Fig. 5). For

catechol, this result is at odds with the NAH7 system,

where an absolute requirement for a carboxyl group exists

(Cebolla et al., 1997).

Significantly, 4HBA and 3HBA did not induce biolumi-

nescence even though they are positional isomers of sal-

icylic acid. Despite the structural similarities between

salicylate, 3HBA and 4HBA, their degradation are regu-

lated by different genes in Acinetobactersp. ADP1 (Collier

Fig. 3. Bioluminescence and green fluorescent protein (GFP) expres-sion in Acinetobactersp. ADPWH_luxand ADPWH_gfpinduced by100 mM salicylate in LB. Bioluminescence and OD600 of Acinetobacter

ADPWH_luxin the absence (A) and in the presence (B) of salicylate.Green fluorescent protein expression and OD600 of AcinetobacterADPWH_gfpin the absence (C) and in the presence (D) of salicylate.Error bars represent one standard deviation of the mean (n= 3).

B

0.1

1

0 2 4 6 8 100

5000

10000

15000

20000

25000

0.1

1

0 2 4 6 8 100

5000

10000

15000

20000

25000

A

OD600nm

(--)

Luminescencece

ll1

(AU)

GFPflu

orescencecell1

(AU)

ADPWH_lux

ADPWH_lux

+

salicylate

0.1

1

0 6 12 18 240

250

500

750

1000

ADPWH_gfpC

0.1

1

0 6 12 18 240

250

500

750

1000

ADPWH_gfp

+

salicylate

D

Time (h)

-

-

-

-

Fig. 4. Bioluminescence and GFP expression in Acinetobactersp.ADPWH_luxand ADPWH_gfpinduced by a range of salicylate con-centrations in LB after 2 h of induction. Error bars represent one

standard deviation of the mean (n= 3).

0

5000

10000

15000

20000

25000

30000

35000

40000

1 10 100 1000

0

300

600

900

Lumin

escencecell1

(AU)

-

-

GFPfluo

rescencecell1

(AU)

-

-

Salicylate concentration (M)

8/14/2019 2005 EM

6/10



et al., 1998; Jones et al., 1999; Brzostowicz et al., 2003;

Parke and Ornston, 2003). Hence, the salicylate operon

should not be induced by 3HBA and 4HBA, and these

data confirm this observation. It remains unclear as to the

cause for the induction by aspirin, other than the presence

of a carboxyl group, but this did not cause induction from

many of the other analogue compounds containing it (e.g.

4HBA or 3HBA). However, true induction by acetylsalicy-

clic acid was observed for the NAH7 system (Cebolla

et al., 1997) where intermediate metabolite production

(e.g. salicylate) was blocked, suggesting that some com-

mon mechanisms may be acting with regard to this com-

pound, despite different salicylate pathways. However, for

future uses of the sensors, the presence of such com-

pounds at the required concentration in samples where

salicylate detection would be performed would more than

likely be negligible, and hence should not interfere with

the specificity of the developed sensors.

Applications during naphthalene degradation to

demonstrate intermediate metabolite production

As salicylate is a central metabolite of naphthalene deg-

radation by Pseudonomas putida NCIB9816 an experi-

ment was performed to detect salicylate by ADPWH_lux

within a naphthalene-degrading culture of P. putida

NCIB9816 (Yen and Serdar, 1988). Jones and colleagues

(2000) indicated that the parent strain Acinetobactersp.

ADP1 cannot utilize naphthalene and to confirm this naph-

thalene concentrations between 1 and 200 mM were

exposed to ADPWH_luxand no induction of biolumines-

cence was observed (data not shown).

For P. putida NCIB9816 cultures growing on naphtha-

lene, both high-performance liquid chromatography

(HPLC) and ADPWH_luxassays indicated that salicylate

was produced during naphthalene degradation (Fig. 6).

Over a 48 h period, the bioluminescence of ADPWH_lux

whole-cell assays increased, with salicylate being

0

500

1000

1500

2000

2500

3000

3500

4000

0.05 0.5 5 50 500 5000 50000

Analogue concentration (mM)

Luminescencecell1

(AU)

Salicylic acid 4-HBA 3-HBA Benzoate Catechol

Acetylsalicylic

acidO

C ONa

O

C

C

O

OCH3

OH

O

C OH

OH

O

CO

C ONaOH

OH

OH

OH

OH

Fig. 5. Bioluminescence expression in Acine-tobactersp. ADPWH_luxinduced by salicylateand five structurally similar analogues. Lumi-

nescence measurements were taken after 2 hof induction in LB containing salicylate or itsanalogues at concentrations ranging between50 pM and 50 mM. Error bars represent onestandard deviation of the mean (n= 3).

Fig. 6. Acinetobactersp. ADPWH_luxdetection of salicylate in cell-free extracts during Pseudomonas putidaNCIB9816 degradation of

naphthalene. Filled symbols represent the luminescence per cell (AU)produced after a 90 min incubation of the cell-free extracts withADPWH_lux, and represented visually in the composite image. Theopen symbols represent the absolute concentration of salicylate asmeasured by HPLC. Error bars represent one standard deviation of

the mean (n= 2).

0.1

1

10

100

1000

10000

0 20 40 60

1

10

100

1000

10000

Time (h)

SalicylateconcentrationbyHPLC

(mM)

-

-

ADPWH

_luxluminescencecell1

-

-

Control 0h 2h 24h 48h

8/14/2019 2005 EM

7/10



detected in the water phase by ADPWH_lux within 4 h.

As we concentrated on salicylate induction of the gene

fusions, and our previous data indicated napthalene deg-

radation intermediates such as catechol did not induce

the sensor unless at unrealistically high concentrations,

we specifically measured only the key inducer, salicylate,

in the degrading cultures by HPLC. While this may not fully

map the degradation kinetics of naphthalene and its inter-

mediates, we still observed discrepancies between the

sensor induction and those measures by HPLC. Specifi-

cally, the HPLC data indicated only appreciable salicylate

being formed after 20 h, indicating that the whole-cell

assay was more sensitive to the production of salicylate

than the HPLC method during the early stages of naph-

thalene degradation. Further, these data suggested an

accumulation of salicylate in the water phase over 48 h,

indicating that the salicylate production pathway from

naphthalene is probably acting faster than the salicylate

breakdown pathway (Yen and Serdar, 1988). As salicylate

is an intermediate metabolite for many poly-ring hydrocar-

bon degradation pathways (Yen and Serdar, 1988; Har-wood and Parales, 1996; Johri et al., 1999), these data

suggest that rapid and specific salicylate detection using

biosensors such as ADPWH_luxcould be used as a good

indicator of the activity of such degradation pathways in

complex degrading systems. However, as with all gene

fusion biosensors, rigorous calibration of the sensors

response to more complex pollutant mixtures and inter-

mediates is required before deploying such reagents to

complex in situsensing modes.

Experimental procedures

Bacterial strains, plasmids and culture media

The bacterial strains and plasmids used in this study are

listed in Table 1. Unless otherwise stated all chemicals were

Analar grade reagents. LuriaBertani medium (Oxoid) was

used for general cultivation of bacteria, induction and ana-

logue studies. However, minimal medium (MM) was used for

the selection of transformants. Minimal medium was pre-pared containing the following (l-1): Na2HPO4: 3.0 g; KH2PO4:

3.0 g; NH4Cl: 1.0 g; MgSO47H2O: 0.5 g; saturated CaCl2 and

FeSO4 solution: 35 drops. Salicylate agar (SAA) medium

was prepared using 2.5 mM salicylate (sodium salt) as a sole

carbon source and solidified within 1.4% noble agar contain-

ing MM. Where appropriate, ampicillin and kanamycin were

used at a final concentration of 100 and 50 mg ml-1,

respectively, for Escherichia coliand kanamycin at 10 mg ml-1

for Acinetobactersp.

General PCR amplification reagents

Primers were purchased from MWG Biotech and are listed

in Table 2. Polymerase chain reaction amplifications werecarried out in 50 ml reactions containing 1 reaction buffer,

200 mM of each deoxynucleoside triphosphate (Bioline),

0.5 mM of each primer, 12 unit Taq DNA polymerase

(Sigma).

Overlap extension PCR to createsalAR fusions with

required restriction sites

EcoRI and BamHI restriction sites were created between

salA and partial salR fragments by overlap extension PCR

Table 1. Bacterial strains and plasmids used in this study.

Bacterial strains Description Reference

AcinetobacterADP1(BD413) Wild type Juni and Janik (1969)

AcinetobacterADPW67 SalA::Kmr, Km gene is inserted into ClaI site of salA Jones et al. (2000)

AcinetobacterADPWH_lux luxCDABE (~5.8 kb) gene inserted between salA and salR,obtained by transformation of ADPW67 with pSalAR_lux

This study

AcinetobacterADPWH_gfp GFP gene inserted between salA and salR, obtained bytransformation of ADPW67 with pSalAR_gfp

This study

E. coliJM109 High-efficiency competent cells Promega

Pseudonomas putidaNCIB9816 Wild type Cane and Williams (1982)

Plasmids

pGEM-T Ampr, T7 and SP6 promoters, lacZ, vector Promega

pRMJ2 Source plasmid for GFP gene. Promoterless GFP gene (~900 bp)was cloned in pRMJ1 and replaced sacB

Jones and Williams (2003)

pSB417 luxCDABEsource plasmid containing luxCDABE fromPhotorhabdus (Xenorhabdus) luminescensATCC2999

Winson et al. (1998)

pSalAR_BE Whole salA and partial salR fragment cloned into pGEM-T. EcoRIand BamHI sites located between salA and salR

This study

pSalAR_lux luxCDABE (5846 bp) inserted into EcoRI site created betweensalA and salR of pSalAR_BE

This study

pSalAR_gfp GFP inserted into EcoRI site created between salA and salRofpSalAR_BE

This study

8/14/2019 2005 EM

8/10



(Fig. 1) using a small amount of Acinetobacter sp. ADP1

bacterial colony (0.10.25 ml) as the template in the PCR

reaction. Polymerase chain reaction amplifications were per-

formed with initial denaturation at 95C for 5 min, followed by

35 cycles of 94C for 1 min, 50C for 1 min and 72C for

2 min, and a final additional 72C for 10 min extension. SalA

and partial salRfragments were separately amplified by col-

ony PCR using the primer pairs salA_fwd_out

salAR_BE_rev and salAR_BE_fwdsalAR_rev (Table 2).

Polymerase chain reaction products were isolated from a 1%

agarose gel and purified according to the manufacturersinstructions using a QIAquick gel extraction kit (Qiagen). To

fuse salA and salR fragments, a PCR amplification (using

the same reaction conditions above) was carried out contain-

ing 1 ml of 1:100 diluted salA (1314 bp) and partial salR

(735 bp) fragments and primers salA_fwd_out and

salAR_rev.

Plasmid construction

Standard molecular techniques were performed as previ-

ously described (Sambrook et al., 1989). Fused salARfrag-

ments containing EcoRI and BamHI restriction sites were

ligated into pGEM-T (Promega), and subsequently trans-formed into E. coli JM109. After transformation, cells were

selected on LB containing 100 mg ml-1 ampicillin and 2 mM

salicylate. Plasmids containing salAR insertions displayed

the salA phenotype, which encodes salicylate hydroxylase,

turning salicylate into catechol, generating brown halos

around the colonies. These colonies were subsequently

selected and the salA/salR fusion containing plasmids des-

ignated as pSalAR_BE.

Green fluorescent protein and luxCDABEfragments were

excised from pRMJ2 (generously donated by Dr Rheinallt

M. Jones) and pSB417 (generously donated by Dr Mike

Winson) by EcoRI digestion and subsequently gel purified

(Qiagen). The digested GFP and luxCDABE fragments

were ligated into pSalAR_BE as an EcoR1 fragment.

Ligated products were transformed into E. coli JM109 and

plated onto LB containing 100 mg ml-1 ampicillin and 2 mM

salicylate. Colonies expressing salicylate hydroxylase

together with GFP or lux were chosen and their plasmids

designated as pSalAR_gfp and pSalAR_lux respectively.

To confirm the construction, plasmids pSalAR_BE,

pSalAR_gfp and pSalAR_lux were purified (Qiagen), and

were sequenced around the sites of insertion by SP6/T7

promoter primers and salAR_fwd/salAR_rev primers

(Table 2).

Chromosomal integration of lux and GFP gene of

Acinetobacter sp.

Preparation of competent cells of Acinetobacter sp. ADP1

was performed as described previously (Palmen et al., 1993).

Acinetobactersp. strain ADPW67 served as the recipient and

was grown in 5 ml of LB (containing 10 mg ml-1 kanamycin)

at 30C overnight, with 200 r.p.m. shaking. Two hundred

microlitres of culture were then diluted into 5 ml of fresh LB

medium and incubated for 2 h to make the cells competent.

For transformation, 5 ml of the plasmid pSalAR_gfp orpSalAR_lux was added to 0.5 ml of competent cells (109

cells ml-1) and the cells were incubated for 2 h. The cultures

were subsequently plated onto SAA medium for selection of

transformants which has restored the salicylate degradation

function.

Polymerase chain reaction to testAcinetobacter

sp. mutants

To confirm the integration of GFP gene and luxCDABEgenes

to the chromosome of Acinetobactersp. ADP1, PCR ampli-

fications using salAR_fwd and salAR_rev_out for

ADPWH_gfp and luxE_for and salAR_rev_out (Table 2) forADPWH_lux were carried out (Fig. 2). Polymerase chain

reaction amplifications were performed with initial denatur-

ation at 95C for 5 min, following 35 cycles of 95C for 1 min,

60C for 1 min and 72C for 2 min 30 s, and then additional

72C for 10 min to finish extension. After amplification, PCR

products were run on a 1% agarose gel, band purified

(Qiagen) and sequenced.

Kinetic analysis GFP fluorescence and bioluminescence

induced by salicylate

Green fluorescent protein (GFP) fluorescence, biolumines-

cence and OD600 of Acinetobacter sp. strains ADPWH_gfp

and ADPWH_luxwere measured using a Synergy HT Multi-

Detection Microplate Reader (Bio-Tek). For growth curve,

induction and analogue studies, overnight cultures for each

strain were diluted in LB to 1:20 and incubated at 37C for

2 h with 150 r.p.m. shaking. Subsequently, triplicate cultures

of ADPWH_gfp or ADPWH_lux were initiated containing a

range of concentrations of salicylate or its analogues, at 37C

with 150 r.p.m. shaking. At specific time points, 200 ml of each

culture was placed in a 96-well microplate and samples were

immediately measured. Relative fluorescence intensity of

Table 2. Primers used in this study.

Primers Sequence (5 3) Note

salA_fwd_out CTCAAAGGAAATGAGTCGTGGGTAsalAR_BE_fwd CGCTAAGAATTCGGATCCAGAGTGTTTTGA Created EcoRI and BamHI sites

salAR_BE_rev TCAAAACACTCTGGATCCGAATTCTTAGCG Created EcoRI and BamHI sites

salAR_fwd CAGGACTGGAGCGAAAGCTGsalAR_rev GACCTGAGTATGCCCGGTAG

luxE_fwd TGGTTTACCAGTAGCGGCACG Internal to luxEgene

salAR_rev_out GCCCTCAGGTAATGGCGACTA Chromosomal flanking primer

8/14/2019 2005 EM

9/10



GFP and bioluminescence was obtained by dividing by the

OD600, to allow normalization. For GFP fluorescence mea-

surements, the Synergy HT Multi-Detection Microplate

Reader was set at an excitation wavelength of 480 nm and

an emission detection at 520 nm.

Detection of analogues of salicylic acid

To test the specificity of the biosensors, Acinetobacter sp.strains ADPWH_gfpand ADPWH_luxwere used to detect a

series of concentrations of five analogues of salicylic acid.

On the basis of their chemical structures and properties, 4-

hydroxybenzoic acid, 3-hydroxybenzoic acid, benzoate,

catechol and acetylsalicylic acid (aspirin) were chosen for

testing.

Nucleotide sequencing and sequence analysis

All DNA samples (PCR products or plasmids) were

sequenced using dye terminator sequencing on an Applied

Biosystems 3730 DNA analyser according to the manufac-

turers instructions. DNA sequence analysis was carried outusing BLASTN for confirmation of sequence homology and

these data were aligned and edited using BIOEDIT to confirm

correct insertions (Tom Hall, Department of Microbiology,

North Carolina State University).

Acinetobacter sp.ADPWH_lux and HPLC determination

of salicylate production in naphthalene-degrading

samples

To test the utility of the constructed biosensor in complex-

degrading scenarios, the kinetics of salicylate production in

the water phase of extracts from naphthalene-degrading cul-

tures was tested. Pseudomonas putida NCIB9816 (kindlyprovided by Professor Peter Williams) was inoculated into

replicate 30 ml universal tubes containing 5 ml of MM

medium and 1 mg of naphthalene and incubated at 30C with

150 r.p.m. shaking. At discreet intervals over 48 h, 100 ml of

each culture was removed and clarified by passing through

a 0.2 mm filter.

Acinetobactersp. ADPWH_luxcells were diluted in fresh

LB (1:20) after overnight growth at 37C with 150 r.p.m.

shaking. The cells were then incubated for 23 h before

performing the detection assays, with a final bacterial den-

sity in all cases of 109 ml-1. Fifty microlitres of Acinetobacter

sp. ADPWH_luxwere added to 50 ml of the clarified extract

obtained above, and the amount of salicylate in the water

phase was measured by the relative increase in biolumi-

nescence, versus salicylate free controls, after 90 min at

37C.

In tandem, absolute salicylate concentrations were moni-

tored by HPLC. Cell-free supernatants obtained above were

analysed on a Dionex liquid chromatograph (Camberley, UK)

equipped with a diode array detector with a Phenomenex C18

column (250 mm 3.25 mm, par ticle diameter 5 mm) and

appropriate standards for salicylate-specific calibration. An

isocratic program was applied with a mobile phase containing

30% acetonitrile and 2% orthophosphate.

Acknowledgements

We thank Dr Michael Winson for providing pSB417 and asso-

ciated information, Professor Peter Williams and Dr Rheinallt

M. Jones for providing plasmid pRMJ2, Acinetobacter sp.

ADPW67 and P. putidaNCIB9816.

References

Andersen, J.B., Sternberg, C., Poulsen, L.K., Bjrn, S.P.,

Givskov, M., and Molin, S. (1998) New unstable variants

of green fluorescent protein for studies of transient gene

expression in bacteria. Appl Environ Microbiol 64: 2240

2246.

Applegate, B.M., Kehrmeyer, S.R., and Sayler, G.S. (1998)

A chromosomally based tod-luxCDABEwhole-cell reporter

for benzene, toluene, ethybenzene, and xylene (BTEX)

sensing. Appl Environ Microbiol64: 27302735.

Belkin, S. (2003) Microbial whole-cell sensing systems of

environmental pollutants. Curr Opin Microbiol 6: 206

212.

Brzostowicz, P.C., Reams, A.B., Clark, T.J., and Neidle, E.L.

(2003) Transcriptional cross-regulation of the catechol andprotocatechuate branches of the beta-ketoadipate pathway

contributes to carbon source-dependent expression of the

Acinetobacter sp. strain ADP1 pobA gene. Appl Environ

Microbiol69: 15981606.

Cane, P.A., and Williams, P.A. (1982) The plasmid-coded

metabolism of naphthalene and 2-methylnaphthalene in

Pseudomonas strains phenotypic changes correlated

with structural modification of the plasmid Pww60-1. J Gen

Microbiol128: 22812290.

Cebolla, A., Sousa, C., and deLorenzo, V. (1997) Effector

specificity mutants of the transcriptional activator NahR of

naphthalene degrading Pseudomonasdefine protein sites

involved in binding of aromatic inducers. J Biol Chem272:

39863992.Chen, S.H., and Aitken, M.D. (1999) Salicylate stimulates the

degradation of high molecular weight polycyclic aromatic

hydrocarbons by Pseudomonas saccharophilaP15. Envi-

ron Sci Technol33: 435439.

Collier, L.S., Gaines, G.L., and Neidle, E.L. (1998) Regula-

tion of benzoate degradation in Acinetobacter sp. strain

ADP1 by BenM, a LysR-Type transcriptional activator. J

Bacteriol180: 24932501.

Daunert, S., Barrett, G., Feliciano, J.S., Shetty, R.S.,

Shrestha, S., and Smith-Spencer, W. (2000) Genetically

engineered whole-cell sensing systems: coupling biologi-

cal recognition with reporter genes. Chem Rev100: 2705

2738.

Delaney, T.P., Uknes, S., Vernooij, B., Friedrich, L., Wey-

mann, K., Negrotto, D., et al. (1994) A central role of

salicylic acid in plant disease resistance. Science 266:

12471250.

Dubnau, D. (1999) DNA uptake in bacteria. Ann Rev Micro-

biol53: 217244.

Errampalli, D., Leung, K., Cassidy, M.B., Kostrzynska, M.,

Blears, M., Lee, H., and Trevors, J.T. (1999) Applications

of the green fluorescent protein as a molecular marker in

environmental microorganisms. J Microbiol Methods 35:

187199.

8/14/2019 2005 EM

10/10



Gaffney, T., Friedrich, L., Vernooij, B., Negrotto, D., Nye, G.,

Uknes, S., et al. (1993) Requirement of salicylic acid for

the induction of systemic acquired resistance. Science

261: 754756.

Harwood, C.S., and Parales, R.E. (1996) The beta-ketoadi-

pate pathway and the biology of self-identity. Ann Rev


Jansson, J.K. (2003) Marker and reporter genes: illuminating

tools for environmental microbiologists. Curr Opin Micro-

biol6: 310316.

Johri, A.K., Dua, M., Singh, A., Sethunathan, N., and Legge,

R.L. (1999) Characterization and regulation of catabolic

genes. Crit Rev Microbiol25: 245273.

Jones, R.M., and Williams, P.A. (2003) Mutational analysis

of the critical bases involved in activation of the AreR-

regulated sigma(54)-dependent promoter in Acinetobacter

sp. strain ADP1. Appl Environ Microbiol69: 56275635.

Jones, R.M., Collier, L.S., Neidle, E.L., and Williams, P.A.

(1999) areABC genes determine the catabolism of aryl

esters in Acinetobactersp. strain ADP1. J Bacteriol181:

45684575.

Jones, R.M., Pagmantidis, V., and Williams, P.A. (2000) sal

genes determining the catabolism of salicylate esters are

part of a supraoperonic cluster of catabolic genes in Acine-tobactersp. strain ADP1. J Bacteriol182: 20182025.

Juni, E., and Janik, A. (1969) Transformation of Acinetobacter

calcoaceticus (Bacterium anitratum). J Bacteriol98: 281

288.

King, J.M.H., Digrazia, P.M., Applegate, B., Burlage, R.,

Sanseverino, J., Dunbar, P., et al. (1990) Rapid, sensitive

bioluminescent reporter technology for naphthalene expo-

sure and biodegradation. Science249: 778781.

Leveau, J.H.J., and Lindow, S.E. (2002) Bioreporters in

microbial ecology. Curr Opin Microbiol5: 259265.

Lippincott-Schwartz, J., and Patterson, G.H. (2003) Develop-

ment and use of fluorescent protein markers in living cells.

Science300: 8791.

Loh, K.C., and Yu, Y.G. (2000) Kinetics of carbazole degra-dation by Pseudomonas putidain presence of sodium sal-

icylate. Water Res34: 41314138.

Malamy, J., Carr, J.P., Klessig, D.F., and Raskin, I. (1990)

Salicylic acid a likely endogenous signal in the resistance

response of tobacco to viral infection. Science250: 1002

1004.

Meighen, E.A. (1994) Genetics of bacterial bioluminescence.

Ann Rev Genet28: 117139.

Moller, S., Sternberg, C., Andersen, J.B., Christensen, B.B.,

Ramos, J.L., Givskov, M., and Molin, S. (1998) In situgene

expression in mixed-culture biofilms: evidence of metabolic

interactions between community members. Appl Environ


Palmen, R., Vosman, B., Buijsman, P., Breek, C.K.D., and

Hellingwerf, K.J. (1993) Physiological characterization of

natural transformation in Acinetobacter calcoaceticus. J

Gen Microbiol139: 295305.

Parke, D., and Ornston, L.N. (2003) Hydroxycinnamate (hca)

catabolic genes from Acinetobacter sp. strain ADP1 are

repressed by HcaR and are induced by hydroxycinnamoyl-

coenzyme a thioesters. Appl Environ Microbiol69: 5398

5409.

Sambrook, J., Fritsch, E.F., and Maniatis, T. (1989) Molecu-

lar Cloning: A Laboratory Manual. Cold Spring Harbor, NY

USA: Cold Spring Harbor Laboratory.

Singer, A.C., Crowley, D.E., and Thompson, I.P. (2003) Sec-

ondary plant metabolites in phytoremediation and biotrans-

formation. Trends Biotechnol21: 123130.

Stiner, L., and Halverson, L.J. (2002) Development and char-

acterization of a green fluorescent protein-based bacterial

biosensor for bioavailable toluene and related compounds.

Appl Environ Microbiol68: 19621971.Tsien, R.Y. (1998) The green fluorescent protein. Annu Rev

Biochem67: 509544.

de Vries, J., and Wackernagel, W. (2002) Integration of for-

eign DNA during natural transformation of Acinetobacter

sp. by homology-facilitated illegitimate recombination. Proc

Natl Acad Sci USA99: 20942099.

Willardson, B.M., Wilkins, J.F., Rand, T.A., Schupp, J.M., Hill,

K.K., Keim, P., and Jackson, P.J. (1998) Development and

testing of a bacterial biosensor for toluene based environ-

mental contaminants. Appl Environ Microbiol 64: 1006

1012.

Wilson, T., and Hastings, J.W. (1998) Bioluminescence.

Annu Rev Cell Dev Biol14: 197230.

Winson, M.K., Swift, S., Hill, P.J., Sims, C.M., Griesmayr, G.,Bycroft, B.W., et al. (1998) Engineering the luxCDABE

genes from Photorhabdus luminescensto provide a biolu-

minescent reporter for constitutive and promoter probe

plasmids and mini-Tn5 constructs. FEMS Microbiol Lett

163: 193202.

Yen, K.M., and Serdar, C.M. (1988) Genetics of naphthalene

catabolism in Pseudomonads. Crit Rev Microbiol15: 247

268.

Documents

2005 EM