PCR Amplification, Cloning, Sequence Determination, and Bioinformatics

Analyses of Novel Plant GAPDH Genes from Cyperus alternifolius, Schefflera

actinophylla and Tropical Flora Endemic to Puerto Rico

Lydia E. Cortes, Dr. Michael Rubin. University of Puerto Rico at Cayey

Biographical Sketch (CV)

Lydia E. Cortes

Education and Honors:

University of Puerto Rico at CayeyBachelor degree in Natural Sciences, Concentration in BiologyActual GPA 3.90

Professional Experience:

Investigator in training RISE Program, University of Puerto Rico at Cayey

Exchange student at UMASS Boston Courses about Caribbean history and culture.

Certification on PCR University of North Carolina at Chapel Hill

Summer ResearchLeadership AllianceMiller School of Medicine, University of Miami

1

Research Plan

Specific Aims

The investigation has four principal aims:

Transform and clone Cyperus alternifolius and Schefflera actinophylla

GAPDH genes into E. Coli JM109

Purify and clone Cyperus alternifolius and Schefflera actinophylla GAPDH

genes

Sequence determination of clones Cyperus alternifolius and Schefflera

actinophylla GAPDH genes

Bioinformatics analysis of Cyperus alternifolius and Schefflera actinophylla

GAPDH genes

Background and Significance

GAPDH, or glyceraldehyde-3-phosphate dehydrogenase, is a protein coding gene.

The product of this gene catalyzes an energy-yielding step in carbohydrate

metabolism, catalyzing the sixth step of glycolysis and thus serving to break down

glucose for energy and carbon molecules.In addition, GAPDH has recently been

implicated with transcription activation, initiation of apoptosis, and Endoplasmic

Reticulum to Golgi vesicle shuttling.The enzyme of GAPDH exists as a tetramer of

identical chains, each subunit having an active site. The reaction catalyzed by

GAPDH is:

Glyceraldehyde-3-phosphate+ NAD+ + Pi —>1,3-bisphosphoglycerate+ NADH +H+

The GAPDH gene has been found and sequenced in various organisms such as

humans and Arabidopsis Thaliana; but other organisms have not been sequenced for

this gene. The purpose of this investigation is to sequence the GAPDH gene from

various plants endemic to Puerto Rico. The hypothesis is that the two plants studied in

this investigation will have some segments with a similar sequence, but other

sequences will be different.

2

GAPDH is one of many genes called housekeeping genes. These genes are really

important for the scientists since they code for proteins that are expressed at a

relatively constant rate.Housekeeping genes provides a reference against which to

compare a protein (or RNA) of interest. Lately, research has proven that the proteins

coded from GAPDH are not expressed constantly, so some scientists do not consider

GAPDH as a housekeeping gene anymore.

The role of GAPDH in cell death or apoptosis is the principal factor studied from

this gene. According to past research, GAPDH appears to contribute to cell death

triggered by a nitric oxidecascade; this is by functioning in the nucleus to stimulate

the acetyltransferase activity of p300/CBP, leading to the activation of p53 and

proapoptotic gene expression. Burke et al.(1996) postulated that the diseases

characterized by the presence of an expanded CAG repeat may share a common

metabolic pathogenesis involving GAPDH as a functional component. Observations

made by Myers et al. (2002), Li et al. (2004), and other scientist raised the

possibilities that the GAPDH genes are Alzheimer disease risk factors, a hypothesis

that is consistent with the role of GAPDH in neuronal apoptosis. GAPDH gene has

been related with other diseases such as Cancer and Huntington disease.

Sequencing and studies of the GAPDH gene have been developing for a long time.

Li et al. (2004) located a GAPDHpseudogene on chromosome 12q of the human.

Arabidopsis thaliana is a plant studied extensively and used as the control for various

research. A. thaliana’s genome has been sequence completely, including the GAPDH

gene. The sequence of A. thaliana’s GAPDH gene is presented in figure 1.A. thaliana

has eight GAPDH genes, some of them are: GAPC (Cytosolic), GAPCP ( Plastid),

GAPA (Chloroplast), GAPB (Chloroplast) and GAPN (Cytosolic,

nonphosphorylating). In table 1 is seen the reaction that catalyzes each enzyme.Even

when a lot of information is available about the GAPDH gene of various organisms,

several other organisms have not been sequenced for the gene. For example, most of

the plants native from Puerto Rico have not been sequenced for the GAPDH gene.

Cyperus alternifolius and Schefflera actinophylla are the two species of plants

studied in this investigation. Cyperus alternifolius (umbrella papyrus or umbrella

palm) is a grass-like plant in the very large genus Cyperus of the sedge family,

3

Cyperaceae. The sequences for eight genes of Cyperus alternifolius are present in

GenBank, but none of them is the GAPDH gene. Schefflera actinophylla (Brassaia

actinophylla) is a tree in the Araliaceae family, and only five genes of this plant have

been sequenced. The purpose of this investigation is to sequence the GAPDH gene

from the plants Cyperus alternifolius and Schefflera actinophylla.

With a wider knowledge about GAPDH variants, it will be possible to study and

learn more about the gene. It could be possible to find a way for the GAPDH to still

be functional as a housekeeping gene. By sequencing the gene it will be possible too

to study its sequence and mutations, information that could be used in future studies.

Research Design and Methods

Transform and cloneCyperus alternifolius andSchefflera actinophylla GAPDH

genes into E. Coli JM109

For transformation, we pipette 5 microliters of DNA from Cyperus alternifolius

and Schefflera actinophylla in a microcentrifuge tube. Then added 50 microliters of

JM 109 E. Coli competent bacteria (prepared before) to the tubes. Incubate for 30

minutes in ice. Heated each microcentrifuge tube for 45 seconds at 37 °C. Incubated

in ice for two minutes. Added 950 microliters of SOC media to each tube. Incubated

for 45 minutes at 37°C, while shaking. Plated 5 microliters of cells in LB Amp agar

plates. Took the rest 900 microliters, centrifuged and took out the supernatant. Pipette

50 microliters of media and resuspended. Plated the cells. Incubate at 37 °C

overnight.

Before the following step, transformed bacterial colonies will need to be grown in

liquid culture minipreps. First, we prepared 25 ml of LB Amp broth. Using sterile

technique, pipette 18 ml of LB Amp broth into one culture tube. Used a sterile pipette

tip to pick a single colony from the LB Amp IPTG plate containing the plated bacteria

4

transformed with the plant gene ligation reaction. Placed the miniprep cultures to

grow overnight at 37°C in a shaking incubator. Prepared a 1% agarose gel and

electrophoresis running buffer to analyze the plasmid miniprep restriction enzyme

digestion. Counted the number of bacterial colonies that grew on the LB Amp IPTG

agar plates.

Purify and clone Cyperus alternifolius and Schefflera actinophyllaGAPDH genes

Added 100 ml of 95–100% ethanol to the Aurum wash solution and mix well.

Transfered 1.5 ml of each miniprep culture into one of the appropriately labeled

microcentrifuge tubes by pipetting or decanting. Centrifuged the microcentrifuge

tubes for 1 minute at top speed (>12,000 x g) to pellet the bacteria. Located the

bacterial pellet and removed the supernatant from each tube using a 1,000 µl pipet or

a vacuum source, avoiding the pellet. Resuspended the bacterial pellet in each tube in

250 µl of resuspension solution by pipetting up and down or vortexing. Pipette 250 µl

of lysis solution into each tube andl mixed by gently inverting 6–8 times. Within 5

minutes of adding lysis solution, pipette 350 µl of neutralization solution into each

tube and mixed by gently inverting 6–8 times. Centrifuged the tubes for 5 minutes at

top speed in the microcentrifuge. Decanted or pipette supernatant from the centrifuged

tubes onto the appropriately labeled column. Centrifuged the columns in the

microcentrifuge for 1minute at top speed. Discarded the flow-though from the

collection tube and replaced the column in the collection tube. Pipette 750 µl of wash

solution onto each column. Centrifuged columns in the capless collection tubes in the

microcentrifuge for 1 minute at top speed. Discarded the flow-though from the

collection tube. Replaced columns into collection tubes and centrifuged for an

additional 1 minute to dry out the column. Transfered each column to the

5

appropriately labeled capped "miniprep DNA" microcentrifuge tube and pipette 100

µl of elution solution onto the column. Let the elution solution be absorbed into the

column for 1–2 minutes. Placed the column in the microcentrifuge tube into the

centrifuge. Centrifuged the columns for 2 minutes. Discarded the columns and caped

the tubes containing the eluted sample. Stored the miniprep plasmid DNA.

For restriction digestion analysis, first prepared a 10x master mix for Bgl II

restriction digestion reactions. Prepared digestion reactions by combining 2 µl of the

Bgl II master mix and 10 µl of each plasmid DNA in the appropriately labeled

microcentrifuge tubes. Added too 6 ul of water and 2 ul of Bgl II enzyme. Mixed the

tube components and spin briefly in a microcentrifuge to collect the contents at the

bottom of the tube. Incubated the reactions at 37°C for 1 hour.

For electrophoresis, added 1 µl of 5x loading dye to each sample. Put a 1%

agarose gel in the electrophoresis chamber and added electrophoresis running buffer

to just cover the gel. Loaded 20 µl of each sample and 10 µl of the 500 bp molecular

weight ruler. Connected the electrophoresis chamber to the power supply and turned

on the power. Ran the gel at 70 V for 30 minutes.

Sequence determination of clones Cyperus alternifolius andSchefflera

actinophyllaGAPDH genes

Prepared four sequencing samples for each of your two plasmid minipreps.

Combined each plasmid miniprep with each of the four different sequencing primers

— two forward primers and two reverse primers — to ensure complete coverage of

the insert. In the microcentrifuge tubes, combined 10 μl of the miniprep DNA with 1

μl of sequencing primer. Pipette up and down to mix. Pipette 10 μl of the

6

plasmid/primer mixtures into the assigned wells of the 96-well plate. Sealed the plate

using the sealing film. Mailed the plate to the sequencing facility.

Bioinformatics analysis of Cyperusalternifolius and Scheffleraactinophylla

GAPDH genes

Used iFinch for Educators and FinchTV to look at the quality of individual reads

and the class’ data as a whole set. Then, use BLAST (blastn) for a preliminary

determination of which GAPDH gene was cloned. Assembled sequences into a contig

using CAP3, and corrected sequencing errors with FinchTV. Verified which GAPDH

gene was cloned using BLAST (blastn) on the contig sequence against the GenBank

genomic sequence database. Annotated gene by predicting gene structure (i.e.

exon/intron boundaries) and mRNA sequence using BLAST (blastn) against the

GenBank mRNA sequence database. Translated the predicted mRNA sequence into

protein sequence and verified it with BLAST(blastp).

Previous Results

Luis Lopez and Dr. Michael Rubin began this investigation by extracting the nucleic

acid, doing PCR and electrophoresis of the GAPDH gene from Cyperus alternifolius

and Schefflera actinophylla. The results obtained from this investigation are presented

in figures 2, 3 and 4. In figure 2 can be seen the isolated genomic DNA and initial

PCR of Arabidopsis Thaliana, Cyperus alternifolius and Schefflera actinophylla.

According to this results, the GAPDH gene of these three plants were sequenced. In

figure 3 is seen the gel of the nested PCR. According to these results, both the purified

and unpurified sequences of GAPDH gene from Arabidopsis Thaliana, Cyperus

alternifolius and Schefflera actinophylla were obtained. Figure 4 presents the cloning

7

gel. In this gel is seen both the vector and the DNA of Arabidopsis Thaliana, Cyperus

alternifolius and Schefflera actinophylla’s GAPDH gene.

Results

During the transformation protocol, the E.Coli cells transformed were count. The

way of knowing which cells were transformed is by growing the cells in an

Ampicilline solution. Only the cells transformed with the GAPDH gene were resistant

to Ampicilline, this is because the E. Coli cells do not have the sequence for

resistance, but the GAPDH gene inserted does. The results obtained were similar to

the expected, this is because in the plates grown with a concentration of 900 ul was

seen more transformed cells than the ones grown in a 50 ul concentration. This

difference was more that a 400 fold. The results are seen in Table 2.

In figure 5 is seen the cloning gel. The gel broke, but it was possible to obtained

results. According to the gel, the sequences of the GAPDH gene from Cyperus

alternifolius and Schefflera actinophylla were obtained. In figure 6 is seen the cloning

gel that was performed again. Cyperus alternifoliu’s DNA had a size of 1500 bp and

Schefflera actinophylla’s DNA had a size of 1000 bp.

Tables and Figures:

8

GACTACGTTGTTGAGTCTACTGGTGTCTTCACTGACAAAGACAAGGCTGCAGCTCACTTGAAGGTTTGTCTTATTTGAATTGGTTATTTTTGTCTTGTAATGATATAAATAGTTTATGTGCTAGAATTTGCTTAGTATCATTCAACTAAATTTGTGACTTGTTGTATTTTCAGGGTGGTGCCAAGAAGGTTGTTATCTCTGCCCCCAGCAAAGACGCTCCAATGTTTGTTGTTGGTGTCAACGAGCACGAATACAAGTCCGACCTTGACATTGTCTCCAACGCTAGCTGCACCACTAACTGCCTTGCTCCCCTTGCCAAGGTAAAATATCTGATATTCTATATGATCAAATTTGACTTTGTATTTCAAGTTGAAGTGACTAATTTCATTTAACGTTCTTTGATTTCATTGTGTAGGTTATCAATGACAGATTTGGAATTGTTGAGGGTCTTATGACTACAGTCCACTCAATCACTGGTAAATTTATCAATCAGTTAGAAGTTTATTACAAACTTGCTTGCCTATAGGTGGAAAATTTGTGATTTAATGGGGTTTGCTTTATGATTTCAGCTACTCAGAAGACTGTTGATGGGCCTTCAATGAAGGACTGGAGAGGTGGAAGAGCTGCTTCATTCAACATTATTCCCAGCAGCACTGGAGCTGCCAAGGCTGTCGGAAAGGTGCTTCCAGCTCTTAACGGAAAGTTGACTGGAATGTCTTTCCGTGTCCCAACCGTTGATGTCTCAGTTGTTGACCTTACTGTCAGACTCGAGAAAGCTGCTACCTACGATGAAATCAAAAAGGCTATCAAGTAAGCTTTTGAGCAATGACAGATTAAGTTTACTTATATTCCAGTAGTGATCAAATTACTCACCAAGTGTTTTTACCACCAATACATAGGGAGGAATCCGAAGGCAAACTCAAGGGAATCCTTGGATACACCGAGGATGATGTTGTCTCAACTGACTTCGTTGGCGACAACAGGTCGAGCATTTTTGACGCCAAGGCTGGAATTGCATTGAGCGACAAGTTTGTGAAATTGGTGTCATGGTACGACAACGAATGG

Fig. 1. Sequence of GAPDH gene from Arabidopsis Thaliana. Presenting Initial Primers (in bold) and Nested Primers (underlined).

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17

Fig 2. Isolated Genomic DNA and Initial PCR. From left to right: (1)marker, (2) Arabidopsis Thaliana, (3) Cyperus DNA, (4) Schefflera DNA, (5) marker, (6) PCR 1, (7) Negative Control, (8) Arabidopsis gDNA, (9) pGAP, (10) marker, (11) PCR 1, (12) Negative control, (13) Arabidopsis, (14) pGAP, (15) Cyperus DNA, (16) Schefflera DNA, (17) marker

9

1 2 3 4 5 6 7 8 9 10 11 12 13

Fig 3. Nested PCR. From left to right: (1) marker, (2) Negative Control, (3) Unpurified Arabidpsis 1, (4) Purified Arabidpsis 1, (5) Unpurified Arabidopsis 2, (6) Purified Arabidopsis 2, (7) Unpurified pGAP, (8) Purified pGAP, (9) marker, (10) marker, (11) Unpurified and Purified Cyperus DNA, (12) Unpurified and Purified Schefflera DNA

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24

Fig 4. Cloning gel. From left to right: (1) and (2) no DNA, (3) pGAP Bacterial product, (4) - (6) pGap restriction digest product, (7)- (10) Arabidopsis PCR, (11) marker, (12)- (17) Cyperus DNA and (18) – (24) Schefflera DNA.

10

Fig 5. Cloning gel. (1)Cyperusalternifolius, (2)Scheffleraactinophylla,and (3) marker.

Fig 6. . Cloning gel. (1)Cyperusalternifolius, (2)Scheffleraactinophylla,and (3) marker.

Fig 7. Cloning gel

1 2 3

1 2 3

11

Table 1. GAPDH enzymes and the genes enconding them in Arabidopsis. Enzyme Commission (EC) assigns numbers to all enzymes based on the reactions that they catalyze:• EC 1._._._ designates enzymes that are oxidoreductases.• EC 1.2._._ designates enzymes that act on the aldehyde or oxo group of donors• EC 1.2.1._ designates enzymes specifically with NAD+ or NADP+ as acceptor• EC 1.2.1.12 specifically designates a phosphorylating GAPDH enzyme

Table 2.Cells transformed with GAPDH gene.

Type of DNA Number of cells in 50 microliters

Number of cells in 900 microliters

CYPERUS ALTERNIFOLIUS

17 440

SCHEFFLERA ACTINOPHYLLA

10 560

Acknowledgements:

I would like to acknowledge Dr. Robert Ross, who helped me choose the plants to

be studied in a future.The RISE Students: Mayrim Bernard, Aixa Castro,

SheydanisDíaz, Luis López, and Pedro Rodríguez. They extracted the nucleic acid,

did PCR and electrophoresis of the GAPDH gene from Cyperusalternifolius and

Scheffleraactinophylla.Melisa Medina, Paola Montes and Ana Velazquez, who helped

me during the investigation.Dr. Edgar Lleraand Yadira Ortiz who help me when I

needed them. RISE Program (R25GM59429) for their founding and materials.

12

Reference:

Burke, J. R.; Enghild, J. J.; Martin, M. E.; Jou, Y.-S.; Myers, R. M.; Roses, A. D.; Vance, J. M.; Strittmatter, W. J. :Huntingtin and DRPLA proteins selectively interact with the enzyme GAPDH. Nature Med. 2: 347-350, 1996.PubMedID :8612237

Cloning and Sequencing Explorer Series: Curriculum Manual. Biotechnology Explorer. 1-302.

Li, Y.; Nowotny, P.; Holmans, P.; Smemo, S.; Kauwe, J. S. K.; Hinrichs, A. L.; Tacey, K.; Doil, L.; van Luchene, R.; Garcia, V.; Rowland, C.; Schrodi, S.; and 20 others :Association of late-onset Alzheimer's disease with genetic variation in multiple members of the GAPD gene family. Proc. Nat. Acad. Sci. 101: 15688-15693, 2004. Note: Erratum: Proc. Nat. Acad. Sci. 103: 6411 only, 2006. PubMedID :15507493

Myers, A.; Wavrant De-Vrieze, F.; Holmans, P.; Hamshere, M.; Crook, R.; Compton, D.; Marshall, H.; Meyer, D.; Shears, S.; Booth, J.; Ramic, D.; Knowles, H.; and 16 others :Full genome screen for Alzheimer disease: stage II analysis. Am. J. Med. Genet. 114: 235-244, 2002.PubMedID :11857588

Rethore, M.-O.; Junien, C.; Malpuech, G.; Baccichetti, C.; Tenconi, R.; Kaplan, J.-C.;deRomeuf, J.; Lejeune, J. :Localisation du gene de la glyceraldehyde-3-phosphate dehydrogenase (G3PD) sur le segment distal du bras court de chromosome 12. Ann. Genet. 19: 140-142, 1976.PubMedID :1085604

13