51
TREE THINKING GAME MODULES DEMO NOTE These slides do not represent the final game design or completed content. They are for demonstration purposes only.

Tree Thinking Demo

Embed Size (px)

DESCRIPTION

 

Citation preview

Page 1: Tree Thinking Demo

TREE THINKING GAME MODULES DEMO

NOTE These slides do not represent the final game design or completed content.

They are for demonstration purposes only.

Page 2: Tree Thinking Demo

What is this game about?

Page 3: Tree Thinking Demo

An evolutionary tree is like a family tree

Page 4: Tree Thinking Demo

Looking at your family tree, you can see you and your first cousins share grandparents, two generations back.

Mrs. Mr.

Arthur Will

Liz Jorge Cho Aaron

Anastasia Ernesto Phil Anna Tony

Page 5: Tree Thinking Demo

Cousins

Looking at your family tree, you can see you and your first cousins share grandparents, two generations back.

Mrs. Mr.

Arthur Will

Liz Jorge Cho Aaron

Anastasia Ernesto Phil Anna Tony

Page 6: Tree Thinking Demo

Cousins

Looking at your family tree, you can see you and your first cousins share grandparents, two generations back.

Mrs. Mr.

Arthur Will

Liz Jorge Cho Aaron

Anastasia Ernesto Phil Anna Tony

Page 7: Tree Thinking Demo

Cousins

Looking at your family tree, you can see you and your first cousins share grandparents, two generations back.

Mrs. Mr.

Arthur Will

Liz Jorge Cho Aaron

Anastasia Ernesto Phil Anna Tony

Page 8: Tree Thinking Demo

Grandparents

Cousins

Looking at your family tree, you can see you and your first cousins share grandparents, two generations back.

Mrs. Mr.

Arthur Will

Liz Jorge Cho Aaron

Anastasia Ernesto Phil Anna Tony

Page 9: Tree Thinking Demo

You and your second cousins share great-grandparents, three generations back.

Mrs. Mr.

Arthur Will

Liz Jorge Cho Aaron

Anastasia Ernesto Phil Anna Tony

Page 10: Tree Thinking Demo

2nd cousins

You and your second cousins share great-grandparents, three generations back.

Mrs. Mr.

Arthur Will

Liz Jorge Cho Aaron

Anastasia Ernesto Phil Anna Tony

Page 11: Tree Thinking Demo

2nd cousins

You and your second cousins share great-grandparents, three generations back.

Mrs. Mr.

Arthur Will

Liz Jorge Cho Aaron

Anastasia Ernesto Phil Anna Tony

Page 12: Tree Thinking Demo

2nd cousins

You and your second cousins share great-grandparents, three generations back.

Mrs. Mr.

Arthur Will

Liz Jorge Cho Aaron

Anastasia Ernesto Phil Anna Tony

Page 13: Tree Thinking Demo

2nd cousins

You and your second cousins share great-grandparents, three generations back.

Mrs. Mr.

Arthur Will

Liz Jorge Cho Aaron

Anastasia Ernesto Phil Anna Tony

Page 14: Tree Thinking Demo

2nd cousins

Great-grandparents

You and your second cousins share great-grandparents, three generations back.

Mrs. Mr.

Arthur Will

Liz Jorge Cho Aaron

Anastasia Ernesto Phil Anna Tony

Page 15: Tree Thinking Demo

What if you went even further back on your family tree?

Page 16: Tree Thinking Demo

What if you went even further back on your family tree?

Page 17: Tree Thinking Demo

What if you went even further back on your family tree?

Ten generations?

Page 18: Tree Thinking Demo

What if you went even further back on your family tree?

Ten generations?

Page 19: Tree Thinking Demo

What if you went even further back on your family tree?

Ten generations?

A thousand generations?

Page 20: Tree Thinking Demo

What if you went even further back on your family tree?

Ten generations?

A thousand generations?

Page 21: Tree Thinking Demo

What if you went even further back on your family tree?

Ten generations?

A thousand generations?

A million?

Page 22: Tree Thinking Demo

What if you went even further back on your family tree?

Ten generations?

A thousand generations?

A million?

What do you think your distant cousins would look like then?

Page 23: Tree Thinking Demo

All of Life is part of one big family that began when the first cell started its life in a primordial pond almost 4 billion years ago.

Page 24: Tree Thinking Demo

All of the species alive today are cousins on the 3.8 billion year old tree of life

Human Cow Lizard Turtle

Page 25: Tree Thinking Demo

We use DNA to figure out where species belong on this tree

Human Cow Lizard Turtle

?

Page 26: Tree Thinking Demo

Human Cow Lizard Turtle Bird

We use DNA to figure out where species belong on this tree

Page 27: Tree Thinking Demo

This game lets you solve a puzzle, putting animals in their spot on the tree of life

Page 28: Tree Thinking Demo

DNA Animal 1

DNA Animal 2

When you drag an animal around, hover it over the species on the tree to see how much its DNA matches

95%

Page 29: Tree Thinking Demo

Eventually this game will be a lot fancier

Which new branch does the elephant go on?

Page 30: Tree Thinking Demo

…With a tutorial and fun facts about each animal

ORCA Orcinus orca

The orca, more commonly known as the killer whale, is the largest member of the dolphin family. The largest orcas grow almost as long as a school bus. Orcas are found throughout the world’s oceans, and swim in large family groups called “pods.” Members of each pod communicate in dialects of clicks and whistles that are unique to that group. FUN FACT: Orcas can live as long as the average human!

Page 31: Tree Thinking Demo

Proposed levels:

Level 1: (Broad evolutionary relationships) e.g, Humans, sea anemone, house fly, tree, seaweed, fungus, bacterium Level 2: (Animals) e.g, Humans, orcas, cow, elephant, opossum, alligator, coelacanth, trout Level 3: (Canids) Fox, wolf, Chinese Shar-Pei, chow chow, basenji, Siberian husky, Afghan hound, chihuahua, boxer Level 4: (Solve a societal problem) e.g, Figure out which contemporary influenza virus is most similar to the Spanish flu of 1918 (using RNA similarity)

Page 32: Tree Thinking Demo

Proposed 15-30 second long educational modules:

1)   What's this game about? 2)   What is DNA? 3)   How do scientists collect these DNA “fingerprints”? 4)   How does the game work? 5)   How closely related are these two animals? 6)   What does the percentage mean?

Page 33: Tree Thinking Demo

What is dNA?

Sample information module

Page 34: Tree Thinking Demo

Within every one of the trillions of cells that make up your body lies a small molecule called DNA.

Page 35: Tree Thinking Demo

Within every one of the trillions of cells that make up your body lies a small molecule called DNA.

Page 36: Tree Thinking Demo

Within every one of the trillions of cells that make up your body lies a small molecule called DNA.

This is DNA!

Page 37: Tree Thinking Demo

DNA is made up of four different pieces that form an alphabet

Page 38: Tree Thinking Demo

A

DNA is made up of four different pieces that form an alphabet

Page 39: Tree Thinking Demo

A T

DNA is made up of four different pieces that form an alphabet

Page 40: Tree Thinking Demo

A T G

DNA is made up of four different pieces that form an alphabet

Page 41: Tree Thinking Demo

A T G C

DNA is made up of four different pieces that form an alphabet

Page 42: Tree Thinking Demo

ATTCTTCGTATGGCCCCCCGTATGGATATATATATGCGCGGGGGACTGACTTGCGCTTCTCCCCCTATAGGTATGCCTCTCTATTATTATTCTTTGCTATACTTCCCCCCAACCCCTTGAGGAC

DNA is made up of four different pieces that form an alphabet that is read like an instruction manual for our bodies.

YOU CCCCGTGCGGGGTTCCACTCCATATATGGA

CTATTCTGCTTCTACC

TATGGATAAACCCCTAGGTATATGGATATATTGGCCTTCCGGGGACTGATAAGTATGCCTTATGGATATATATATGCGCGGATAGCAT

Page 43: Tree Thinking Demo

When the cells of our bodies multiply as we grow and have children, the DNA gets copied along with it.

Page 44: Tree Thinking Demo

Sometimes there is a little glitch in the copying process, and one of the letters of the DNA alphabet gets switched to another.

Page 45: Tree Thinking Demo

Sometimes there is a little glitch in the copying process, and one of the letters of the DNA alphabet gets switched to another.

These mistakes are called mutations!

Page 46: Tree Thinking Demo

As the tree of life grew and divided into many diverse species

Page 47: Tree Thinking Demo

As the tree of life grew and divided into many diverse species, each had its own unique sets of mutations which they passed on to their children.

Page 48: Tree Thinking Demo

These mutations are like "fingerprints" in the genetic code

Page 49: Tree Thinking Demo

These mutations are like "fingerprints" in the genetic code, and let us find where a creature belongs on the tree of life compared to its relatives.

Page 50: Tree Thinking Demo

These mutations are like "fingerprints" in the genetic code, and let us find where a creature belongs on the tree of life compared to its relatives.

Page 51: Tree Thinking Demo

CREDITS

Content and Design By Laura Crothers, Ammon Thompson, and PowersCombined

Worm by Ana María Lora Macias from The Noun Project

Grass by Bryn Mackenzie from The Noun Project

Sea Turtle by Baffi Lab from The Noun Project

Network by Juan Pablo Bravo from The Noun Project

Book by Pyetro Rapp from The Noun Project

Cell by Maurizio Fusillo from The Noun Project

Other images in the public domain or by Laura Crothers