Upload
ilri
View
2.790
Download
0
Embed Size (px)
DESCRIPTION
A presentation prepared by Obura E., Midega C., Zeyaur K., Pickett J. and Masiga D. for the ASARECA/ILRI Workshop on Mitigating the Impact of Napier Grass Smut and Stunt Diseases, Addis Ababa, June 2-3, 2010.
Citation preview
1Obura E, 1Midega C, 1Khan ZR, 2Pickett J and 1Masiga D 1ICIPE: International centre of Insect Physiology and Ecology 2Rothamsted Research, Harpenden, Hertfordshire AL5 2JQ, UK
Napier stunt disease is transmitted by a leafhopper vector Maiestas (=Recilia) banda in Western Kenya
Presented at the ASARECA/ILRI Workshop on Mitigating the Impact of Napier Grass Smut and Stunt Diseases, Addis Ababa, June 2-3, 2010
Model of sustainable small-holder mixed farming at ICIPE, Mbita
Organic Manure
Non-chemical cereal pest management
Enough fodder for livestock
Soil conservation
Increased maize, milk and meat production
Napier stunt disease
Which leafhopper species is transmitting Napier stunt disease?
ICIPE collected 22 plant sucking Hoppers from Bungoma, Busia, Kitale and Suba areas, Kenya
The plant sucking hoppers were reared in cages at ICIPE, Mbita
22 plant sucking Hoppers and their phytoplasma status
Family Insect Species PCR Testing/Phytoplasma status
Cicadellidae Cofana spectra +
Cofana unimaculata -
Cofana polaris +
Cicadulina mbila +
Exitianus distanti +
Exitianus attenuatus +
Glossocratus afzelii +
Recilia banda +
Delphacidae Thriambus levis -
Thriambus strenuus +
Thriambus vegatatus -
Leptodelphax cyclops -
Leptodelphax maculigera -
Leptodelphax dymas +
Sogatella Manetho +
Sogatella nigrigenis -
Sogatella kolophon -
Rhinotettix fuscipennis +
Rhinotettix breviceps -
Tagosodes cubanus. -
Aphrophoridae Poophilus sp. -
Clovia sp. -
For full data contact authors
60 Days phytoplasma infection, 10 gravid
female insects
Disease monitoring cage
The Hoppers were tested for Phytoplasma transmission
Only R. banda transmitted phytoplasma
1.2-kb
Plants before phytoplasma inoculation
Plants after phytoplasma transmission
1.2-kb
M - + 1 2 3 4 5 6 7 8 9 10 11 12
M + - 1 2 3 4 5 6 7 8 9 10 1112
7/12 plants developed symptoms and died after 6 months
MBS
Transmitted phytoplasma formed clade with NGSNGS-E
BrGWL
BGWLSGGS
SCGSSCWL
RYD
NGS-KNGS-UNGS-Ex
NGS-D
NGS-Recilia SCYL
BDROL
The Genus Maiestas (=Recilia)
23 Species Afrotropical
R. mica: blast disease phytoplasma in oil palm seedlings (WA)
R. dorsalis: rice dwarf phytoreovirus, rice gall dwarf phytoreovirus, and rice orange leaf (ROL) phytoplasma (ASIA)
ICIPE has Barcoded Recilia banda
>Recilia banda COI partial sequenceatactttatcttagggagatgaactagaatcttggggatttctttaagaagattaatccgatttgaaatcaattcaatagatacaatctttgaagaaaaaagatcttataatattttaatcacttctcatgcaattattataatcttttttttagtaatacctgtaactataggtggatttggaaattgattagttcctttaatattaataactcctgacatagcttttccacgattaaataatttcaggttttgaattttactaccttctttaataatatttataagaagaataatattaaaaactggtgtaatagcaggatgaacaatttaccctcctttaacattacttaacagccatccagattactcaatagaattaactatttttaggcttcatttagcaggaatttcgtcaattttgagttcaattaattttataacaactacaattaacataagatccgtaaaatttataaaaattccattatttgtatgatcaattaattttactgctattttattaattttaacattgcctgtactagccggagcaattactatattattgtttgatcgaaattttaacacatcattttatgaccctacaggaagaggagatccaaggatgcagag
For full details please contact authors
Patterns of NGS phytoplasma acquisition and transmission by the leafhopper R. bandaPhytoplasma acquisition time longer: 1-3 days
Plant infection/inoculation time as short as 5 mins
Only 3 infected insects required to deliver enough phytoplasma dose to initiate infection to 1 potted Napier grass
Hoppers are infective for life (up to 60 days)
Life cycle of NSD in the region
Recilia banda
(1-3 days)
(≥5 mins)
(7-10 days)
R. Banda survives and breed well on diseased plants
The phytoplasma seems to confer survival advantage to the insect
R. banda density in the field
Up to 20 insects/m2 collected from Diseased Napier grass plot
Only up to 5 insects/m2 collected from Healthy Napier grass plot
Up to 100% of insects collected from Diseased Napier grass canopy are phytoplasma infected
Up to 20% of the insects in the healthy Napier grass plots are infected
There is up to 60% infected insects in nearby healthy plots after Rouging diseased plants by farmers
Up to 40% infected insects collected in healthy canopy after a farm activity (walking, weeding)
Eggs or Nymphs and adults are disseminated by farmers with Napier grass seed canes
R. banda dispersal
Loop mediated isothermal amplifcation of DNA for rapid detection of phytoplasma
M + - 1 2 3 4 5 6 7 8
M - + 1 2 3 4 5 6 7 8
A: Symptomatic B: Assymptomatic/-PCR
M - + 1 2 3 4 5 6 7 8
M + - 1 2 3 4 5 6 7 8
Assay Serial dilutions of DNA extracted from test plant
Initial DNA 1:102 1:104 1:106
Nested PCR
+ + - -
LAMP + + + -
LAMP gene target and Primers
30 cultivars are being screened for phytoplasma resistance at ICIPE, Mbita
18 cultivars confirmed susceptible
Variety Name Resistant/Susceptible
1. Kakamega 1 S
2. Kakamega 2 S
3. Kakamega3 S
4. Kakamega5 S
5. Kakamega8 S
6. Ex Bokole S
7. French Cameroon S
8. Pakistan Hybrid S
9. Ex Matuga S
10. Ex-Mariakani S
11. Clone 13 S
12. Congo Kinshasha S
13. Gold Coast ongoing
14. Uganda Border S
15. Uganda L14 S
16. Nigeria 14 S
17. Nairobi L8 ongoing
18. Machakos Hairless S
19. South Africa L3 ongoing
20. Gold Coast Ongoing
21. Malawi Ongoing
22. Bana grass S
Known GermplasmVariety Name Resistant/
Susceptible
BV S
BFTC Ongoing
RT1 Ongoing
RT2 Ongoing
LO Ongoing
OK Ongoing
O2 Ongoing
JO Ongoing
Farmer selectedFor full data contact the authors
For full data contact the authors
17 Wild host grasses are being screened for R. banda survival and phytoplasma transmission
1. Cynodon dactylon2. Digitaria scalarum3. Echinochloa pyramidalis4. Cenchrus ciliaris 5. Eragrostis superba6. Setaria incrisata7. Sporobolus pyramidalis 8. Eleusine indica9. Panicum maximum10. Heteropogon contortus11. Hyperrhenia rufa12. Bathrochloa bladhi13. Bathrochloa insculpta14. Themeda triandra15. Dactyloctenium aegyptum16. Sorghum sudanensis
For full data contact the authors
Phytoplasma diseased Cynodon dactylon in Busia area, western Kenya (Obura et al., NDR, 2010)
C. dactylon is Common/important grass for turf and wild rangeland in eastern Africa
Common Name
Scientific Name Survival
Maize Zea mays NS
Sugarcane Sacharum sp MS,P
Pearl Millet Pennisetum glaucum
S&B, P
Rice Oryzae sativa MS,P
Wheat Triticum aestivum
NS
Sorghum Sorghum vulgare NS
Finger Millet Eleusine corocana
NS
MS-Minimal survival (1 week)
S&B-Survival and Breeding
P-Successful phytoplasma transmission
NS-No survival
7 cereals have been screened for R. banda survival and NSD transmissionFor full data contact the
authors
3/12 pearl milet samples infected with phytoplasma
M - + 1 2 3 4 5 6 7 8 9 10 11 12
R. Banda breeds and transmit phytoplasma to Pearl millet
For full data contact the authors
Pearl millet is a very important cereal
At ICIPE
Discriminate R. banda in eastern Africa
Identify a phytoplasma resistant Napier grass cultivar
Develop genetic and Morphological markers for the selection of the resistant cultivar
Genetic transformation of Resistant cultivar
Study the wild grass host range of Napier stunt phytoplasma
Screen phytoplasma infection to other cereals
Study the genetic diversity of Recilia banda in eastern Africa
Dr. Mike Wilson, National Museum of Wales, Cardiff, UK
Dr. Tadashi Ishikawa, Tokyo University of Agriculture,
Japan.
Biotechnology Unit, ICIPE
The Kilimo Trust, East Africa, the Gatsby Charitable
Foundation, UK, and DAAD
ACKNOWLEDGEMENT
THANK YOU