Upload
candy-smellie
View
430
Download
4
Embed Size (px)
DESCRIPTION
Have you considered that protein over-expression or inefficient mRNA knockdown may be masking physiological effects in your assays? Increasingly scientists are moving to endogenous gene-editing to characterise the function of their genes of interest. Dr Chris Thorne from Cambridge Biotech Horizon Discovery discusses the ground breaking gene-editing technology CRISPR. The simplicity of experimental design has led to rapid adoption of the technology across the scientific community. However, challenges remain. This Slidedeck focuses specifically on implementing CRISPR experiments, and explore a number of key considerations crucial to maximising chances of targeting success, whether your goal is to generate a knock-out or a knock-in. Chris also takes a look at some of the alternative uses of CRISPR, including sgRNA genome wide synthetic lethality screens. The slides aim to support those researchers either planning to or already using CRISPR gene-editing in their lab. Horizon Discovery have also recently launched a program aimed specifically at academic cell biologists to promote the adoption of CRISPR by offering FREE CRISPR Reagents for knock-out cell line generation - more information available here. http://www.horizondiscovery.com/what-we-do/discovery-toolbox/genassist-crispr--raav-genome-editing-tools
Citation preview
GENASSIST™ CRISPR: Gene editing for everyone.
Join the Program Now!Visit www.horizondiscovery.com/guidebook
FREE CRISPR Reagents for Knockout Generation
2
Horizon Discovery Ltd. 7100 Cambridge Research Park, UK
Our mission
“to translate the human genome and accelerate the discovery of personalised medicines”
Tailoring the right drugs...to the right patients...at the right time
The opportunity: translating genetic information into personalised medicines
Information is no longer a bottleneck, emphasis is shifting to the ‘what does it all mean’
Genome editing is enabling the promise of the genomic era to be realized in the form of novel therapeutics and diagnostics
It involves the capability to efficiently introduce targeted alterations into any specific gene in living cells
3
GENESIS™: Comprehensive genome editing
rAAV• High precision / low thru-put• Any locus, wide cell tropism• Well validated, KI focus
Zinc Fingers • Med precision / med thru-put• Good genome coverage• Well validated / KO Focus
CRISPR • New but high potential• Capable of multi-gene targeting• Simple RNA-directed cleavage• Combinable with AAV
4
Horizon is the only source of rAAV expertise and is uniquely capable of exploiting multiple platforms: CRISPR, ZFNs and rAAV singularly or combined
Horizon’s scientists are experts at all forms of gene editing and so have the experience to help guide customers towards the approach that best suits their project
Table of Contents
The CRISPR/Cas9 gene editing system
Using CRISPR to generate knock-outs and knock-ins
• Case study: Knock-out of MAPK3 in A375 cells• Case study: Knock-in of Cas9n into safe harbour locus in HEK293T cells
Key considerations for CRISPR gene editing
Other CRISPR applications
• Case study: sgRNA library screening
CRISPR at developments at Horizon Discovery and beyond
RNA-guided platform to introduce either a cut at a specified location in the genome.
Short ‘guide’ RNAs with homology to target loci direct a generic nuclease (Cas9)
Guide RNA + Cas9 are delivered into the cell
Cas9 cleavage is repaired by either NHEJ, or HDR in tandem with a donor
High efficiencies of knockout or knock-in
The CRISPR/Cas9 System
Crispr (cr) RNA + trans-activating (tra) crRNA combined = single guide (sg) RNA
The CRISPR/Cas9 System
The CRISPR/Cas9 System
AGCTGGGATCAACTATAGCG CGGgRNA target sequence PAM
Cas9 wild-type or Cas9 nickase?
Cas9 Wild type Cas9 Nickase (Cas9n)
Induces double strand break Only “nicks” a single strand
Only requires single gRNA Requires two guide RNAs for reasonable activity
Concerns about off-target specificity Reduced likelihood of off-target events
High efficiency of cleavage Especially good for random indels (= KO)
Guide efficiency dictated by efficiency of the weakest gRNA
Nishimasu et al Cell
Designing a guide RNA
Cas9 wild-type: The cut site occurs 3 bp 5’ of the PAM sequence
Cas9n (D10a): the single strand nick occurs on the opposite strand
AGCTGGGATCAACTATAGCG CGGTCGACCCTAGTTGATATCGC GCC
gRNA target sequence PAM
AGCTGGGATCAACTATAGCG CGGTCGACCCTAGTTGATATCGC GCC
gRNA target sequence PAM
Designing a guide RNA
Ran et al Cell 2014
Table of Contents
The CRISPR/Cas9 gene editing system
Using CRISPR to generate knock-outs and knock-ins
• Case study: Knock-out of MAPK3 in A375 cells• Case study: Knock-in of Cas9n into safe harbour locus in HEK293T cells
Key considerations for CRISPR gene editing
Other CRISPR applications
• Case study: sgRNA library screening
CRISPR at developments at Horizon Discovery and beyond
Using CRISPR to Generate Gene KOs and KIs
Case Study: Disruption of the MAPK3 gene in the A375 cell line (copy number = 3)
96 Clones Screened
28 Positive for cutting
7 Clones Sequenced
3 Clones with indels on all three alleles
Conserved exon 3 targeted
ENSEMBL
1
2
3
Parental
Allele 1Allele 2Allele 3
Using CRISPR to Generate Gene KOs and KIs
Case Study: Disruption of the MAPK3 gene in the A375 cell line (copy number = 3)
Using CRISPR to Generate Gene KOs and KIs
Case Study: Insertion of the Cas9n gene into a safe harbour locus for constitutive expression
1 2 3 4 THUMPD3
Plasmid donor Cas9n
SV40 NLS
BGH PolyA
hROSA26 locus
635 bp 571 bp
Using CRISPR to Generate Gene KOs and KIs
Neg
ative
con
trol
gRN
A 1
only
gRN
A 2
only
gRN
A 1
and
2
gRN
A 1
and
2 +
Cas9
n
100bp
200bp
300bp400bp500bp600bp
Case Study: Insertion of the Cas9n gene into a safe harbour locus for constitutive expression
Clones Screened
10% Positive for integration
All positives contained only a single insertion
All positives contained indels in second allele
On the surface genome editing with CRISPR appears as simple as:
... HOWEVER …
Identifying a gRNA target sequence
Ordering an oligo with the target sequence and cloning it into a gRNA vector
Transfecting cells with the gRNA + Cas9
Key Considerations For CRISPR Gene Editing
Gene Target Specifics
Cell Line
gRNA Design
gRNA Activity
Donor Design
Screening
Validation
Key Considerations For CRISPR Gene Editing
Gene Target Specifics
Cell Line
gRNA Design
gRNA Activity
Donor Design
Screening
Validation
Normal human karyotype
HeLa cell karyotype
Gene copy number Number and nature of modified alleles Effect of modification on growth
Key Considerations For CRISPR Gene Editing
Gene Target Specifics
Cell Line
gRNA Design
gRNA Activity
Donor Design
Screening
Validation
Transfection/electroporation Single-cell dilution Optimal growth conditions
Key Considerations For CRISPR Gene Editing
Gene Target Specifics
Cell Line
gRNA Design
gRNA Activity
Donor Design
Screening
Validation
Sequence source Off-target potential Guide proximity Wild-type Cas9 or mutant nickase
Key Considerations For CRISPR Gene Editing
Gene Target Specifics
Cell Line
gRNA Design
gRNA Activity
Donor Design
Screening
Validation
Number of gRNAs gRNA activity measurement
NTCas9 wt
only4uncut 1 52 3
gRNA
200
300
400
500
100
600
+ve
700
200
300
400
500
100
600700
Key Considerations For CRISPR Gene Editing
Gene Target Specifics
Cell Line
gRNA Design
gRNA Activity
Donor Design
Screening
Validation
Donor sequence modifications Modification effects on expression or splicing Donor size Type of donor (AAV, oligo, plasmid) Selection based strategies
Cas9 Cut Site
Genomic Sequence
Donor Sequence containing mutation
Key Considerations For CRISPR Gene Editing
Gene Target Specifics
Cell Line
gRNA Design
gRNA Activity
Donor Design
Screening
Validation
Donor sequence modifications Modification effects on expression or splicing Donor size Type of donor (AAV, oligo, plasmid) Selection based strategies
(+/+)
(+/-)
(-/-)
(KI/-)
(KI/+)(KI/KI)
Limiting re-cutting by the gRNA can improve the odds (… greatly)
Key Considerations For CRISPR Gene Editing
Gene Target Specifics
Cell Line
gRNA Design
gRNA Activity
Donor Design
Screening
Validation
Number of cells to screen Screening strategy Modifications on different alleles Homozygous or heterozygous
modifications versus mixed cultures
% cells targeted
Key Considerations For CRISPR Gene Editing
Gene Target Specifics
Cell Line
gRNA Design
gRNA Activity
Donor Design
Screening
Validation
Confirmatory genotyping strategies Off-target site analysis Genetic drift/stability Modification expression Contamination
Heterozygous knock-in
Wild type
Key Considerations For CRISPR Gene Editing
Gene Target Specifics
Cell Line
gRNA Design
gRNA Activity
Donor Design
Screening
Validation
How many copies?
Is it suitable?
What’s my goal? (Precision vs Efficiency)
Does my guide cut?
Have I minimised re-cutting?
How many clones to find a positive?
Is my engineering as expected?
Table of Contents
The CRISPR/Cas9 gene editing system
Using CRISPR to generate knock-outs and knock-ins
• Case study: Knock-out of MAPK3 in A375 cells• Case study: Knock-in of Cas9n into safe harbour locus in HEK293T cells
Key considerations for CRISPR gene editing
Other CRISPR applications
• Case study: sgRNA library screening
CRISPR at developments at Horizon Discovery and beyond
Other applications of the CRISPR platform
(A) Nuclease or Nickase
(B) Two nickase complexes can mimic targeted DSBs via cooperative nicks
(C) Expression of all components from one plasmid
(D) Purified Cas9 protein and in vitro transcribed gRNA can be microinjected into fertilized zygotes
(E) Viral vectors encoding CRISPR reagents can be transduced into tissues or cells of interest.
(F) Genome-scale functional screening can be facilitated by mass synthesis and delivery of guide RNA libraries.
(G) Catalytically dead Cas9 can be fused to functional effectors such as transcriptional activators or epigenetic enzymes.
(H) Cas9 coupled to fluorescent reporters facilitates live imaging of DNA loci
(I) Inducible reconstituting split fragments of Cas9 confers temporal control of dynamic cellular processes.
Hsu et al. Cell. 2014
Lentivirally delivered sgRNA can drive efficient cleavage of target genomic
sequences for use in whole genome screens
Use massively-parallel next-gen sequencing to assess results
Possible addition/replacement to RNAi screens
sgRNA Screening
32
sgRNA Screening
Shalem et al Science 2014
Cas9/sgRNA suppresses gene expression far more effectively than shRNA
Shalem et al Science 2014
34
Synthetic Lethality sgRNA Screening
We are integrating CRISPR-based Synthetic Lethality Screens into our platform
sgRNA technology will be transformational for both Target ID and early-stage
Target Validation
LentiCRISPR v2 reagents and GeCKO v2 library
Due to large vector size, only low titers were achievable with version 1 vectors→ large-scale v1 library virus production (and concentration)
By vector element clean-up and optimization, v2 vectors produce ~10-fold higher titers
Additional two-vector lentiviral system now available for hard-to-infect cell lines
Sanjana et al. Nature Methods 2014
LentiCRISPR v2 reagents and GeCKO v2 library
~120,000 guideRNAs against ~19,000 genes
6 guides vs. each gene in two half-libraries (3 guides/gene in Library A or B)
1000 non-targeting sgRNAs
Sanjana et al. Nature Methods 2014
LentiCRISPR v2 reagents and GeCKO v2 library
GeCKO v2 library has now arrivedLibrary amplification + QCLentivirus production• Determine MOI for GeCKO v2 library lentivirus
Two-vector v2 lentiCRISPR system upgraded to include fluorescent tags for rapid hit validation by dual-colour co-culture experiments
GFP
P2A
lentiGuide-Puro_P2A_tGFP
RFP
P2A
lentiGuide-Puro_P2A_tRFP
Table of Contents
The CRISPR/Cas9 gene editing system
Using CRISPR to generate knock-outs and knock-ins
• Case study: Knock-out of MAPK3 in A375 cells• Case study: Knock-in of Cas9n into safe harbour locus in HEK293T cells
Key considerations for CRISPR gene editing
Other CRISPR applications
• Case study: sgRNA library screening
CRISPR at developments at Horizon Discovery and beyond
Horizons CRISPR developments: Combining rAAV + CRISPR
Can we combine technologies for improved efficiency?
Tested using a reporter cell-line harbouring an inactivating mutation in GFP
Correction donor-vector supplied either as dsPlasmid, ssDNA oligos, or ssDNA rAAV
rAAV = the most efficient donor vector (50 fold)
% G
reen
cel
ls (F
ACs)
Open to all academic researchers
Free guide design using gUIDEbook, Horizon’s in silico guide design software
Free cloning 5 guides cloned into all-in-one plasmids that express Cas9
Must let Horizon know when your guide has been used to generate a cell line (feedback on which guide or guides worked)
Must license that cell line back to Horizon in return for a royalty
Only pay cost of shipping
Horizon would like to license your cell lines!
Horizons CRISPR developments: Free CRISPR Reagents for Knock-Outs
Strengthen
Academic Links
Expand Cell Line
Repository
Improve gRNA
Design Platform
What? Free? WHY?!
GENASSIST: CRISPR and rAAV enabled gene editing
Cas9 Vectors• Wild type and nickase• Separate or combined with guide
Guide RNA• Single or double guides• Available OTS for in-lab cloning• Custom guide generation available with validation
Donors• Available OTS for in-lab cloning• Plasmid or rAAV format• Custom donor generation available
Cell Lines• CRISPR-ready cell lines• 550+ OTS cell line menu available for further gene editing
Services• Viral encapsulation of rAAV donor• Project design support• On-going expert scientific support
CRISPR and rAAV Intellectual property
It is Horizon's intent to ensure that our customers have a risk free environment to perform and benefit from CRISPR gene editing now and in the future.
We bring to our customers the widest breadth of IP available from any commercial source:
We currently have either already taken a license to or are in late-stage negotiations to access multiple separate CRISPR IP patent estates
Horizon is the only company with access to rAAV as a precise gene editing or DNA/plasmid delivery platform, we are the only company able to offer hybrid rAAV/CRISPR systems that draw from the best aspects of both approaches for far superior gene editing efficiencies.
Your Horizon Contact:
Horizon Discovery Ltd, 7100 Cambridge Research Park, Waterbeach, Cambridge, CB25 9TL, United Kingdom
Tel: +44 (0) 1223 655 580 (Reception / Front desk) Fax: +44 (0) 1223 655 581 Email: [email protected] Web:
www.horizondiscovery.com
Chris Thorne PhDGene Editing Community [email protected] +44 1223 204799
Useful Resources
From Horizon
Free gRNAs in Cas9 wild type vector – www.horizondiscovery.com/guidebook
Technical manuals for working with CRISPR - http://www.horizondiscovery.com/talk-to-us/technical-manuals
In the Literature
Exploring the importance of offset and overhand for nickase - http://www.cell.com/cell/abstract/S0092-8674(13)01015-5
sgRNA whole genome screening:• Shalem et al - http://www.sciencemag.org/content/343/6166/84.short• Wang et al - http://www.sciencemag.org/content/343/6166/80.abstract
On the web
Feng Zhang on Game Changing Therapeutic Technology (Link to Feng’s Video)
Guide design - http://crispr.mit.edu/
CRISPR Google Group - https://groups.google.com/forum/#!forum/crispr