Levy Lab

Matthew LevyDepartment of Biochemistry

Albert Einstein College of Medicine

Targeting cells with aptamers

Aptamers• Nucleic acid based binding species

• Can be selected against a variety of targets

• Kd’s in the sub-nanomolar to nanomolar range with specificities (comparable to monoclonal antibodies)

• Small (ca. 10,000 MW) and easily synthesized in milligram or greater quantities

• Can be readily derivatized for conjugation

• Non-immunogenic– Macugen, anti-VEGF aptamer, approved by FDA 2004

• In vitro origin of aptamers allows for tailored selections

Aptamers exist naturally• Small RNA loop binds

protein (U1A) with pM affinity

In vitro selection of aptamers

N40

Constant regions

Random regionOf 40 nucleotides

Library size = ~1014-15

Aptamers that target cell surface receptors can be used for delivery of cargoes to cells

• siRNA• Toxins • Small molecule drugs

Hicke et al. J Nucl Med. 2006 Apr;47(4):668-78

Anti-PSMA aptamer Anti-hTfR aptamer

Anti-Tenascin C aptamer

Aptamers can be used to target in vivo

Cancer/Aptamer projects underway in my lab

• Targeted drug delivery– Transferrin Receptor– PSMA

• Vaccine Development– DEC205 (dendritic cell receptor)

The transferrin receptor (TfR, CD71)

• Cell surface (type II) glycoprotein involved in iron uptake

• Expressed at LOW levels on normal cells

• Expressed at HIGH levels on cells with high proliferation rates– Highly over expressed in many cancers– Expressed on activated PBMCs– Expressed on the BBB.

• Transferrin and anti-TfR Abs have been demonstrated to cross the BBB

• Diagnostics • Therapeutics

Selection for aptamers targeting the transferrin receptor

• 4 rounds of selection against recombinant protein

• Round 5 of selection conducted on HeLa cells (TfR+)

Anti-TfR aptamers label multiple human cancer

cell lines

FACs based analysis using AF488 labeled aptamer

Minimization eliminates more than half of the c2 sequence.

c2 c2.min.2 c2.min.6 c2.min.9.1

38.6 kDa 14.0 kDa

Brian Wengerter

Prostate-specific membrane antigen

Two 2’F modified RNA aptamers (A9 and A10) selected by Lupold et al. (2002)

Cytoplasmic domain

Transmembrane domain

Extracellular domain

NH2

COOH

Catalytic domain

NH2

COOH

Catalytic domain

•110 kDa type II transmembrane protein

•Expressed in high level by prostate tumor cells

•Expressed in tumor neovasculature

•Known to internalize via clatherin mediated endocytosis

Using a library based on the A9 aptamer we have now performed a

‘doped’ selection

Doped A9 selection

GGGAGGACGATGCGGACCGAAAAAGACCTGACTTCTATACTAAGTCTACGTTCCCAGACGACTCGCCC (68)

Linsley Kelly

Heavily mutagenize (30%)

Reselect (HeLa-PSMA cells)

Minimization of the anti-PSMA A9 aptamer

GGGAGGACGATGCGGACCGAAAAAGACCTGACTTCTATACTAAGTCTACGTTCCCAGACGACTCGCCC (68)

Linsley Kelly

• These aptamers are currently being adapted for the delivery of a variety of cargoes

Targeting DEC 205

DEC205 is a C-type lectin expressed on the surface of dendritic cells (DCs) that is very efficient at cross-presentation.

Cross-presentation = the ability to process and present extracellular antigens with MHC class I molecules to CD8 T cells (cytotoxic T cells).

This process can be harnessed to enhance the immune response to tumors!

An anti-DEC205 antibody fused to the protein NY-ESO-1 is currently in phase II clinical trials.

Targeting cell surface receptors with aptamersanti-DEC205

• 3 rounds of selection against recombinant protein

• Round 4 and 5 conducted on CHO DEC 205 (+)

• Knocking down DEC205 with siRNA leads to decrease is surface staining

Brian Wengerter

Anti-DEC205 aptamers bind CHO cells that express DEC205

• We have now minimized our DEC205 aptamers

• We have made aptamer OVA conjugates are learning to do antigen presentation assays on primary DCs (thank you Debbie Palliser).

Brian Wengerter

Summary

• Aptamers posses unique qualities that make them well suited for the targeted delivery of cargoes to cells and translation to the clinic.

– siRNA and drugs to cancer cells– Targeting dendritic cells (DEC205) for antigen

presentation

• These technologies can be broadly applied to other receptors and multiple types of cancer.

AcknowledgementsLab Members:

• Amos Yan• Maria Magalhaes

• Linsley Kelly• Brian Wengerter

Funding:Albert Einstein College of MedicineMarion Bessin Liver Research Center

NIH/NIGMS, 1R01GM087985-01SU2C/AACR, IRG

Collaborators:

• AECOM– Debbie Palliser – Steve Almo– Peng Wu

• David Soriano del Amo

Rockefeller University – Steinmann Lab

• Chae Gyu Park • Jake Rosenberg