Chelonian

Diagnostics,

Pathology, and

Treatment

Matt Allender, DVM, MS, PhD, Diplomate ACZM

Ranavirus Symposium

July 2013

@Turtle_Doc

#RV13

Ranavirus epidemiology Disease events are often clustered in local epizootics

Some occur on annual basis

Several sources report a significant threat to

biodiversity

Population density mortality in salamander studies

Environmental factors change prevalence

Restoration efforts

Quantitative PCR TaqMan primer-probes were designed using Primer

Express targeting a portion of the MCP that was

contained within the 531 bp product

Forward: AACGCCGACCGAAAACTG

Reverse: GCTGCCAAGATGTCGGGTAA

Probe: CCGGCTTTCGGGC

Resultant segment was a 54 bp product

Conventional PCR

Level of Detection:

529,000 viral

copies

52 viral copies

Quantitative PCR

Epidemiologic evidenceCategory Institution FV3 positive FV3

negative

Prevalence 95% CI

Free-living* OR 1 308 0.3% 0 – 1.8 %

Rehabilitation* 7 217 3.13% 1.5 – 6.3%

UT 3 35 7.9% 2.7 – 20.1 %

WCV 2 120 1.6% 0.4 – 5.9 %

NCSU 0 46 0.00% 0 – 7.7 %

AWC 2 14 14.3% 4.0 – 39.9 %

UGA 0 9 0.00% 0 – 29.9 %

Total 8 525 1.5% 0.8 – 2.9%

* Significant difference between prevalence in free-living population and

rehabilitation populations, p=0.01, one-tailed

Results

Variable FV3 positive FV3 negative Prevalence 95% CI

Female 3 168 1.8 % 0.6 – 5.0 %

Male 0 218 0.00% 0 – 1.7 %

Adult 2 398 0.5 % 0.1 – 1.8 %

Juvenile 2 55 3.5 % 0.9 – 11.9 %

Sex: p=0.157, observed power = 0.73

Age: p=0.081, observed power = 0.91

Housing

Environmental chamber within Division of Animal

Resources at UI-CVM

15’9” x 12”

Temperature was acclimated for 1 week prior to

beginning study

Recorded daily and maintained +/- 1°C throughout

duration of study

Adult female red-eared sliders maintained in 45 or 50

gallon plastic enclosures with ~20 gallons freshwater

and basking spot

Virus Ranavirus isolated from infected eastern box turtle

100% sequence homology to MCP of FV3

Grown to confluence in TH-1

Divided into aliquots of 5 x 105 TCID50

Quantitative PCR performed on virus

Four animal in each temperature group were administered 1 aliquot (0.67 ml) in the right forelimb muscle

Uninfected controls administered same volume crude cell lysate

Sample collection

Weight, whole blood, oral and cloacal swabs collected twice prior to inoculation to confirm negative status, then twice weekly throughout duration of study PCV, TS, WBC, differential performed each sample

Clinical signs were recorded daily

Animals were euthanized when clinical signs were severe (as described in IACUC) or at 30 days post-inoculation Control animal was euthanized at same time as inoculated

animal

Gross necropsy performed within 48 hours

Histopathology of 8 tissues

qPCR of necropsy tissues

Results Survival

22°C – all inoculated turtles

were euthanized due to

severity of signs

28°C – only 2 turtles were

euthanized due to clinical

signs

One uninfected control

died of sepsis

Median survival times

22°C = 24 days (14 -30)

28°C = 30 days (17-30)

22C28C

Results

*Significant increase over time (F=11.1, p=0.045) Significant difference between control and inoculated turtles

(p=0.035)

#Significant increase over time (F=7.13, p=0.026)

Time 22°C

Weight

28°C

Weight

Pre-inoculation 1693.5625* 2063.1250#

Initial post-

inoculation

1692.50* 2082.50#

Terminal 1802.50* 2159.50#

Results

Tissue Parameter 22C

Viral Copies

28C

Viral Copies

Tongue Mean/median* 1.25 x 109* 5.94 x 106*

Skeletal

Muscle

Mean/median* 3.7 x 1010* 3.64 x 108*

Lung Mean/median* 6.29 x 109* 5.01 x 109*

Heart# Mean/median* 2.92 x 1010 1.27 x 109*

Liver^ Mean/median* 2.15 x 109 1.70 x 107*

Spleen Mean/median* 2.23 x 1010* 5.44 x 107*

Ovary Mean/median* 8.93 x 109* 9.06 x 106*

Kidney Mean/median* 3.46 x 1010* 2.54 x 108*

# Significant difference between environmental temperatures, p=0.012

^ Significant difference between environmental temperatures, p=0.011

Results

Temperature evidence

Mortality

22°C

Significant association between inoculation and disease

(p=0.014)

28°C

No significant association between inoculation and

disease (p=0.214)

Non-significant mortality was seen at lower

temperature (100%) than higher temperature (50%)

Power = 0.34

Temperature evidence qPCR

Viral copies quickly went from undetectable to millions/billions of copies

All positive turtles had between 2 and 4 positive samples prior to death

Highest in whole blood, lowest in cloacal swab (non-significant) at 22°C

Specificity and Sensitivity

Whole blood

100% specific and 100% sensitive

Oral swab and cloacal swab

100% specific and 83% sensitive

Results

Conclusions Prevalence in surveys of free-ranging populations are

low

Are chelonians a spill-over host?

Natural history characteristics make it difficult to identify

mortality events?

Are chelonians a reservoir host and fail to develop signs?

Are mechanisms of transmission different in chelonians

which provide natural protection?

Conclusions Environmental temperature leads to differences in

mortality in red-eared sliders

Both host and pathogen factors that may lead to

protection at higher temperatures

May play a role in persistence or transmission

Do other species have similar response to changes in

temperature?

Opportunity for therapeutic intervention

Funding Sources Morris Animal Foundation

qPCR development and prevalence study

CRESO

Prevalence study

Fluker’s Farms/Cox Pharmacology lab

PK study

Questions?