Download ppt - Synbioabs2 gold

Transcript
Page 1: Synbioabs2 gold

Synthetic Biology Synthetic Biology Extreme Genetic

Engineering

Jim Thomas

ETC Group.

Page 2: Synbioabs2 gold

Designing Lifeforms in the

21st Century…

A Rough Guide to

Page 3: Synbioabs2 gold
Page 4: Synbioabs2 gold
Page 5: Synbioabs2 gold
Page 6: Synbioabs2 gold
Page 7: Synbioabs2 gold
Page 8: Synbioabs2 gold

$ 3000

7500bp

Page 9: Synbioabs2 gold

atgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataa

Page 10: Synbioabs2 gold
Page 11: Synbioabs2 gold
Page 12: Synbioabs2 gold
Page 13: Synbioabs2 gold
Page 14: Synbioabs2 gold

Synbio

Cells

=

Seven

Steps

Page 15: Synbioabs2 gold

Café

Latte

=

Twelve

Steps

(And costs more in

equipment)

Page 16: Synbioabs2 gold

BBa_E0030 Part-only sequence (723bp)

atggtgagcaagggcgaggagctgttcaccggggtggtgcccatcctggtcgagctggacggcgacgtaaacggccacaagttcagcgtgtccggcgagggcgagggcgatgccacctacggcaagctgaccctgaagttcatctgcaccaccggcaagctgcccgtgccctggcccaccctcgtgaccaccttcggctacggcctgcaatgcttcgcccgctaccccgaccacatgaagctgcacgacttcttcaagtccgccatgcccgaaggctacgtccaggagcgcaccatcttcttcaaggacgacggcaactacaagacccgcgccgaggtgaagttcgagggcgacaccctggtgaaccgcatcgagctgaagggcatcgacttcaaggaggacggcaacatcctggggcacaagctggagtacaactacaacagccacaacgtctatatcatggccgacaagcagaagaacggcatcaaggtgaacttcaagatccgccacaacatcgaggacggcagcgtgcagctcgccgaccactaccagcagaacacccccatcggcgacggccccgtgctgctgcccgacaaccactacctgagctaccagtccgccctgagcaaagaccccaacgagaagcgcgatcacatggtcctgctggagttcgtgaccgccgccgggatcactctcggcatggacgagctgtacaagtaataa

Page 17: Synbioabs2 gold
Page 18: Synbioabs2 gold

“Teenagers..”

Page 19: Synbioabs2 gold

“Biohackers…”

Page 20: Synbioabs2 gold
Page 21: Synbioabs2 gold

“Start-Ups…”

Page 22: Synbioabs2 gold

STEP 1: Use philanthropic money

to destroy african farm

livelihoods…

Page 23: Synbioabs2 gold

STEP 2: Use the same

technology to take over the

biofuels industry.

Page 24: Synbioabs2 gold

“Moguls…”

Page 25: Synbioabs2 gold

“Over the next 20 years, synthetic genomics is going to become the standard for making anything. The chemical industry will depend on it. Hopefully, a large part of the energy industry will depend on it.”

"We have modest goals of replacing the whole petrochemical industry and becoming a major source of energy,"

Page 26: Synbioabs2 gold

“Corporations…”

Page 27: Synbioabs2 gold
Page 28: Synbioabs2 gold

Why

Worry??

Page 29: Synbioabs2 gold

BIOWARFARE

Reasons to worry..

Page 30: Synbioabs2 gold
Page 31: Synbioabs2 gold
Page 32: Synbioabs2 gold
Page 33: Synbioabs2 gold

BIOPIRACY

Reasons to worry..

“We ought to be able to make any compound produced by a plant inside a microbe”

Jay Keasling

Engineered Biological Systems

ŅThe Amyris team of scientists and engineers is nowpoised to commercialize pharmaceuticals and otherhigh value, fine chemicals taken from the worldÕsforests and oceans by making these compounds insynthetic microbes.Ó

Artemisia annua - source of powerfulAnti-malarial compound

Q ui ckTi me™ and aTI FF (Uncompressed) decompressor

are needed to see thi s pi cture.

Page 34: Synbioabs2 gold

Lets say we want to digitally steal

guarana…

Reasons to worry..

STEP 1: identify the

plant

Paullinia cupana

Page 35: Synbioabs2 gold

Lets say we want to digitally steal

guarana…

Reasons to worry..

STEP 2: Find

appropriate gene

sequences on

GENBANK

Page 36: Synbioabs2 gold

Lets say we want to digitally steal

guarana…

Reasons to worry..

STEP 3: Order the

gene sequences from

a DNA synthesis

company

Page 37: Synbioabs2 gold

Lets say we want to digitally steal

guarana…

Reasons to worry..

STEP 4:Engineer

Synthetic DNA

pathways into microbe

and tinker to produce

Guarana extract

Page 38: Synbioabs2 gold

Reasons to worry..

NOTE!!!

No Material Transfer Agreement needed

(Access and Benefit Sharing)

Because

No MATERIAL is transferred.

Page 39: Synbioabs2 gold

“The poster boy for the commercialisation of research”

Page 40: Synbioabs2 gold

”The application of modern genomics techniques to the study of communities of microbial organisms directly in their natural environments, bypassing the need for isolation and lab cultivation of individual species.”

- Kevin Chen and Lior Pachtr (UC Berkeley)

Phase 1 METAGENOMICS

Page 41: Synbioabs2 gold

Massive Raw Materials Grab.

Sargasso:

1.4 million new genes

Halifax > Galapagos:

Six million new genes

Page 42: Synbioabs2 gold
Page 43: Synbioabs2 gold
Page 44: Synbioabs2 gold

4 million genes of foreign species in mouth, intestines etc - More bacterial cells than human cells -10 percent of what is in our bloodstream is bacterial metabolites

“We are as much dependent on bacterial metabolism as human metabolism” - Venter.

Page 45: Synbioabs2 gold
Page 46: Synbioabs2 gold
Page 47: Synbioabs2 gold

Minimal genome.

Transplantation

Full genome construction

+

+

Mycoplasma genitalium

Phase 1: An operating system

Page 48: Synbioabs2 gold

Mycoplasma laboratorium

Page 49: Synbioabs2 gold

Combinatorial Genomics - “ a new Cambrian Explosion”

I call it combinatorial genomics.. Its one of my better ideas if it works. In fact, its one of my better ideas if it

doesn’t work’ - Venter

Page 50: Synbioabs2 gold
Page 51: Synbioabs2 gold
Page 52: Synbioabs2 gold

+ +

= “Ten million genes are the design components of the

future, With combinatorial genomics and casette-based construction, we can make millions of genomes per day.”

- JC Venter

Plug-in gene

cassette system

Millions of new

sequences

Rapid Robotic

construction

Page 53: Synbioabs2 gold

Implications for ABS:

1. No identification at the organism level - delinked from traditional knowledge.

2. Faster identification of useful sequences. Ie rapid biopiracy.

3. No need for physical transfer of material - digital discovery.

4. More data you have the easier it is to disprove a single source.

Page 54: Synbioabs2 gold

BIOSAFETY

Reasons to worry..

“The engineers can come and rewire this and that. But biological systems are not simple...

And the engineers will find out that the bacteria are just laughing at them.” - Eckard Wimmer, SUNY StonyBrook

Page 55: Synbioabs2 gold
Page 56: Synbioabs2 gold

“The logical extrapolation from this experiment is to suggest that it is possible to make a genetically engineered microorganism that would kill all terrestrial plants. “

Dr Elaine Ingham. University of Oregon.

Page 57: Synbioabs2 gold

BIODEVESTATION (via the

Biomass Economy )

Reasons to worry..

Page 58: Synbioabs2 gold

Recommended