Routine Molecular Epidemiology Routine Molecular Epidemiology for Enhanced Detection and for Enhanced Detection and
Control of Foodborne OutbreaksControl of Foodborne Outbreaks
Lee H. Harrison, MDLee H. Harrison, MD
Associate ProfessorAssociate Professor
Departments of Epidemiology and Departments of Epidemiology and MedicineMedicine
University of PittsburghUniversity of Pittsburgh
What is molecular epidemiology in infectious diseases?
PurposePurpose: : Determine modes of Determine modes of transmission and source of infectiontransmission and source of infection
PrincipalPrincipal: : Exploit pheno-/genotypic Exploit pheno-/genotypic differences between strains differences between strains
PracticePractice: : Molecular subtypingMolecular subtyping of of bacterial/fungal/viral/parasitic isolatesbacterial/fungal/viral/parasitic isolates
Molecular Epidemiology in Infectious Diseases: Why molecular methods?
Previously used methods:Previously used methods: – antimicrobial susceptibility patternsantimicrobial susceptibility patterns– serologic/biochemical typingserologic/biochemical typing
Examples:Examples:– 95% of invasive 95% of invasive H. influenzaeH. influenzae were serotype b were serotype b– L. monocytogenesL. monocytogenes: 3 major serotypes (1/2a, 1/2b, 4b): 3 major serotypes (1/2a, 1/2b, 4b)
Molecular Epidemiology in Infectious Diseases: Basic Types of Methods
Genotypic methodsGenotypic methods– DNA basedDNA based
– Heritable and stableHeritable and stable
– Not affected by isolation/culture conditionsNot affected by isolation/culture conditions Phenotypic methodsPhenotypic methods
– Rely on expressed characteristicsRely on expressed characteristics
– Affected by isolation/culture/test conditionsAffected by isolation/culture/test conditions
Molecular Epidemiology in Infectious Diseases: Common Methods
Analysis of chromosomal DNAAnalysis of chromosomal DNA– Restriction Restriction endonuclease analysisendonuclease analysis ( (REAREA))– Pulse field gel electrophoresis (PFGE)Pulse field gel electrophoresis (PFGE)– Restriction fragment length polymorphism (RFLP)Restriction fragment length polymorphism (RFLP)– rDNA gene restriction patterns (ribotyping)rDNA gene restriction patterns (ribotyping)– Nucleic acid sequencingNucleic acid sequencing– Nucleic acid hybridization of entire genomeNucleic acid hybridization of entire genome
Molecular Epidemiology in Infectious Diseases: Common Methods
Analysis of plasmid DNAAnalysis of plasmid DNA– Plasmid sizePlasmid size
– Restriction digestsRestriction digests Protein analysisProtein analysis
– Outer membrane protein (OMP) analysisOuter membrane protein (OMP) analysis
– Multilocus enzyme typing (MLE)Multilocus enzyme typing (MLE)
Click for larger picture
Recognition Sequences ofRecognition Sequences ofSelected Restriction EndonucleasesSelected Restriction Endonucleases
EndonucleaseEndonuclease
EcoREcoR I I
HindHind III III
HhaHha II II
Sequence Sequence GAATTC GAATTC
CTTAAG CTTAAG
AAGCTTAAGCTT
TTCGAATTCGAA
CCGGCCGG
GGCCGGCC
SourceSource
Escherichia coliEscherichia coli RY13 RY13
H. influenzaeH. influenzae Rd Rd
H. parainfluenze H. parainfluenze
DNA Cutting by DNA Cutting by HIND HIND III: StaggeredIII: StaggeredCuts Leaving “Sticky” EndsCuts Leaving “Sticky” Ends
TTCGAATAAGCTTCCCTGAGAAGCTTATTCGAAGGGACTC
TTCGAATA AAGCTTATTCG
AGCTTCCCTGAG AAGGGACTC++
General principals of molecular subtyping General principals of molecular subtyping using restriction endonucleasesusing restriction endonucleases
ElectrophoresisElectrophoresis
= Restriction endonuclease (“molecular scissors”)= Restriction endonuclease (“molecular scissors”)
..
..
.. ....
.. ..
..
..
.. = DNA sequence recognized by restriction endonuclease= DNA sequence recognized by restriction endonuclease
Bacterial chromosomal DNABacterial chromosomal DNA
Molecular Epidemiology in Infectious Diseases: Common Methods
Nucleic acid detectionNucleic acid detection –Plasmid sizePlasmid size
–Restriction digestsRestriction digests Phage typingPhage typing
Pulsed-Field Gel ElectrophoresisPulsed-Field Gel Electrophoresis
Genetic relatedness (dendrogram) analysisGenetic relatedness (dendrogram) analysis
Molecular Epidemiology in Infectious Diseases: Interpretation of Data
Heterogeneity within speciesHeterogeneity within species
Must have knowledge of frequency distribution Must have knowledge of frequency distribution
of subtypesof subtypes
Utility of individual method is species specificUtility of individual method is species specific
Molecular Epidemiology in Infectious Diseases: Requirements
Method must work with vast majority of isolatesMethod must work with vast majority of isolates
ReproducibilityReproducibility
Discrimination powerDiscrimination power
Ease of methodEase of method
Ease of interpretationEase of interpretation