ORIGINALARTICLE
Quaternary palaeoenvironmentaloscillations drove the evolution of theEurasian Carassius auratus complex(Cypriniformes, Cyprinidae)
Yun Gao1�, Shu-Yan Wang1,2�, Jing Luo3, Robert W. Murphy1,4,
Rui Du3, Shi-Fang Wu1, Chun-Ling Zhu1, Yan Li3, Andrei D. Poyarkov5,
Sang Ngoc Nguyen1,6, Peng-Tao Luan3 and Ya-Ping Zhang1,3*
1State Key Laboratory of Genetic Resources and
Evolution and Yunnan Laboratory of
Molecular Biology of Domestic Animals,
Kunming Institute of Zoology, The Chinese
Academy of Sciences, Kunming, China, 2School
of Life Sciences, University of Science and
Technology of China, Hefei, China,3Laboratory of Conservation and Utilization of
Bio-resources and Key Laboratory for Animal
Genetic Diversity and Evolution of High
Education in Yunnan Province, School of Life
Sciences, Yunnan University, Kunming, China,4Centre for Biodiversity and Conservation
Biology, Royal Ontario Museum, Toronto,
Ontario, Canada, 5A. N. Severtzov Institute of
Ecology and Evolution, Russian Academy of
Sciences, Moscow, Russia, 6Institute of Tropical
Biology, the Vietnamese Academy of Science
and Technology, Ho Chi Minh City, Vietnam
*Correspondence: Ya-Ping Zhang, State Key
Laboratory of Genetic Resources and Evolution,
Kunming Institute of Zoology, The Chinese
Academy of Sciences, Kunming 650223, China.
E-mail: [email protected]�These authors contributed equally.
ABSTRACT
Aim We sought to reconstruct the spatio-temporal genetic diversification in
goldfish of the Carassius auratus complex, which is widely distributed in Eurasia,
to test whether vicariance events or human-mediated translocations best
explained lineage divergence and genogeographical history.
Location East Asia and the Oriental islands including Japan, the Ryukyus and
Taiwan, and Europe, including Russia and the Czech Republic.
Methods We reconstructed the matrilineal history of Eurasian goldfish using
1876 sequences from the partial mitochondrial DNA control region (426 bp) and
191 complete sequences of cytochrome b (1140 bp) from 67 localities
representing most of the range of the species. Divergence times were estimated
using a Bayesian Markov chain Monte Carlo approach based either on molecular
clock data or on the fossil record. Genetic structure and the historical
demography of populations were analysed using partial correlation tests and
analyses of molecular variance.
Results Three lineages had high levels of regional specificity. Lineages A and B
from the main islands of Japan differed greatly from lineage C, which occurred on
the mainland, Taiwan and the Ryukyus. Lineages A and B had late Pliocene
origins. Six geographically constrained sublineages within lineage C had near-
simultaneous mid-Pleistocene divergences.
Main conclusions Genetic structure in the C. auratus complex appears to have
been driven by palaeoenvironmental perturbations rather than human
translocations. The disappearance of a land bridge in the Tsushima Strait
around 3.0 Ma is responsible for the separation of Japanese and continental
lineages; the estimated divergence time is 2.75–2.32 Ma. Fujian, China and
Vietnam appear to have provided important refugia for the C. auratus complex
during glaciation. After warm, moist summer monsoons intensified during the
mid-Pleistocene, goldfish are likely to have dispersed north-eastwards to
recolonize the Ryukyus via Taiwan and northwards to recolonize mainland
China.
Keywords
Dispersal, divergence dating, East Asia, Eurasian goldfish, glacial cycling,
monsoon oscillations, mtDNA, phylogeography, Pleistocene.
Journal of Biogeography (J. Biogeogr.) (2012) 39, 2264–2278
2264 http://wileyonlinelibrary.com/journal/jbi ª 2012 Blackwell Publishing Ltddoi:10.1111/j.1365-2699.2012.02755.x
INTRODUCTION
Glacial cycling from the Pliocene and through the Quaternary is
known to have caused dramatic climatic (Bray, 1979) and
biogeographical changes (Ogasawara, 1994; Kimura, 2002) on
mainland China as well as the nearby Oriental islands. These
oscillations, which included eustatic sea-level changes and the
concomitant formation of ephemeral land bridges, are likely to
have been imprinted in rapidly evolving and maternally
inherited mitochondrial genes (Hewitt, 1996, 2000) and in
the fossil record. When investigating the genetic consequences
of such events, it is important to consider that mesophilic and
aquatic organisms are more likely than xerophilic taxa to have
been affected by environmental perturbations (Murphy &
Aguirre-Leon, 2002). Further, genogeographical (sensu Sereb-
rovsky, 1928; phylogeographical sensu Avise et al., 1987)
investigations can be complicated by human-mediated trans-
locations (Kottelat, 1997; Kalous et al., 2007; Sakai et al., 2009),
especially when evaluating economically important species.
Quaternary glaciations are known to have had far-reaching
effects in the Northern Hemisphere. For example, palaeonto-
logical and genogeographical studies indicate that European
and North American species experienced repeated episodes of
contraction and expansion of their ranges due to major
climatic oscillations (Hewitt, 2000, 2004). Similarly, the fossil
record of mainland China suggests the early Pliocene fauna,
which was adapted to warm, wet weather, retreated south-
eastwards during glacial times when the northern regions
became much cooler and drier (Li et al., 2004). At times of
glaciation, several ancient lineages of warm freshwater fishes,
such as the members of the Cyprininae, are thought to have
gradually become extinct in cooler parts of the mainland
(Chen, 1998). Populations of freshwater fishes (Chen & He,
2000), frogs (Emerson & Berrigan, 1993), salamanders (Hay-
ashi & Matsui, 1988) and non-avian reptiles (Ota, 1998) in
Taiwan and the Ryukyus share close historical relationships
with eastern China, probably reflecting the occurrence of
ephemeral land bridges that connected these areas. Further,
genogeographical studies of Chinese freshwater fishes, includ-
ing Hemibagrus guttatus (Yang & He, 2008) and Neosalanx
taihuensis (Zhao et al., 2008), suggest that the trajectories of
the major Chinese rivers have changed. Regardless, little is
known about the effect of East Asian palaeoenvironmental
oscillations on the genetic structure, possible refugia and the
contraction and expansion routes of aquatic species.
The Carassius auratus complex (Cypriniformes, Cyprinidae)
is widely distributed across Eurasia, including the Oriental
islands, and is thought to have had opportunities to occupy
new environments (Berg, 1949; Nakamura, 1969; Eschmeyer,
1998). The complex had a late Pliocene origin and Pleistocene
radiation (see below). Consequently, the species can be used to
investigate the genetic consequences of Quaternary palaeoen-
vironmental changes in East Asia. This complex exhibits
remarkable morphological and genetic diversity and some wild
lineages are endemic to particular geographical regions. In
general, Carassius auratus auratus (Linnaeus, 1758) occurs in
mainland China (Nakamura, 1969; Meng et al., 1995; Luo
et al., 1999) and Carassius auratus gibelio (Bloch, 1782; the
gibel carp) is restricted to the northern Amur River systems
and eastern Europe (Cherfas, 1981; Jiang et al., 1983; Gui,
1997, 2007). Both Carassius auratus langsdorfii Temminck &
Schlegel, 1846 and Carassius auratus cuvieri Temminck &
Schlegel, 1846 occur on the main islands of Japan (Meng et al.,
1995; Luo et al., 1999). However, morphological similarity and
human-facilitated translocations among lineages of the C. au-
ratus complex can make the identification of subspecies
difficult.
Takada et al. (2010) have examined the matrilineal genealogy
of the East Asian C. auratus complex, mostly from Japan and
the Ryukyus. They have identified two major lineages and seven
sublineages with high regional specificity. Further, five possible
human-facilitated translocation routes have been proposed.
The potential impacts of historical geography and climatic
variation on continental samples of the species have been noted
as topics requiring further study. Herein, we investigate
genogeographical patterns based on substantially increased
sample sizes and locations from mainland China and Europe.
Partial control region (CR) sequences are surveyed because of
their high evolutionary rate of mutation (Tzeng et al., 1992;
Chang et al., 1994; Meyer, 1993; Broughton et al., 2001), but we
also sequence the entire cytochrome b gene (cyt b) of a subset of
individuals in order to evaluate the matrilineal genealogy of East
Asian samples within a broader geographical sample, including
Eurasian Carassius, because this gene is more conserved than the
CR (Moritz et al., 1987; Tzeng et al., 1992; Meyer, 1993; Johns &
Avise, 1998; Broughton et al., 2001). We also evaluate human-
mediated translocations by assessing whether the present
biogeographical patterns of lineages correspond either to
long-term isolation of resident populations or to records of
anthropogenic activities involving goldfish.
MATERIALS AND METHODS
Sampling and sequencing
Following animal-use protocols approved by the Kunming
Institute of Zoology Animal Care and Ethics Committee, we
collected 960 specimens of Carassius, primarily from mainland
China, Russia, Vietnam and Japan. The specimens were
identified morphologically to the lowest taxonomic category
possible. A total of 916 mitochondrial DNA (mtDNA) CR
sequences of Carassius with sampling localities were down-
loaded from GenBank. Altogether, we evaluated 1876
sequences of CR from mainland China (922 sequences),
Europe (Russia and the Czech Republic, 60 sequences), Taiwan
(43 sequences), Vietnam (4 sequences), the main islands of
Japan (366 sequences) and the Ryukyus (481 sequences). The
outgroup consisted of seven samples of Cyprinus carpio.
Detailed sampling localities and their corresponding voucher
specimen acronyms are listed in Table 1 and mapped in Fig. 1.
One or more specimens in our laboratory with unique CR
haplotypes were selected to estimate variation in the cyt b
Diversification of Eurasian goldfish
Journal of Biogeography 39, 2264–2278 2265ª 2012 Blackwell Publishing Ltd
Table 1 Sampling information for the 67 populations of the Carassius auratus complex in Eurasia in the present study.
Localities Code
Sample
size (n)
Haplotype
diversity (h)
Nucleotide
diversity (p) Groups
1 Puplovo, Russia RUA 13 0.7179 ± 0.0888 0.0342 ± 0.0185 Europe
2 Moscow*, Russia RUB 20 0.3684 ± 0.1351 0.0764 ± 0.0389
3 Ivanovsk, Russia RUC 13 0.3846 ± 0.1321 0.0255 ± 0.0139
4 Czech Republic� CZ 14 1.000 ± 0.0270 0.0258 ± 0.0140
5 Fangzheng, Heilongjiang FZ 40 0.7333 ± 0.0790 0.0080 ± 0.0049 Northern mainland China
6 Hulanhe, Heilongjiang HL 11 0.6182 ± 0.1643 0.0035 ± 0.0026
7 Shonghuajiang, Heilongjiang SH 20 0.8474 ± 0.0469 0.0148 ± 0.0082
8 Altay, Xinjiang AL 18 0.5000 ± 0.2652 0.0048 ± 0.0040
9 Irtysh River, Xinjiang ER 3 0.6667 ± 0.3143 0.0253 ± 0.0199
10 Habahe, Xinjiang HA 11 0.3273 ± 0.1533 0.0171 ± 0.0098
11 Tarim River, Xinjiang TL 4 0.8333 ± 0.2224 0.0127 ± 0.0092
12 Liaoyang, Liaoning LN 15 0.8095 ± 0.0782 0.0199 ± 0.0110
13 Dehong, Yunnan DH 17 0.6544 ± 0.0891 0.0058 ± 0.0037 Southern mainland China
14 Dali, Yunnan DL 48 0.8538 ± 0.0251 0.0101 ± 0.0057
15 Kunming, Yunnan KM 249 0.8006 ± 0.0184 0.0117 ± 0.0063
16 Lijiang, Yunnan LJ 31 0.8000 ± 0.0916 0.0062 ± 0.0039
17 Tengchong, Yunnan TC 11 0.5636 ± 0.1340 0.0047 ± 0.0032
18 Wenshan, Yunnan WS 4 0.8333 ± 0.2224 0.0214 ± 0.0149
19 Qinghai QH 44 0.8753 ± 0.0322 0.0200 ± 0.0105
20 Ningqiang, Shaanxi SX 7 0.8059 ± 0.1298 0.0039 ± 0.0030
21 Dongyin, Shandong SD 19 0.8304 ± 0.0490 0.0048 ± 0.0032
22 Yaan, Sichuan SC 33 0.8636 ± 0.0382 0.0385 ± 0.0196
23 Puan, Guizhou GZ 47 0.7266 ± 0.0523 0.0244 ± 0.0126
24 Guilin, Guangxi GX 25 0.9100 ± 0.0264 0.0088 ± 0.0051
25 Zongyang, Anhui ZY 34 0.9597 ± 0.0141 0.0208 ± 0.0109
26 Huaiyuan, Anhui HY 15 0.8381 ± 0.0852 0.0168 ± 0.0094
27 Hangzhou, Zhejiang HZ 13 0.9231 ± 0.0500 0.0061 ± 0.0039
28 Huzhou, Zhejiang HU 20 0.8895 ± 0.0380 0.0058 ± 0.0037
29 Wenzhou, Zhejiang WZ 11 0.7455 ± 0.0978 0.0074 ± 0.0047
30 Dongting, Hunan HN 36 0.8746 ± 0.0319 0.0254 ± 0.0131
31 Shashi, Hubei HB 32 0.9619 ± 0.0260 0.0854 ± 0.0432
32 Qihe�, Henan HE 11 0.7636 ± 0.1066 0.0124 ± 0.0073
33 Guangzhou, Guangdong GD 20 0.8857 ± 0.0686 0.0126 ± 0.0072
34 Longyan, Fujian LY 42 0.6942 ± 0.0523 0.0045 ± 0.0029
35 Zhangzhou, Fujian ZZ 31 0.7656 ± 0.0591 0.0174 ± 0.0093
36 Tra Khuc River, Vietnam VN 4 0.8333 ± 0.2224 0.0029 ± 0.0027 Vietnam
37 Taipei§, Taiwan TW 43 0.8051 ± 0.0303 0.0190 ± 0.0102 Taiwan
38 Amamioshima§, Ryukyus Am 21 0.5714 ± 0.0519 0.0071 ± 0.0045 South-central Ryukyus
39 Tokunoshima§, Ryukyus To 4
40 Iheya Island§, Ryukyus Ih 32 0.0625 ± 0.0577 0.0002 ± 0.0005
41 Izena Island§, Ryukyus Iz 59 0.5710 ± 0.0308 0.0110 ± 0.0063
42 Okinawajima§, Ryukyus Ok 242 0.8462 ± 0.0147 0.0293 ± 0.0149
43 Takashiki Island§, Ryukyus Tk 1
44 Zamami Island§, Ryukyus Za 27
45 Kume Island§, Ryukyus Ku 27 0.3333 ± 0.1105 0.0037 ± 0.0027
46 Minamidaito§, Ryukyus Mi 9
47 Ishigakijima§, Ryukyus Is 9 0.5556 ± 0.0902 0.0212 ± 0.0125
48 Tanegashima§, Ryukyus Ta 50 0.5902 ± 0.0404 0.0226 ± 0.0120 Northern Ryukyus
49 Sakasazawa§, Japan Ls 24 0.8188 ± 0.0391 0.0156 ± 0.0088 Japanese main islands
50 Fukushimagate§, Japan Lf 4 0.5000 ± 0.2652 0.0064 ± 0.0054
Y. Gao et al.
2266 Journal of Biogeography 39, 2264–2278ª 2012 Blackwell Publishing Ltd
sequences for further biogeographical analyses (see Appen-
dix S1 in Supporting information).
Genomic DNA from freshly frozen or ethanol-fixed tissues
was extracted using the standard phenol/chloroform method.
We amplified a partial CR sequence (426 bp) and the entire cyt
b gene (1140 bp; Table 2). A 50 lL polymerase chain reaction
(PCR) amplification was performed with final concentrations
of 1· buffer containing 0.15 mm MgCl2 (Sina-American,
Beijing, China), 0.25 mm dNTPs (Amresco, Solon, OH, USA),
0.8 lm of each primer (Takara, Shanghai, China), 1 U Taq
DNA polymerase (Sina-American) and 25–50 ng total DNA.
Amplifications were performed on a Gene Amp PCR system
9700 (Applied Biosystems, Foster City, CA, USA) with the
following thermal profile: an initial 2 min denaturation at
96 �C, followed by 30 cycles at 96 �C for 1 min, 1 min
annealing (CR, 58 �C; cyt b, 50 �C), and extension at 72 �C for
1 min, followed by a final extension at 72 �C for 10 min. The
PCR products were purified on agarose gels and extracted
(Watson BioMedical Inc., Shanghai, China). Double-stranded
PCR products were directly sequenced in both directions on an
ABI 3730 with ABI PRISM BigDye Terminator Cycle Sequenc-
ing Ready Reaction Kit (Applied Biosystems) according to the
manufacturer’s instructions.
Genealogical reconstruction
We used dnastar 5.0 (DNASTAR Inc., Madison, WI, USA) to
edit and initially align the sequences. The initial CR alignments
were manually adjusted where necessary. dambe 4.1.19 (Xia &
Xie, 2001) was used to identify unique haplotypes and mega
4.0 (Kumar et al., 2008; Tamura et al., 2007) was used to
extract information on nucleotide variation.
Two datasets were subjected to phylogenetic analyses:
unique CR haplotypes only (216 haplotypes) and combined
CR and cyt b (180 haplotypes). Trees were constructed using
maximum likelihood (ML), maximum parsimony (MP) and
Bayesian inference (BI). The ML and MP trees, obtained using
RAxML (Stamatakis et al., 2008) and paup* 4.0b10 (Swofford,
2002), respectively, involved a heuristic search with 100
random addition replicates. Likelihood ratio tests (Goldman,
1993a,b; Huelsenbeck & Crandall, 1997), as implemented in
Modeltest 3.7 (Posada & Crandall, 1998), were employed to
select the best-fitting models for the ML and BI analyses. The
HKY + I + G model was selected for the partitioned CR
dataset, and the TrN + I + G model for the combined dataset,
both based on the Akaike information criterion (AIC; Akaike,
1974). BI and Bayesian posterior probabilities (BPP) were
estimated using MrBayes 3.0b4 (Huelsenbeck & Ronquist,
2001; Ronquist & Huelsenbeck, 2003). BI used four simulta-
neous Metropolis-coupled Markov chain Monte Carlo
(MCMC) runs, each lasting 5,000,000 generations. The average
standard deviation of split frequencies was required to drop to
below 0.01, and the convergence diagnostic for branch length
posterior probabilities (potential scale reduction factor) to
approach 1 (Gelman & Rubin, 1992) after 1,000,000 genera-
tions. Convergence to stationarity was evaluated in tracer 1.5
Table 1 Continued
Localities Code
Sample
size (n)
Haplotype
diversity (h)
Nucleotide
diversity (p) Groups
51 Inawashiro§, Japan Li 6 0.3333 ± 0.2152 0.0053 ± 0.0042
52 Urano River§, Japan Ur 21 0.7048 ± 0.0935 0.0162 ± 0.0091
53 Kasumigaura§, Japan Lk 32 0.7379 ± 0.0511 0.0176 ± 0.0097
54 Magame River§, Japan Mr 15 0.1333 ± 0.1123 0.0051 ± 0.0036
55 Kamidokan Moat§, Japan Km 21 0.5524 ± 0.0658 0.0048 ± 0.0034
56 Nagara River§, Japan Nr 1
57 Lake Biwa§, Japan Lb 39 0.8475 ± 0.0415 0.0722 ± 0.0358
58 Kako River§, Japan Kr 6 0.6000 ± 0.2152 0.0072 ± 0.0053
59 Takatsu River§, Japan Tu 15
60 Shimato River§, Japan Sa 14 0.5824 ± 0.0919 0.0253 ± 0.0141
61 Shigenobu River§, Japan Sr 27 0.4701 ± 0.0962 0.0341 ± 0.0178
62 Iki Island§, Japan Ik 4 0.6667 ± 0.2041 0.0021 ± 0.0024
63 Takara River§, Japan Tr 18 0.4706 ± 0.0823 0.0015 ± 0.0015
64 Chikugo River§, Japan Cr 6 0.5333 ± 0.1721 0.0338 ± 0.0207
65 Sakai River–, Japan Sk 25 0.3913 ± 0.0912 0.0100 ± 0.0060
66 Shibuta River–, Japan Sb 70 0.8824 ± 0.0216 0.1260 ± 0.0611
67 Imba River–, Japan Ir 18 0.8676 ± 0.0446 0.1476 ± 0.0750
Note: Groups, sampling localities and the codes are mapped in Fig. 1, sample size (n) of the specimens together with the haplotype (h) and nucleotide
(p) diversity of the population are listed. The values of h and p equivalent to zero were not shown.
Source: *Three specimens from Takada et al. (2010).
�From Papousek et al. (2008).
�From Li & Gui (2007).
§From Takada et al. (2010).
–From Murakami et al. (2001).
Diversification of Eurasian goldfish
Journal of Biogeography 39, 2264–2278 2267ª 2012 Blackwell Publishing Ltd
(Rambaut & Drummond, 2009) using log-likelihood values.
The first 25% of the trees were discarded as burn-in and the
remaining tree samples were used to generate a consensus tree.
The BPP values were mapped onto the tree, and nodal support
for other tree building methods was assessed using nonpara-
metric bootstrapping (BS; Felsenstein, 1985) calculated in
paup* for the MP analysis (MPBS) and RAxML (Stamatakis
et al., 2008) for ML (MLBS) using 1000 pseudoreplicates each.
Estimation of divergence times
Divergence times among the main lineages of Carassius were
estimated using a Bayesian MCMC approach performed in
beast based on a strict molecular clock or fossil records
(Drummond & Rambaut, 2007; substitution model,
GTR + G + I; tree prior, constant size; 10,000,000 generations;
parameters logged every 1000; burn-in value = 1000). We used
two datasets to estimate the divergence time: unique cyt b
haplotypes only and combined CR and cyt b. The molecular
clock was assumed to be 2.0% site)1 Myr)1 (Meyer, 1993) for
the unique cyt b haplotypes. A node calibration estimated from
a fossil Carassius (Liu & Su, 1962) for the split between
Carassius carassius and the C. auratus complex was dated at
3.6–4.0 Ma. This date was also used in the analyses of the
combined data, and of cyt b alone.
Distribution patterns and hierarchical genetic
structure
To clarify the genogeographical relationships of C. auratus, we
classified the 1876 specimens sequenced for CR using the
combined tree as a backbone, and mapped the distribution of
the haplotypes for each sampling locality on Fig. 1. The
compiled data are listed in Appendix S1.
We used an analysis of molecular variance (AMOVA;
Excoffier et al., 1992; Excoffier & Lischer, 2010) and partial
correlation tests (PCTs) to identify the hierarchical genetic
structure of the C. auratus complex. Sampling localities in
mainland China were classified into eight groups as follows:
Yunnan-Guizhou plateau (e.g. Yunnan and Guizhou), the
Yellow River (e.g. Qinghai), the Pearl River (e.g. Guangxi and
Guangdong), the middle reach of the Yangtze River (e.g. Hunan
and Hubei), the lower Yangtze River (e.g. Anhui and Zhejiang),
the Minjiang River (e.g. Fujian), the Amur River (e.g. Hei-
longjiang and Liaoning) and the inland rivers in Xinjiang (e.g.
the Irtysh and Tarim rivers). AMOVA among the different
20
RUA RUB
8 10
3
241118
11
3
RUA RUC
AL
HA
ER
FZ
HL
SH 46Lk
Ur Lf
Ls
Li
Lk
40
21
5
13
2815
19
20
4
11
ER
TLQH
SCSX
HE
SD
HBHU
LN
154
6
18
Cr
Tr
Lk
Mr
Ik Tu
Sa
CZ
15
Sk
25
2144
32
15
HY
13
1
14
1134
SX
ZYTC
DL
KM
GZ
HB
HNHZ
WZ
TW
11732
13
20
9
a
Am
TaKm
LbKr
Sa
27
21
50
3647249
48
33
39
Sr Ir18
31ZZ b
1
6
Colour of lineages
Li C S bli C3Lineage C Sublineage C2Lineage C Sublineage C1Lineage BLineage A
43
27
32174
31
DH LJWS
GX
GD
20
25
4
Is
ZaTk
Ok
Iz
Mi
IhTo
591
70
Sb42
LY27
9
242 Nr
CC. carassiusLineage C Sublineage C6Lineage C Sublineage C5Lineage C Sublineage C4Lineage C Sublineage C3
Ku
VN
4
B
A
B
//
Figure 1 Geographical distribution and population structure of the Carassius auratus complex and C. carassius in Eurasia. Codes for
sampling localities are listed in Table 1. The inset shows the matrilineal genealogy (from Fig. 2) that depicts eight lineages. Each lineage or
sublineage is uniquely coloured. The number of mitochondrial DNA control region sequences is graphed for each location. Black bar ‘a’ is
the Tokara Gap and ‘b’ is the Kerama Gap.
Y. Gao et al.
2268 Journal of Biogeography 39, 2264–2278ª 2012 Blackwell Publishing Ltd
drainage basins and populations within each Chinese drainage
basin was implemented using Arlequin 3.5 (Excoffier & Lischer,
2010). We also tested whether or not geographical structure
existed in each of the drainage basins. The drainage basin matrix
value was set to 0 for individuals from the same drainage basin,
and to 1 if in different drainage basins. Geographical distance
was estimated as the Euclidean distance obtained from the
longitude and latitude of sampling localities. Pairwise genetic
differentiation values (FST) were calculated using Arlequin
(Appendix S2). PCTs were used to assess congruence between
genealogical divergence and geographical distance within each
drainage basin (Smouse et al., 1986; Thorpe et al., 1996; Kozak
et al., 2006). PCTs between FST and geographical distance (D) in
each drainage basin were implemented by spss 15 (2006; SPSS
Inc., Chicago, IL, USA). Arlequin was also used to calculate
haplotypic (h) and nucleotide (p) diversity.
RESULTS
Sequence variation
Hyper-variable CR sequences consisted of 426 nucleotide
positions of which 130 were variable (106 potentially parsi-
mony informative). The downloaded data included 916
individuals having 323 nucleotide positions, which were
aligned against our longer fragment. A total of 216 haplotypes
were found in the 1876 samples of Carassius from 67 Eurasian
localities including the Oriental islands and the seven outgroup
sequences (Appendix S1).
The 1140 bp of cyt b had 303 variable sites (232 potentially
parsimony informative), and 110 unique haplotypes were
identified from our 197 specimens (Appendix S1) plus the
downloaded sequences (including the outgroup taxa). The
combined CR and cyt b dataset contained 1566 bp, with 423
variable sites (371 potentially parsimony informative).
Because some of the CR haplotypes in GenBank were not
associated with cyt b sequences, the combined data
distinguished 180 unique haplotypes including six from the
outgroup.
Matrilineal genealogy
BI, MP and ML analyses based on partitioned CR sequences
yielded essentially the same genealogy; variation was restricted
to poorly supported nodes. Although most terminal lineages
were well supported by all methods of analysis, the relation-
ships between sublineages were still unresolved. The matrilin-
eal genealogy based on unique CR haplotypes is presented in
Appendix S3.
Analyses of the combined data yielded essentially the same
topology as the supermatrix tree of Takada et al. (2010), except
for the position of C. carassius and the two new sublineages
(Fig. 2). In their tree, C. carassius appeared to have diverged
after C. a. cuvieri, although without support, presumably
because of the missing CR, ND4 and ND5 data. In our tree,
the two haplotypes of C. carassius from Russia clustered
together (MLBS = 100%, MPBS = 100%, BPP = 100%) and
then formed the sister group of the C. auratus complex,
including C. a. cuvieri, with robust support (MLBS = 100%,
MPBS = 100%, BPP = 100%).
The relationships between (sub)lineages within the C. auratus
complex were more clearly resolved in the analyses of combined
data than when using partitioned CR sequences alone. Within the
C. auratus complex, three major lineages with high support were
identified. First, lineage A included individuals of C. a. cuvieri
from the main islands of Japan (MLBS = 100%, MPBS = 100%,
BPP = 100%). Second, lineage B (superclade A of Takada et al.,
2010) included individuals of C. a. langsdorfii from the main
islands of Japan and the northern Ryukyus (MLBS = 94%,
MPBS = 98%, BPP = 100%). It differed from the CR tree
(Appendix S3), in which lineage B fell within the sublineages of
lineage C, albeit without support. Considering the absence of
support, the two trees were considered to be compatible. Finally,
lineage C (superclade B of Takada et al., 2010) contained the
Table 2 Primer sequences used to amplify by PCR and sequence mitochondrial DNA genes of the genus Carassius.
Target Primer Sequence (5¢ fi 3¢) References
For PCR
cyt b PF15239 TTTAACCGAGACCAATGACT’ This study
PR16473 ACAAGACCGATGCTTTTAT This study
CR DL16526 TCACCCCTGGCTACCAAAGCCAG Luo et al. (2004)
DH478 TGCATATAAAAGAAYGCTCGGCATG Luo et al. (2004)
For sequencing
cyt b PF15239 TTTAACCGAGACCAATGACT This study
PR16473 ACAAGACCGATGCTTTTAT This study
SR16077 ATTRGCTGGRGTGAAGTTTT This study
SF15624 CAAAGAAACCTGAAACAT This study
SR15649 CTACYCCAATGTTTCAGGTT This study
SF15950 TTTCTTTCCACCCATACT This study
CR DL16543 CTCCCAAAGCCAGAATTCTAAAC This study
DH478 TGCATATAAAAGAAYGCTCGGCATG Luo et al. (2004)
PCR, polymerase chain reaction; CR, control region; cyt b, cytochrome b gene.
Diversification of Eurasian goldfish
Journal of Biogeography 39, 2264–2278 2269ª 2012 Blackwell Publishing Ltd
h60B79
Figure 2 Matrilineal genealogy of the Carassius auratus complex and C. carassius in East Asia generated from 1566 bp of combined
mitochondrial DNA, cytochrome b and partial control region sequences generated by Bayesian inference (BI) using unique haplotypes only;
the scale bar indicates substitutions per site. Numbers above the branches represent branch support (> 50%) for maximum parsimony and
maximum likelihood estimations (bootstrap) and Bayesian posterior probabilities, respectively. Numbers below branches denote estimated
divergence dates listed in Table 3; nodes with fossil records are marked with an asterisk.
Y. Gao et al.
2270 Journal of Biogeography 39, 2264–2278ª 2012 Blackwell Publishing Ltd
Eurasian group including specimens from mainland China,
Taiwan, Russia, the Czech Republic, Vietnam and the south-
central Ryukyus (MLBS = 87%, MPBS = 81%, BPP = 100%).
Six geographically constrained sublineages were identified
within lineage C (Fig. 2) of which two (C1 and C5) were newly
discovered. Sublineage C1, which was the sister group to the
Figure 2 Continued
Diversification of Eurasian goldfish
Journal of Biogeography 39, 2264–2278 2271ª 2012 Blackwell Publishing Ltd
rest of C, only included individuals from Vietnam and Fujian,
China (MLBS = 83%, BPP = 80%). This sublineage was not
resolved by Takada et al. (2010). Sublineage C2 (clade V of
Takada et al., 2010; MLBS = 95%, MPBS = 62%,
BPP = 100%) included the gibel carp mainly from northern
mainland China and Europe. Sublineages C3 (clade VI of
Takada et al., 2010; MLBS = 97%, MPBS = 99%,
BPP = 100%) and C4 (clade IV of Takada et al., 2010;
MLBS = 70%, MPBS = 97%, BPP = 100%) contained haplo-
types generally from the south-central Ryukyus, Japan, Taiwan
and Anhui and Fujian, China. Within sublineage C4, the
haplotypes from mainland China (h41B34 and h94B34;
Fujian) rooted more basally than those from the Ryukyus.
Haplotypes in sublineage C4 were only found south of the
Tokara Gap. Sublineage C5 (MLBS = 100%, MPBS = 99%,
BPP = 100%), which was also not resolved by Takada et al.
(2010), only included individuals from localities close to the
Yangtze River. Sublineage C6 (Clade VII of Takada et al.,
2010) included about 40% of all sampled individuals, most of
which were from southern mainland China. This sublineage
received low support in the ML and MP analyses, but high
support in the BI treatment (BPP = 98%).
Estimated times of divergence
In the two beast analyses based on cyt b only, lineage A
(C. a. cuvieri) clustered with lineage B (C. a. langsdorfii)
first, and the sublineages C3 and C4 exchanged relative
positions. The substitution rate of cyt b was independently
estimated to be 2.09% site)1 Myr)1 based on a nodal
calibration (C. carassius–C. auratus complex) dated at
around 3.6–4.0 Ma (Liu & Su, 1962) using cyt b only. The
divergence time between C. carassius and the C. auratus
complex was estimated to be 4.76 Ma [95% confidence
interval (CI): 3.51–5.96] based on cyt b only using the
assumed molecular clock (2.0% site)1 Myr)1, Meyer, 1993)
corresponding well to the fossil-calibrated estimate. The
beast and BI analyses of combined cyt b and CR sequences
resulted in similar topologies.
Estimated divergence times calculated in all analyses were
similar to each other (Table 3). The separation of Cyprinus and
Carassius occurred about 11.11–9.14 Ma. The two species of
Carassius split around 4.76–3.45 Ma, which matched the fossil
calibration. Lineage A (C. a. cuvieri) split around 2.75–
2.32 Ma and lineages B (C. a. langsdorfii) and C separated
around 2.35–1.80 Ma.
Within lineage C, goldfish from Fujian, China and Vietnam
(sublineage C1) were estimated to have separated first around
0.79–0.69 Ma, followed shortly thereafter by the near simul-
taneous divergences of sublineages C2–C6 at about
0.68–0.59 Ma. Most recently, lineages from Taiwan and the
south-central Ryukyus in sublineage C3 separated around
0.21–0.17 Ma, and within sublineage C4, lineages from the south-
central Ryukyus were isolated around 0.12–0.11 Ma (Table 3).
Table 3 Estimated divergence time for
the Carassius auratus complex from
C. carassius calculated by three approaches.
Node no.
Estimated divergence time
based on combined CR
and cyt b dataset (Ma)
Estimated divergence time based on cyt b only
(Ma)
Based on fossil
calibration for the
C. carassius–C. auratus
complex (3.6–4.0 Ma)
Based on fossil
calibration for the
C. carassius–C. auratus
complex (3.6–4.0 Ma)
Based on molecular
clock of cyt b (2.0%
site)1 Myr)1)
1 9.14 (5.76–12.96) 9.34 (6.80–12.50) 11.11 (7.60–15.70)
2* 3.45 (2.38–4.40) 4.33 (3.27–5.45) 4.76 (3.51–5.96)
3 2.32 (1.43–3.13) 2.64 (2.10–3.25) 2.75 (2.12–3.36)
4 1.80 (1.21–2.54) 2.26 (1.72–2.82) 2.35 (1.84–3.00)
5 0.02 (0.00–0.04) 0.03 (0.00–0.07) 0.03 (0.00–0.07)
6 0.78 (0.46–1.08) 1.02 (0.73–1.33) 1.03 (0.75–1.36)
7 0.69 (0.42–0.98) 0.77 (0.58–0.97) 0.79 (0.60–0.99)
8 0.59 (0.34–0.81) 0.68 (0.53–0.87) 0.64 (0.47–0.79)
9 0.53 (0.31–0.77) 0.53 (0.34–0.73) 0.53 (0.35–0.73)
10 0.30 (0.17–0.46) 0.18 (0.08–0.29) 0.18 (0.09–0.29)
11 0.21 (0.11–0.32) 0.17 (0.07–0.28) 0.17 (0.08–0.28)
12 0.23 (0.12–0.35) 0.25 (0.12–0.38) 0.26 (0.13–0.38)
13 0.15 (0.08–0.22) 0.15 (0.08–0.22) 0.15 (0.08–0.23)
14 0.23 (0.13–0.34) 0.18 (0.12–0.26) 0.19 (0.03–0.12)
15 0.12 (0.06–0.18) 0.11 (0.05–0.17) 0.11 (0.12–0.27)
CR, control region; cyt b, cytochrome b gene.
Node numbers listed in the first row correspond to those given below the branches in Fig. 2. The
node with fossil record was marked with asterisk. The confidence intervals follow the estimated
dates (in parentheses).
Y. Gao et al.
2272 Journal of Biogeography 39, 2264–2278ª 2012 Blackwell Publishing Ltd
Distributional pattern and hierarchical genetic
structure
Within sublineage C1, no haplotypes were shared between
Fujian, China and Vietnam. Populations in sublineage C2 from
the Amur River and the Czech Republic had many unique
haplotypes and exhibited greater polymorphism than did those
from southern China and Russia. Furthermore, all four
haplotypes of sublineage C2 found in southern China were
shared with northern China. Haplotype GH1 was widespread
across mainland China and Europe. Sublineages C3 and C4,
which were widespread in mainland China (Fig. 2), were also
distributed south of the Tokara Gap only (Fig. 1). Mainland
China and the Ryukyus did not share haplotypes (Fig. 2,
Appendix S1), even when all the sequences were cut to the
same length of 323 bp. Within sublineages C5 and C6, the
genetic diversity from southern mainland China was much
higher than that from northern mainland China and Europe.
Haplotypes h55 and h56 were widespread across mainland
China (Appendix S1).
The AMOVA analysis, which focused on the mainland,
detected significant genetic divergence among the six drainage
basins (FCT = 0.415, P < 0.01). A smaller but significant
amount of genetic divergence (FSC = 0.183, P < 0.01) was
found among populations within each drainage basin. A
significant positive correlation occurred between genetic
divergence and geographical distance in each of the drainage
basins in mainland China (r = 0.237, P < 0.001). These
results indicated a significant, and probably old, genealogical
divergence within and among mainland Chinese drainage
basins.
DISCUSSION
Natural versus human-facilitated dispersal
of Carassius
Our genealogical and population genetic analyses strongly
suggest that the haplotypic patterns mostly reflect natural
occurrences, as originally reported by Takada et al. (2010).
Artificial introductions are evident only at a low frequency
among the different lineages. Only 27 of 366 samples of
sublineage C6 (C. a. auratus) from the main islands of Japan
are identified as being recent translocations; each of these 27
individuals has one of three common mainland haplotypes.
Given the history of goldfish domestication (Wang, 1985), the
Japanese occurrence of sublineage C6 is not unexpected. In
addition, the sporadic distribution of haplotypes GH1 and
GH2 (sublineage C2; gibel carp) in southern China (77/800
individuals) might reflect escapes from hatcheries. This taxon
– and in particular these two haplotypes – naturally occurs in
the Amur River and eastern Europe and it is widely cultured
in mainland Chinese hatcheries (Zhou et al., 2000; Zhou &
Gui, 2002; Li & Gui, 2007). Similarly, C. a. langsdorfii (lineage
B), originally from the main islands of Japan (Luo et al.,
1999), occurs sporadically in the south-central Ryukyus (42/
431 individuals). Among the 42 individuals, 31 have four of
the six haplotypes shared with the main islands of Japan. This
pattern may reflect human-facilitated translocations from the
main islands of Japan to the south-central Ryukyus, noted in
the historical record (Senou, 1985; Takada & Tachihara,
2009).
Although sporadic human-facilitated translocations are
evident, they do not play a major role in the present
distributions of the lineages. All specimens of C. carassius are
from Russia and the Czech Republic (Fig. 1, Appendix S1) and
this corresponds with their native distribution from the Irtysh
River in China to Europe and the British Isles (Wheeler, 1977,
2000; Meng et al., 1995; Luo et al., 1999). Over 90% of the
samples from the main islands of Japan belong to either lineage
A (C. a. cuvieri) or lineage B (C. a. langsdorfii; Fig. 1, Appen-
dix S1). All mainland Chinese samples are identified as
belonging to lineage C (Fig. 1). Within sublineages C3 and
C4, although the populations from the Ryukyus and mainland
China have a close genealogical relationship, the localities do
not share any haplotypes. If the population from the south-
central Ryukyus is the result of translocation, then its
haplotypes should be shared with eastern China. Recently, a
Pleistocene fossil Diplothrix was recorded from the deposits of
Renzidong Cave in Anhui, and its age pre-dates the first
appearance of this species in the Ryukyus (Wang & Jin, 2009;
Wang et al., 2010). Given that Diplothrix and the C. auratus
complex have nearly identical distributions, we infer that the
close relationship between the C. auratus complex from
eastern mainland China and the south-central Ryukyus is the
result of a natural Pleistocene dispersal and not human-
mediated translocations.
Vicariance event in the C. auratus complex between
mainland China and Japan
Today’s freshwater ichthyofaunas from the Japanese islands
and China differ dramatically, while those of the Pliocene and
Miocene appear to have resembled each other. Our intensive
study of samples from the rich East Asian C. auratus complex
indicates that the evolutionary history of the complex is likely
to be a result of Quaternary palaeogeographical events. Fossils
indicate that in the late Pliocene, C. auratus was distributed
across the continent and the main islands of Japan (Liu & Su,
1962; Zhang & Chen, 2000). The main islands of Japan and
mainland China are known to have formed a contiguous land
mass in the late Pliocene (Kimura, 1996a,b). Their isolation is
likely to have occurred in the last 3.0 Myr due to the
disappearance of a land bridge in the Tsushima Strait
(Ogasawara, 1994; Kimura, 2002). Stratigraphic data corrob-
orate the genetic evidence that Japanese lineages A and B
separated from lineage C around 2.75–1.80 Ma (Fig. 2,
Table 3). This vicariance event appears to be responsible for
the independent evolution of the insular and continental
lineages (Fig. 3). Our evolutionary reconstruction is consistent
with ichthyofaunal studies of both extant (Chen, 1998) and
fossil (Zhang & Chen, 2000) species.
Diversification of Eurasian goldfish
Journal of Biogeography 39, 2264–2278 2273ª 2012 Blackwell Publishing Ltd
Historical demography of the C. auratus complex
in mainland China
Isolation by distance (IBD) between different drainage basins best
explains genetic divergence in the Chinese C. auratus complex
(UCT = 0.415, P < 0.01). However, IBD also explains a signifi-
cant amount of variation (r = 0.237, P < 0.001) within drainages.
Patterns of divergence suggest natural historical events.
Genealogical analyses both of the CR sequences (Group 2,
Appendix S3) and of the concatenated data (sublineage C2,
Fig. 2) cluster the haplotypes of gibel carp with strong support.
Sublineage C2 from the Amur River system is far more
polymorphic than sublineages from southern China. This
discovery corresponds to previous suggestions that the gibel
carp has a northern origin (Cherfas, 1981; Jiang et al., 1983;
Luo et al., 1999; Gui, 2007). Populations of C. a. auratus from
southern mainland China (sublineages C5, C6), especially
those downstream in the Yangtze River, have the highest levels
of genetic diversity. This may be the result of repeated episodes
of range contraction and expansion during glacial cycling.
Mainland Chinese rivers, except for the Amur and inland
rivers in Xinjiang, are known to have flowed north-eastwards
and repeatedly anastomosed with one another during post-
glacial and Holocene times because of erosion (Yap, 2002);
stream capture and the mixing of independently evolved
lineages of goldfish is likely to have been common and the
genetic signal of these events persists today.
Refugia and dispersal routes of the C. auratus
complex in East Asia
Pleistocene glacial cycling had a major impact on monsoon
oscillations as well as subaerial landmasses and, consequently,
the East Asian biota. East Asian winter monsoons have
intensified, and the summer monsoons have weakened, since
about 2.6 Ma (An et al., 2001, 2006; Shi, 2002). As a result,
north-western regions were cold and dry, and south-eastern
mainland China was warm and humid (Chen, 1998; An et al.,
2006). Our analyses revealed that sublineages C1–C6 diverged
after 0.79–0.69 Ma. Sublineage C1 occurred only in warm and
moist tropical or subtropical areas (Vietnam and Fujian,
China; Fig. 1; Shi, 2002). Vietnam and Fujian, China, may
have provided important refugia for East Asian freshwater
fishes during glaciations. Strengthening cold and dry winter
monsoons forced the southward retreat of East Asian fresh-
water fishes. Whereas Chen (1998) proposed that the retreat
stopped at the Yangtze River, our analyses suggested they went
far south of this river. During interglacial times since 1.0–
0.78 Ma, the warm, wet East Asian summer monsoons
intensified (An et al., 2006; Ye et al., 2007). Lineages of the
C. auratus complex may have dispersed north-eastwards to
recolonize the Ryukyus via Taiwan, and northwards to
recolonize mainland China.
The genogeography of the C. auratus complex provides
evidence of ephemeral land bridges. During glaciations, the
2.75-1.80 Ma
4.76-3.45 Ma
C. carassiusChinese lineage Japanese
0.79-0.69 Ma lineage
A &B
C
C1C2-C6
12
FujianTokara Gap
C3 & C4
Vietnam
Figure 3 Scenario for the evolutionary history of the Carassius auratus complex and C. carassius in East Asia. A vicariance event for the
C. auratus complex between mainland China (lineage C) and Japan (lineages A and B) occurred after 3.0 Ma. Lineage C of the C. auratus
complex radiated across mainland China and dispersed north-eastwards to the Ryukyus as far as the Tokara Gap via a land bridge between
Taiwan and the mainland when East Asian summer monsoons were enhanced after 1.0–0.78 Ma. Two fossil records for the genus Carassius
are also mapped with numbers as follows: 1, Yushe, Shanxi (Liu & Su, 1962); 2, Lake Biwa (Kodera, 1985).
Y. Gao et al.
2274 Journal of Biogeography 39, 2264–2278ª 2012 Blackwell Publishing Ltd
shoreline of mainland China appears to have expanded about
600 km eastwards when the sea level was 120–140 m lower
than today (Li et al., 2004). Pleistocene sea-level changes and
tectonic activities are responsible for the formation and
destruction of land bridges between the southern Ryukyus
and mainland China (Kizaki & Oshiro, 1977, 1980; Ujiie,
1990). However, it remains unclear whether the land bridges
extended to the Kerama (Ota, 1998) and Tokara gaps (Kimura,
1996a; b; Kizaki & Oshiro, 1977, 1980) or to the main islands
of Japan (Ujiie, 1990; Ujiie et al., 1991). Lineages from the
south-central Ryukyus and Taiwan closely cluster with those
from eastern China; these insular lineages only occur south of
the Tokara Gap (Fig. 1). Sublineages C3 and C4 are distributed
in mainland China (Fig. 2). In contrast, lineages from the main
islands of Japan occur only north of the Tokara Gap (Fig. 1).
Thus, terrestrial and freshwater connections between the
Ryukyus and eastern mainland China do not appear to have
passed the Tokara Gap. The same biogeographical pattern also
occurs in most amphibians and non-avian reptiles (Ota, 1998;
Otsuka & Takahashi, 2000) and the murine Diplothrix (Wang
& Jin, 2009; Wang et al., 2010) from the Ryukyu Archipelago.
The estimated dispersal times of 0.26–0.11 Ma (Fig. 2;
Table 3) are coincident with land-bridge connections that
existed 0.2–0.02 Ma (Kimura, 1996a, b). Thus, it is likely that
the C. auratus complex dispersed from mainland China via
Taiwan to the Ryukyus. The increased diversity of haplotypes
may reflect mutations accumulated through repeated intergla-
cial isolation events when sea levels were high (Fig. 3).
CONCLUSIONS
Our study supports the proposition that the genealogical
history of the C. auratus complex in Eurasia is mainly a result
of Quaternary palaeogeographical and palaeoclimatic pertur-
bations rather than recent human-mediated translocations.
Three distinct, mostly geographically constrained, matrilineag-
es document a vicariance event around 3.0 Ma – the disap-
pearance of a land bridge in the Tsushima Strait – for
populations on Japan and the continent (estimated divergence
time around 2.75–2.32 Ma). The newly detected older sublin-
eage C1 from Fujian, China and Vietnam appears to identify
important refugia for the C. auratus complex during glaciation.
Warm, moist summer monsoons were enhanced during the
mid-Pleistocene and in response it is likely that goldfish
dispersed north-eastwards from refugia to occupy the Ryukyus
via Taiwan, but stopping at the Tokara Gap. A second lineage
seems to have recolonized mainland China during interglacial
times. Additional molecular markers and more extensive
sampling, especially from Siberia and the Far East, may identify
lineages involved in the early evolution of Eurasian Carassius.
ACKNOWLEDGEMENTS
We gratefully acknowledge Yong-yi Shen, Qing-peng Kong,
Zhe-kun Zhou, David M. Irwin, and Mi-man Zhang for
valuable comments. We thank Yong-gang Yao, Kai Zhao,
Tian-xiang Gao, Shao-jun Liu, Xin-hua Chen, Sheng-guo
Fang, Yun-fa Ge, Xin-wen Bo, Zi-ming Chen, Nikolai A.
Poyarkov, Ekaterina D. Vasil’eva, Mu-yeong Lee and many
other individuals for collecting samples important to this
study. Amy Lathrop assisted with preparation of the figures.
This work was supported by grants from the State Key Basic
Research and Development Plan (2007CB411600), the Bureau
of Science and Technology of Yunnan Province, the National
Natural Science Foundation of China (30600065 and
30870291) and the ‘Western Light programme’ of the Chinese
Academy of Sciences to Y.G. J.L. was funded by the State Key
Laboratory of Genetic Resources and Evolution and R.W.M.
was supported by a Visiting Professorship for Senior Interna-
tional Scientists from the Chinese Academy of Sciences.
REFERENCES
Akaike, H. (1974) A new look at statistical model identification.
IEEE Transactions on Automatic Control, AC-19, 716–723.
An, Z.S., Kutzbach, J.E., Prell, W.L. & Porter, S.C. (2001)
Evolution of Asian monsoons and phased uplift of the
Himalaya–Tibetan Plateau since Late Miocene times. Nat-
ure, 411, 62–66.
An, Z.S., Zhang, P.Z., Wang, E.C., Wang, S.M., Qiang, X.K., Li,
L., Song, Y.G., Chang, H., Liu, X.D., Zhou, W.J., Liu, W.G.,
Cao, J.J., Li, X.Q., Shen, J., Liu, Y. & Ai, L. (2006) Changes
of the monsoon-arid environment in China and growth of
the Tibetan Plateau since the Miocene. Quaternary Sciences,
26, 678–693 (in Chinese).
Avise, J.C., Arnold, J., Ball, R.M., Bermingham, E., Lamb, T.,
Neigel, J.E., Reeb, C.A. & Saunders, N.C. (1987) Intraspe-
cific phylogeography: the mitochondrial DNA bridge be-
tween population genetics and systematics. Annual Review of
Ecology and Systematics, 18, 489–522.
Berg, L.S. (1949) Freshwater fishes of the USSR and adjacent
countries, Part II. Academy of Sciences of the USSR, Moscow
and Leningrad (in Russian).
Bray, J.R. (1979) Neogene explosive volcanicity, temperature
and glaciations. Nature, 282, 603–605.
Broughton, R.E., Milam, J.E. & Roe, B.A. (2001) The complete
sequence of the zebrafish (Danio rerio) mitochondrial gen-
ome and evolutionary patterns in vertebrate mitochondrial
DNA. Genome Research, 11, 1958–1967.
Chang, Y.S., Huang, F.L. & Lo, T.B. (1994) The complete
nucleotide sequence and gene organization of carp (Cypri-
nus carpio) mitochondrial genome. Journal of Molecular
Evolution, 38, 138–155.
Chen, Y.Y. (ed.) (1998) Fauna Sinica, Osteichthyes, Cyprini-
formes II. Science Press, Beijing (in Chinese).
Chen, Y.Y. & He, S.P. (2000) Freshwater fishes distribution in
Taiwan and continent of China and its biogeographical
significance. Progress in Natural Science, 11, 411–416 (in
Chinese).
Cherfas, N.B. (1981) Gynogenesis in fishes. Genetic bases of fish
selection (ed. by V.S. Kirichnikov), pp. 255–273. Springer,
Berlin.
Diversification of Eurasian goldfish
Journal of Biogeography 39, 2264–2278 2275ª 2012 Blackwell Publishing Ltd
Drummond, A.J. & Rambaut, A.J. (2007) BEAST: Bayes evo-
lutionary analysis by sampling trees. BMC Evolutionary
Biology, 7, 214.
Emerson, S.B. & Berrigan, D. (1993) Systematics of South-
east Asian ranids: multiple origins of voicelessness in the
subgenus Limnonectes (Fitzinger). Herpetologica, 49, 22–
31.
Eschmeyer, W.N. (1998) Catalog of fishes. Special Publication
No. 1. Center for Biodiversity Research and Information,
California Academy of Sciences, San Francisco.
Excoffier, L. & Lischer, H.E.L. (2010) Arlequin suite v.3.5: a
new series of programs to perform population genetics
analyses under Linux and Windows. Molecular Ecology
Resources, 10, 564–567.
Excoffier, L., Smouse, P.E. & Quattro, J.M. (1992) Analysis of
molecular variance inferred from metric distances among
DNA haplotypes: application to human mitochondrial DNA
restriction data. Genetics, 131, 479–491.
Felsenstein, J. (1985) Confidence limits on phylogenies: an
approach using the bootstrap. Evolution, 39, 783–791.
Gelman, A. & Rubin, D.B. (1992) Inference from iterative
simulation using multiple sequences. Statistical Science, 7,
457–511.
Goldman, N. (1993a) Statistical tests of models of DNA sub-
stitution. Journal of Molecular Evolution, 36, 182–198.
Goldman, N. (1993b) Simple diagnostic statistical tests of
models of DNA substitution. Journal of Molecular Evolution,
37, 650–661.
Gui, J.F. (1997) Retrospects and prospects of studies on the
mechanism of natural gynogenesis in silver crucian carp
(Carassius auratus gibelio). Bulletin of the National Natural
Science Foundation of China, 1, 11–16 (in Chinese).
Gui, J.F. (2007) Genetic basis and artificial control of sexuality
and reproduction in fish. Science Press, Beijing (in Chinese).
Hayashi, T. & Matsui, M. (1988) Biochemical differentiation in
Japanese newts, genus Cynops (Salamandridae). Zoological
Science, 5, 1121–1136.
Hewitt, G.M. (1996) Some genetic consequences of ice ages,
and their role in divergence and speciation. Biological Jour-
nal of the Linnean Society, 58, 247–276.
Hewitt, G.M. (2000) The genetic legacy of the Quaternary ice
ages. Nature, 405, 907–913.
Hewitt, G.M. (2004) The structure of biodiversity – insights
from molecular phylogeography. Frontiers in Zoology, 1, 4.
Huelsenbeck, J.P. & Crandall, K.A. (1997) Phylogeny estima-
tion and hypothesis testing using maximum likelihood.
Annual Review of Ecology and Systematics, 28, 437–466.
Huelsenbeck, J.P. & Ronquist, F. (2001) MRBAYES: Bayesian
inference of phylogenetic trees. Bioinformatics, 17, 754–755.
Jiang, Y.G., Liang, S.C., Chen, B.D., Yu, H., Shan, S.X., Yang,
D.L., Lin, S.E. & Shen, G.Q. (1983) Biological effect of
heterologous sperm on gynogenetic offspring in Carassius
auratus gibelio. Acta Hydrobiologica Sinica, 8, 1–13 (in
Chinese with English abstract).
Johns, G.C. & Avise, J.C. (1998) A comparative summary of
genetic distances in the vertebrates from the mitochondrial
cytochrome b gene. Molecular Biology and Evolution, 15,
1481–1490.
Kalous, L., Slechtova, V., Jr, Bohlen, J., Petrtyl, M. &
Svatora, M. (2007) First European record of Carassius
langsdorfii from the Elbe Basin. Journal of Fish Biology, 70,
132–138.
Kimura, M. (1996a) Quaternary paleogeography of the Ryukyu
Arc. Journal of Geography, 105, 259–285 (in Japanese with
English abstract).
Kimura, M. (1996b) Palaeogeography of the Ryukyu Arc.
Chikyu Monthly, 18, 488–494 (in Japanese).
Kimura, M. (ed.) (2002) The formation of the Ryukyu Arc and
migration of biota to the arc. Okinawa Times, Naha (in
Japanese).
Kizaki, K. & Oshiro, I. (1977) Paleogeography of the Ryukyu
Islands. Marine Science Monthly, 9, 542–549.
Kizaki, K. & Oshiro, I. (1980) The origin of the Ryukyu Is-
lands. Natural history of the Ryukyus (ed. by K. Kizaki), pp.
8–37. Tsukiji-shokan, Tokyo (in Japanese).
Kodera, H. (1985) Paleontological evidence for appearance of a
species, gengoro-buna (Carassius cuvieri Temminck &
Schlegel). A comparative study of the dental tissues between
living and fossil species. Earth Science, 39, 272–281 (in
Japanese).
Kottelat, M. (1997) European freshwater fishes. Biologia, 52, 1–
271.
Kozak, K.H., Blaine, R.A. & Larson, A. (2006) Gene lineages
and eastern North American palaeodrainage basins:
phylogeography and speciation in salamanders of the
Eurycea bislineata species complex. Molecular Ecology, 15,
191–207.
Kumar, S., Nei, M., Dudley, J. & Tamura, K. (2008) MEGA: a
biologist-centric software for evolutionary analysis of DNA
and protein sequences. Briefings in Bioinformatics, 9, 299–
306.
Li, F.-B. & Gui, J.-F. (2007) Clonal diversity and genealogical
relationships of gibel carp in four hatcheries. Animal
Genetics, 39, 28–33.
Li, J.J., Shu, Q., Zhou, S.Z., Zhao, Z.J. & Zhang, J.M. (2004)
Review and prospects of Quaternary glaciation research in
China. Journal of Glaciology and Geocryology, 26, 235–243.
(in Chinese with English abstract).
Liu, H.-T. & Su, T.-T. (1962) Pliocene fishes from Yushe Basin,
Shansi. Vertebrata PalAsiatica, 6, 1–125 (in Chinese with
English abstract).
Luo, J., Zhang, Y.-P., Zhu, C.-L., Xiao, W.-H. & Huang, S.-Y.
(1999) Genetic diversity in crucian carp (Carassius auratus).
Biochemical Genetics, 37, 267–279.
Luo, J., Yang, D., Suzuki, H., Wang, Y., Chen, W.-J., Campbell,
K.L. & Zhang, Y.-P. (2004) Molecular phylogeny and bio-
geography of Oriental voles: genus Eothenomys (Muridae,
Mammalia). Molecular Phylogenetics and Evolution, 33, 349–
362.
Meng, Q.W., Su, J.X. & Miao, X.Z. (1995) Fish taxonomy.
China Agriculture Press, Beijing (in Chinese with English
abstract).
Y. Gao et al.
2276 Journal of Biogeography 39, 2264–2278ª 2012 Blackwell Publishing Ltd
Meyer, A. (1993) Evolution of mitochondrial DNA in fishes.
Molecular biology frontiers, biochemistry and molecular biol-
ogy of fishes, Vol. 2 (ed. by P.W. Hochachka and T.P.
Mommsen), pp. 1–38. Elsevier, The Hague.
Moritz, C., Dowling, T.E. & Brown, W.M. (1987) Evolution of
animal mitochondrial DNA: relevance for population biol-
ogy and systematics. Annual Review of Ecology and System-
atics, 18, 269–292.
Murakami, M., Matsuba, C. & Fujitani, H. (2001) The
maternal origins of the triploid ginbuna (Carassius auratus
langsdorfii): phylogenetic relationships within the C. auratus
taxa by partial mitochondrial D-loop sequencing. Genes and
Genetic Systems, 76, 25–32.
Murphy, R.W. & Aguirre-Leon, G. (2002) The non-avian
reptiles: origins and evolution. A new island biogeography of
the Sea of Cortes (ed. by T.J. Case, M.L. Cody and E. Ez-
curra), pp. 181–220. Oxford University Press, New York.
Nakamura, M. (1969) Cyprinid fishes of Japan. Research
Institute for Natural Resources, Tokyo (in Japanese).
Ogasawara, K. (1994) Neogene paleogeography and marine
climate of the Japanese Islands based on shallow-marine
molluscs. Palaeogeography, Palaeoclimatology, Palaeoecology,
108, 335–351.
Ota, H. (1998) Geographic patterns of endemism and specia-
tion in amphibians and reptiles of the Ryukyu Archipelago,
Japan, with special reference to their paleogeographical
implications. Researches on Population Ecology, 40, 189–204.
Otsuka, H. & Takahashi, A. (2000) Pleistocene vertebrate
faunas in the Ryukyu Islands: their migration and extinc-
tion. Tropics, 10, 25–40.
Papousek, I., Vetesnık, L., Halacka, K., Luskova, V., Humpl,
M. & Mendelv, J. (2008) Identification of natural hybrids of
gibel carp Carassius auratus gibelio (Bloch) and crucian carp
Carassius carassius (L.) from lower Dyje River floodplain
(Czech Republic). Journal of Fish Biology, 72, 1230–1235.
Posada, D. & Crandall, K.A. (1998) MODELTEST: testing the
model of DNA substitution. Bioinformatics, 14, 817–818.
Rambaut, A. & Drummond, A.J. (2009) Tracer v1.5. Available
at: http://beast.bio.ed.ac.uk/Tracer (accessed 30 November
2009).
Ronquist, F. & Huelsenbeck, J.P. (2003) MrBayes 3: Bayesian
phylogenetic inference under mixed models. Bioinformatics,
19, 1572–1574.
Sakai, H., Iguchi, K., Yamazaki, Y., Sideleva, V.G. & Goto, A.
(2009) Morphological and mtDNA sequence studies on
three crucian carps (Carassius: Cyprinidae) including a new
stock from the Ob River system, Kazakhstan. Journal of Fish
Biology, 74, 1756–1773.
Senou, H. (1985) The inland water fishes of Ryukyu Islands are
endangered. Freshwater Fish, 11, 73–78.
Serebrovsky, A.S. (1928) Genogeography and the genofund of
farm animals. Nauchnoye slovo, 1928, 3–23 (in Russian).
Shi, Y.F. (2002) A suggestion to improve the chronology of
Quaternary glaciations in China. Journal of Glaciology and
Geocryology, 24, 687–692.
Smouse, P.E., Long, J.C. & Sokal, R.R. (1986) Multiple
regression and correlation extensions of the Mantel tests of
matrix correspondence. Systematic Zoology, 35, 627–632.
Stamatakis, A., Hoover, P. & Rougemont, J. (2008) A rapid
bootstrap algorithm for the RAxML web servers. Systematic
Biology, 75, 758–771.
Swofford, D.L. (2002) PAUP*. Phylogenetic analysis using
parsimony (*and other methods). Version 4. Sinauer Associ-
ates, Sunderland, MA.
Takada, M. & Tachihara, K. (2009) Comparisons of age,
growth, and maturity between male and female, and diploid
and triploid individuals in Carassius auratus from Okinawa-
jima Island, Japan. Aquatic Conservation: Marine and
Freshwater Ecosystems, 19, 806–814.
Takada, M., Tachihara, K., Kon, T., Yamamoto, G., Kei’ichiro,
I., Miya, M. & Nishuda, M. (2010) Biogeography and evo-
lution of the Carassius auratus-complex in East Asia. BMC
Evolutionary Biology, 10, 1–18.
Tamura, K., Dudley, J., Nei, M. & Kumar, S. (2007) MEGA4:
Molecular Evolutionary Genetics Analysis (MEGA) software
version 4.0. Molecular Biology and Evolution, 24, 1596–1599.
Thorpe, R.S., Black, H. & Malhotra, A. (1996) Matrix corre-
spondence tests on the DNA phylogeny of the Tenerife
lacertid elucidate both historical causes and morphological
adaptation. Systematic Biology, 45, 335–343.
Tzeng, C.-S., Hui, C.-F., Shen, S.-C. & Huang, P.C. (1992) The
complete nucleotide sequence of the Crossostoma lacustre
mitochondrial genome: conservation and variations among
vertebrates. Nucleic Acids Research, 20, 4853–4858.
Ujiie, H. (1990) Geological history of the Ryukyu Island Arc.
Nature of Okinawa: geomorphology and geology (ed. by H.
Ujiie), pp. 251–255. Hirugisha, Naha (in Japanese).
Ujiie, H., Tanaka, Y. & Ono, T. (1991) Late Quaternary
paleoceanographic record from the middle Ryukyu Trench
slope, northwest Pacific. Marine Micropaleontology, 18, 115–
128.
Wang, C.Y. (1985) The origin of the goldfish. Bulletin of
Biology, 12, 11–12 (in Chinese).
Wang, Y. & Jin, C.Z. (2009) Fossil Diplothrix (Diplothrix sp.
nov., Muridae) from Renzidong Cave, Fanchang, Anhui,
China. Proceedings of Eleventh Annual Meeting of Chinese
Society of Vertebrate Paleontology (ed. by W. Dong), pp. 65–
71. China Ocean Press, Beijing (in Chinese).
Wang, Y., Jin, C.-Z. & Wei, G.-B. (2010) First discovery of
fossil Diplothrix (Muridae, Rodentia) outside the Ryukyu
Islands, Japan. Geology, 55, 411–417.
Wheeler, A. (1977) The origin and distribution of the fresh-
water fishes of the British Isles. Journal of Biogeography, 4, 1–
24.
Wheeler, A. (2000) Status of the crucian carp, Carassius car-
assius (L.) in the U.K. Fisheries Management and Ecology, 7,
315–322.
Xia, X. & Xie, Z. (2001) DAMBE: software package for data
analysis in molecular biology and evolution. Journal of
Heredity, 92, 371–373.
Diversification of Eurasian goldfish
Journal of Biogeography 39, 2264–2278 2277ª 2012 Blackwell Publishing Ltd
Yang, L. & He, S.-P. (2008) Phylogeography of the freshwater
catfish Hemibagrus guttatus (Siluriformes, Bagridae):
implications for South China biogeography and influence of
sea-level changes. Molecular Phylogenetics and Evolution, 49,
393–398.
Yap, S.Y. (2002) On the distributional patterns of Southeast–
East Asian freshwater fish and their history. Journal of Bio-
geography, 29, 1187–1199.
Ye, F., Liu, Z.-F., Tuo, S.-T. & Jian, Z.-M. (2007) Grain size
record of terrigenous clast during Mid-Pleistocene Transi-
tion (0.78–1.0 Ma) in the northern South China Sea. Marine
Geology and Quaternary Geology, 27, 77–83.
Zhang [= Chang], M.M. & Chen, Y.Y. (2000) Late Mesozoic
and Tertiary ichthyofaunas from China and some
puzzling patterns of distribution. Vertebrata PalAsiatica, 38,
161–175.
Zhao, L., Zhang, J., Liu, Z.-J., Funk, S.M., Wei, F.-W., Xu, M.
& Li, M. (2008) Complex population genetic and demo-
graphic history of the salangid, Neosalanx taihuensis, based
on cytochrome b sequences. BMC Evolutionary Biology, 8,
201.
Zhou, L. & Gui, J.F. (2002) Karyotypic diversity in polyploid
gibel carp, Carassius auratus gibelio Bloch. Genetica, 115,
223–232.
Zhou, L., Wang, Y. & Gui, J.F. (2000) Analysis of genetic
heterogeneity among five gynogenetic clones of silver cru-
cian carp, Carassius auratus gibelio Bloch, based on detection
of RAPD molecular markers. Cytogenetics and Cell Genetics,
88, 133–139.
SUPPORTING INFORMATION
Additional Supporting Information may be found in the
online version of this article:
Appendix S1 Distribution of control region (CR) haplotypes
from the genus Carassius grouped according to their evolu-
tionary history (Fig. 2), GenBank accession numbers of CR
and cyt b, and the sampling localities of the specimens with cyt
b sequences.
Appendix S2 Pairwise FST values and geographical distances
(D) for the Carassius auratus complex.
Appendix S3 Matrilineal genealogy of Carassius generated
from 323 to 426 bp of mitochondrial DNA control region
sequences inferred using MrBayes.
As a service to our authors and readers, this journal provides
supporting information supplied by the authors. Such mate-
rials are peer-reviewed and may be re-organized for online
delivery, but are not copy-edited or typeset. Technical support
issues arising from supporting information (other than
missing files) should be addressed to the authors.
BIOSKETCHES
Yun Gao, an Associate Professor, is interested in the
biogeography of widely distributed East Asian freshwater
fishes and other vertebrates. All members of our research team
are keenly interested in understanding the drivers of biogeo-
graphical patterns, for example, rapid rates of evolution under
natural or artificial selection.
Author contributions: Y.G. and Y.-P.Z. developed the ideas
and obtained funding support; S.-Y.W., Y.G., J.L. and R.W.M.
analysed the data and Y.G., S.-Y.W. and R.W.M. led the
writing; S.-Y.W., R.D., S.-F.W., C.-L.Z., Y.L., P.-T.L., A.D.P.
and S.N.N. collected data or samples.
Editor: Brett Riddle
Y. Gao et al.
2278 Journal of Biogeography 39, 2264–2278ª 2012 Blackwell Publishing Ltd