Transcript
Page 1: Personalized Medicine: Hype or Help? · Personalized Medicine The Personalized Health Care Initiative will improve the safety, quality and effectiveness of healthcare for every patient

Personalized Medicine:

Hype or Help?

The Foundation for Community Health

5/20/09

Greg Feero, M.D., Ph.D.Chief, Genomic Healthcare Branch

National Human Genome Research Institute

National Institutes of Health

Page 2: Personalized Medicine: Hype or Help? · Personalized Medicine The Personalized Health Care Initiative will improve the safety, quality and effectiveness of healthcare for every patient

September, 2008

Page 3: Personalized Medicine: Hype or Help? · Personalized Medicine The Personalized Health Care Initiative will improve the safety, quality and effectiveness of healthcare for every patient

Jim Watson receiving his own personal

genome sequence on a DVD

May 31, 2007

Page 4: Personalized Medicine: Hype or Help? · Personalized Medicine The Personalized Health Care Initiative will improve the safety, quality and effectiveness of healthcare for every patient
Page 5: Personalized Medicine: Hype or Help? · Personalized Medicine The Personalized Health Care Initiative will improve the safety, quality and effectiveness of healthcare for every patient
Page 6: Personalized Medicine: Hype or Help? · Personalized Medicine The Personalized Health Care Initiative will improve the safety, quality and effectiveness of healthcare for every patient

Outline

• A definition and some context.

• The world according to GWAS.

• Challenges ahead.

• Conclusions.

Page 7: Personalized Medicine: Hype or Help? · Personalized Medicine The Personalized Health Care Initiative will improve the safety, quality and effectiveness of healthcare for every patient

Personalized Medicine

The Personalized Health Care Initiative will improve

the safety, quality and effectiveness of healthcare for

every patient in the US. By using “genomics”, or the

identification of genes and how they relate to drug

treatment, personalized health care will enable

medicine to be tailored to each person’s needs.

http://www.hhs.gov/myhealthcare/index.html

Page 8: Personalized Medicine: Hype or Help? · Personalized Medicine The Personalized Health Care Initiative will improve the safety, quality and effectiveness of healthcare for every patient

Personalized Medicine

Genomics

Page 9: Personalized Medicine: Hype or Help? · Personalized Medicine The Personalized Health Care Initiative will improve the safety, quality and effectiveness of healthcare for every patient

• $2.26 trillion dollars spent on health care

in the U.S. in 2007 (16% GDP)

• About equal to the total GDP of France,

Italy or the U.K.

The Health of Our Society

Page 10: Personalized Medicine: Hype or Help? · Personalized Medicine The Personalized Health Care Initiative will improve the safety, quality and effectiveness of healthcare for every patient

OECD “Amenable Mortality”

- Nolte, Health Affairs, Jan. 2008

Page 11: Personalized Medicine: Hype or Help? · Personalized Medicine The Personalized Health Care Initiative will improve the safety, quality and effectiveness of healthcare for every patient

“More than 4 million hospitalizations

potentially could be prevented each year by

improving the quality of primary care...

Billions of dollars could also be saved by

avoiding the need to hospitalize patients for

health problems that, in most cases, can be

prevented or if already present, kept stable

by high-quality care in physicians' offices.”AHRQ News and Numbers,

Aug. 2007

Trends in Potentially Preventable Hospitalizations

among Adults and Children, 1997-2004

http://www.hcup-us.ahrq.gov/reports/statbriefs/sb36.pdf

Page 12: Personalized Medicine: Hype or Help? · Personalized Medicine The Personalized Health Care Initiative will improve the safety, quality and effectiveness of healthcare for every patient

“We are installing 10,000

ICDs per month in the U.S.”

Harvard Cardiology Professor

6/2008

Page 13: Personalized Medicine: Hype or Help? · Personalized Medicine The Personalized Health Care Initiative will improve the safety, quality and effectiveness of healthcare for every patient

We can improve the situation a lot

by creating a health care system in

the U.S. …….

…. but that will only

get us so far ….

…..people still get sick in

Andorra.

Page 14: Personalized Medicine: Hype or Help? · Personalized Medicine The Personalized Health Care Initiative will improve the safety, quality and effectiveness of healthcare for every patient

Chronic diseases!

• More than 90 million Americans live with chronic illnesses.

• Chronic diseases account for 70% of all deaths in the United States.

• The medical care costs of people with chronic

diseases account for more than 75% of the nation’s $1.4 trillion medical care costs.

• Chronic diseases account for one-third of the years of potential life lost before age 65.

CDC http://www.cdc.gov/nccdphp/overview.htm#2

Page 15: Personalized Medicine: Hype or Help? · Personalized Medicine The Personalized Health Care Initiative will improve the safety, quality and effectiveness of healthcare for every patient

We need:

• Better screening methods

• Better strategies for prevention (lifestyle, chemoprevention)

• Better therapies

• Better ways to assess who is at risk

Page 16: Personalized Medicine: Hype or Help? · Personalized Medicine The Personalized Health Care Initiative will improve the safety, quality and effectiveness of healthcare for every patient

Top 10 Causes of Death 06

1. Diseases of heart *

2. Cancer *

3. Stroke *

4. Chronic lower respiratory diseases *

5. Accidents (unintentional injuries)

6. Alzheimer’s disease *

7. Diabetes mellitus *

8. Influenza and pneumonia *

9. Kidney disease *

10. Septicemia *CDC 2008

Page 17: Personalized Medicine: Hype or Help? · Personalized Medicine The Personalized Health Care Initiative will improve the safety, quality and effectiveness of healthcare for every patient

Cystic fibrosis Adult onset diabetes AIDS

Page 18: Personalized Medicine: Hype or Help? · Personalized Medicine The Personalized Health Care Initiative will improve the safety, quality and effectiveness of healthcare for every patient

Can genomics be used to

get a handle on chronic

disease?

Page 19: Personalized Medicine: Hype or Help? · Personalized Medicine The Personalized Health Care Initiative will improve the safety, quality and effectiveness of healthcare for every patient

1800

1900

2000

1850

1950

Gre

eks t

hin

k a

bo

ut

ato

ms

Year

Atoms and DNA: a discovery timeline

Page 20: Personalized Medicine: Hype or Help? · Personalized Medicine The Personalized Health Care Initiative will improve the safety, quality and effectiveness of healthcare for every patient

BMJ 2008;336:22 (5 January)

“The sequencing of the human

genome was completed in 2003.

Since then we’ve been told that

we’re living in the "genomic era"—

the biggest revolution in human

health since antibiotics, some say,

and the beginning of scientific,

personalised medicine. In the United

States we’ve spent about $4bn

(£2bn; 2.8bn) since 2000 to fund the

National Human Genome Research

Institute, so it seems fair to ask

what we’ve got for our money.”

Page 21: Personalized Medicine: Hype or Help? · Personalized Medicine The Personalized Health Care Initiative will improve the safety, quality and effectiveness of healthcare for every patient

0

200

400

600

800

1000

1200

1400

1600

1800

2000

1981

1982

1983

1984

1985

1986

1987

1988

1989

1990

1991

1992

1993

1994

1995

1996

1997

1998

1999

2000

2001

2002

2003

2004

2005

Cumulative Pace of Disease Gene Discovery 1981-2005

Year

Number

of Genes

Associated

with

Disease

Source: Online Mendelian Inheritance in Man

HG

P

Page 22: Personalized Medicine: Hype or Help? · Personalized Medicine The Personalized Health Care Initiative will improve the safety, quality and effectiveness of healthcare for every patient

Glazier et al., Science 298:2345-9, 2002

Page 23: Personalized Medicine: Hype or Help? · Personalized Medicine The Personalized Health Care Initiative will improve the safety, quality and effectiveness of healthcare for every patient
Page 24: Personalized Medicine: Hype or Help? · Personalized Medicine The Personalized Health Care Initiative will improve the safety, quality and effectiveness of healthcare for every patient
Page 25: Personalized Medicine: Hype or Help? · Personalized Medicine The Personalized Health Care Initiative will improve the safety, quality and effectiveness of healthcare for every patient

Sequence from chromosome 7

GAAATAATTAATGTTTTCCTTCCTTCTCCTATTTTGTCCTTTACTTCAATTTATTTATTTATTATTAATATTATTATTTTTTGAG

ACGGAGTTTCACTCTTGTTGCCAACCTGGAGTGCAGTGGCGTGATCTCAGCTCACTGCACACTCCGCTTTCC/TGGTTT

CAAGCGATTCTCCTGCCTCAGCCTCCTGAGTAGCTGGGACTACAGTCACACACCACCACGCCCGGCTAATTTTTGTATT

TTTAGTAGAGTTGGGGTTTCACCATGTTGGCCAGACTGGTCTCGAACTCCTGACCTTGTGATCCGCCAGCCTCTGCCT

CCCAAAGAGCTGGGATTACAGGCGTGAGCCACCGCGCTCGGCCCTTTGCATCAATTTCTACAGCTTGTTTTCTTTGCCT

GGACTTTACAAGTCTTACCTTGTTCTGCCTTCAGATATTTGTGTGGTCTCATTCTGGTGTGCCAGTAGCTAAAAATCCAT

GATTTGCTCTCATCCCACTCCTGTTGTTCATCTCCTCTTATCTGGGGTCACA/CTATCTCTTCGTGATTGCATTCTGATCCC

CAGTACTTAGCATGTGCGTAACAACTCTGCCTCTGCTTTCCCAGGCTGTTGATGGGGTGCTGTTCATGCCTCAGAAAAA

TGCATTGTAAGTTAAATTATTAAAGATTTTAAATATAGGAAAAAAGTAAGCAAACATAAGGAACAAAAAGGAAAGAACAT

GTATTCTAATCCATTATTTATTATACAATTAAGAAATTTGGAAACTTTAGATTACACTGCTTTTAGAGATGGAGATGTAGTA

AGTCTTTTACTCTTTACAAAATACATGTGTTAGCAATTTTGGGAAGAATAGTAACTCACCCGAACAGTGTAATGTGAATAT

GTCACTTACTAGAGGAAAGAAGGCACTTGAAAAACATCTCTAAACCGTATAAAAACAATTACATCATAATGATGAAAAC

CCAAGGAATTTTTTTAGAAAACATTACCAGGGCTAATAACAAAGTAGAGCCACATGTCATTTATCTTCCCTTTGTGTCTG

TGTGAGAATTCTAGAGTTATATTTGTACATAGCATGGAAAAATGAGAGGCTAGTTTATCAACTAGTTCATTTTTAAAAGTC

TAACACATCCTAGGTATAGGTGAACTGTCCTCCTGCCAATGTATTGCACATTTGTGCCCAGATCCAGCATAGGGTATGTT

TGCCATTTACAAACGTTTATGTCTTAAGAGAGGAAATATGAAGAGCAAAACAGTGCATGCTGGAGAGAGAAAGCTGAT

ACAAATATAAATGAAACAATAATTGGAAAAATTGAGAAACTACTCATTTTCTAAATTACTCATGTATTTTCCTAGAATTTAA

GTCTTTTAATTTTTGATAAATCCCAATGTGAGACAAGATAAGTATTAGTGATGGTATGAGTAATTAATATCTGTTATATAATA

TTCATTTTCATAGTGGAAGAAATAAAATAAAGGTTGTGATGATTGTTGATTATTTTTTCTAGAGGGGTTGTCAGGGAAAG

AAATTGCTTTTTTTCATTCTCTCTTTCCACTAAGAAAGTTCAACTATTAATTTAGGCACATACAATAATTACTCCATTCTAA

AATGCCAAAAAGGTAATTTAAGAGACTTAAAACTGAAAAGTTTAAGATAGTCACACTGAACTATATTAAAAAATCCACAG

GGTGGTTGGAACTAGGCCTTATATTAAAGAGGCTAAAAATTGCAATAAGACCACAGGCTTTAAATATGGCTTTAAACTGT

GAAAGGTGAAACTAGAATGAATAAAATCCTATAAATTTAAATCAAAAGAAAGAAACAAACTA/GAAATTAAAGTTAATATA

CAAGAATATGGTGGCCTGGATCTAGTGAACATATAGTAAAGATAAAACAGAATATTTCTGAAAAATCCTGGAAAATCTTT

TGGGCTAACCTGAAAACAGTATATTTGAAACTATTTTTAAA

Are the SNPs correlated with their neighbors?

Page 26: Personalized Medicine: Hype or Help? · Personalized Medicine The Personalized Health Care Initiative will improve the safety, quality and effectiveness of healthcare for every patient

Diabetes Diabetes

Unaffected Unaffected

SNP A SNP B

Page 27: Personalized Medicine: Hype or Help? · Personalized Medicine The Personalized Health Care Initiative will improve the safety, quality and effectiveness of healthcare for every patient

Christensen and Murray, N Engl J Med 2007; 356:1094-97.

Mapping the Relationships Among SNPs

Page 28: Personalized Medicine: Hype or Help? · Personalized Medicine The Personalized Health Care Initiative will improve the safety, quality and effectiveness of healthcare for every patient

www.hapmap.org

Page 29: Personalized Medicine: Hype or Help? · Personalized Medicine The Personalized Health Care Initiative will improve the safety, quality and effectiveness of healthcare for every patient

0

300

600

900

1200

1500

1800

Jul-05 Oct-05 Jan-06 Apr-06 Jul-06 Oct-06

Affymetrix500K

Illumina317K

Illumina550K

Illumina650Y

Continued Progress in

Genotyping Technology

Courtesy S. Gabriel, Broad/MIT

July 2005 Oct 2006

Co

st p

er

pe

rso

n (

US

D)

Page 30: Personalized Medicine: Hype or Help? · Personalized Medicine The Personalized Health Care Initiative will improve the safety, quality and effectiveness of healthcare for every patient

Genome Wide Association

Approach to Common Disease:

The View from 2008

• Identify an optimum set of 300,000 tag SNPs

• Collect 1000 cases and 1000 controls

• Genotype all DNAs for all SNPs

• That adds up to 600 million genotypes

• In 2002, $10 billion for each disease – completely out of the question

• Genotyping just dropped to $0.0010, so that’s $600,000 for each disease

Page 31: Personalized Medicine: Hype or Help? · Personalized Medicine The Personalized Health Care Initiative will improve the safety, quality and effectiveness of healthcare for every patient
Page 32: Personalized Medicine: Hype or Help? · Personalized Medicine The Personalized Health Care Initiative will improve the safety, quality and effectiveness of healthcare for every patient

200520062007 first quarter2007 second quarter2007 third quarter2007 fourth quarterFirst quarter 2008

Manolio, Brooks, Collins, J. Clin. Invest., May 2008

Page 33: Personalized Medicine: Hype or Help? · Personalized Medicine The Personalized Health Care Initiative will improve the safety, quality and effectiveness of healthcare for every patient

Diseases and Traits with Published GWA Studies (n = 93, 3/30/09)

• Macular Degeneration• Exfoliation Glaucoma

• Lung Cancer• Prostate Cancer• Breast Cancer• Colorectal Cancer• Bladder Cancer• Neuroblastoma• Melanoma• Basal Cell Cancer• TP53 Cancer Pred’n• Ac/Ch Lym. Leukemia• Thyroid Cancer• Myeloprolif. Synd.

• Infl. Bowel Disease• Celiac Disease• Gallstones• Hirschsprung Disease• Cleft Palate

• QT Prolongation • Coronary Disease• Coronary Spasm• Atrial Fibrill’n/Flutter

• Pain• Panic Disorder• Neuroticism• Schizophrenia• Sz. Iloperidone Rsp.• Bipolar Disorder• Family Chaos• Narcolepsy• ADHD• Personality Traits

• Rheumatoid Arthritis• RA Anti-TNF Rsp.• Syst. Lupus Erythem.• Juv. Idiop. Arthritis• Osteoarthritis• Psoriasis• Kawaski Disease• Sarcoidosis• Pulmonary Fibrosis• COPD/Lung Function• CF Severity• Asthma• Chr. Rhinosinusitis• HIV Viral Setpoint

• Stroke

• Intracranial Aneurysm

• Hypertension

• Hypt. Diuretic Rsp.

• Periph. Artery Disease

• Lipids/Lipoproteins

• Warfarin Dosing

• Ximelegatran Adv.Rsp.

• Parkinson Disease

• Amyotrophic Lat.Scler.

• Multiple Sclerosis

• MS Interferon-β Rsp.

• Prog. Supranuc. Palsy

• Tauopathies

• Alzheimer’s Disease

• Var. Creutzfeldt-Jakob

• Cognitive Ability

• Memory

• Hearing, Otosclerosis

• Restless Legs Synd.

• Essential Tremor

• Nicotine Dependence

• Methamphet Depend.

• Type 1 Diabetes

• Type 2 Diabetes

• Diabetic Nephropathy

• End-St. Renal Dis.

• Obesity, BMI, Waist

• IR, Metabolic Traits

• Height

• Osteoporosis

• Age at Menarche

• Male Patt. Baldness

• Fetal Hemoglobin

• Platelet Mass/Volume

• Transferrin Levels

• C-Reactive Protein

• ICAM-1 Levels

• Eosinophil Numbers

• Total IgE Levels

• Urate Levels, Gout

• Protein Levels

• Folate Path. Vitamins

• β-Carotene Levels

• Recombination Rate

• Pigmentation

Page 34: Personalized Medicine: Hype or Help? · Personalized Medicine The Personalized Health Care Initiative will improve the safety, quality and effectiveness of healthcare for every patient

Glazier et al., Science 298:2345-9, 2002

Page 35: Personalized Medicine: Hype or Help? · Personalized Medicine The Personalized Health Care Initiative will improve the safety, quality and effectiveness of healthcare for every patient

Hunter DJ and Kraft P, N Engl J Med 2007; 357:436-439.

“There have been few, if any, similar bursts of

discovery in the history of medical research…”

Page 36: Personalized Medicine: Hype or Help? · Personalized Medicine The Personalized Health Care Initiative will improve the safety, quality and effectiveness of healthcare for every patient

Pennisi E, Science 2007; 318:1842-43.

2007: The Year of GWA Studies

Page 37: Personalized Medicine: Hype or Help? · Personalized Medicine The Personalized Health Care Initiative will improve the safety, quality and effectiveness of healthcare for every patient

Following from GWAS

• Drug discovery – novel pathways

• Treatment selection – “right drug, right dose”

• Prognosis – how will the disease affect you

• Disease risk prediction – panels of markers

http://www.genome.gov/26525384

Page 38: Personalized Medicine: Hype or Help? · Personalized Medicine The Personalized Health Care Initiative will improve the safety, quality and effectiveness of healthcare for every patient

0 10 20 30 40 50 60

Intergenic

3' (0.5kb)

5' (2kb)

miRTS

3' UTR

5' UTR

Intronic

Synonymous

Missense

Functional Classification of 782 Index SNPs Associated with Complex Traits

37

0 10 20 30 40 50 60Percent

11

340

11

2

6

22

20

354

Page 39: Personalized Medicine: Hype or Help? · Personalized Medicine The Personalized Health Care Initiative will improve the safety, quality and effectiveness of healthcare for every patient

Lessons Learned from Initial GWA Studies

Signals in Previously Unsuspected Genes Signals in Common

Macular Degeneration CFH

Coronary Disease CDKN2A/2B Diabetes, Melanoma

Childhood Asthma ORMDL3 Crohn’s Disease

Type II Diabetes CDKAL1 Prostate Cancer

Crohn’s Disease ATG16L1

Signals in Gene “Deserts” Signals in Common

Prostate Cancer 8q24Breast, Colorectal

Cancer; Crohn’s

Crohn’s Disease5p13.1, 1q31.2,

10p21

Signals in Common

Multiple Sclerosis IL7R Type 1 Diabetes

Sarcoidosis C10orf67 Celiac Disease

RA, T1DM PTPN2, PTPN22 Crohn’s

Page 40: Personalized Medicine: Hype or Help? · Personalized Medicine The Personalized Health Care Initiative will improve the safety, quality and effectiveness of healthcare for every patient
Page 41: Personalized Medicine: Hype or Help? · Personalized Medicine The Personalized Health Care Initiative will improve the safety, quality and effectiveness of healthcare for every patient
Page 42: Personalized Medicine: Hype or Help? · Personalized Medicine The Personalized Health Care Initiative will improve the safety, quality and effectiveness of healthcare for every patient

Following from GWAS

• Drug discovery – novel pathways

• Treatment selection – “right drug, right dose”

• Prognosis – how will the disease affect you

• Disease risk prediction – panels of markers

Page 43: Personalized Medicine: Hype or Help? · Personalized Medicine The Personalized Health Care Initiative will improve the safety, quality and effectiveness of healthcare for every patient
Page 44: Personalized Medicine: Hype or Help? · Personalized Medicine The Personalized Health Care Initiative will improve the safety, quality and effectiveness of healthcare for every patient
Page 45: Personalized Medicine: Hype or Help? · Personalized Medicine The Personalized Health Care Initiative will improve the safety, quality and effectiveness of healthcare for every patient

Following from GWAS

• Drug discovery – novel pathways

• Treatment selection – “right drug, right dose”

• Prognosis – how will the disease affect you

• Disease risk prediction – panels of markers

Page 46: Personalized Medicine: Hype or Help? · Personalized Medicine The Personalized Health Care Initiative will improve the safety, quality and effectiveness of healthcare for every patient
Page 47: Personalized Medicine: Hype or Help? · Personalized Medicine The Personalized Health Care Initiative will improve the safety, quality and effectiveness of healthcare for every patient

Following from GWAS

• Drug discovery – novel pathways

• Treatment selection – “right drug, right dose”

• Prognosis – how will the disease affect you

• Disease risk prediction – panels of markers

Page 48: Personalized Medicine: Hype or Help? · Personalized Medicine The Personalized Health Care Initiative will improve the safety, quality and effectiveness of healthcare for every patient

Key points about GWAS markers

• Most associations published have very high reproducibility

• Most associations confer small risk increases in isolation (OR 1.2-1.5)

• Combinations of markers can confer very great risk (AMD - 250X with greatest risk combination)

• Missing heritability

Page 49: Personalized Medicine: Hype or Help? · Personalized Medicine The Personalized Health Care Initiative will improve the safety, quality and effectiveness of healthcare for every patient
Page 50: Personalized Medicine: Hype or Help? · Personalized Medicine The Personalized Health Care Initiative will improve the safety, quality and effectiveness of healthcare for every patient
Page 51: Personalized Medicine: Hype or Help? · Personalized Medicine The Personalized Health Care Initiative will improve the safety, quality and effectiveness of healthcare for every patient

Key points about GWAS markers

• We know little about how the markers

perform prospectively

• We know little about interactions with

other SNPs and/or the environment

• We know little about diverse populations

• We know little about how this

information might affect clinical care

Page 52: Personalized Medicine: Hype or Help? · Personalized Medicine The Personalized Health Care Initiative will improve the safety, quality and effectiveness of healthcare for every patient

Multiplex Genetic Susceptibility Testing:

A prototype for applied research to inform personalized medicine

Colleen M. McBride, PhD. & Larry Brody, Ph.D.

Research Partners:National Human Genome Research Institute

Henry Ford Health SystemGroup Health Cooperative

Cancer Research Network (NCI)

Page 53: Personalized Medicine: Hype or Help? · Personalized Medicine The Personalized Health Care Initiative will improve the safety, quality and effectiveness of healthcare for every patient

The Spectrum of Genetic Testing

Treatment selection:

EGFR/breast cancer

Rare disorders:

Huntington’s disease

Cancer syndromes:

BRCA1

Pgx:

Warfarin

metabolism

Expression profiling:

Breast cancer Genome scans:

Complex disease risk

Prenatal screening:

Cystic fibrosis

Pgx:

Abacavir

hypersensitivity

Page 54: Personalized Medicine: Hype or Help? · Personalized Medicine The Personalized Health Care Initiative will improve the safety, quality and effectiveness of healthcare for every patient

Surgeon General's My Family Health Portrait

Family Health History Portal

54

Page 55: Personalized Medicine: Hype or Help? · Personalized Medicine The Personalized Health Care Initiative will improve the safety, quality and effectiveness of healthcare for every patient
Page 56: Personalized Medicine: Hype or Help? · Personalized Medicine The Personalized Health Care Initiative will improve the safety, quality and effectiveness of healthcare for every patient

Translation?

Page 57: Personalized Medicine: Hype or Help? · Personalized Medicine The Personalized Health Care Initiative will improve the safety, quality and effectiveness of healthcare for every patient

Translating Genomics…

• Genomic discoveries relevant to common disease diagnosis and management are coming at an increasing rate.

• Basic discoveries are leading to the development of clinical applications.

• Ergo, improved healthcare is around the corner!

Page 58: Personalized Medicine: Hype or Help? · Personalized Medicine The Personalized Health Care Initiative will improve the safety, quality and effectiveness of healthcare for every patient

JM Westfall et al JAMA 2007;297:403.

Page 59: Personalized Medicine: Hype or Help? · Personalized Medicine The Personalized Health Care Initiative will improve the safety, quality and effectiveness of healthcare for every patient

“We identified only 1 RCT of a

genetic testing intervention for a

common condition that measured

a clinical outcome.”

- Scheuner et al., JAMA 2008

Page 60: Personalized Medicine: Hype or Help? · Personalized Medicine The Personalized Health Care Initiative will improve the safety, quality and effectiveness of healthcare for every patient

Translating Genomics…

• Genomic discoveries relevant to common disease diagnosis and management are coming at an increasing rate.

• Basic discoveries are leading to the development of clinical applications.

Mind the gap!

• Ergo, improved healthcare is around the corner!

Page 61: Personalized Medicine: Hype or Help? · Personalized Medicine The Personalized Health Care Initiative will improve the safety, quality and effectiveness of healthcare for every patient

Who will (pay to) fill the gap?

Page 62: Personalized Medicine: Hype or Help? · Personalized Medicine The Personalized Health Care Initiative will improve the safety, quality and effectiveness of healthcare for every patient
Page 63: Personalized Medicine: Hype or Help? · Personalized Medicine The Personalized Health Care Initiative will improve the safety, quality and effectiveness of healthcare for every patient

EGAPP

Evaluation of

Genomic

Applications in

Practice and

Prevention

Non-regulatory

Independent, non-federal,

multidisciplinary Working

Group

Integrate existing processes for

evaluation and appraisal

Minimize conflicts of interest

Evidence-based, transparent,

and publicly accountable

Page 64: Personalized Medicine: Hype or Help? · Personalized Medicine The Personalized Health Care Initiative will improve the safety, quality and effectiveness of healthcare for every patient

www.egappreviews.org

Page 65: Personalized Medicine: Hype or Help? · Personalized Medicine The Personalized Health Care Initiative will improve the safety, quality and effectiveness of healthcare for every patient

Hold on to your hats!

Page 66: Personalized Medicine: Hype or Help? · Personalized Medicine The Personalized Health Care Initiative will improve the safety, quality and effectiveness of healthcare for every patient
Page 67: Personalized Medicine: Hype or Help? · Personalized Medicine The Personalized Health Care Initiative will improve the safety, quality and effectiveness of healthcare for every patient

14,000X

Moore’s Law put to shame

Courtesy of Eric Lander, Broad Institute

Page 68: Personalized Medicine: Hype or Help? · Personalized Medicine The Personalized Health Care Initiative will improve the safety, quality and effectiveness of healthcare for every patient
Page 69: Personalized Medicine: Hype or Help? · Personalized Medicine The Personalized Health Care Initiative will improve the safety, quality and effectiveness of healthcare for every patient
Page 70: Personalized Medicine: Hype or Help? · Personalized Medicine The Personalized Health Care Initiative will improve the safety, quality and effectiveness of healthcare for every patient
Page 71: Personalized Medicine: Hype or Help? · Personalized Medicine The Personalized Health Care Initiative will improve the safety, quality and effectiveness of healthcare for every patient

Personal Medical Home

The American Academy of Family Physicians believes that everyone should have a personal medical home that serves as the focal point through which all individuals-regardless of age, sex, race, or socioeconomic status-receive acute, chronic, and preventive medical services. Through an on-going relationship with a family physician in their medical home, patients can be assured of care that is not only accessible but also accountable, comprehensive, integrated, patient-centered, safe, scientifically valid, and satisfying to both patients and their physicians.

http://www.aafp.org/online/en/home/policy/policies/p/personalmedicalhome.html

Page 72: Personalized Medicine: Hype or Help? · Personalized Medicine The Personalized Health Care Initiative will improve the safety, quality and effectiveness of healthcare for every patient

Genomics

Personalized Medicine

Personal Medical Home

Page 73: Personalized Medicine: Hype or Help? · Personalized Medicine The Personalized Health Care Initiative will improve the safety, quality and effectiveness of healthcare for every patient

Conclusions

• Many genetic tests are well established and some are highly predictive. FOR MANY COMMON CONDITIONS THIS IS NOT YET TRUE!

• The ultimate benefit of the current crop of discoveries driven by GWAS will likely be in the development of new preventive and therapeutic strategies.

• Family history is a great interim personalized medicine tool for disease risk prediction.

• Think long term….

Page 74: Personalized Medicine: Hype or Help? · Personalized Medicine The Personalized Health Care Initiative will improve the safety, quality and effectiveness of healthcare for every patient

THANKS

Slides courtesy of:

Francis Collins, address unknown

Alan Guttmacher, NHGRI

Muin Khoury, CDC

Teri Manolio, NHGRI

Colleen McBride NHGRI


Recommended