Download ppt - L Zhang et al . Nature 000 , 1 - 7 (2011) doi:10.1038/nature10690

Transcript

Page 1: L Zhang et al . Nature 000 , 1 - 7 (2011) doi:10.1038/nature10690

L Zhang et al. Nature 000, 1-7 (2011) doi:10.1038/nature10690

NleE is a SAM-dependent methyltransferase that specificallymodifies Cys673/692 in TAB2/3-NZF domains.

Recommended

Nature Neuroscience: doi:10.1038/nnNtrk2 TTTTTTTAGTTTTTTTTGTTAGTTAATAAA CACATCTCAATAATCAACCACATC BS Nature Neuroscience: doi:10.1038/nn.3976 Author Andrew Gordon Created Date 2/25/2015

Nature Neuroscience: doi:10.1038/nnNtrk2 TTTTTTTAGTTTTTTTTGTTAGTTAATAAA CACATCTCAATAATCAACCACATC BS Nature Neuroscience: doi:10.1038/nn.3976 Author Andrew Gordon Created Date 2/25/2015 Documents

Neuropsychopharmacology (2011) 36, 2406-2421; doi:10.1038/npp.2011.128

Neuropsychopharmacology (2011) 36, 2406-2421; doi:10.1038/npp.2011.128 Documents

GI Motility online (May 2006) | doi:10.1038/gimo48

GI Motility online (May 2006) | doi:10.1038/gimo48 Documents

DOI: 10.1038/NMAT4299 Supplementary file for P … · SUPPLEMENTARY INFORMATION. DOI: 10.1038/NMAT4299. NATURE MATERIALS | . 1 1 Supplementary file for Photo-oxidation and quantum

DOI: 10.1038/NMAT4299 Supplementary file for P … · SUPPLEMENTARY INFORMATION. DOI: 10.1038/NMAT4299. NATURE MATERIALS | . 1 1 Supplementary file for Photo-oxidation and quantum Documents

GI Motility online (May 2006) | doi:10.1038/gimo12

GI Motility online (May 2006) | doi:10.1038/gimo12 Documents

Nature Structural and Molecular Biology: doi:10.1038/nsmb · Nature Structural and Molecular Biology: doi:10.1038/nsmb.2938 Supplementary Figure 1 Characterization of designed leucine-rich-repeat

Nature Structural and Molecular Biology: doi:10.1038/nsmb · Nature Structural and Molecular Biology: doi:10.1038/nsmb.2938 Supplementary Figure 1 Characterization of designed leucine-rich-repeat Documents

Ecosystem turnover in palaeoecological records: …€¦ · Web viewNature Publishing Group: 53–59. DOI: 10.1038/nature08227. DOI: 10.1038/nature08227. Seddon AW, Macias-Fauria

Ecosystem turnover in palaeoecological records: …€¦ · Web viewNature Publishing Group: 53–59. DOI: 10.1038/nature08227. DOI: 10.1038/nature08227. Seddon AW, Macias-Fauria Documents

Vol 453 1 May 2008 doi:10.1038/nature06733 LETTERS

Vol 453 1 May 2008 doi:10.1038/nature06733 LETTERS Documents

DOI: 10.1038/NMAT4801 Metal-Oxide-Semiconductor

DOI: 10.1038/NMAT4801 Metal-Oxide-Semiconductor Documents

DOI: 10.1038/NMAT3074 Maltodextrin based imaging … · and in vivo SUPPLEMENTARY INFORMATION DOI: 10.1038/NMAT3074 ©

DOI: 10.1038/NMAT3074 Maltodextrin based imaging … · and in vivo SUPPLEMENTARY INFORMATION DOI: 10.1038/NMAT3074 © Documents

Nature Biotechnology: doi:10.1038/nbtmanalis-lab.mit.edu/publications/cermak_SI.pdf · Nature Biotechnology: doi:10.1038/nbt.3666. Supplementary Figure 13 Comparison of precision

Nature Biotechnology: doi:10.1038/nbtmanalis-lab.mit.edu/publications/cermak_SI.pdf · Nature Biotechnology: doi:10.1038/nbt.3666. Supplementary Figure 13 Comparison of precision Documents

Guo et al ., Nature Materials, DOI:10.1038/ nmat3234 (2012)

Guo et al ., Nature Materials, DOI:10.1038/ nmat3234 (2012) Documents

doi:10.1038/nature06481 LETTERS

doi:10.1038/nature06481 LETTERS Documents

DOI: 10.1038/NMAT4143 - Nature Research...in – √ ((− ((((= √ (. (). (in (() (∼ × → in ≃), ∆ = (˜)/ (˜ +) ± × ˜/ = = ˜/ =. × ×−

DOI: 10.1038/NMAT4143 - Nature Research...in – √ ((− ((((= √ (. (). (in (() (∼ × → in ≃), ∆ = (˜)/ (˜ +) ± × ˜/ = = ˜/ =. × ×− Documents

Nature Genetics doi:10.1038/ng · Aortic stenosis Aortic regurgitation Nature Genetics: doi:10.1038/ng.3618. Cardiomyopathy Hypertrophic card Pericardial Problem Pericarditis Pericardial

Nature Genetics doi:10.1038/ng · Aortic stenosis Aortic regurgitation Nature Genetics: doi:10.1038/ng.3618. Cardiomyopathy Hypertrophic card Pericardial Problem Pericarditis Pericardial Documents

Published in Nature Materials (2016) doi:10.1038/nmat4569

Published in Nature Materials (2016) doi:10.1038/nmat4569 Documents

Nature Genetics: doi:10.1038/ng...Nature Genetics: doi:10.1038/ng.3245 Supplementary Figure 6 Effect of shared controls on conditional posterior probability of association with disease

Nature Genetics: doi:10.1038/ng...Nature Genetics: doi:10.1038/ng.3245 Supplementary Figure 6 Effect of shared controls on conditional posterior probability of association with disease Documents

Modulationofthermalandthermoelectric ... · PDF fileLETTERS PUBLISHEDONLINE:31JULY2017|DOI:10.1038/NMAT4946 Modulationofthermalandthermoelectric transportinindividualcarbonnanotubesby

Modulationofthermalandthermoelectric ... · PDF fileLETTERS PUBLISHEDONLINE:31JULY2017|DOI:10.1038/NMAT4946 Modulationofthermalandthermoelectric transportinindividualcarbonnanotubesby Documents