killer vegetables, animal-human hybrids, other scary stuff.
Chapter 1: Epistasis for beginners
KEVIN HIOM
Galway 2010
Basic principles of DT40
DT40: A genetically tractable eukaryotic cell line
DT40• Genetically tractable• Good model for genome stability in mammals• Complementation by human genes• Good database
versus humans
Genetically tractable DT40
All these require manipulation of the genome
Phenotypic analysisKnocking out or mutating genes and looking at cellular function
Mapping genetic pathwaysCombining mutations- epistasis
Structure/function analysis/ cell biologyComplementation, proteomics
Genetic regulationReporter assays
Integrate DNA
Target DNA
Alter DNA
Remove DNA
*
*
Random Integration- non homologous end joining
Targeted Integration- Homologous/Homeologous recombination
Site specific recombination
Genetic Recombination is our tool
Non Homologous End Joining-Random integration
AdvantagesSimpleRelatively high frequency
Potential uncharacterised genetic effectMultiple integrationShut down of expression
Disadvantages
Ku, DNA-PKcs, LigIV,
Homologous recombination- site specific integration, gene disruption, mutation
DNA End ResectionMre11/RAD50/NBS1, CtIP, Exo1
Strand InvasionRAD51
ResolutionSlx1/4, GEN1
Branch MigrationRAD51BCDHolliday Junctions
Homologous recombination
Homologous Recombination
Advantages
Acurate/error free Introduction of multiple changes
DisdvantagesEasy to introduce errorsAberrant recombinationNeighbouring sequencesEpistasis difficult for HR genes
Site specific recombination- cre/lox
ATAACTTCGTATAGCATACATTATACGAAGTTAT
LOXP
Site specific recombination- re-using antibiotic resistance
Cre recombinase
drugr
synapsis
excision
Site specific recombination
Courtesy of the National Library of Medicine (NLM)
Understanding recombination is the key to manipulating the DT40 genome
3 copies of chromosome 2
Genomes are ‘plastic’- Don’t culture for too long
Words of warning