Download pdf - i-Bulletin 7

Transcript
  • 8/14/2019 i-Bulletin 7

    1/5

    promoting a widerappreciation ofinformation andknowledgemanagement foragriculturaldevelopment

    generally andspecifically,support for theIICA/CTA

    MEAgrISys project.

    #7 of 2008

    a collaborativeeffort of:

    Naitram RamnananCaRAPN member

    and:

    Diana FrancisTrade Policies and

    Negotiations ProgrammeIICA Caribbean Region

    enabled by:Technical Centre

    for Agricultural andRural Cooperation

    (CTA ACP)

    The Views expressedherein are not necessarilythose of the CTA and IICA

    ininininformation + knowledgeformation + knowledgeformation + knowledgeformation + knowledge ++++partnerships =partnerships =partnerships =partnerships =

    practical actions and ppractical actions and ppractical actions and ppractical actions and positiveositiveositiveositive results!results!results!results!Over the years, marketing agencies and produce

    boards in the Caribbean participate in

    international trade fairs to promote Caribbean

    fresh and processed agricultural products. This

    has made the Caribbean brand synonymous with flavour

    and taste, and Caribbean food products are in high

    demand. These trade shows are also meant to stimulate

    business by putting buyers in direct contact with suppliers.

    However, when buyers place their orders, oftentimes, by

    the container-load, oftentimes we find that our suppliers

    are only able to manage one or two shipments.

    There is just not enough supply!

    Our production cannot keep up with both local and

    international demands. We have been called 'nations that

    produce samples'. We are failing to capitalize on the

    Caribbean label. Our competitors appear to be better at

    producing to fill the market, consistently, than we are. For

    example, Costa Rica has developed a significant business

    and trade in organic banana grown in their "Caribbean"

    coast, which conditions similar to CARCIOM Caribbean

    countries. Information has played an important role in

    defining market opportunities and translating that information to the farmers, in

    terms of tech packs, packaging and distribution. They have built a new value

    chain around bananas, focusing on organic baby foods and organic vinegar

    Many CARICOM countries have acres and acres of bananas, and while the Fair

    Trade label has grown significantly from when it started, bananas are still being

    traded in its original form - as fresh bananas.Agriculture in CARICOM has yet to tap into the immense potential that exists for

    fresh, processed and other non-food products and services. On the fresh

    produce, there is a rich history and traditional knowledge in root crops that has

    remained relatively under-developed. Hot peppers and pumpkin cannot satisfy

    international demand; demand for tropical fruits, vegetables and flowers is

    growing, but CARICOM producers fail to consistently supply a range of tropica

    fruits and vegetables to export markets. Processors also complain that sourcing

    local/regional raw material is uncompetitive and unreliable.

  • 8/14/2019 i-Bulletin 7

    2/5

    Pg.2

    The more successful agri-enterprises, such as, poultry, pork, hybrid vegetables, are all produced from almost

    100% imported inputs. Processed products are also being 'manufactured' largely on imported raw materia

    content. In spite of the fact that there are several micro and small jams and jellies processors in almost al

    CARICOM countries, we import more jams and jellies than we produce. The same goes for fruit juices. This

    situation is no different in respect to livestock subsector: Bufalypso, Barbados black belly sheep and the

    Jamaican red hope have not attained their full potential, while we cannot meet the demand for the sma

    ruminants.

    The ability to meeting a demand for any product, whether for an agriculture fresh

    produce, cosmetic, or medicine, depends on information. Since it is being said that we live in a

    market-driven world, information is the base of sifting out opportunities and making decisions to

    capitalize on them. Information It is now well accepted that unimpeded information and knowledge

    flows are prerequisite to better technologies, management and organization systems that make

    production systems and economies more competitive. As the example, i-bulletin #1 or 2007, aptly

    demonstrated that the dasheen farmer has a need for small scale machinery for tillage, fertilization and pest

    control operations. But after several decades of ineffective agricultural knowledge and information system

    development in agriculture, this farmer's technological needs are unmet.

    For agriculture in CARICOM tap into the emerging opportunities for fresh, processed and other non-

    food products and services, an effective, integrated and participatory information system is a must.

    The 6 previous i-bulletins all focused on a specific link in the value chain in an effort to demonstrate the

    importance of information in effective decision-making to business success, and as well the possible good

    influence that effective decisions in one part of the value chain can have on the other parts.

    TTTTTTTThhhhhhhheeeeeeee rrrrrrrriiiiiiiigggggggghhhhhhhhtttttttt IIIIIIIINNNNNNNNFFFFFFFFOOOOOOOORRRRRRRRMMMMMMMMAAAAAAAATTTTTTTTIIIIIIIIOOOOOOOONNNNNNNN,,,,,,,, pppppppprrrrrrrroooooooovvvvvvvviiiiiiiiddddddddeeeeeeeedddddddd JJJJJJJJUUUUUUUUSSSSSSSSTTTTTTTT--------IIIIIIIINNNNNNNN--------TTTTTTTTIIIIIIIIMMMMMMMMEEEEEEEE aaaaaaaannnnnnnndddddddd UUUUUUUUSSSSSSSSEEEEEEEEDDDDDDDD bbbbbbbbyyyyyyyy tttttttthhhhhhhheeeeeeee rrrrrrrriiiiiiiigggggggghhhhhhhhtttttttt PPPPPPPPEEEEEEEEOOOOOOOOPPPPPPPPLLLLLLLLEEEEEEEE,,,,,,,, iiiiiiiissssssss

    ccccccccrrrrrrrriiiiiiiittttttttiiiiiiiiccccccccaaaaaaaallllllll ttttttttoooooooo eeeeeeeennnnnnnnaaaaaaaabbbbbbbblllllllliiiiiiiinnnnnnnngggggggg tttttttthhhhhhhheeeeeeee pppppppprrrrrrrriiiiiiiivvvvvvvvaaaaaaaatttttttteeeeeeee sssssssseeeeeeeeccccccccttttttttoooooooorrrrrrrr,,,,,,,, iiiiiiiinnnnnnnncccccccclllllllluuuuuuuuddddddddiiiiiiiinnnnnnnngggggggg ffffffffaaaaaaaarrrrrrrrmmmmmmmmeeeeeeeerrrrrrrrssssssss,,,,,,,, ttttttttoooooooo ttttttttaaaaaaaakkkkkkkkeeeeeeee pppppppprrrrrrrraaaaaaaaccccccccttttttttiiiiiiiiccccccccaaaaaaaallllllll AAAAAAAACCCCCCCCTTTTTTTTIIIIIIIIOOOOOOOONNNNNNNNSSSSSSSS

    ttttttttoooooooo mmmmmmmmaaaaaaaannnnnnnnaaaaaaaaggggggggeeeeeeee pppppppprrrrrrrroooooooodddddddduuuuuuuuccccccccttttttttiiiiiiiioooooooonnnnnnnn sssssssscccccccchhhhhhhheeeeeeeedddddddduuuuuuuulllllllleeeeeeeessssssss aaaaaaaannnnnnnndddddddd mmmmmmmmaaaaaaaakkkkkkkkeeeeeeee aaaaaaaalllllllllllllllliiiiiiiiaaaaaaaannnnnnnncccccccceeeeeeeessssssss wwwwwwwwiiiiiiiitttttttthhhhhhhh ooooooootttttttthhhhhhhheeeeeeeerrrrrrrr pppppppprrrrrrrroooooooodddddddduuuuuuuucccccccceeeeeeeerrrrrrrrssssssss ttttttttoooooooo mmmmmmmmeeeeeeeeeeeeeeeetttttttt

    mmmmmmmmaaaaaaaarrrrrrrrkkkkkkkkeeeeeeeetttttttt ddddddddeeeeeeeemmmmmmmmaaaaaaaannnnnnnnddddddddssssssss iiiiiiiinnnnnnnn aaaaaaaa rrrrrrrreeeeeeeelllllllliiiiiiiiaaaaaaaabbbbbbbblllllllleeeeeeee mmmmmmmmaaaaaaaannnnnnnnnnnnnnnneeeeeeeerrrrrrrr........

    Making information work for agriculture wilenhance the knowledge base for decision making and leadto practical actions and consequently positive results. Thisis essential in modern agriculture. Agricultural informationsystems need to be built to meet the real informationneeds of decision makers, to foster true partnerships

    among participants for the system to work, and to feedback credible information to stakeholders, intheir own language and at the time they need it. Several public (including Ministries of Agriculture) andprivate sector organizations (including commodity industries) are exploring ways to strengthen theirinformation and knowledge management systems as a major factor in either achieving an/or enhancingcompetitive advantage. An integrated approach is central to this process.

    ThisThisThisThis i----bulletibulletibulletibulletin issue features a comprehensive system addresses the Agricultural Knowledge andn issue features a comprehensive system addresses the Agricultural Knowledge andn issue features a comprehensive system addresses the Agricultural Knowledge andn issue features a comprehensive system addresses the Agricultural Knowledge and

    Information System (AKIS)Information System (AKIS)Information System (AKIS)Information System (AKIS) as a new concept and analytical tool in examining how we address the problems

    that are confronting us and leading to the general decline in agriculture

    .IInnffoorrmmaattiioonnaanndd tthheeAAggrriiccuullttuurraallDDeevveellooppmmeennttAAggeennddaa -- TThhee BBiiggggeerr PPiiccttuurree!!

  • 8/14/2019 i-Bulletin 7

    3/5

    Pg.3

    ExplainingExplainingExplainingExplaining AKISAKISAKISAKISAn Agricultural Knowledge and Information System (AKIS) compriseAn Agricultural Knowledge and Information System (AKIS) compriseAn Agricultural Knowledge and Information System (AKIS) compriseAn Agricultural Knowledge and Information System (AKIS) comprisessss the institutions andthe institutions andthe institutions andthe institutions and

    individualsindividualsindividualsindividuals,,,, and identifand identifand identifand identifiesiesiesies the knowledge, experiences and information they possess tothe knowledge, experiences and information they possess tothe knowledge, experiences and information they possess tothe knowledge, experiences and information they possess to

    supportsupportsupportsupport decision making in all link of the agriculture valuedecision making in all link of the agriculture valuedecision making in all link of the agriculture valuedecision making in all link of the agriculture value chain, from farm to market.chain, from farm to market.chain, from farm to market.chain, from farm to market.

    AKISAKISAKISAKIS:::: the set of organisthe set of organisthe set of organisthe set of organisaaaations and/or personstions and/or personstions and/or personstions and/or persons and the links and interactions between them thatand the links and interactions between them thatand the links and interactions between them thatand the links and interactions between them that

    are engaged in, or manage such processes as the anticipation, generation, transformation,are engaged in, or manage such processes as the anticipation, generation, transformation,are engaged in, or manage such processes as the anticipation, generation, transformation,are engaged in, or manage such processes as the anticipation, generation, transformation,

    transmission, storage, retrieval, integratransmission, storage, retrieval, integratransmission, storage, retrieval, integratransmission, storage, retrieval, integration, diffusion and utilization of agricultural knowledgetion, diffusion and utilization of agricultural knowledgetion, diffusion and utilization of agricultural knowledgetion, diffusion and utilization of agricultural knowledge

    and information, whand information, whand information, whand information, which potentially work synergicallich potentially work synergicallich potentially work synergicallich potentially work synergically to support dy to support dy to support dy to support decision making, problemecision making, problemecision making, problemecision making, problem

    solvingsolvingsolvingsolving and innovation in agriculture or a domain thereof.and innovation in agriculture or a domain thereof.and innovation in agriculture or a domain thereof.and innovation in agriculture or a domain thereof.1111

    This approach makes a concerted effort to understand and improve existing configurations of agricultura

    institutions and design better ones. It came about largely to address the situation where agricultura

    developers, planners and policy makers were inclined, partly for reason of institutional politics, to view

    farming systems, extension, development of agricultural technologies, research and policy making as separate

    spheres, each with their own set of issues, managed by groups of researchers and professionals who overlap

    only marginally. The AKIS cThe AKIS cThe AKIS cThe AKIS concept represents a shiftoncept represents a shiftoncept represents a shiftoncept represents a shift and visualizesand visualizesand visualizesand visualizes major players of anmajor players of anmajor players of anmajor players of an

    agricultural system asagricultural system asagricultural system asagricultural system as aaaa closely integrated and linked systemclosely integrated and linked systemclosely integrated and linked systemclosely integrated and linked system. This represents both a historical and

    conceptual progression from treating various institutions and practices, such as, Farming Systems

    Development, Extension, and Research, individually, as opposed to parts of a whole, where decisions taken in

    one area, affects outcomes in another within a system. A systemic approach demands that we treat with al

    elements as an agricultural knowledge and information system. The Caribbean needs to advance along this

    path to achieve integrated and sustainable development in agriculture and rural communities.

    Examining the knowledge generation processes in successful multinational companies, public service

    organizations, among others, strongly supports the notion that knowledge processes can be effectively

    managed through an AKIS. Using AKIS as a base can assist in identifying opportunities to enhance the way key

    stakeholders are organised in the existing network of players for the purpose of knowledge generation and

    information exchange. It can also contribute to enhancing awareness of the process of agricultural innovation

    and information exchange. If well developed, an AKIS can also support the identification of ways to create this

    elusive enabling environment by allowing for the bigger picture to be clearly visible. This will in turn

    engender greater commitment and collaboration among actors who may then be more inclined to remove

    these constraints or contribute to an improvement in the systems performance. AKIS provides the mechanism

    for the two-way flow of information and knowledge to facilitate the development of policies, technologies and

    other elements that can have positive impacts on agricultural development.

    The typical information environment in the Caribbean can best be described as comprising pockets of

    information systems, that in many instances, have little or no linkages between them or to other systems. For

    example, a pocket of information may exist for livestock, with further sub-systems for the various types of

    livestock produced, such as, dairy, beef, small ruminants, pork, poultry, rabbits, aquaculture and other types

    of livestock. The Ministry of Agriculture, Research Institutions, Development and other service organizations

    1 Roling, N. and P. G.H. Engel (1991) *The development of the concept of agricultural knowledge and information systems (AKIS)

    Implications for extension. In W.M. Rivera and D.J. Gustafson (eds) Agricultural Extension: Worldwide institutional and evolution and

    forces for change. Elsevier, Amsterdam.

  • 8/14/2019 i-Bulletin 7

    4/5

    Pg.4

    generally tend to have broad information and knowledge on these various sub-systems. However the specifics

    of data, information and knowledge on these various systems are held by the farmers and their representative

    association, such as, the dairy farmers association or the poultry association. An AKIS provides the tools and

    mechanisms to provide coordination and linkages of these information pockets in the context of a broader

    development objective and information need. When all the players in the system are well documented and

    linked an AKIS acts like a road map, detailing the route to the type of information required that enables good

    decisions and practical actions.

    A typical AKISA typical AKISA typical AKISA typical AKIS

    Agriculture is an activity and a sector that pervades the entire society therefore systems that contain

    information on agriculture is complex. Especially since the public sector has dominated the production and

    marketing of a majority of activities in agriculture, this makes it even more complex, with the information

    widely dispersed over many ministries, statutory authorities, non-governmental organizations, internationa

    and regional bodies. Among the various Government Ministries with important pieces of information are the

    Ministry of Agriculture, which generates and documents governments policy, which includes incentives

    systems, general information and technical information for production and marketing. Ministries of Health

    have the mandates for matters pertaining to food safety. They would also have critical information pertaining

    to the status of nutrition and nutritional needs of the population that needs to be fed back into productiondecisions. Ministries of Legal Affairs are responsible for issues of land ownership and laws that govern the

    sector. They also have valuable information that can be used to make effective decisions on addressing issues

    related to risks, such as, praedial larceny. Ministries of Works or local government have information on the

    status of access roads, rural bridges. Ministries of Public Utilities have information on the status of electricity

    telecommunications and water in rural communities. Other Ministries that are responsible for investmen

    promotion, human resource development, through education and skills training, poverty reduction

    programmes, trade information, regulations governing trade, etc., all hold information that is vital to effective

    decision-making in agriculture. The types of information that they manage has to be known and made

    accessible through an AKIS.

    Other important elements of an AKIS includeOther important elements of an AKIS includeOther important elements of an AKIS includeOther important elements of an AKIS include Libraries and Documentation Centres, which contain valuable

    collections of useful information. These Centres are found in most agricultural departments, research

    organizations, projects management units, laboratories, etc. However, often these are not well catalogued and

    managed and hence even known to exist. This cannot be good for modern agriculture. Marketing Boards

    generally have useful information on all aspects of markets and marketing requirements. Their knowledge

    management systems need to be greatly improved. Training institutions, such as, universities and other

    diploma granting colleges, secondary schools, farmers training centres among other training organizations al

    have useful information as part of their various training programmes as well as projects and research

    conducted by students. Farmers organizations are the best source of information on indigenous knowledge

    and local conditions. Typically, they have not focussed on developing knowledge management capacities; this

    needs to change, urgently and fast! Other private sector or business organizations have qualitative information

    on production and trade with respect to the entire value chain. This needs to be integrated into a system.

    Weak information systems were identified as a key binding constraint to the development of the agriculture

    system by the regional Initiative to reposition agriculture being led by President Bharrat Jagdeo of Guyana.

    Developing a system such as AKIS at the national level is the most direct and practical way to address this

    issue.

  • 8/14/2019 i-Bulletin 7

    5/5

    Pg.5

    . an information learning process for a difference!

    TTTThehehehe MEAgrISysMEAgrISysMEAgrISysMEAgrISys project on Building a Monitoring and

    Evaluation Agricultural Information System is managed by

    IICA and the CTA to strengthen the quality of information

    generated by and used for decision making in agriculture.

    IIIIts conceptual basets conceptual basets conceptual basets conceptual base is built on AgRuis built on AgRuis built on AgRuis built on AgRu----matrmatrmatrmatrixixixix that promotesthat promotesthat promotesthat promotes

    - an evolved concept of agriculture beyond the farm,food and rural areas;

    - a development approach built on full participation,integration and sustainability;

    - an expanded concept of information beyond thestatistics andeconomic indicators.

    The process startedThe process startedThe process startedThe process started inininin the late 1990sthe late 1990sthe late 1990sthe late 1990s, when IICA, on

    behalf of member states led a process to positionagriculture as of strategic importance to sustainable

    development in the hemisphere. In 2001, it was included

    on the agenda of the Summit of the Americas. At the

    2003 Summit, Heads of the State endorsed the Agro Plan

    2003-2015 for improving agriculture and rural life and

    mandated Ministers of Agriculture to develop appropriate

    mechanisms to measure and evaluate progress.

    It complements theIt complements theIt complements theIt complements the CCCCARICOMARICOMARICOMARICOM Jagdeo Initiative Jagdeo Initiative Jagdeo Initiative Jagdeo Initiative which is

    the current strategy for alleviating 10 Key Binding

    Constraints as a critical step in improving agriculture in theCARICOM member states. MEAgrISys will be developed to

    enable follow-up and measuring of impact.

    ItItItIt is buis buis buis builtiltiltilt onononon 3333 mutuallymutuallymutuallymutually----rererere----enforcing types of informationenforcing types of informationenforcing types of informationenforcing types of information:

    - Expectations and opinions of key persons on progressand prospects of major development objectives;

    "Expectations move the worldExpectations move the worldExpectations move the worldExpectations move the world"

    - Experiences documented in National Reports on themain actions and challenges of countries to achieve

    these objectives;

    - Performance Indicators that measure results, progressand impact of actions.

    It ISIt ISIt ISIt IS aaaa ppppractical approachractical approachractical approachractical approach becausebecausebecausebecause these types of

    information are not new; they already exist in national

    surveys, annual reports of Ministries and other

    organizations. This practical approach allows one include

    elements defined by 'expectations'. Other approaches do

    not take that into consideration MEAgrISys will try to pull

    all types of information together in a common framework

    to provide a more holistic analysis of the situation in

    agriculture.

    It hopes toIt hopes toIt hopes toIt hopes to make a differencemake a differencemake a differencemake a difference and to promoteand to promoteand to promoteand to promote information

    as critical to achieving the Vision set for agriculture

    MEAgrISys seeks to facilitate the identification, collection

    storage, analysis and sharing of that information. Its

    success depends on participation of all involved, interested

    and affected by developments in agriculture. It is not

    intended to address all the deficiencies of the information

    environment in agriculture in the Caribbean, but will build

    on and add value to some good national efforts.

    TThhee BBoottttoomm--LLiinnee

    EEaacchh ppeerrssoonn lliivviinngg iinn aa ssoocciieettyy,, wwhheetthheerr aatt ttccoommmmuunniittyy lleevveell,, iinn uurrbbaann cceennttrreess,, oorr iinn mmaacciittiieess,, uusseess iinnffoorrmmaattiioonn aavvaaiillaabbllee ttoo hhiimm//hheerrmmaakkee ppeerrssoonnaall,, pprrooffeessssiioonnaall,, bbuussiinneessss aanndd ootthh

    ddeecciissiioonnss.. TThhee ssaammee aapppplliieess iinn aaggrriiccuullttuurree vvaacchhaaiinnss.. EEaacchh ppllaayyeerr iinn tthhee cchhaaiinn iiss,, aatt oonnee ppooiinnttpprroodduucceerr aanndd aa ccoonnssuummeerr.. TThhee ddeecciissiioonnss mmaawwhheenn wweeaarriinngg bbootthh hhaattss aarree iinntteerr--rreellaatteedd aaddeeppeenndd oonn tthhee iinnffoorrmmaattiioonn sseett aavvaaiillaabbllee ttoo tthheemm..

    UUssiinngg IInnffoorrmmaattiioonn iiss aa MMUUSSTT!!HHaavviinngg ggoooodd iinnffoorrmmaattiioonn iiss aa RRIIGGHHTT!!

    BBuutt wwee ddoo nnoott aallwwaayyss hhaavvee tthhee ssyysstteemmss iinn ppllaaccee tteennssuurree ssuucchh rriigghhttss.. IInn ttooddaayyss iinntteennsseellyy iinntteeggrraatteewwoorrlldd,, tthhee iinnffoorrmmaattiioonn tthhaatt iiss bbeeiinngg ffeedd iinn aallllffoorrmmss,, ffrroomm aallll vvaarriioouuss mmeeddiiaa,, ccaann bbeeoovveerrwwhheellmmiinngg.. WWee aallll ddeeppeenndd oonn eeaacchh ootthheerr ttooffiilltteerr oouutt tthhee ffaaccttss aanndd ffiillll iinn tthhee bbllaannkkss..

    TThhee WWee iinn tthhee ssyysstteemm iiss aallll ooffuuss!!

    AAllll tthhee iinnddiivviidduuaallss aanndd iinnssttiittuuttiioonnss tthhaattiinnddiivviidduuaallllyy,, hhaavvee ccrriittiiccaall ffaaccttss aanndd ccaann ffiilllloouurr bbllaannkkss..WWee aallll,, ttooggeetthheerr,, mmaakkee uupp tthhee AAKKIISS AAggrriiccuullttuurraall KKnnoowwlleeddggee aanndd IInnffoorrmmaattiioonnSSyysstteemm..

    Information binds all of us in the agricultural development process.We all play a role in providing key pieces to fill the agricultureinformation puzzle. Building that puzzle takes partnerships!