Download pdf - Fate of Embryonic Stem Cell Derivatives Implanted into the Vitreous of a Slow Retinal Degenerative Mouse Model

247

Introduction

The irreversible loss of retinal cells is a common, fi nal manifestation of many of the retinal diseases including

ischemic retinopathy, toxic retinopathy, and a variety of inherited or acquired retinal degenerations. Currently, no therapy exists to repair or restore damaged retinal cells and vision [1–4]. Recent advances in stem cell research provide promising opportunities to develop cell therapy for repair-ing, regenerating, or replacing lost or damaged retinal tis-sues. For instance, adult stem cells from nonocular sources have been used to treat animal models of retinal degenera-tion or injury [4,5]. It has been shown that bone marrow-derived stem cells conferred a neurotrophic effect on the degenerating retina of two mouse models of retinal degen-eration, rd1 and rd10 [4]. The use of neural precursors or pro-genitor cells from fetal or newborn tissues to treat animal models of retinal disease has also been described by several investigators [6–10]. However, stem cells derived from adult

tissues only possess limited differentiation and self-renewal capacity [11]. Furthermore, adult stem cells may have com-promised genetic stability due to changes in the genome resulting from environmental exposure. A few reports sug-gest that ESC derivatives can be used as an alternative cell source for regeneration studies [12,13]. ESCs may be a more potent therapeutic agent in the treatment of retinal degener-ative diseases as compared to other sources of cell therapy because of their pluripotency and limitless cell division.

In one report, neuralized ESC derivatives incorporated into the retina of an rd1 mouse model that display rapid retinal degeneration [14]. Since there are only limited stud-ies investigating slow degeneration of the retina, pertinent studies to examine the ability of ESCs to rescue the retina from progression of injury at the rate seen in humans are warranted. Recently, molecular genetic analysis has identi-fi ed over 110 mutations in mouse genome that contribute to retinal degeneration [4]. Most of these mutations have been

Fate of Embryonic Stem Cell Derivatives Implanted into the Vitreous of a Slow Retinal Degenerative Mouse Model

G. Rasul Chaudhry,1 Christopher Fecek,1 Michael M. Lai,2 Wei-Chi Wu,3 Mei Chang,1 Adrian Vasquez,1 Magda Pasierb,1 and Michael T. Trese2

Stem cell therapy may be used potentially to treat retinal degeneration and restore vision. Since embryonic stem cells (ESCs) can differentiate into almost any cell types, including those found in the eye, they can be trans-planted to repair or replace damaged or injured retinal tissue resulting from inherited diseases or traumas. In this investigation, we explored the potential of ESCs and ESC-derived neuroprogenitors to proliferate and inte-grate into the diseased retinal tissue of rd12 mice. These rd12 mice mimic the slow and progressive retinal degen-eration seen in humans. Both ESCs and ESC-derived neuroprogenitors from ESCs survived and proliferated as evidenced from an increase in yellow fl uorescent protein fl uorescence. Quantifi cation analysis of cryosectioned retinal tissue initially revealed that both ESCs and neuroprogenitors differentiated into cells expressing neural markers. However, ESC proliferation was robust and resulted in the disruption of the retinal structure and the eventual formation of teratomas beyond 6 weeks postimplantation. In contrast, the neuroprogenitors prolifer-ated slowly, but differentiated further and integrated into the retinal layers of the eye. The differentiation of neuroprogenitors represented various retinal cell types, as judged from the expression of cell-specifi c markers including Nestin, Olig1, and glial fi brillary acidic protein. These results suggest that ESC-derived neuroprogeni-tors can survive, proliferate, and differentiate when implanted into the eyes of experimental mice and may be used potentially as cell therapy for treating degenerated or damaged retinal tissue.

1Department of Biological Sciences, Oakland University, Rochester, Michigan.2Associated Retinal Consultants, William Beaumont Hospital, Royal Oak, Michigan.3Department of Ophthalmology, Chang Gung Memorial Hospital, and Chang Gung University, College of Medicine, Taoyuan, Taiwan.

STEM CELLS AND DEVELOPMENTVolume 18, Number 2, 2009© Mary Ann Liebert, Inc.DOI: 10.1089/scd.2008.0057

06-SCD-2008_0057.indd 247 3/2/2009 8:26:40 AM

CHAUDHRY ET AL.248

Immunocytochemical analysis

Cell grown on slides in neural differentiation medium for 2 days were washed with phosphate buffer saline solution (PBS) and fi xed in 4% paraformaldehyde for 45 min followed by 5% bovine serum albumin (BSA) treatment for 1 h. The samples were then washed again with PBS and treated with primary antibody NeuN (Santa Cruz Biotechnology, Inc., CA, USA), diluted 1:100 in 0.2% Triton X-100 (Sigma) at 4°C overnight. After washing with PBS, samples were treated with Alexa Fluor labeled secondary anti-mouse goat anti-body (Invitrogen, which were diluted 1:400 in PBS) for 1 h at room temperature. The samples were washed with PBS and stained for 2 min using 4,6-Diamidino-2-phenylindole (DAPI) (Invitrogen). Cover slips were mounted onto the slides using an aqueous gel mount, and slides were analyzed by fl uorescent microscopy.

Experimental rd12 mouse model

The rd12 mutant mice (strain B6 (A)-Rpe65rd12/J) used as the experimental animal model in these studies [19] were purchased from Jackson Laboratories (Bar Harbor, ME, USA) and maintained at Oakland University (Rochester, MI, USA). The rd12 contain a nonsense mutation in exon 3 of the Rpe65 gene [18,20]. Biochemical and functional analysis showed disruption of vitamin A metabolism and visual processing in rd12 mice. No loss of retinal function is detected by the electroretinography (ERG) for the fi rst month of neonatal development, except at the brightest stimulus intensities. However, the retinal morphology remains relatively intact for up to seven to 8 months with the fi rst “voids” appearing in the photoreceptor composition as early as at 6 weeks of development [18,20,21]. All animals were cared for in accor-dance with the guides for the care and use of laboratory ani-mals published by the U.S. National Institutes of Health (NIH publication No. 85-23, revised 1996) and the ARVO statement for the use of animals in ophthalmic and vision research. The animal experimental protocol was also approved by the Animal Care Committee of Oakland University.

Implantation of cells into rd12 mice retina

Five-weeks-old mice were anesthetized with interperi-toneal injections of 80 mg/kg ketamine (Avertin), 8 mg/kg xylazine, and 1.6 mg/kg acepromazine tribromoethanol and implanted with 30,000 cells/μL in PBS. 1.5 μL were injected into the vitreous of each eye using a 10 μL Hamilton syringe and a 33-gauge needle (Hamilton, Reno, NV, USA). For transplantation, eyes were visualized under a dissecting microscope. A fi ssure was created in the upper portion of the sclera using a fi ne scalpel and the cells were injected in the subretinal or vitreal space [4,23,24].

In order to determine the optimal method for preparing the cells used for implantation into the mouse retina, two dif-ferent methods were tested. In the fi rst method, cells were scrapped and suspended in 0.1 M PBS. In the second method, cells were trypsinized and also suspended in PBS. The sec-ond method was selected for implantation studies after it was noticed that trypsinized cells could fl ow more easily though the 33-gauge needle. After standardizing the cell preparation method, 36 eyes from the experimental mice were treated in

associated with enzymatic and structural components of the neuroretina or the retinal pigment epithelial (RPE) layer [15]. The RPE protein is exclusively present in the RPE layer, associates with serum retinol binding proteins, and is essen-tial for the conversion of vitamin A (all-trans retinol) to 11-cis retinal, the chromophore of the visual pigments [15–17]. A mouse model expressing slow retinal degeneration, rd12, contains homozygous mutations in the genome at the Rpe65 gene [18]. Rpe65 gene mutations have been found in approx-imately 10% of patients with Leber congenital amaurosis, a retinal disease resulting in vision loss. Errors in the Rpe65 gene including missense, point, and small rearrangement mutations lead to the nonfunctional proteins that are respon-sible for retinal degeneration [15,19]. The retina in rd12 mice displays a progressive loss of outer retinal layers, as well as profound electroretinogram abnormalities [18,20,21]. Since the slow retinal degeneration in rd12 mice mimics that seen in humans, it prompted us to use this animal model in reti-nal regenerative studies using ESCs and their neural deriva-tives. In this study, we found ESC-derived neuroprogenitors survived, proliferated, differentiated, and integrated into implanted retinas of rd12 mice.

Materials and Methods

Cell culture

Mouse ESC lines, D3 and 7AC5/EYFP, were obtained from Dr. Sue O’Shea (University of Michigan) and ATCC (Manassas, VA, USA), respectively. The D3 line was cul-tured on 0.1% gelatin (Sigma, St Louis, MO, USA) coated dishes without feeder cells using ESC medium at 37°C in 5% CO2. ESC medium contained Dulbecco’s modifi ed Eagle’s medium (Invitrogen, Carisbad, CA, USA) supplemented with 10% fetal bovine serum (modifi ed from previous stud-ies) (Atlanta Biologicals, Atlanta, GA, USA), 0.1 mM 2-mer-captoethanol (Sigma), 0.1 mM nonessential amino acids (Invitrogen), 1 mM sodium pyruvate (Sigma), and 1,000 U/mL of leukemia inhibitory factor (LIF; Chemicon International Inc, Temecula, CA, USA). The 7AC5/EYFP cells, which had been labeled with yellow fl uorescent protein (YFP) [7], were maintained in the same way as the D3 cells, except that they were cultured on a feeder layer of gamma irradiated mouse embryonic fi broblasts (MEFs).

Preparation of embryoid bodies and differentiation into neuroprogenitors

ESCs grown to 75% confl uency were used to prepare embryoid bodies (EBs) using the “hanging drop” method [22]. ESCs suspended in ESC medium lacking LIF were placed as 20 μL droplets (containing 1,000 cells) on inverted lids of 100 × 15 mm petri plates and incubated in humidifi ed CO2 at 37°C for 3 days. The resulting EBs were then trans-ferred to fresh petri plates, treated with 10−7 M cis-retinoic acid (RA), and cultured further for 3 days in ESC medium lacking LIF. To differentiate the EBs into neuroprogeni-tors, the RA-treated EBs were transferred to gelatin-coated tissue culture plates and cultured in neurobasal medium (Invitrogen) supplemented with 1% ×50 B27, (Invitrogen), 0.2 mM l-Glutamine (Sigma), 0.168 mM Penicillin (Sigma), and 0.249 mM streptomyocin (Sigma).

06-SCD-2008_0057.indd 248 3/2/2009 8:26:40 AM

FATE OF ESC DERIVATIVES IMPLANTED INTO THE VITREOUS 249

DAPI. The relative percentage of YFP-positive cells was then determined for each section. Quantifi cation of GFAP expres-sion was carried out using the same method.

Extraction of RNA and RT-PCR analysis

To study the survival and migration of the donor cells, the implanted animals were sacrifi ced and various parts of the enucleated eyes such as cornea, iris, retina, and RPE were isolated. mRNAs of these isolated tissues were used to determine the presence of YFP-positive cells in the vari-ous parts of the eye. In order to examine the expression of a cell-specifi c marker among the derivatives of the implanted cells, the retinal cells of experimental rd12 mice were cul-tured and YFP-positive cells were isolated by scratching and further subculturing. The purifi ed YFP cells were used to isolate mRNA and analyzed for the expression of specifi c markers such as YFP, Nestin, Olig 1, GFAP, and β-Actin (con-trol) using reverse transcriptase-polymerase chain reaction (RT-PCR).

Cells and retinal tissues were extracted for RNA isola-tion and RT-PCR was performed as described previously [22]. The RT-PCR primer pairs used in this study are given in Table 1. Briefl y, RNA from cells or tissue was extracted using RNeasy Kit (Qiagen GmbH, Germany) according to the instructions given by the manufacturer. The specifi c PCR conditions used were as follows: reverse transcrip-tion, 50°C, 30 min; Taq polymerase activation, 95°C, 15 min; then thermal cycling, 94°C, 30 s, 55–60°C, 30 s, 72°C, 30 s, for 35 cycles; followed by a single elongation step at 72°C, 10 min. RT-PCR products were analyzed by 2.0% agarose gel electrophoresis.

Results

Differentiation of ESCs into neuroprogenitors

ESC-derived EBs were treated with and without RA, cultured in neurobasal medium, and were monitored for differentiation into neural derivatives of ESCs. Untreated EBs showed populations of cells with diverse lineages. The EBs treated with RA extensively differentiated into neural

the following manner: 18 eyes were injected with trypsinized ESCs and 18 eyes were injected with trypsinized ESC-derived neuroprogenitors. The control eyes included six untreated eyes and six eyes injected with PBS. The animals were moni-tored closely for postimplantation recovery. Subsequently, they were routinely examined on a daily basis for their gen-eral well-being during the course of the study.

Postimplantation analysis

At predetermined intervals of 2, 3, 4, 6, 8, and 12 weeks postimplantation, the animals were euthanized by excess CO2 inhalation and the eyes were enucleated. Enucleated eyes were rinsed with PBS and processed for analysis. For immunohistological and whole retinal mount analysis, the eyes were placed in a fi xative consisting of 4% paraformal-dehyde in PBS (pH 7.4).

Whole mounts of retinas were prepared in order to exam-ine the surface distribution of the implanted cells. For these preparations, the eyes were enucleated and incubated in the 4% paraformaldehyde fi xative for 30 min. The corneas, irises, and lenses were then removed, and the eyes were incubated and washed with PBS. The retinas were then separated from the eye cups and incubated in the fi xative for an additional 2 h. After the second fi xation, the retinas were washed again with PBS and a series of radial cuts were made in the retinas to enable the tissue to lie fairly fl at [8]. The samples were then mounted onto microscope slides.

For cross-section studies, the cornea, iris, and lens were re-moved following 15 min of fi xation at room temperature, and the rest of the eye was fi xed for an additional 12 h at 4°C. After overnight incubation in PBS containing 20% sucrose at 4°C, the samples were embedded in Tissue-Tek Optimum Cutting Temperature compound (Electron Microscopy Sciences, Hatfi eld, PA, USA) and transverse cryostat sections were cut at a thickness of 5–10 μm. Every sixth tissue section was used for analysis. Cryostat sections were blocked in 5% BSA in PBS, containing 0.5% Triton X-100, before incubating with rabbit anti-glial fi brillary acidic protein (GFAP) polyclonal antibodies (1:100; Chemicon) at room temperature for 1 h, followed by Alexa Fluor 594 goat anti-rabbit IgG secondary antibody treatment (1:200; Invitrogen) at room temperature for 1 h. The cell nuclei were stained with DAPI at a concentra-tion of 10 μg/mL. Fluorescent microscopy was used to deter-mine the expression of YFP and a neural cell-specifi c marker in the implanted retinas. Slides were observed using a bright fi eld microscope equipped with epifl uorescence (model no. Optihot-2, Nikon, Tokyo, Japan). Another set of control and experimental eyes were divided into three portions. The fi rst and second portions were stored at −20°C for investigation of the expression of a cell-specifi c marker and for latter use, re-spectively. In the third portion, the retinas and neural tissue were separated from the eye, minced, treated with trypsin/EDTA (Invitrogen), and cultured in neurobasal medium for the retrieval of implanted ESC derivatives.

Quantifi cation of donor cell growth in vivo

For the quantifi cation of in vivo growth of ESCs and neuroprogenitors, YFP expressing cells were counted from 5–10 μm thick retinal cryosections of experimental mice. The total number of cells present in each section was based on the number of cell nuclei that stained positively with

Table 1. The Primer Pairs Used in the Reverse Transcriptase-Polymerase Chain Reaction

Primer Sequence (5′–3′)

Oct 4 Left CCAATCAGCTTGGGCTAGAGRight TGGGAAAGGTGTCCCTGTA

YFP Left TTGAATTCGCCACCATGGTGAGC Right TTGAATTCTTACTTGTACAGCTCGTCC

Nestin Left GAAGAGCCAGCAGGCGRight TCCTCTGCGTCTTCAAACCT

Olig 1 Left GCGAGCCTGAAAAACAGAACRight CTTGCTCTCTCCAGCCAAAC

GFAP Left CACGAACGAGTCCCTAGAGCRight ATGGTGATGCGGTTTTCTTC

β-Actin Left GGCCCAGAGCAAGAGAGGTATCCRight ACGCACGATTTCCCTCTCAGC

06-SCD-2008_0057.indd 249 3/2/2009 8:26:40 AM

CHAUDHRY ET AL.250

micrographs (Fig. 3A, Panel 2) and H&E stained sections (Fig. 3B, Panel 2) revealed a loss of structural integrity of the inner nuclear layer of retina, which was confi rmed by staining with DAPI (Fig. 3C, Panel 2) and anti-GFAP (Fig. 3D, Panel 2), followed by fl uorescent microscopic analy-sis. In addition, substantial proliferation of the transplanted cells was evident as large aggregates of YFP-positive cells were growing throughout the retina (Fig. 3E, Panel 2). More than 6 weeks of ESC implantation resulted in the formation of tumors appearing as large masses of heterogeneous cells within the vitreous cavity (Fig. 3E, Panel 2). Different cell types representing all three embryonic germ layers were noted in these tumors and confi rmed by histological analy-sis and culturing of the retrieved tissues, suggesting that the tumors were teratomas. Clearly, teratoma-like outgrowths of the implanted cells resulted in the disruption of the inner nuclear layer of the implanted retina (Fig. 3F, Panel 2).

Growth and differentiation of neuroprogenitors in implanted retinas

Analysis of the rd12 mice retinas implanted with neu-roprogenitors showed controlled growth of the implanted cells when compared to ESCs. Analysis of the whole mount retinas (Fig. 4A) following 2 weeks postimplantation showed the presence of YFP-positive cells on the surface of the ret-ina (Fig. 4B). No fl uorescent cells were observed in the con-trol retinas. Furthermore, the intensity of YFP fl orescence increased with time, suggesting that the implanted cells pro-liferated in vivo. Cryosections of the retinas retrieved at 2, 4, 6, and 8 weeks after the implantation of neuroprogenitors also showed a slow but progressive increase in YFP-positive cells. Phase contrast (Fig. 5A) and H&E (Fig. 5B) analysis of the sectioned implants showed that retinal integrity was not

lineages. When incubated in the differentiation medium, the EBs fi rst differentiated into neurospheres in 4 to 7 days. When selected neurospheres were subcultured in the same medium, they differentiated into neuroprogenitors. Figure 1A shows the neuroprogenitors differentiating into neural cells that were derived from EBs prepared from ESCs. ESC-derived neuroprogenitors differentiated further to pro-duce neurons that developed extensive networks of neuro-fi laments (Fig. 1B). Immunocytochemical analysis showed that the neuroprogenitors differentiated mainly into neural cell types and expressed a neural cell-specifi c marker, NeuN (Fig. 2). After confi rming the derivation and differentiation of neuroprogenitors into neural cells, they were used for implantation studies.

Growth of ESCs in implanted retinas

To determine whether undifferentiated ESCs survived transplantation into the vitreous cavities of rd12 mice, both whole mount retina preparations and cross-sections of retrieved retinas were examined at various time intervals following intravitreal injections. Analysis of the whole mount retinas after 2 weeks following transplantation of ESCs indi-cated survival of GFP-positive donor cells, as judged by fl uorescent microscopy (results not shown). H&E stained cryosections of such retina displayed full inner nuclear layer integrity of the retina implanted with ESCs (Fig. 3A, Panel 1). Fluorescent microscopic analysis results depicted in Fig. 3B–E, Panel 1 showed the presence of YFP-positive cells in the intact nuclear layer and glial cells of the cryo-sections of the retina implanted with the ESCs for 3 weeks. These results further indicated that the donor cells remained limited to the site of implantation.

After 6 weeks, the retrieved retinas implanted with ESCs showed a massive growth of donor cells. Phase contrast

A B

FIG. 1. Derivation of progenitors from embryonic stem cells capable of differentiating into neural cells. Embryoid bodies treated with cis-retinoic acid differentiated into neural progenitors (A). The neural progenitors further differentiated into neurons with an extensive neurofi lament network as seen in culture after 4 weeks (B).

06-SCD-2008_0057.indd 250 3/2/2009 8:26:40 AM


GFAP between 3 and 6 weeks postimplantation. ESC injected retinas at 3 weeks showed that 20% of YFP-positive cells also expressed GFAP (Fig. 6). However, by 6 weeks postimplan-tation, only 6.45% of YFP-positive cells were found to be GFAP-positive (Fig. 6).

The growth and integration of the cells implanted as neuroprogenitors were evident as depicted in Fig. 7. After 8 weeks postimplantation, neuroprogenitor derivatives survived and accounted for 4.2% of the total retinal cells. In addition, neuroprogenitor implanted retinas showed that approximately 25.4% of the YFP-positive cells also expressed GFAP (Fig. 7).

Expression of YFP and neural markers in the transplanted cells in vivo

To further investigate the survival and differentiation of the transplanted cells in the eyes, RT-PCR was performed using the primer pairs shown in Table 1. mRNA isolated from the tissues retrieved from transplanted and control eyes (not implanted with cells) showed the expression of the YFP gene only in the transplanted eyes. The results in Fig. 8 show the expression of the YFP gene in the ret-ina 6 weeks after transplantation. However, YFP expres-sion was detected up to 12 weeks posttransplantation. The results from the 2- to 3-week-old implanted eyes showed that YFP expression was detected in the retina, but not in other parts of the eye including the cornea, iris, and RPE layer (Fig. 9). When the mRNAs isolated from the separated

compromised even at 8 weeks postimplantation. Initially, YFP-positive cells remained confi ned to the site of implan-tation, but after 8 weeks of implantation, they were found in the inner nuclear layer and inner vitreous of the eyes. YFP-positive cells were clearly seen integrating into the inner nuclear layer and vitreous of the eyes by 8 weeks postintra-vitrial implantation as evidenced by fl uorescent microscopy (Fig. 5C–E). A careful inspection of these results revealed approximately 3% of the neuroprogenitor derivatives incor-porated into the RPE layer of the retina at 8 weeks postin-travitreal implantation (Fig. 5F—see arrows). These results suggest, unlike ESCs, neither growth, differentiation, or integration of neuroprogenitors compromises the structural integrity of the retina. Furthermore, implanted neuropro-genitors also stained positively for GFAP (Fig. 5D). Longer periods (up to 12 weeks) of implantation of neuroprogentors did not produce teratomas.

Incorporation of donor cells into host retina

In the case of ESC implanted retinas, the donor deriva-tives accounted for 15.9% of the total cells in the retina after 3 weeks postimplantation (Fig. 6). By 6 weeks, the number of YFP-positive cells increased to 63.2%, showing a 3-fold increase in the donor cell derivatives (Fig. 6). This increased growth of ESC derivatives was in line with the teratoma for-mation, as observed in most of the ESC implanted retinas. Furthermore, in ESC implanted retinas, there was a differ-ence in the amount of YFP-positive cells that also expressed

A B

C

FIG. 2. Expression of a neural cell specifi c marker, NeuN, by embryonic stem cell derivatives. The cells were treated with DAPI and NeuN antibodies for immunocytochemical staining of nuclei and neural cells, respectively. The neu-ral derivatives treated with DAPI (A) and anti-NeuN (B). A merged view of A and B showed that neural type cells expressed the NeuN marker (C).

06-SCD-2008_0057.indd 251 3/2/2009 8:26:42 AM

CHAUDHRY ET AL.252

FIG. 3. Teratoma formation in embryonic stem cells (ESCs) implanted mouse retina. Panel 1 and Panel 2 represent cryosec-tioned retinal tissue retrieved 3 and 6 weeks, respectively, after implantation of ESCs into the vitreous of rd12 mouse retina. Light micrograph of cryosections of retrieved retinal tissue stained with hematoxylin and eosin (A); fl uorescent micro-graphs of retrieved retinal tissue stained with DAPI and anti-GFAP (B and C, respectively). Fluorescent micrograph of YFP expressing ESC derivatives (D). The merged image of B–D is shown in E. A comparison of YFP expression in cryosections of three week (Panel 1, D) and 6-week-old implants (Panel 2, E) demonstrated substantial increase in the proliferation of implanted ESCs, as evident from the increased YFP fl uorescence at 6 weeks compared to 3 weeks postimplantation as seen in D. Robust growth of ESCs appeared to disrupt the structural and cellular integrity of the inner nuclear layer (Panel 2, A and F). The animals implanted with ESCs for more than 6 weeks developed teratomas in 100% of the cases.

A B

Panel 1

C D

E

06-SCD-2008_0057.indd 252 3/2/2009 8:26:42 AM


Discussion

ESCs have been reported to differentiate into multiple cell types in vitro [3,14,22,25]. In this study, ESC-derived EBs treated with cis-RA were allowed to differentiate in neurobasal medium. The EBs fi rst differentiated into neuro-spheres and then developed into neuroprogenitors (Fig. 1). Subculturing and prolonged growth of neuroprogenitors

and cultured YFP-positive cells retrieved from the eyes 6 weeks after implantation of neuroprogenitors were ana-lyzed, they expressed not only Nestin but also GFAP and Olig 1 (Fig. 10). These results suggest the implanted cells differentiated into multiple neural cell types. However, no attempt was made to separate or isolate specifi c types of neural cells cultured from the retrieved retinal tissues of the implanted eyes.

AB

C D

E F

Panel 2

FIG. 3. Continued

06-SCD-2008_0057.indd 253 3/2/2009 8:26:43 AM

CHAUDHRY ET AL.254

analysis of the implants retrieved at 8 weeks revealed that 4.2% of the retinal cells were derived from the donor cells as deduced from the YFP-positive cell counts. Similar to ESC implants, neuroprogenitors also differentiated into glial-like cells. One in four YFP-positive cells was found to express GFAP in neuroprogenitor implants (Fig. 7). However, unlike ESCs, neuroprogenitors did not produce teratomas, despite longer growth periods. Therefore, neuroprogenitors could be used for the restoration of degenerative retinal tissue. Despite these results, it should be cautioned that further studies with longer periods of implantation are needed in order to completely rule out the possibility of teratoma for-mation using ESC-derived neuroprogenitors.

While Nestin and NeuN are important markers for neu-rons [14,25,27,32,33], Olig 1 and GFAP have been shown to be specifi cally expressed in glial cells such as oligodendrocytes [34], astrocytes [35], and Muller cells [36]. Based on the mor-phological characteristics of the implanted retina express-ing the YFP marker, we wondered if, after implantation, the neuroprogenitors further differentiated in the eyes of experimental mice.

Molecular analysis of genes expressed in the YFP-positive cells (Fig. 8), which were retrieved from eyes implanted with neuroprogenitors, showed expression of not only Nestin, but also Olig1 and GFAP (Fig. 10). These results suggest that the implanted neuroprogenitors differentiated into various ret-inal cell types. GFAP expression is found to be limited to the ganglion cell layer [14]. In our study, implanted neuro-progenitors expressed GFAP, suggesting that YFP-positive derivatives incorporated into the ganglion cell layer of the retina. Interestingly, the integration of differentiated cells into the inner layers of the retina was more pronounced than the RPE layer. Relatively fewer number of implanted cell derivatives (3% of the YFP-positive cells, Fig. 5E) were found in the RPE layer. These results could be justifi ed owing to the fact that photoreceptor cells loss in rd12 mice occurs at as early as 6 weeks of age, while the retinal mor-phology remains relatively intact for seven to 8 months [18,20]. Therefore, it can be argued that early loss of photore-ceptor cells in rd12 mice helped the selective and more pro-nounced neural differentiation of donor cells. Even though the differentiation and integration of donor cells into the

resulted in differentiation to neural lineage, as judged by the morphological characteristics of the differentiated cells. Differentiated cells produced an extensive network of neu-rofi laments after 4 weeks of culturing (Fig. 1B). The neural cells derived from ESCs under our culture conditions also expressed NeuN as evidenced by immunocytochemical analysis (Fig. 2). The presence of neurofi laments and NeuN has been implicated with neural cell development [26,27]. Differentiation of ESCs into neural cells was confi rmed fur-ther by the amplifi cation of Nestin transcripts using RT-PCR (Fig. 10). Based on the production of neurofi laments and expression of NeuN and Nestin genes by the differentiated cells, it can be concluded that our protocol effectively pro-duced neural cells from ESCs. Similar methods for generat-ing neuroprogenitors and neural cells from ESCs have been reported by others [1,3,14,28].

When ESCs were directly implanted into the retinas, they showed survivability and limited proliferation for the fi rst 2 weeks. However, after 3 weeks of transplantation, the donor cells showed robust growth and migration into the vitreous of the eyes of experimental mice (Fig. 3, Panel 1). One-fi fth of the YFP-positive cells also expressed GFAP, suggesting that some of the ESCs had differentiated into glial-like cells (Fig. 6). By 6 weeks, the proliferated ESCs disrupted the inner nuclear layer of the retina (Fig. 3, Panel 2). Concurrently, there was a dramatic increase in the number of YFP-positive cells between 3 and 6 weeks. However, the relative number of YFP-positive cells expressing GFAP decreased signifi cantly, suggesting that the growth of ESCs between 3 and 6 weeks was largely nonspecifi c. Such rapid growth of ESC deriva-tives coincided with the observed teratoma formation 6 weeks after implantation in virtually 100% of the cases. The implantation of ESCs into various tissues have been known to cause teratomas as reported in previous studies [29–31].

In contrast to ESCs, the neuroprogenitors grew slowly in vivo (Fig. 5). However, the donor cells increased in number with time. After 8 weeks, signifi cant growth of the implanted neuroprogenitors was evident at the site of implantation, as well as in other areas of vitreous and in the inner nuclear layer (Fig. 5F). Differentiation, migration, and integration of neuroprogenitors were observed in the retina, but not in other parts of the transplanted eyes (Fig. 9). Quantitative

FIG. 4. Embryonic stem cell-derived neuroprogenitors became associated with the host retina after intravitreal transplanta-tion in rd12 mouse eyes. A light micrograph of the partial whole-mount retina preparation (A) and a fl uorescent micrograph of the whole-mount indicating the incorporation of YFP protein-expressing neuroprogenitors at 2 weeks postimplantation (B).

A B

06-SCD-2008_0057.indd 254 3/2/2009 8:26:44 AM


express RPE-specifi c markers such as β-secretase, APP, and neprilysin as well [37].

The results of this study show the presence of derivatives of implanted neuroprogenitors in the vitreous and various retinal layers, suggesting that the donor cells migrated and

RPE layer was less compared to the other layers of the ret-ina, it provided a protective effect on the survival and pro-liferation of the implanted cells. Further studies are needed to explore the nature of protective effects of implanted cells and their integration into the RPE layer and whether they

A

C

E

D

F

B

FIG. 5. Proliferation, differentiation, and integration of neuroprogenitors implanted into the vitreous of rd12 mouse eyes. A phase contrast and hematoxylin and eosin micrograph from cryosections of a retrieved retina injected with neurpro-genitors (A and B, respectively). Fluorescent microscopy shows retinal nuclei stained positive for DAPI (C) and anti-GFAP stained astrocytes (D). The presence of implanted neuroprogenitors and their derivatives are shown by YFP fl uorescence (E). Although the majority of the YFP positive cells were seen in the vitreous at the site of implantation (see large arrow in E and F), some cells did migrate into the vitreous and various layers of the retina (medium arrows in E and F) including the RPE layer (small arrows in E and F).

06-SCD-2008_0057.indd 255 3/2/2009 8:26:45 AM

CHAUDHRY ET AL.256

differentiated into various retinal cell types. Similar fi ndings have been recently reported, which photoreceptor precur-sors integrated and differentiated into rod photoreceptors, formed synaptic connections, and improved visual function [38]. In another report, retinal stem cell derivatives preferen-tially integrated into ganglion cell and inner plexiform layers of the retina [24]. ESCs cocultured with the damaged retinal cells also generated ESC derivatives that integrated into the host ganglion cell layer in vitro [39]. These studies point to

FIG. 6. Proliferation of embryonic stem cells (ESCs) implanted into rd12 mouse retinas. YFP and GFAP fl uores-cence of donor ESCs implanted into the retina of experi-mental mice. Donor ESCs grew to occupy 15.9% of the total number of retinal cells after 3 weeks postimplantation and one-fi fth expressed the glial cell specifi c marker GFAP. By 6 weeks postimplantation, donor cells had grown to 63.2% of the total retinal cells, but expressed a relatively lower per-centage of GFAP.

100%

50%

0%3 Weeks 6 Weeks

Ce

ll C

ou

nts

DAPI

YFP

GFAP

GFAP+YFP

FIG. 7. Proliferation, differentiation, and integration of neuroprogenitors implanted in rd12 mouse retina. YFP expressing cells are indicative of donor derivatives and were seen at 8 weeks postimplantation. Some YFP positive cells were also GFAP positive suggesting differentiation of the donor cells into glial cells.

DAPI

YFP

GFAP

GFAP+YFP

100%

50%

0%

8 Weeks

Ce

ll C

ou

nts

FIG. 8. Expression of the YFP gene in the transplanted cells that survived and proliferated in vivo. mRNA was iso-lated from the retrieved cells and tissues, amplifi ed using RT-PCR, and analyzed by 2.0% agarose gel electrophoresis. Shown are the PCR amplifi ed products of the YFP gene in ESCs, EBs, neuroprogenitors, and tissue retrieved from the retina after 6 weeks of transplantation (Lanes 2, 3, 4, and 5, respectively). Lanes 1 and 6 are controls lacking mRNA and RT enzyme, respectively.

FIG. 9. YFP gene expression was observed in the retina, but not in other parts of the implanted rd12 mouse eyes. mRNA was isolated from the tissues of various parts of the implanted eye, amplifi ed using RT-PCR, and analyzed by 2.0% agarose gel electrophoresis. Shown are the PCR ampli-fi ed products of YFP gene in control, ESCs, EBs, neuropro-genitors, iris, cornea, retina, and the RPE layer (Lanes 2–9, respectively). Lane 1 is a DNA ladder 300 bps to 3 kbs.

the importance of the ontogenetic stage of the donor cells in the success of integration and functional recovery. Our stud-ies suggest that the neuroprogenitors derived from ESCs appeared to be of appropriate ontogenic stage for retinal implantation. However, further studies are warranted to con-fi rm these fi ndings. When ESC derivatives were implanted into the normal eyes of mice, they did not produce observ-able migration (results not shown). In contrast to a normal tissue environment, damaged or degenerated tissue envi-ronment has been shown to promote migration of implanted cells [40]. It was believed that migration of neuroprogenitors in the degenerated mouse retinas was due to the damaged retina and not due to the fl uidic nature of vitreous.

Our results indicate that ESC-derived neuroprogeni-tors can survive, differentiate, migrate, and can be suc-cessfully implanted in vivo into a mouse model presenting retinal degeneration. In brief, these fi ndings suggest that the implantation of neuroprogenitors may be used potentially to repair damaged retinal tissue and restore vision loss that resulted from retinal degeneration.

06-SCD-2008_0057.indd 256 3/2/2009 8:26:47 AM


precursor cells transplanted to adult rat retina. Stem Cells

22:27–38.

9. Qiu G, MJ Seiler, C Mui, S Arai, RB Aramant, E de Juan Jr and

S Sadda. (2005). Photoreceptor differentiation and integration of

retinal progenitor cells transplanted into transgenic rats. Exp

Eye Res 80:515–525.

10. Warfvinge K, JF Kiilgaard, EB Lavik, E Scherfi g, R Langer,

HJ Klassen and MJ Young. (2005). Retinal progenitor cell xeno-

grafts to the pig retina: morphologic integration and cytochem-

ical differentiation. Arch Ophthalmol 123:385–393.

11. Kolf CM, E Cho and RS Tuan. Mesenchymal stromal cells.

(2007). Biology of adult mesenchymal stem cells: regulation

of niche, self-renewal and differentiation. Arthritis Res Ther

9:204–213.

12. Lamba DA, MO Karl, CB Ware and TA Reh. (2006). Effi cient gen-

eration of retinal progenitor cells from human embryonic stem

cells. Proc Natl Acad Sci USA 103:12769–12774.

13. Haruta M, Y Sasai, H Kawasaki, K Amemiya, S Ooto, M Kitada,

H Suemori, N Nakatsuji, C Ide, Y Honda and M Takahashi.

(2004). In vitro and in vivo characterization of pigment epi-

thelial cells differentiated from primate embryonic stem cells.

Invest Ophthalmol Vis Sci 45:20–25.

14. Meyer JS, ML Katz, JA Maruniak and MD Kirk. (2004). Neural

differentiation of mouse embryonic stem cells in vitro and after

transplantation into eyes of mutant mice with rapid retinal

degeneration. Brain Res 1014:131–144.

15. Gu SM, DA Thompson, CR Srikumari, B Lorenz, U Finckh,

A Nicoletti, KR Murthy, M Rathmann, G Kumaramanickavel,

MJ Denton and A Gal. (1997). Mutations in RPE65 cause auto-

somal recessive childhood-onset severe retinal dystrophy. Nat

Genet 17:194–197.

16. Nicoletti A, DJ Wong, K Kawase, LH Gibson, TL Yang-Feng,

JE Richards and DA Thompson. (1995). Molecular characterization

of the human gene encoding an abundant 61 kDa protein specifi c

to the retinal pigment epithelium. Hum Mol Genet 4:641–649.

17. Thompson DA and A Gal. (2003). Genetic defects in vitamin A

metabolism of the retinal pigment epithelium. Dev Ophthalmol

37:141–154.

18. Pang JJ, B Chang, NL Hawes, RE Hurd, MT Davisson, J Li,

SM Noorwez, R Malhotra, JH McDowell, S Kaushal, WW

Hauswirth, S Nusinowitz, DA Thompson and JR Heckenlively.

(2005). Retinal degeneration 12 (rd12): a new, spontaneously

arising mouse model for human Leber congenital amaurosis

(LCA). Mol Vis 11:152–162.

19. Marlhens F, C Bareil, JM Griffoin, E Zrenner, P Amalric, C Eliaou,

SY Liu, E Harris, TM Redmond, B Arnaud, M Claustres and CP

Hamel. (1997). Mutations in RPE65 cause Leber’s congenital

amaurosis. Nat Genet 17:39–41.

20. Nusinowitz S, WH Ridder III, JJ Pang, B Chang, SM Noorwez,

S Kaushal, WW Hauswirth and JR Heckenlively. (2006). Cortical

visual function in the rd12 mouse model of Leber Congenital

Amarousis (LCA) after gene replacement therapy to restore ret-

inal function. Vision Res 46:3926–3934.

21. Roman AJ, SL Boye, TS Aleman, JJ Pang, JH McDowell, SE Boye,

AV Cideciyan, SG Jacobson and WW Hauswirth. (2007).

Electroretinographic analyses of Rpe65-mutant rd12 mice:

developing an in vivo bioassay for human gene therapy trials of

Leber congenital amaurosis. Mol Vis 18:1701–1710.

22. Chaudhry GR, D Yao, A Smith and A Hussain. (2004). Osteogenic

cells derived from embryonic stem cells produced bone nod-

ules in three-dimensional scaffolds. J Biomed Biotechnol

2004:203–210.

23. Banin E, A Obolensky, M Idelson, I Hemo, E Reinhardtz,

E Pikarsky, Ben- T Hur and B Reubinoff. (2006). Retinal incor-

poration and differentiation of neural precursors derived from

human embryonic stem cells. Stem Cells 24:246–257.

24. Canola K, B Angénieux, M Tekaya, A Quiambao, MI Naash,

FL Munier, DF Schorderet and Y Arsenijevic. (2007). Retinal

stem cells transplanted into models of late stages of retinitis

Acknowledgments

This study was supported by the William Beaumont Hospital Foundation and Oakland University. We would like to thank Jaime Brozowski for reviewing the manuscript.

References

1. Young MJ, J Ray, SJ Whiteley, H Klassen and FH Gage. (2000).

Neuronal differentiation and morphological integration of hip-

pocampal progenitor cells transplanted to the retina of imma-

ture and mature dystrophic rats. Mol Cell Neurosci 3:197–205.

2. Nishida A, M Takahashi, H Tanihara, I Nakano, JB Takahashi,

A Mizoguchi, C Ide and Y Honda. (2000). Incorporation and dif-

ferentiation of hippocampus-derived neural stem cells trans-

planted in injured adult rat retina. Invest Ophthalmol Vis Sci

41:4268–4274.

3. Guo Y, P Saloupis, SJ Shaw and DW Rickman. (2003).

Engraftment of adult neural progenitor cells transplanted to rat

retina injured by transient ischemia. Invest Ophthalmol Vis Sci

44:3194–3201.

4. Otani A, MI Dorrell, K Kinder, SK Moreno, S Nusinowitz,

E Banin, J Heckenlively and M Friedlander. (2004). Rescue of

retinal degeneration by intravitreally injected adult bone mar-

row-derived lineage-negative hematopoietic stem cells. J Clin

Invest 114:765–774.

5. Arnhold S, P Heiduschka, H Klein, Y Absenger, S Basnaoglu,

F Kreppel, S Henke-Fahle, S Kochanek, KU Bartz-Schmidt,

K Addicks and U Schraermeyer. (2006). Adenovirally trans-

duced bone marrow stromal cells differentiate into pigment

epithelial cells and induce rescue effects in RCS rats. Invest

Ophthalmol Vis Sci 47:4121–4129.

6. Morimura H, GA Fishman, SA Grover, AB Fulton, EL Berson

and TP Dryja. (1998). Mutations in the RPE65 gene in patients

with autosomal recessive retinitis pigmentosa or leber congeni-

tal amaurosis. Proc Natl Acad Sci USA 95:3088–3093.

7. Hadjantonakis AK, S Macmaster and A Nagy. (2002). Embryonic

stem cells and mice expressing different GFP variants for mul-

tiple noninvasive reporter usage within a single animal. BMC

Biotechnol 2:11–19.

8. Wojciechowski AB, U Englund, C Lundberg and K Warfvinge.

(2004). Survival and long distance migration of brain-derived

FIG. 10. Expression of neurospecifi c markers in the YFP positive cells isolated from rd12 mouse eyes implanted with neuroprogenitors. mRNA was isolated from the YFP pos-itive cells, amplifi ed using RT-PCR, and analyzed by 2.0% agarose gel electrophoresis. Shown are the amplifi ed prod-ucts of YFP, Nestin, Olig 1, GFAP, and β-Actin (lanes 3–7, respectively). Lane 1 is a DNA ladder 25–600 bps.

06-SCD-2008_0057.indd 257 3/2/2009 8:26:47 AM

CHAUDHRY ET AL.258

(2001). FGF-2 regulation of neurogenesis in adult hippocampus

after brain injury. Proc Natl Acad Sci USA 98:5874–5879.

34. Zhang P, J Chebath, P Lonai and M Revel. (2004). Enhancement

of oligodendrocyte differentiation from murine embryonic stem

cells by an activator of gp130 signaling. Stem Cells 22:344–354.

35. Williams AJ, HH Wei, JR Dave and FC Tortella. (2007). Acute and

delayed neuroinfl ammatory response following experimental

penetrating ballistic brain injury in the rat. J Neuroinfl ammation

4:17–28.

36. Greenberg KP, SF Geller, DV Schaffer and JG Flannery. (2007).

Targeted transgene expression in muller glia of normal and

diseased retinas using lentiviral vectors. Invest Ophthalmol

Vis Sci 48:1844–1852.

37. Yoshida T, K Ohno-Matsui, S Ichinose, T Sato, N Iwata, TC Saido,

T Hisatomi, M Mochizuki and I Morita. (2005). The potential

role of amyloid beta in the pathogenesis of age-related macular

degeneration. J Clin Invest 115:2793–2800.

38. MacLaren RE, RA Pearson, A MacNeil, RH Douglas, TE Salt,

M Akimoto, A Swaroop, JC Sowden and RR Ali. (2006). Retinal

repair by transplantation of photoreceptor precursors. Nature

444:203–207.

39. Aoki H, A Hara, M Niwa, T Motohashi, T Suzuki and

T Kunisada. (2007). An in vitro mouse model for retinal gan-

glion cell replacement therapy using eye-like structures differ-

entiated from ES cells. Exp Eye Res 84:868–875.

40. Neuss S, E Becher, M Wöltje, L Tietze and W Jahnen-Dechent.

(2004). Functional expression of HGF and HGF receptor/c-met in

adult human mesenchymal stem cells suggests a role in cell mobi-

lization, tissue repair, and wound healing. Stem Cells 22:405–414.

Address reprint requests to:Dr. G. Rasul Chaudhry

Department of Biological SciencesOakland University

2200 Squirel RdRochester, MI 48309

E-mail: [email protected]

Received for publication January 27, 2008; accepted after revision April 28, 2008.

pigmentosa preferentially adopt a glial or a retinal ganglion cell

fate. Invest Ophthalmol Vis Sci 48:446–454.

25. Pressmar S, M Ader, G Richard, M Schachner and U Bartsch.

(2001). The fate of heterotopically grafted neural precursor

cells in the normal and dystrophic adult mouse retina. Invest

Ophthalmol Vis Sci 13:3311–3319.

26. Han WK, A Dickerson, D Ortiz, AF Pimenta, CM Moran, J Motil,

SJ Snyder, K Malik, HC Pant and TB Shea. (2004). Mitogen-

activated protein kinase regulates neurofi lament axonal trans-

port. J Cell Sci 117:4629–4642.

27. Shacka JJ, BJ Klocke, C Young, M Shibata, JW Olney, Y Uchiyama,

P Saftig and KA Roth. (2007). Cathepsin D defi ciency induces

persistent neurodegeneration in the absence of Bax-dependent

apoptosis. J Neurosci 27:2081–2090.

28. Klassen HJ, TF Ng, Y Kurimoto, I Kirov, M Shatos, P Coffey

and MJ Young. (2004). Multipotent retinal progenitors express

developmental markers, differentiate into retinal neurons, and

preserve light-mediated behavior. Invest Ophthal mol Vis Sci

45:4167–4173.

29. Swijnenburg RJ, M Tanaka, H Vogel, J Baker, T Kofi dis,

F Gunawan, DR Lebl, AD Caffarelli, JL de Bruin, EV Fedoseyeva

and RC Robbins. (2005). Embryonic stem cell immunogenicity

increases upon differentiation after transplantation into ische-

mic myocardium. Circulation 112:166–173.

30. Arnhold S, H Klein, I Semkova, K Addicks and U Schraermeyer.

(2004). Neurally selected embryonic stem cells induce tumor

formation after long-term survival following engraftment into

the subretinal space. Invest Ophthalmol Vis Sci 45:4251–4255.

31. Wakitani S, K Takaoka, T Hattori, N Miyazawa, T Iwanaga,

S Takeda, TK Watanabe and A Tanigami. (2003). Embryonic

stem cells injected into the mouse knee joint form teratomas

and subsequently destroy the joint. Rheumatology (Oxford)

42:162–165.

32. Shiras A, A Bhosale, V Shepal, R Shukla, VS Baburao,

K Prabhakara and P Shastry. (2003). A unique model system for

tumor progression in GBM comprising two developed human

neuro-epithelial cell lines with differential transforming poten-

tial and coexpressing neuronal and glial markers. Neoplasia

5:520–532.

33. Yoshimura S, Y Takagi, J Harada, T Teramoto, SS Thomas,

C Waeber, JC Bakowska, XO Breakefi eld and MA Moskowitz.

06-SCD-2008_0057.indd 258 3/2/2009 8:26:48 AM