Expression of Xylella fastidiosa fimbrial and afimbrial proteins during the biofilm
formation.
1
2
3
4
5
6
9
10
11
Caserta, R.1 2; Takita, M. A.1; Targon, M. L.1; Rosselli-Murai, L. K.2; de Souza, A. P.2;
Peroni, L.3; Stach-Machado, D. R.3; Andrade, A.4; Labate, C. A.4; Kitajima, E. W.5; Machado,
M.A.1; de Souza, A. A.1*
1. Centro APTA Citros Sylvio Moreira/IAC, Rodovia Anhanguera Km 158, Cordeirópolis – 7
SP, BRAZIL, Zip code: 13490-970. 8
2. Universidade Estadual de Campinas/UNICAMP, Centro de Biologia Molecular e
Engenharia Genética, Departamento de Genética e Evolução, Instituto de Biologia, PO Box
6010, Campinas – SP, BRAZIL, Zip code: 13083-970.
3. Universidade Estadual de Campinas/UNICAMP, Laboratório de Imunologia Aplicada, 12
Departamento de Microbiologia e Imunologia, Rua Monteiro Lobato s/n, Campinas – SP, 13
BRAZIL, Zip code:13083-970. 14
15
16
17
18
19
20
21
22
23
24
25
4. Escola Superior de Agricultura “Luiz de Queiroz”/USP, Laboratório Max Feffer de
Genética de Plantas, Departamento de Genética, P.O. Box 83, Piracicaba - SP, BRAZIL, Zip
code: 13400-970.
5. Escola Superior de Agricultura “Luiz de Queiroz”/USP, Núcleo de Apoio à Pesquisa em
Microscopia Eletrônica aplicada à Pesquisa Agropecuária (NAP/MEPA), Piracicaba - SP,
BRAZIL, Zip code: 13418-900.
Running title: Adhesins in the X. fastidiosa biofilm formation
*Corresponding author: Alessandra Alves de Souza
Email: [email protected]
Copyright © 2010, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights Reserved.Appl. Environ. Microbiol. doi:10.1128/AEM.02114-09 AEM Accepts, published online ahead of print on 14 May 2010
on March 15, 2018 by guest
http://aem.asm
.org/D
ownloaded from
2
Abstract 27
The complete sequencing of the Xylella fastidiosa genome revealed characteristics that 28
were previously unknown for a phytopathogen. One characteristic of this genome was the 29
abundance of genes encoding proteins with adhesion functions related to biofilm formation, 30
an essential step for the colonization of the plant host or the insect vector. Among the 31
different proteins belonging to this class present in the genome of X. fastidiosa, we examined 32
the PilA2 and PilC fimbrial proteins, components of the type IV pili, and XadA1 and XadA2, 33
afimbrial adhesins. Polyclonal antibodies were raised against these four proteins and their 34
behavior during the biofilm development was assessed by Western blot and 35
immunofluorescence experiments assays. In addition, immunogold electron microscopy was 36
used to detect these proteins in bacteria present in xylem vessels of three different hosts 37
(citrus, periwrinkle and hibiscus). We verified that these proteins are present in the biofilm of 38
X. fastidiosa but show a differential regulation since their amounts varied temporally during 39
biofilm formation as well as spatially within the biofilms. The proteins were also detected in 40
bacteria colonizing the xylem vessels of infected plants. 41
42
Introduction 43
Aggregative growth is a common feature in the microbial world and its discovery 44
radically changed our concept of microbial growth dynamics. A cellular aggregate adhered to 45
a surface is known as biofilm. It exhibits important characteristics such as higher resistance to 46
antimicrobial compounds (55, 35), increased capacity of cells to uptake nutrients from the 47
environment (60), and higher efficiency in detoxification resulting from an increase in 48
expression of genes encoding efflux pumps (44). These characteristics give the biofilm cells a 49
great adaptative advantage. 50
on March 15, 2018 by guest
http://aem.asm
.org/D
ownloaded from
3
Biofilm growth also confers advantages to plant pathogens by promoting virulence 51
and protection against plant defense responses. Bacteria can colonize different niches in the 52
plant, from aerial surfaces to roots and the vascular system and biofilm formation can play a 53
role in all these sites of colonization. In the vessels, biofilm is very important since the cells 54
need to survive in a competitive habitat where plant defense compounds are produced in 55
response to infection (8). 56
Biofilm development is divided into at least five phases (i) reversible attachment, (ii) 57
irreversible attachment, (iii) beginning of maturation, (iv) mature biofilm, and (v) dispersion 58
(15, 51). In X. fastidiosa 9a5c strain, the maturation phase occurs between 15 and 20 days in 59
vitro while its dispersion happens between 25 and 30 days, as observed by our analysis of 60
biofilm formation using different methods including scanning electron microscopy and 61
quantification of exopolysaccharides, biomass, and total protein (unpublished data). The 62
establishment and development of biofilms of plant colonizing bacteria shares several features 63
with human bacterial pathogens such as the regulation by quorum sensing, nutrient starvation 64
regulation, and phase variation. Motility is also an important factor not only for the initiation 65
and development of the biofilm but also for dispersion (51). Attachment is mediated by 66
surface-associated structures, which includes both polysaccharides and proteins classified as 67
fimbrial and afimbrial adhesins, depending on the structure to which they contribute. Fimbrial 68
adhesins form filamentous structures, while afimbrial adhesins produce projections on the 69
outer membrane (24). 70
Xylella fastidiosa, a gram-negative phytopathogen that grows as a biofilm within both 71
plant xylem vessels and the cybarium of insect vectors, is a major threat for plant production 72
around the world. In Brazil, it has a major economic impact on citriculture since it causes 73
Citrus Variegated Chlorosis disease (CVC) (39, 36, 43). The biofilm formed by X. fastidiosa 74
blocks the xylem vessels of susceptible citrus plants impairing water flow. This blockage 75
on March 15, 2018 by guest
http://aem.asm
.org/D
ownloaded from
4
leads to a drastic reduction in fruit size (33) and consequently, severe economic losses 76
resulting from reduced plant productivity (4). 77
Due to the economic damage caused by CVC, there has been a major effort to generate 78
more information about its biology. This led to the sequencing of the genome of this 79
pathogen. The X. fastidiosa genome harbors a wide variety of genes encoding adhesins (54). 80
Bacterial cell surface adhesins are important at the initial phases of adherence to surfaces as 81
well as in bacterium – bacterium interactions and microcolony development (17). Insight into 82
X. fastidiosa has also come from genome analysis of a strain of X. fastidiosa, which cause 83
Pierce's disease of grape (59). Studies on this strain showed that the cellular aggregation 84
process involves type I and type IV fimbrial adhesins. Both fimbriae present different 85
adhesion forces that help bacteria to adhere to the substrate (31, 11). Adhesion proteins have 86
also been demonstrated to mediate adherence to carbohydrates of the leafhopper foregut 87
surfaces (28). In addition, both fimbrial and afimbrial adhesins are important for plant 88
pathogenicity (42, 38). However, the expression of these proteins during X. fastidiosa biofilm 89
formation either in vitro or in planta is still poorly understood. For X. fastidiosa strains 90
causing CVC, nothing is known about the role of these proteins in pathogenicity or biofilm 91
formation although some adhesion-encoding genes such as pilA2, pilC, xadA1 and xadA2 92
were found to be up-regulated in either virulent strains of this pathogen or during biofilm 93
formation (14, 16). These results suggest that the biofilm mode of growth is important for the 94
colonization success of CVC X. fastidiosa in the citrus host. In this work we focused on the 95
temporal expression of the PilA2 and PilC fimbrial proteins and XadA1 and XadA2, afimbrial 96
adhesins, during the in vitro development of the CVC X. fastidiosa biofilm. We demonstrate 97
that the fimbrial and afimbrial adhesins exhibit very different temporal and spatial patterns of 98
expression during the biofilm development in vitro. Moreover, we also verified the presence 99
on March 15, 2018 by guest
http://aem.asm
.org/D
ownloaded from
5
of these adhesins in X. fastidiosa cells in symptomatic plants from three different hosts (citrus, 100
periwinkle and hibiscus). 101
102
Material and Methods 103
X. fastidiosa strain and in vitro growth condition 104
X. fastidiosa subsp. Pauca strain 9a5c (52), for which a genome sequence is available 105
and obtained from INRA (Institut National de La Recherche Agronomique, Bordeaux, 106
France) was used in all studies. Bacteria were extracted from petioles of symptomatic plants 107
ground in phosphate buffer saline (PBS) and the suspension was spread on periwinkle wilt 108
medium (PW) (9). The first colonies were observed between ten to fifteen days after 109
inoculation and such cells were inoculated into 50mL of PW medium and grown at 130rpm 110
and 28ºC. These cultures were transferred weekly to new media (one week corresponds to one 111
passage) and used to obtain both the biofilm and planktonic cells. The biofilms were 112
recovered from the first (7 days, 14 generations) to the eighth (56 days, 112 generations) 113
passage. Planktonic cells which no longer formed a biofilm were collected after the 114
eighteenth passage (126 days, 252 generations) in PW medium, and used after the 10th
day of 115
growth. For X. fastidiosa 9a5c strain, the doubling time corresponds to 12 hours. 116
117
Construction of expression vectors 118
In order to amplify highly antigenic regions of the target proteins for antibody 119
production, primers were designed to flanking coding sequences carrying hydrophilic and 120
antigenic regions (Lasergene 99 DNASTAR, Inc.). More than one pair of primers were 121
designed for different antigenic regions of the fimbrial proteins PilA2 [Tfp pilus assembly 122
protein, major pilin FimA/PilA (Type IV fimbrillin)] (LBI ORF ID: XF2539) and PilC (Type 123
IV fimbrial assembly protein PilC) (LBI ORF ID: XF 2538), and the afimbrial proteins 124
on March 15, 2018 by guest
http://aem.asm
.org/D
ownloaded from
6
XadA2 (Surface protein adhesin YadA-like) (LBI ORF ID: XF 1529) and XadA1 (Surface 125
protein adhesin YadA-like) (LBI ORF ID: XF 1516). These proteins were originally 126
annotated as FimA, PilC, Hsf and UspA1 but later were re-annotated as noted above; the 127
current accepted annotation can be accessed at www.xylella.lncc.br. Sites for EcoRI and 128
HindIII were placed at the 5´ and 3´ regions of each primer, for directional cloning in pET28a 129
(Novagen). The software Primer Select from Lasergene99 (DNASTAR, Inc.) was used to 130
design the primers. The primers sequences are listed in Table 1. 131
The PCR mix used for obtaining the amplicons contained 100ng of total 9a5c DNA, 132
50ng of each primer Forward (F) and Reverse (R), 2.5mM of dNTP, 1.25µL of 50mM 133
MgSO4, 2.5µL of 10X buffer (Invitrogen), 1 unit de Taq Platinum High Fidelity (Invitrogen) 134
and Milli-Q H2O to 25µL. The amplification was done by one cycle at 94ºC for 3 min, 135
followed by 35 cycles of 55ºC for 1 min, 72
ºC for 1.5 min and 94
ºC for 1 min, and 10 min at 136
72ºC for further extension. The amplified fragments were analyzed in 1% agarose gel stained 137
with ethidium bromide, and visualized under UV light. The fragments were excised from the 138
gel and purified using the ‘GFXTM
PCR DNA and Gel Band Purification’ kit (Amersham 139
Biosciences). The amplicons were cloned in the pGEM-T vector (Promega). E. coli DH5α 140
competent cells were transformed with the constructions and the transformants were grown in 141
LB containing 100µg/mL of ampicilin. 142
The recombinant plasmids were sequenced with the two primers used for amplification 143
of the target genes and primers for pGEM-T vector (T7 and SP6 promoter primers). For 144
sequencing the xadA1-1 and xadA1-2 fragments (1.5Kb and 2.0Kb, respectively), internal 145
primers were also used in order to obtain the full nucleotide sequences. The reactions were 146
prepared according to Applied Biosystems instructions for DNA Sequencing Kit Big Dye 147
Terminator Cycle Sequencing Ready Reaction, v 3.0, and the resulting DNAs were run in the 148
ABI 3730 automatic sequencer (Applied Biosystems). The quality of the cloned DNA 149
on March 15, 2018 by guest
http://aem.asm
.org/D
ownloaded from
7
fragment was confirmed through similarity searches against the X. fastidiosa database using 150
BlastN and BlastX (http://www.ncbi.nlm.nih.gov/sutils/genom_table.cgi) tools. Plasmids 151
containing sequences with 100% of identity with the expected nucleotide sequences were 152
cleaved with EcoRI and HindIII (Invitrogen) for directional cloning in pET28a using T4 DNA 153
Ligase (Invitrogen). pET28a is designed for expression of the recombinant protein fused to a 154
six amino acid His-tag in both the N and C-terminal regions of the protein. Rosetta competent 155
cells of E. coli were transformed with the recombinant plasmids and the selection conducted 156
in LB plates containing 100µg/mL of kanamycin. PCR colony screen was used for false 157
positive exclusion. 158
159
Expression of the target proteins and purification 160
The induction of the target proteins was performed using 1mM of IPTG in 100mL of 161
culture and two hours incubation at 37ºC. For the proteins that appeared in the insoluble 162
phase, a lower temperature of induction was used (25ºC). The cells were collected by 163
centrifugation at 4000xg for 20 min at 8ºC, suspended in 1mL of buffer 1 (Tris 50mM, NaCl 164
300mM pH7.5) containing 1mg/mL lysozyme and 1mM of PMSF (Phenyl Methyl Sulphonyl 165
Fluoride), and lysed by sonication on ice, in an ultrasonic cell disruptor (Unique). The cell 166
debris and supernatant were precipitated by centrifugation at 12,000rpm for 15 min at 8ºC and 167
the expression pattern of each sample was monitored by SDS – PAGE performed using 12% 168
or 15% separation gel under reducing conditions according to Laemmli (30) and stained with 169
Coomassie brilliant blue R-250 and distained with methanol/acetic acid. 170
Soluble proteins were purified through an Immobilized Metal Affinity Chromatography 171
(IMAC) column packed with 1.0mL of nickel-nitrilotriacetic acid (Ni-NTA) resin. Bound 172
proteins were eluted with 4mL of 200mM of imidazole in 50mM Tris pH7.5, 300mM NaCl. 173
on March 15, 2018 by guest
http://aem.asm
.org/D
ownloaded from
8
Fractions were used to estimate total protein concentration (Bradford assay) and analyzed by 174
SDS-PAGE. 175
Even at low induction temperatures PilC was found only in the insoluble fraction of the 176
extract. Therefore, this protein was cut out of the gel for immunization purpose. 177
178
Identification of purified proteins by LC-MS/MS 179
After obtaining the target proteins, we confirmed their identity through mass 180
spectrometry analysis. For that, the samples were excised from SDS – Page gel and digested 181
according to Celedon (5), using trypsin (Invitrogen), before sequence analysis. The peptide 182
mixtures were identified by on-line chromatography using a Cap-LC coupled to a Q-TOF 183
Ultima API mass spectrometer (Waters). Five microliters of sample were loaded onto a 184
nanoease trapping column 0.18 x 23.5mm (Waters) for pre-concentration, followed by peptide 185
separation in a LC nanoease column Symmetry 300 C18 3.5µm, 75x100mm (Waters). 186
Peptides were eluted in a 60 min linear gradient of solvent B [95 % (v/v) ACN, 0.1% (v/v) 187
formic acid in water] at a flow rate of 250nLmin-¹. Solvent A consisted of [5 % (v/v) ACN, 188
0.1% (v/v) formic acid in water]. The whole analysis was performed using a positive ion 189
mode at a 3kV needle voltage. The mass range was set from 300 to 2000m/z, and the MS/MS 190
spectra acquired for the most intense peaks (≥ 15 counts). Multiple charged precursor ions 191
were selected for fragmentation and peptide sequencing using automated data dependent 192
acquisition (DDA) MassLynx software (Waters), switching from the MS to MS/MS mode and 193
then returning to the MS. The resulting fragmented spectra were processed using the 194
ProteinLynx v4.0 software (Waters). The MASCOT MS/MS Ion Search 195
(www.matrixscience.com) was used to blast the sequences against the SwissProt and NCBI nr 196
databases. Combined MS-MS/MS searches were conducted with parent ion mass tolerance at 197
50ppm, MS/MS mass tolerance of 0.1Da, carbamidomethylation of cysteine (fixed 198
on March 15, 2018 by guest
http://aem.asm
.org/D
ownloaded from
9
modification) and methionine oxidation (variable modification). According to MASCOT 199
probability analysis, only significant (P < 0.05) hits were accepted. 200
Antibody production 201
The antibodies against the target proteins were obtained in New Zealand White 202
rabbits. The purified proteins as well as PilC (excised from an SDS gel) were individually 203
mixed with Freund’s complete adjuvant (Sigma) and injected into individual rabbits. Two 204
additional injections of proteins mixed with Freund’s incomplete adjuvant were done at 10 205
and 20 days after the first injection. The concentration of inoculated proteins reached 150µg. 206
The quality of the antibodies was tested by direct enzyme-linked immunosorbent assay 207
(ELISA), using 3µg of the target proteins as antigens and PBS buffer as negative control. The 208
antibodies dilution varied from 1:10,000 to 1:256,000. The antibodies yielded positive 209
reactions even at 1:250,000 dilution and no cross-reaction was observed with any of the other 210
proteins used for antibody production. 211
212
Total protein extraction of X. fastidiosa biofilm growth phases 213
Three replicate experiments were carried out for biofilm protein extraction. Cells 214
grown in PW medium until the eighth passage were transferred to flasks containing 50mL of 215
medium and grown under the conditions described above. The biofilms formed attached to the 216
glass at the medium-air interface were collected at 3, 5, 10, 15, 20, and 30 days of growth, 217
corresponding to the different developmental biofilm phases (15), and total protein was 218
extracted. For this procedure, the medium was discarded and 1mL of wash buffer (Tris pH8.0 219
50mM; NaCl 25mM; EDTA 5mM pH8.0; 2% Triton X-100) was used to collect biofilm cells. 220
Lysozyme and PMSF (1mM each) were added to the extract and the samples kept on ice for 221
20 min. Cell lysis was obtained by sonication, followed by centrifugation at 10,000xg for 10 222
on March 15, 2018 by guest
http://aem.asm
.org/D
ownloaded from
10
min. The supernatant and pellet were used for protein analysis. For planktonic condition, the 223
cells were obtained after the eighteenth passage when no biofilm was observed at the 224
medium-air interface and collected through centrifugation at 6,000xg for 5 min. Total protein 225
was extracted by treating the cells as described for the biofilms. For all the biological 226
experiments carried out, the amount of total protein obtained from each biofilm phase was 227
normalized before loading the gel, based on a BSA standard curve comparison, which 228
presented an R2 = 0.956. 229
230
Western blot assays 231
X. fastidiosa proteins from different biofilm developmental phases and planktonic 232
growth were quantified according to the procedure described by Lowry (32). For the Western 233
blot assays, 6 µg of proteins for each of the growth conditions were separated in 9 % or 12% 234
SDS-PAGE (sodium dodecyl sulfate polyacrilamide gel electrophoresis), depending on the 235
protein size. Individual Western blot experiments were done for each of the antibodies tested 236
and preimmune rabbit antiserum was used to verify a possible unspecific cross-reaction. After 237
electrophoresis, gels were incubated in Tris glycine buffer (48mM Tris; 39mM glycine; 238
0.04% SDS; 20% methanol) for 1h and the proteins were transferred to A nitrocellulose 239
membrane (Hybond - C Ultra, Amersham) according to the specifications of the manufacturer 240
(Pharmacia) for the Multiphor II Novablot Electrophoretic transfer unit. Membranes were 241
treated according to Amersham's Hybond TM – C nitrocellulose membrane protocol, using 242
TBS buffer (150mM NaCl; 10mM Tris-HCl pH 8.0), blocking period of 16 hours, and 243
incubation with antibodies in a 1:10,000 dilution for 6 hours. The membranes were incubated 244
with a 1:10,000 dilution of goat anti-rabbit alkaline phosphatase conjugate (Sigma) for 1 hour 245
at 37°C, and washed 3 times with 1X TBS, 0.1% Tween-20. For detection of the proteins, the 246
membranes were incubated in freshly prepared substrate solution (0.1M Tris-HCl pH 9.5; 247
on March 15, 2018 by guest
http://aem.asm
.org/D
ownloaded from
11
0.1M NaCl, 5mM MgCl2, 2mg 5-bromo 4-chloro 3-indolyl phosphate and 4mg Nitro Blue 248
Tetrazolium). When the desired staining was achieved, the reaction was stopped by washing 249
the membranes in distilled water. At least three membranes for each biological experiment 250
were tested. 251
Quantification of signal intensity was determined using Image J 1.42q 252
(http://rsb.info.nih.gov/ij) software. The values were used for statistical analyses (t-test, 253
P≤0.05). 254
255
Immunofluorescence of the target proteins in X. fastidiosa biofilm 256
For the immunofluorescence analysis, the biofilms were obtained in cover glasses 257
placed at the bottom of 24 wells Nunclon delta SI Multidishes (Nunc A/S, Roskilde, 258
Denmark) containing 1mL of liquid PW medium in each well. For each time point one plate 259
was used, where 100µL of a pre-inoculum of X. fastidiosa 9a5c (OD = 0.1) were added to 260
four different wells. These culture plates were maintained static at 28ºC and analyzed after 3, 261
5, 10, 15, 20, and 30 days of growth. The PW medium was gently removed from the wells 262
with a pipette, and the biofilm adhered to glass cover was washed, according to Roper (49) 263
but without fixing the cells since the aim of this work was to evaluate just the adhered cells. 264
Each of the antibodies and the preimmune sera were used individually in a dilution of 265
1:1,000. For the localization of proteins in the formed biofilms, we used 1mL of Goat anti-266
rabbit IgG rhodamine conjugated (Santa Cruz Biotechnlogy, Inc., California, USA) in 267
1:10,000 dilution in PBS buffer. The staining of biofilm cells was done with Syto 9 diluted 268
1:600 in MilliQ autoclaved H2O. The images were taken using oil immersion lens (numerical 269
aperture, 1.0) in an Olympus UIS2 Fluorescence microscope using, for Syto 9, a filter that 270
permits an excitation wavelength between 460 and 490nm and emission wavelength between 271
500 and 520nm, and for rhodamine images, a filter that allowed an excitation wavelength 272
on March 15, 2018 by guest
http://aem.asm
.org/D
ownloaded from
12
between 510 and 550nm and emission wavelength between 570 and 590nm. To verify a 273
possible non-specific fluorescent signal, two negative controls were prepared from biofilms at 274
30 days of growth, one without secondary rhodamine conjugate antibodies, and another 275
without primary antibody incubation. 276
277
Immunogold transmission electron microscopy of symptomatic plants 278
Small fragments of petioles from citrus (sweet orange Citrus sinensis cv. Pera), 279
periwinkle (Catharantus roseus) and hibiscus (Hibiscus schizopetalus) infected by X. 280
fastidiosa were fixed in a modified Karnovksy solution (2% paraformaldehyde, 2.5% 281
glutaraldehyde in 0.05M cacodylate buffer, pH 7.2 with 0.001M CaCl2) for 1 to 2 h. These 282
plants were naturally infected by X. fastidiosa, whose presence was confirmed by previous 283
PCR assays. Citrus exhibited characteristic symptoms of CVC, while periwinkle had a general 284
chlorosis and stunting and hibiscus, leaf scald symptoms (29). Fixed tissues were dehydrated 285
in ethanol series (30%, 50%, 70%, 90%) for about 10 min each and then transferred to chilled 286
100% ethanol. Dehydrated tissues were infiltrated with a mixture of ethanol 100% and 287
LRWhite resin (1:1) for 6 h at 4ºC and overnight with pure LRWhite at 4ºC. Infiltrated tissues 288
were then transferred to size 3 gelatin capsules filled with pure LR White and let polymerize 289
at 60ºC for 2 days. Embedded tissues were cut in thin sections in a Leica UC 6 290
ultramicrotome equipped with a Diatome diamond knife and the sections mounted in 100 291
mesh nickel grids covered with Formvar films. Immunolocalization assays with antibodies 292
against the target proteins were done according to the protocol of Vandenbosch (58). As 293
controls for the experiment, images of non-infected xylem vessels of infected plants, the wall 294
of infected xylem vessels, and parenchyma were evaluated and compared. The background 295
was reduced by adjusting the antibodies dilution to 1:250. About 40 immunogold tests for 296
each plant with at least eighty sections per test were done generating a minimum of twenty 297
on March 15, 2018 by guest
http://aem.asm
.org/D
ownloaded from
13
images for each protein in each plant species in the experiment. Transmission electron 298
microscopic examinations were done in a Zeiss EM 900 electron microscope at 80 KV and 299
the images, registered digitally. 300
301
Results 302
Protein purification, polyclonal antibodies and Western blot analysis 303
Clones containing recombinant plasmids produced the proteins of interest in sufficient 304
amounts for further purification. The recombinant proteins PilA2, XadA2 and XadA1 were 305
obtained in the soluble fraction of the protein extracts. In contrast, PilC was present only in 306
the insoluble fraction, even when low induction temperatures were used. The fractions 307
containing PilA2, XadA2 and XadA1 were purified through IMAC and it was possible to 308
recover high amounts of purified proteins after elution with imidazole. For PilC, we excised 309
the band corresponding to the target protein directly from the polyacrylamide gel. The 310
induction and purification were monitored by SDS-Page (data not shown). The identity of the 311
purified proteins was confirmed by LC-MS/MS (data not shown). The proteins were 312
inoculated in rabbits for antibody production. 313
The amount of fimbrial and afimbrial proteins in biofilms was verified in Western blot 314
using cells obtained at 3, 5, 10, 15, 20, and 30 days of growth (Fig. 1), corresponding to the 315
initial adhesion of the cells to the substrate (3 and 5 days), microcolonies formation (10 days), 316
early development of the biofilm architecture (15 days), mature biofilm (20 days), and after 317
some apparent dispersion had occurred (30 days) (unpublished data). Analysis of PilA2, PilC, 318
and XadA2 revealed proteins with apparent molecular masses of approximately 15KDa, 319
55KDa, and 200KDa respectively. These masses are in accordance with the expected for these 320
proteins (http://www.lbi.ic.unicamp.br/xf/). For XadA1, Western blot revealed a band of 321
approximately 70KDa (Fig. 1D) when the predicted molecular mass for XadA1 from X. 322
on March 15, 2018 by guest
http://aem.asm
.org/D
ownloaded from
14
fastidiosa 9a5c is 98KDa. Since contamination was excluded by the analysis of mass 323
spectrometry (Table 2), there is apparently a cleavage of the protein or its genome annotation 324
is wrong. 325
The temporal pattern of abundance of both fimbrial proteins, PilA2 and PilC, was 326
similar and statistically significant differences were observed between the initial and later 327
phases of biofilm formation (Figs. 1A and 1B). The afimbrial proteins showed different 328
patterns of abundance from each other in Western blot analyses. Very little protein was 329
observed at the beginning of biofilm formation for XadA2. By ten days, the amount of this 330
protein had increased but statistically significant increase over that of young biofilm cells was 331
only observed after 30 days of growth (Fig. 1C). XadA1 was produced rather constitutively, 332
and there was no statistically significant difference in the amount of XadA1 protein at any 333
biofilm phase (Fig. 1D). 334
To verify if these adhesins are associated with the biofilm growth condition, we 335
compared their abundance with that in planktonic cells. Under our experimental conditions, 336
none of the evaluated adhesins was detected in planktonic growth of X. fastidiosa (data not 337
shown). 338
339
Immunofluorescence of adhesion proteins in biofilms grown in vitro 340
In order to localize the adhesion proteins during X. fastidiosa biofilm formation in 341
vitro we performed immunolabeling of the proteins and visualized them by fluorescence 342
microscopy. PilA2 and PilC fimbrial proteins were apparent throughout biofilm development 343
by the third day. However, by the twentieth and thirtieth day, the proteins seem to be more 344
concentrated in some parts of the biofilm than others (Figs. 2 and 3). The afimbrial protein 345
XadA2 was not observed in small cell aggregates on the third day of growth but could be seen 346
by the fifth day of biofilm growth, when cellular aggregates were a little larger. By the tenth 347
on March 15, 2018 by guest
http://aem.asm
.org/D
ownloaded from
15
day, when the biofilm began to show a multilayered organization, this protein was quite 348
evident, suggesting a possible role in cell-cell adhesion and three-dimensional structuring 349
(Fig. 4). XadA1 exhibited a biofilm distribution that was quite different from the other 350
proteins (Fig. 5). At the tenth day, when biofilm maturation has started, this protein was 351
primarily present in gaps in the biofilm structure. At the fifteenth and twentieth days, when 352
the biofilm is thickest, this protein is localized in a somewhat different arrangement, with the 353
proteins primarily located in discrete spots, forming an “island-like” pattern within the 354
biofilm. No other protein showed such a pattern. The expression of XadA1 remained 355
localized in “island-like” inclusions on the thirtieth day, even though the spots were less 356
numerous compared to earlier phases of growth and the labeling seemed not to be as tightly 357
linked to the biofilm (Fig. 5). 358
359
Localization of adhesion proteins in different host plants infected with Xylella 360
fastidiosa. 361
To verify the localization of these bacterial proteins in vivo, we analyzed X. fastidiosa 362
cells present in sections of xylem vessels of infected periwinkle, hibiscus, and citrus leaves 363
exhibiting disease symptoms. As PilA2 is one of the rod-forming units of the type IV pili, 364
immunogold labeling demonstrated its occurrence in cell membranes and outside the cells in 365
all tested hosts (Figs. 6A, 6B, 6C). PilC protein, which is involved in pilus assembly, was also 366
detected in the three tested hosts, but mainly in the bacterial cell membrane (Figs. 6D, 6E, 367
6F). In contrast, the afimbrial proteins were detected outside the cells. XadA2 was outside of 368
the cell but close to the outer membrane of cells in the three plant hosts (Figs. 7A, 7B, 7C)., 369
The high level of background labeling for XadA1 in periwinkle did not allow the analysis of 370
this protein in this plant but little labeling of host materials were seen in hibiscus and citrus 371
enabling XadA1 to be visualized in these species. Similar to XadA2, most of this protein was 372
on March 15, 2018 by guest
http://aem.asm
.org/D
ownloaded from
16
observed to be close to the outer membrane but some labeling was also found at more distant 373
sites (Figs. 7D, 7E, 7F). 374
375
Discussion 376
Hierarchically-ordered gene expression circuits are characteristic of biofilms (41). In 377
the present work we demonstrated that adhesion proteins are expressed temporally throughout 378
biofilm development in an orderly pattern. X. fastidiosa biofilm development can be divided 379
into five different phases including initial attachment, microcolony formation, beginning of 380
maturation, mature biofilm, and dispersion (15). Growth of biofilms is a well-known behavior 381
among bacteria and, in X. fastidiosa it is a necessary condition for symptoms development 382
due to the occlusion of the xylem vessel (1, 42). A study of the Pierce's disease X. fastidiosa 383
Temecula strain suggested that the colonization of vessels is related to the capacity of 384
adhesion and twitching motility, mediated by adhesion proteins (12). 385
Type IV pili are important for adhesion and twitching motility in bacteria (37, 2, 21, 386
45, 47, 31, 13). As expected, the variation in the amounts of PilA2 and PilC showed a 387
somewhat similar temporal pattern during X. fastidiosa biofilm formation since they are 388
involved in type IV pili assembly. Higher amounts were observed at the beginning of 389
development and the dispersion phase when cells might be expected to be more motile. Type 390
IV pili must thus have different roles during biofilm development, with adhesion to the 391
surface and twitching motility associated with biofilm spread early in development. The 392
observation that PilA2 and PilC proteins are present in spots in the biofilm is intriguing and 393
suggests that the labeled cells may be released from the biofilm not only as individual cells 394
but also as clusters. Twitching may take place very early in the biofilm development, being a 395
behavior necessary for the formation of macrocolonies. It is known that twitching motility 396
on March 15, 2018 by guest
http://aem.asm
.org/D
ownloaded from
17
allows the existing microcolonies to join and form macrocolonies that will develop into the 397
mature biofilm (57). 398
Immunogold electron microscopy of these fimbrial proteins in periwinkle, hibiscus 399
and citrus revealed that they were located in the same sub-cellular compartment of the X. 400
fastidiosa biofilm. PilA2 was located in the cell membrane as well as outside the cell while 401
PilC was preferentially close to the membrane. This observation is in agreement with the 402
expected localization for the anchoring of immature pilus subunits and their assembly (25, 403
26). The low amount of PilA2 observed is not unexpected since the assembly of the rod could 404
block the epitopes of this protein, with only the epitopes of proteins that are in the initial 405
assembly steps of the pili available for interaction with the antibody (25). 406
The afimbrial protein XadA1 was detected in all phases of biofilm development and 407
XadA2 mainly at later phases of the biofilm development. Western blot analysis of XadA1 408
revealed a protein smaller than expected. This protein is very similar to UspA1 of M. 409
catarrhalis, for which a reduction in size was previously reported; this size reduction was also 410
dependent on the temperature to which the protein was subjected (22, 40). The discrepancy 411
between the expected and observed size of XadA1 could be due to the same factors as those 412
apparently affecting UspA1 processing. Detection of XadA1 in all phases of biofilm 413
formation suggests a possible role in the initial adhesion to surfaces as well as in cellular 414
aggregation. UspA1 of M. catarrhalis is important for adhesion to other cells and thus in 415
biofilm formation (46). It is noteworthy that XadA1 mutants of X. fastidiosa Temecula were 416
reported to be defective in adhesion as single cells to glass surfaces but that cell-cell 417
aggregates could still form. Thus XadA1 is apparently involved in initial adhesion of 418
Temecula cells (17). In the mature biofilm phase, XadA1 is distributed in an “island-like” 419
pattern, suggesting that it may have a role in biofilm structuring by altering cell-cell adhesion 420
and aggregation. However this hypothesis needs to be further investigated. 421
on March 15, 2018 by guest
http://aem.asm
.org/D
ownloaded from
18
The other afimbrial protein evaluated in our work, XadA2, was observed mainly only 422
after ten days, indicating that it is not likely involved in adherence to the substrate but instead 423
is involved in cell-cell adhesion associated with higher cell density. A protein similar to 424
XadA2 from H. influenzae is known to have specific domains (Hia) contributing to adherence 425
to mammalian cells in vitro (7), and directing attachment to specific proteins (19). These 426
domains are present in the X. fastidiosa protein (Fig. 8) and they could mediate protein-427
protein interactions. XadA1 and XadA2 belong to the family of trimeric autotransporters and 428
as such, they may have adhesive activity that mediates bacterial interaction with either host 429
cells or their own extracellular matrix proteins, or even other unknown proteins (7). Even 430
though X. fastidiosa XadA1 protein resembles UspA1 and YadA, two of the most studied 431
proteins of the family, it contains more hep-hag repetitive regions (Fig. 8). XadA2 has 432
similarity to Hsf from H. influenza, but in X. fastidiosa there are many more domains related 433
to adhesive functions, such as the hep-hag and hemagglutinin domains (Pfam domains 434
PF05658 and PF05662) (Fig. 8). Additionally, analysis of XadA2 reveals the presence of 435
motifs that are unique to proteins from X. fastidiosa (Pfam domain PF06669) (Fig. 8). These 436
structural characteristics suggest that XadA1 and XadA2 may have distinct functions in 437
relation to the biofilm formation and host-interaction. 438
These afimbrial adhesins may complement the role of other afimbrial adhesins such as 439
the hemagglutinins. In X. fastidiosa strain Temecula, the hxfA gene encodes one of the 440
hemagglutinins. A mutant for this gene showed increased virulence and monolayer biofilm 441
formation in vivo, suggesting that this would allow a faster colonization of the xylem vessels, 442
thus causing more severe symptoms (18). This observation suggests that in X. fastidiosa, Hxf 443
may be related to aggregation and therefore biofilm growth may be a form of avoiding a rapid 444
colonization of the host, which is undesirable for the pathogen since it could ultimately lead to 445
the death of its plant host. 446
on March 15, 2018 by guest
http://aem.asm
.org/D
ownloaded from
19
XadA1 and XadA2 immunogold labeling was detected close to the cell membrane, in 447
a pattern similar to that reported for YadA from Y. enterocolitica in which aggregation by the 448
protein head domain located outside the cell directed such localization (23). However some 449
XadA1 was also detected far from the cell and together with the immunofluorescence 450
observations of apparent protein aggregates away from cells, suggests that this protein is 451
secreted to the environment. This hypothesis and the possible roles of such secreted proteins 452
needs to be further investigated. 453
Interestingly, the expression of most of the genes encoding the proteins studied in this 454
work, during the biofilm formation in vitro (14), does not correlate well with the protein 455
accumulation at a given time that was detection by Western blot analysis. The expression of 456
xadA2 for instance, was detected mainly at the fifth and tenth days of biofilm formation in 457
vitro yet we observed the presence of the proteins mainly after the tenth day of the biofilm 458
development. It is intriguing that such a lag between gene expression and protein appearance 459
would occur. It seems likely that differential patterns of transcription, translation, and protein 460
degradation might occur during biofilm development. Translation could be affected by small 461
regulatory RNAs mediated by gacA. The activity of small RNAs related to gacA has been 462
demonstrated for Pseudomonas aeruginosa and also for X. fastidiosa (27, 53). In the later 463
case, regulation via gacA is directly affects xadA1 and xadA2 expression, and thus cell-to-cell 464
adhesion and biofilm formation (53). These small RNAs could post-transcriptionally regulate 465
the expression of a variety of proteins including afimbrial adhesins, thus explaining the delay 466
in the production of these adhesins during the biofilm formation. The regulation of these 467
genes could also be mediated through a DSF-dependent (diffusible signal factor) signaling 468
system. Mutations in rpfF, which is responsible for the synthesis of DSF in X. fastidiosa, 469
impairs biofilm formation in the insect vector (43) and leads to higher virulent in plants due to 470
an increased ability to move in the xylem vessel (6, 43). 471
on March 15, 2018 by guest
http://aem.asm
.org/D
ownloaded from
20
Both fimbrial and afimbrial proteins are involved with biofilm formation in X. 472
fastidiosa in vitro. The expression of these adhesins seems to vary substantially at different 473
phases of the biofilm development suggesting differential contribution to various biofilm 474
processes. The variation in the spatial distribution pattern of these proteins in the biofilm also 475
suggests that they contribute in different ways to biofilm functions. The detection of these 476
proteins in xylem vessels of infected plants indicates that biofilms within plants may resemble 477
those produced in vitro and that such structures likely contribute to the infection process. 478
479
Acknowledgements 480
The authors would like to thank Dr. Steven Lindow for critical revision of the manuscript 481
and Renato Salaroli for transmission electron microscopy technical support. This work was 482
supported by research grants from Fundação de Amparo à Pesquisa do Estado de São Paulo 483
(FAPESP) and Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq) 484
(Proc. Numbers 04/14576-2, 06/52681-8 and INCT-Citros 08/57909-2, 573848/08-4). 485
M.A.T., A.P.S., E.W.K, C.A.L, M.A.M. and A.A.S. are recipient of a research fellowship 486
from CNPq. 487
488
Literature cited 489
1. Almeida, R. P. P., E. F. Pereira, A. H. Purcell, and J. R. S. Lopes. 2001. 490
Multiplication and movement of a citrus strain of Xylella fastidiosa within sweet 491
orange. Plant Dis. 85:382-386. 492
2. Bahar, O., T. Goffer, and S. Burdman. 2009. Type IV Pili are required for virulence, 493
twitching motility, and biofilm formation of Acidovorax avenae subsp. Citrull. Mol. 494
Plant-Microbe Interact. 22:909-920. 495
on March 15, 2018 by guest
http://aem.asm
.org/D
ownloaded from
21
3. Bateman A., E. Birney, L. Cerruti, R. Durbin, L. Etwiller, S. R. Eddy, S. Griffiths-496
Jones, K. L. Howe, M. Marshall, and E. L. Sonnhammer. 2002. "The Pfam protein 497
families database". Nucleic Acids Res. 30:276-280. 498
4. Bové, J. M. and A. J. Ayres. 2007. Etiology of three recent diseases of citrus in São 499
Paulo State: sudden death, variegated chlorosis and huanglongbing. IUBMB Life 500
59:346-354. 501
5. Celedon, P. A. C., A. Andrade, K. C. Xavier, M. C. C. G. Carvalho, D. G. G. 502
Caldas, D. H., Moon, R. T., Carneiro, S. Oda, and C. A. Labate. 2007. Proteomic 503
analysis of the cambial region in juvenile Eucalyptus grandis at three ages. Proteomics 504
7:1-17. 505
6. Chatterjee, S., K. L. Newman, and S. E. Lindow. 2008. Cell-to-Cell Signaling in 506
Xylella fastidiosa Suppresses Movement and Xylem Vessel Colonization in Grape. 507
Mol. Plant-Microbe Interact. 21:1309-1315. 508
7. Cotter, S. E., H. J. Yeo, T. Juehne, and J. W. St Geme III. 2005. Architecture and 509
adhesive activity of the Haemophilus influenzae Hsf adhesin. J. Bacteriol. 187:4656-510
4664. 511
8. Danhorn, T. and C. Fuqua. 2007. Biofilm Formation by Plant-Associated Bacteria. 512
Annu. Rev. Microbiol. 61:401-422. 513
9. Davis, M. J., W. J. French, and N. W. Schaad. 1981. Axenic culture of the bacteria 514
associated with phony disease of peach and plum scald. Curr. Microbiol. 5:311-316. 515
10. De La Fuente, L., T. J. Burr, and H. C. Hoch. 2007. Mutations in type I and type 516
IV pilus biosynthetic genes affect twitching motility rates in Xylella fastidiosa. J. 517
Bacteriol. 189:7507-7510. 518
on March 15, 2018 by guest
http://aem.asm
.org/D
ownloaded from
22
11. De La Fuente, L., E. Montanes, Y. Meng, Y. Li, T. J. Burr, H. C. Hoch, and M. 519
Wu. 2007. Assessing adhesion forces of type I and type IV pili of Xylella fastidiosa 520
using a microfluidic flow chamber. Appl. Environ. Microbiol. 73:2690-2696. 521
12. De La Fuente, L., T. J. Burr, and H. C. Hoch. 2007. Mutations in type I and type 522
IV pilus biosynthetic genes affect twitching motility rates in Xylella fastidiosa. J. 523
Bacteriol. 189:7507-7510. 524
13. De La Fuente, L., T. J. Burr, and H. C. Hoch. 2008. Autoaggregation of Xylella 525
fastidiosa cells is influenced by type I and type IV pili. Appl. Environ. Microbiol. 526
74:5579-5582. 527
14. De Souza, A. A., M. A. Takita, E. O. Pereira, H. D. Coletta-Filho, and M. A. 528
Machado. 2005. Expression of pathogenicity-related genes of Xylella fastidiosa in 529
vitro and in planta. Curr. Microbiol. 50:223-228. 530
15. De Souza, A. A., M. A. Takita, H. D. Coletta-Filho, C. Caldana, G. M. Yanai, N. 531
H. Muto, R. C. Oliveira, L. R. Nunes, and M. A. Machado. 2004. Gene expression 532
profile of the plant pathogen Xylella fastidiosa during biofilm formation in vitro. 533
FEMS Microbiol. Lett. 237:341-353. 534
16. De Souza, A. A., M. A. Takita, H. D. Coletta-Filho, C. Caldana, G. H. Goldman, 535
G. M. Yanai, N. H. Muto, R. C. Oliveira, L. R. Nunes, and M. A. Machado. 2003 536
Analysis of gene expression in two growth states of Xylella fastidiosa and its 537
relationship with pathogenicity. Mol. Plant-Microbe Interact.16:867-875. 538
17. Feil, H., W. S. Feil, and S. E. Lindow. 2007. Contribution of fimbrial and afimbrial 539
adhesins of Xylella fastidiosa to attachment to surfaces and virulence to grape. 540
Phytopathology 97:318-324. 541
18. Guilhabert, M. R. and B. C. Kirkpatrick. 2005. Identification of Xylella fastidiosa 542
antivirulence genes: hemagglutinin adhesins contribute to X. fastidiosa biofilm 543
on March 15, 2018 by guest
http://aem.asm
.org/D
ownloaded from
23
maturation and colonization and attenuate virulence. Mol. Plant-Microbe 544
Interact.18:856-868. 545
19. Hallström, T., E. Trajkovska, A. Forsgren, and K. Riesbeck. 2006. Haemophilus 546
influenzae surface fifbrils contribute to serum resistance by interacting with 547
vitronectin. J. Immun. 177:430-436. 548
20. Henderson, I. R. and J. P. Nataro. 2001. Virulence functions of autotransporter 549
proteins. Infect. Immun. 69:1231-1243. 550
21. Heinz P. Hahn. 1997. The type-4 pilus is the major virulence-associated adhesin of 551
Pseudomonas aeruginosa – a review. Gene 192:99-108. 552
22. Hill, D. J. and M. Virji. 2003. A novel cell-binding mechanism of Moraxella 553
catarrhalis ubiquitous surface protein UspA: specific targeting of the N-domain of 554
carcinoembryonic antigen-related cell adhesion molecules by UspA1. Mol. Microbiol. 555
48:117-129. 556
23. Hoickzyc, E., A. Roggenkamp, M. Reichenbecher, A. Lupas, and J. Heeseman. 557
2000. Structure and sequence analysis of Yersinia YadA and Moraxella UspAs reveal 558
a novel class of adhesins. EMBO J. 19:5989-5999. 559
24. Hultgren, S. J., S. Abraham, M. Caparon, P. Falk, J. W. St. Geme III, and S. 560
Normark. 1993. Pilus and nonpilus bacterial adhesins: Assembly and function in cell 561
recognition. Cell 73:887-901. 562
25. Hultgren, S. J., S. Normark, and S. N. Abraham. 1991. Chaperone-assisted 563
assembly and molecular architecture of adhesive pili. Annu. Rev. Microbiol. 45:383-564
415. 565
26. Jones, C. H., P. Danese, J. Pinkner, T. Silhavy, and S. J. Hultgren. 1997. 566
Chaperone-assisted membrane release and folding pathway sensed by two signal 567
transduction systems. EMBO J. 16:6394-6406. 568
on March 15, 2018 by guest
http://aem.asm
.org/D
ownloaded from
24
27. Kay, E., B. Humair, V. Dénervaud, K. Riedel, S. Spahr, L. Eberl, C. Valverde, 569
and D. Haas. 2006. Two GacA-dependent small RNAs modulate the Quorum-Sensing 570
response in Pseudomonas aeruginosa. J. Bacteriol. 188:6026-6033. 571
28. Killiny, N. and R. P. P. Almeida. 2009. Xylella fastidiosa afimbrial adhesins mediate 572
cell transmission to plants by leafhopper vectors. Appl. Environ. Microbiol. 75:521-573
528. 574
29. Kitajima, E. W., H. D. Coletta-Filho, M. A. Machado, and Q. S. Novaes. 2000. 575
Escaldadura das folhas de Hibiscus schizopetalus associada à infecção por Xylella 576
fastidiosa em Brasília, DF. Fitopatol. Bras. 25(Suppl.):S323. {Meeting abstract 577
published in journal supplement.} 578
30. Laemmli, U. K. 1970. Cleavage of structural proteins during the assembly of the 579
head of bacteriophage T4. Nature 227:680-685. 580
31. Li, Y., G. Hao, C. D. Galvani, Y. Meng, L. De La Fuente, H. C. Hoch, and T. J. 581
Burr. 2007. Type I and type IV pili of Xylella fastidiosa affect twitching motility, 582
biofilm formation and cell–cell aggregation. Microbiology 153:719-726. 583
32. Lowry, O. H., N. J. Rosebrough, A. L. Farr, and R. J. Randall. 1951. Protein 584
measurement with the Folin-phenol reagent. J. Biol. Chem. 193:265-275. 585
33. Luban, S. and D. Kihara. 2007. Comparative genomics of small RNAs in bacterial 586
genomes. OMICS: A Journal of Integrative Biology 11:58-73. 587
34. Machado, E. C., J. A. Quaggio, A. M. M. A. Lagôa, M. Ticelli, and P. R. Furlani. 588
1994. Trocas gasosas e relações hídricas em laranjeiras com clorose variegada dos 589
citros. Rev. Bras. Fisiol. Veg. 6:53-57. 590
35. Mah, T. F., B. Pitts, B. Pellock, G. C. Walker, P. S. Stewart, and G. A. O’Toole. 591
2003. A genetic basis for Pseudomonas aeruginosa biofilm antibiotic resistance. 592
Nature 426:306-310. 593
on March 15, 2018 by guest
http://aem.asm
.org/D
ownloaded from
25
36. Marques, L. L. R., H. Ceri, G. P. Manfio, D. M. Reid, and M. E. Olson. 2002. 594
Characterization of biofilm formation by Xylella fastidiosa in vitro. Plant Dis. 86:633-595
638. 596
37. J. S. Mattick. 2002. Type IV pili and twitching motility. Ann. Rev. Microbiol. 597
56:289-314. 598
38. Meng, Y., Y. Li, C. D. Galvani, G. Hão, J. N. Turner, T. J. Burr, and H. C. Hoch. 599
2005. Upstream migration of Xylella fastidiosa via pilus-driven twitching motility. J. 600
Bacteriol. 187:5560-5567. 601
39. Michelmore, R. 2000. Genomic approaches to plant disease resistance. Curr. Opinion 602
in Plant Biol. 3:125-131. 603
40. McMichael, J. C., M. J. Fiske, R. A. Fredenburg, D. N. Chakravarti, K. R. 604
VanDerMeid, V. Barniak, J. Caplan, E. Bortell, S. Baker, R. Arumugham, and D. 605
Chen. 1998. Isolation and characterization of two proteins from Moraxella catarrhalis 606
that bear a common epitope. Infect. Immun. 66:4374-4381. 607
41. Nadell, C. D., J. B. Xavier, and K. R. Foster. 2008. The sociobiology of biofilms. 608
FEMS Microbiol. Rev. 33: 206-224. 609
42. Newman K. L., R. P. P. Almeida, A. H. Purcell, and S. E. Lindow. 2003. Use of a 610
Green Fluorescent Strain for Analysis of Xylella fastidiosa Colonization of Vitis 611
vinifera. Appl. Environ. Microbiol. 69:7319-7327. 612
43. Newman K. L., R. P. P. Almeida, A. H. Purcell, and S. E. Lindow. 2004. Cell-cell 613
signaling controls Xylella fastidiosa interactions with both insects and plants. Proc. 614
Natl. Acad. Sci. U.S.A. 101:1737-1742. 615
44. Nishino K., E. Nikaido, and A. Yamaguchi. 2007. Regulation of multidrug efflux 616
systems involved in multidrug and metal resistance of Salmonella enterica serovar 617
Typhimurium. J. Bacteriol. 189:9066-9075. 618
on March 15, 2018 by guest
http://aem.asm
.org/D
ownloaded from
26
45. O'Toole G. A., and R. Kolter. 1998. Flagellar and twitching motility are necessary 619
for Pseudomonas aeruginosa biofilm development. Mol. Microbiol. 30:295-304. 620
46. Pearson, M. M., C. A. Laurence, S. E. Guinn, and E. J. Hansen. 2006. Biofilm 621
formation by Moraxella catarrhalis in vitro: roles of the UspA1 adhesin and the Hag 622
hemagglutinin. Infec. Immun. 74:1588-1596. 623
47. Prince, A. 1992. Adhesins and receptors of Pseudomonas aeruginosa associated with 624
infection of the respiratory tract. Microb. Pathog. 13:251-260. 625
48. Reimmann, C., C. Valverde, E. Kay, and D. Haas. 2005. Posttranscriptional 626
repression of GacS/GacA-controlled genes by the RNA-binding protein RsmE acting 627
together with RsmA in the biocontrol Sstrain Pseudomonas fluorescens CHA0. J. 628
Bacteriol. 187:276-285. 629
49. Roper M. C., L. C. Greve, J. M. Labavitch, and B. C. Kirkpatrick. 2007. 630
Detection and visualization of an exopolysaccharide produced by Xylella fastidiosa in 631
vitro and in planta. Appl. Environ. Microbiol. 73:7252-7258. 632
50. Rojas, M. C., J. H. Ham, D. Wen-Ling, J. J. Doyle, and A. Collmer. 2002. HecA, a 633
member of a class of adhesins produced by diverse pathogenic bacteria, contributes to 634
the attachment, aggregation, epidermal cell killing, and virulence phenotypes of 635
Erwinia chrysanthemi EC16 on Nicotiana clevelandii seedlings. Proc. Natl. Acad. Sci. 636
U.S.A. 99:13142-13147. 637
51. Sauer, K., A. K. Camper, G. D. Ehrlich, J. W. Costerton, and D. G. Davies. 2002. 638
Pseudomonas aeruginosa displays multiple phenotypes during development as a 639
biofilm. J. Bacteriol. 184:1140-1154. 640
52. Schaad, N. W., E. Postnikova, G. Lacy, M. B. Fatmi, and C. J. Chang. 2004. 641
Xylella fastidiosa subspecies: X. fastidiosa subsp. piercei, subsp. nov., X. fastidiosa 642
on March 15, 2018 by guest
http://aem.asm
.org/D
ownloaded from
27
subsp. multiplex subsp. nov., and X. fastidiosa subp. pauca subsp. nov. Syst. Appl. 643
Microbiol. 27:290-300. 644
53. Shi, X. Y., C. K. Dumenyo, R. Hernandez-Martinez, H. Azad, and D. A. Cooksey. 645
2009. Characterization of regulatory pathways in Xylella fastidiosa: genes and 646
phenotypes controlled by gacA. Appl. Environ. Microbiol. 75:2275-2283. 647
54. Simpson A. J. G., F. C. Reinach, P. Arruda, F. A. Abreu, M. Acencio, R. 648
Alvarenga, L. M. C. Alves, J. E. Araya, G. S. Baia, C. S. Baptista, M. H. Barros, 649
E. D. Bonaccorsi, S. Bordin, J. M. Bové, M. R. S. Briones, M. R. P. Bueno, A. A. 650
Camargo, L. E. A. Camargo, D. M. Carraro, H. Carrer, N. B. Colauto, C. 651
Colombo, F. F. Costa, M. C. R. Costa, C. M. Costa-Neto, L. L. Coutinho, M. 652
Cristofani, E. Dias-Neto, C. Docena, H. El-Dorry, A. P. Facincani, A. J. S. 653
Ferreira, V. C. A. Ferreira, J. A. Ferro, J. S. Fraga, S. C. França, M. C. Franco, 654
M. Frohme, L. R. Furlan, M. Garnier, G. H. Goldman, M. H. S. Goldman, S. L. 655
Gomes, A. Gruber, P. L. Ho, J. Hoheisel, M. L. Junqueira, E. L. Kemper, J. P. 656
Kitajima, J. E. Krieger, E. E. Kuramae, F. Laigret, M. R. Lambais, L. C. C. 657
Leite, E. G. M. Lemos, M. V. F. Lemos, S. A. Lopes, C. R. Lopes, J. A. Machado, 658
M. A. Machado, A. M. B. N. Madeira, H. M. F. Madeira, C. L. Marino, M. V. 659
Marques, E. A. L. Martins, E. M. F. Martins, A. Y. Matsukuma, C. F. M. Menck, 660
E. C. Miracca, C. Y. Miyaki, C. B. Monteiro-Vitorello, D. H. Moon, M. A. Nagai, 661
A. L. T. O. Nascimento, L. E. S. Netto, A. Nhani Jr, F. G. Nobrega, L. R. Nunes, 662
M. A. Oliveira, M. C. de Oliveira, R. C. de Oliveira, D. A. Palmieri, A. Paris, B. 663
R. Peixoto, G. A. G. Pereira, H. A. Pereira Jr., J. B. Pesquero, R. B. Quaggio, P. 664
G. Roberto, V. Rodrigues, A. J. de M. Rosa, V. E. de Rosa Jr., R. G. de Sá, R. V. 665
Santelli, H. E. Sawasaki, A. C. R. da Silva, A. M. da Silva, F. R. da Silva, W. A. 666
Silva Jr., J. F. da Silveira, M. L. Z. Silvestri, W. J. Siqueira, A. A. de Souza, A. P. 667
on March 15, 2018 by guest
http://aem.asm
.org/D
ownloaded from
28
de Souza, M. F. Terenzi, D. Truffi, S. M. Tsai, M. H. Tsuhako, H. Vallada, M. A. 668
Van Sluys, S. Verjovski-Almeida, A. L. Vettore, M. A. Zago, M. Zatz, J. Meidanis 669
and J. C. Setubal. 2000. The genome sequence of the plant pathogen Xylella 670
fastidiosa. Nature 406:151-157. 671
55. Stewart, P. S. and J. W. Costerton. 2001. Antibiotic resistance of bacteria in 672
biofilms. Lancet 358:135-138. 673
56. St. Geme III, J. W., D. Cutter, and S. J. Barenkamp. 1996. Characterization of the 674
genetic locus enconding Haemophilus influenzae type b surface fibrils. J. Bacteriol. 675
178:6281-6287. 676
57. Toutain, C. M., C. C. Nicki, and G. A. O'Toole. 2004. Molecular basis of biofilm 677
development by pseumonads, p. 43-63. In M. Ghannoum and G. A. O'Toole (ed.), 678
Microbial Biofilms. ASM Press, Washington, DC. 679
58. Vandenbosch, K. 1990. Immunogold labeling, p.181-218. In J.L. Hall and C. Hawesc 680
(ed.), Electron microscopy of plant cells. Academic Press, San Diego, CA. 681
59. Van Sluys M. A., C. B. Monteiro-Vitorello, L. E. Camargo, C. F. Menck, A. C. 682
Da Silva, J. A. Ferro, M. C. Oliveira, J. C. Setubal, J. P. Kitajima, and A. J. 683
Simpson. 2002. Comparative genomic analysis of plant-associated bacteria. Ann. Rev. 684
Phytopathol. 40:169-189. 685
60. Zaini P. A., A. C. Fogaça, F. G. N. Lupo, H. I. Nakaya, R. Z. N. Vêncio, and A. 686
M. da Silva. 2008. The iron stimulon of Xylella fastidiosa includes genes for type IV 687
pilus and colicin V-like bacteriocins J. Bacteriol. 190:2368-2378. 688
689
690
691
692
on March 15, 2018 by guest
http://aem.asm
.org/D
ownloaded from
29
Table 1: Sequences of primers used to amplify target genes. 693
1. Forward sequences. 694
2. Reverse sequences.695
Primer name Primer sequence (5´- 3´) Fragment
size
eco_for (F)1
GAATTCTGGGGCACGAGCTTTTTAGAT pilC-1
rev_hind4 (R)2
AAGCTTCAGCCCTGACCAGATTGCGATAA
568pb
eco_for (F)1
GAATTCTGGGGCACGAGCTTTTTAGAT pilC-2
hind_rev1 (R)2
AAGCTTTTCCCTTCAGAGCCTCAATGTTC
646pb
eco_for5 (F)1
GAATTCGAAGAGCGCTTATGGGTGTGG pilC-3
hind_rev5 (R)2
AAGCTTCAGCCCTGACCAGATTGCGATAAAG
586pb
f_eco2 (F)1
GAATTCCAAGGCGTCGACTCGGTTGCTCTA xadA1-1
r_hind1 (R)2
AAGCTTTCGCCGAAATGCTGACACCACTT
1.564Kb
feco_long5(F)1
GAATTCGTGGCGGCATCGGTGAAG xadA1-2
rhind_in4 (R)2
AAGCTTTAGCCGCCGCCATACTGTTA
2.056Kb
f_eco (F)1
CGAATTCAAAGTTAAGGGCAACTCTCAAGT pilA2-1
rev_hind (R)2
TAAGCTTTTATTTAGAGGCAATGCATCCAGAAGGT
148pb
f2_eco (F)1
GGAATTCAATTATGTCGCCAGGTCCCAACT pilA2-2
rev_hind (R)2
TAAGCTTTTATTTAGAGGCAATGCATCCAGAAGGT
450pb
f_eco_int (F)1
CGAATTCATGAAGAAGCAACAAGGTTTTA pilA2-3
rev_hind (R)2
TAAGCTTTTATTTAGAGGCAATGCATCCAGAAGGT
520pb
f1_eco (F)1
TGAATTCGCGGGCAGCAAGGTGATTAGC xadA2-7
R_hind (R)2
CAAGCTTAGCGTTCACCCCTTATC
882pb
f_ecolong (F)1
GAATTCGCGGGTGCAGTGTCA xadA2-8
r1_hind (R)2
CAAGCTTAATTCCCACCTCAATACATCC
1.6Kb
f1_eco (F)1
TGAATTCGCGGGCAGCAAGGTGATTAGC xadA2-9
r1_hind (R)2
CAAGCTTAATTCCCACCTCAATACATCC
1Kb
on March 15, 2018 by guest
http://aem.asm
.org/D
ownloaded from
30
Table 2: XadA1 sequencing by ESI Q-TOF. Sequence matched are showed in bold. 696
1. Molecular weight in Daltons 697
2. Isoeletric point 698
3. Experimental average mass of sample in Daltons 699
4. Calculated average mass of sample in Daltons 700
5. Parts per million 701
702
703
Protein hits Accession Score Mr (Da)1
pI2 Coverage (%)
Peptides matched
Observed Mr(expt) (Da)3
Mr(calc) (Da)4
Ppm5 Score Peptide
Surface-exposed outer
membrane protein XF1516
[imported] - Xylella fastidiosa
C82672 405 98281 7.17 10
6 759.3655 1516.7164
1516.7845
-44.89 82 R.ATANAIGSSVLGVDSR.A
769.3839 1536.7532
1536.7532
0.02 39 R.TYEANVLSIGSGNGR.G
799.9739 1597.9332
1597.8060
79.6 52 R.IVNVGDGIGNNDAVNK.S
880.9922 1759.9698
1759.8952
42.4 84 K.SQLDGVTASVNDVAASVK.T
894.9738 1787.9330
1787.9265
3.65 97 K.SQLDGVTASVNDVVASVK.N
994.5337 1987.0528
1987.0586
-2.89 56 K.VVSGVAVSDSSVAANAQVLSK.G
on March 15, 2018 by guest
http://aem.asm
.org/D
ownloaded from
31
Figure captions 704
Figure 1: Analysis of proteins in different biofilm growth phases. Total protein was 705
isolated from biofilm cells, normalized by Lowry quantification and evaluated in Western 706
blots using (A) Anti-PilA, (B) Anti-PilC, (C) Anti-XadA2, and (D) Anti-XadA1 antibodies. 707
The bands were quantified using ImageJ software. The values correspond to the average 708
obtained in three independent experiments. Error bars represent the standard error of the 709
mean. 710
711
Figure 2: Fluorescence labeling of PilA in the X. fastidiosa biofilm grown on glass 712
slides. Cells in different growth phases of the biofilm were marked in green using the nucleic 713
acid staining dye Syto 9 and the red spots correspond to the antibody recognition of PilA 714
(secondary antibody labeled with rhodamine). Cells were visualized with oil immersion lens 715
(numerical aperture, 1.0) in an Olympus UIS2 Fluorescence microscopy using, for Syto 9, 716
excitation wavelength between 460 and 490nm and emission wavelength between 500 and 717
520nm, and for rhodamine, excitation wavelength between 510 and 550nm and emission 718
wavelength between 570 and 590nm. White bars represent 10µm. In the first column are the 719
images representing the PilA labeling, with X. fastidiosa cells depicted in red. In the second 720
column are the pictures representing the Syto 9 staining, with X. fastidiosa cells depicted in 721
green. The pictures in the third column are the superposed images of the two channels (green 722
and red). The presence of PilA is depicted by red or orange colors in small cell clusters and in 723
biofilm structure in the first column. 724
725
Figure 3: Fluorescence labeling of PilC in the X. fastidiosa biofilm grown on glass 726
slides. Cells were stained with Syto 9, labeled with an anti-PilC antibody and visualized under 727
the fluorescence microscope. The first column represents the immunolabeling of PilC and the 728
on March 15, 2018 by guest
http://aem.asm
.org/D
ownloaded from
32
second column the green channel. The third column represents the superposed images of the 729
two channels, green and red. 730
731
Figure 4: Fluorescence labeling of XadA2 in the X. fastidiosa biofilm grown on glass 732
slides. Cells were stained with Syto 9, labeled with an anti-XadA2 antibody and visualized 733
under the fluorescence microscope. The first column represents the immunolabeling of 734
XadA2 and the second column the green channel. The third column represents the superposed 735
images of the two channels, green and red. 736
737
Figure 5: Fluorescence labeling of XadA1 in the X. fastidiosa biofilm grown on glass 738
slides. Cells were stained with Syto 9, labeled with an anti-XadA1 antibody and visualized 739
under the fluorescence microscope. The first column represents the immunolabeling of 740
XadA1 and the second column the green channel. The third column represents the superposed 741
images of the two channels, green and red. The arrows indicate gaps in biofilm at 10 days 742
after inoculation in which immunolabeling reveals the presence of XadA1 protein, as 743
visualized in panels H and I, respectively. 744
745
Figure 6: Immunogold electron microscopy of plant xylem vessels infected with X. 746
fastidiosa. The sections were labeled with the anti-PilA2 and anti-PilC antibodies and 747
visualized under transmission electron microscopy in a Zeiss EM 900 microscope. A. X. 748
fastidiosa cells labeled with anti-PilA antibodies inside citrus vessels. B. X. fastidiosa cells 749
labeled with anti-PilA antibodies inside periwinkle vessels. C. X. fastidiosa cells labeled with 750
anti-PilA antibodies inside hibiscus vessels. D. X. fastidiosa cells labeled with anti-PilC 751
antibodies inside citrus vessels. E. X. fastidiosa cells labeled with anti-PilC antibodies inside 752
on March 15, 2018 by guest
http://aem.asm
.org/D
ownloaded from
33
periwinkle vessels. F. X. fastidiosa cells labeled with anti-PilC antibodies inside hibiscus 753
vessels. Arrows indicate labeling of PilA2 or PilC proteins. 754
755
Figure 7: Immunogold electron microscopy of plant xylem vessels infected with X. 756
fastidiosa. Different plant hosts were sectioned and the X. fastidiosa cells were labeled either 757
with the anti-XadA2 or XadA1 antibodies. A. Labeling of citrus vessels with the anti-XadA2 758
antibody. B. Labeling of periwinkle vessels with the anti-XadA2 antibody. C. Labeling of 759
hibiscus vessels with the anti-XadA2 antibody. D. Labeling of citrus vessels with the anti-760
XadA1. E and F. Labeling of hibiscus vessels with the anti-XadA1 antibody. Arrows indicate 761
labeling of XadA2 or XadA1 proteins. 762
763
Figure 8: Comparison of XadA2 and XadA1 proteins. The XadA2 proteins from X. 764
fastidiosa 9a5c (A) and Temecula (B) strains were compared with the Hsf protein from H. 765
influenzae (C), in relation to the structure. The structures of the XadA1 proteins from X. 766
fastidiosa 9a5c (D) and Temecula (E) strains were compared with UspA1 from M. catarrhalis 767
(F) and YadA from Y. enterocolitica (G). All of the C-termini are YadA-like domains, red 768
boxes indicate HIM domains, light green boxes indicate Hep_Hag repetitive regions, dark 769
blue indicate X. fastidiosa surface protein related motifs, yellow boxes indicate domains of 770
unknown functions. 771
772
773
774
775
776
777
on March 15, 2018 by guest
http://aem.asm
.org/D
ownloaded from