Exploring the role of C5a-C5aR1 signalling in development through
pluripotent stem cell modelling
Owen Hawksworth
BSc (Hons)
A thesis submitted for the degree of Doctor of Philosophy at
The University of Queensland in 2017
Faculty of Medicine
ii
Abstract
The complement system has been traditionally described as a powerful controller of innate immunity.
With activation through the recognition of pathogenic surfaces, spontaneous hydrolysis, or extrinsic
cleavage, a cleavage cascade is initiated culminating in the formation of the active complement
fragments C3a, C3b, C5a, and C5b. These fragments direct immune cells to sites of inflammation, as
well as tagging pathogens for destruction and directly lysing foreign cells. It is now clear however,
that this complex family of proteins possesses a wide range of functions outside of immune
regulation. From fertilisation and morphogenesis, to the control of foetal and adult stem cell
populations, studies have described novel actions of complement factors. This thesis is focussed on
the central complement receptor, C5aR1. Traditionally described as a potent activating and
chemotactic receptor for immune cells, C5aR1 has been shown to function in a number of non-
immune cell populations. Of note, our laboratory has previously described a role for C5aR1 in neural
tube closure, with loss of C5aR1 signalling associated with increased neural tube defects under folate
deficient conditions. However, a mechanistic role of C5aR1 at this stage of development was not
described.
In this thesis, pluripotent stem cells were utilised as an in vitro model of human development to
interrogate the expression and function of C5aR1 at a number of developmental stages. Specifically,
in pluripotent stem cells representative of the blastocyst inner cell mass, in neural rosettes
representative of the developing ventricular zone, and in matured post-mitotic cortical neurons. This
builds on previous work by our laboratory, which had identified C5aR1 actions in the mouse
ventricular zone, analogous to late neural rosette cultures, and had shown a neurotoxic effect of
C5aR1 in post-mitotic mouse neurons.
C5aR1 was found to be expressed in pluripotent stem cells, with a role in promoting maintenance of
pluripotency in the absence of FGF2 signalling. Additionally, C5aR1 was found to be apically
expressed in human neural rosettes, with signalling promoting proliferation and maintenance of cell
polarity. This work correlated well with mouse studies performed outside of this thesis, to show that
in vivo, loss of C5aR1 in this neural progenitor population resulted in behavioural deficits and
microstructural brain changes. Lastly, we determined the mRNA expression of C5aR1 in human post-
mitotic cortical neurons. However, in contrast to previous mouse studies, exogenous C5a, alone or in
the presence of secondary stressors, had little effect on the survival of these cells.
Overall, the results presented in this thesis have further expanded our knowledge of C5a-C5aR1
signalling in development, describing novel roles for this signalling pathway. The use of pluripotent
stem cells allowed for the exploration of C5aR1 actions in human development that would otherwise
be limited to animal models. Additionally, it allowed for the correlation of previous animal results to
iii
a human cell type, with both inter-species conservation of function, and discordance, identified.
Additionally, the use of pluripotent stem cell modelling has provided a useful platform for the future
study of complement in both development and disease. This work has direct implications to the
clinical environment, highlighting the important developmental roles of C5aR1, and how modulation
of C5aR1 signalling to target complement driven disease could have detrimental effects on foetal
development.
iv
Declaration by author
This thesis is composed of my original work, and contains no material previously published or written
by another person except where due reference has been made in the text. I have clearly stated the
contribution by others to jointly-authored works that I have included in my thesis.
I have clearly stated the contribution of others to my thesis as a whole, including statistical assistance,
survey design, data analysis, significant technical procedures, professional editorial advice, and any
other original research work used or reported in my thesis. The content of my thesis is the result of
work I have carried out since the commencement of my research higher degree candidature and does
not include a substantial part of work that has been submitted to qualify for the award of any other
degree or diploma in any university or other tertiary institution. I have clearly stated which parts of
my thesis, if any, have been submitted to qualify for another award.
I acknowledge that an electronic copy of my thesis must be lodged with the University Library and,
subject to the policy and procedures of The University of Queensland, the thesis be made available
for research and study in accordance with the Copyright Act 1968 unless a period of embargo has
been approved by the Dean of the Graduate School.
I acknowledge that copyright of all material contained in my thesis resides with the copyright
holder(s) of that material. Where appropriate I have obtained copyright permission from the copyright
holder to reproduce material in this thesis.
v
Publications During Candidature
Journal Articles
Hawksworth OA, Coulthard LG, Woodruff TM (2016) Complement in the fundamental processes
of the cell Molecular Immunology 84; 17-25
Hawksworth OA, Xiang L, Coulthard LG, Wolvetang EJ & Woodruff TM (2017) New concepts on
the therapeutic control of terminal complement receptors Molecular Immunology Epub ahead of print
Hawksworth OA, Coulthard LG, Taylor SM, Wolvetang EJ & Woodruff TM (2014) Complement
C5a promotes human embryonic stem cell pluripotency in the absence of FGF2 Stem Cells 32 (12);
3278-3284
Coulthard LG, Hawksworth OA, Li R, Balachandran A, Lee JD, Sepehrband F, Kurniawan N, Jeanes
A, Simmons DG, Wolvetang EJ & Woodruff TM (2017) Complement C5aR1 Signaling Promotes
Polarization and Proliferation of Embryonic Neural Progenitor Cells through PKCζ Journal of
Neuroscience 37 (22); 5395-5407
Bellows-Peterson ML, Fung HK, Floudas CA, Kieslich CA, Zhang L, Morikis D, Wareham KJ, Monk
PN, Hawksworth OA, Woodruff TM (2012) De novo peptide design with C3a receptor agonist and
antagonist activities: theoretical predictions and experimental validation Journal of Medicinal
Chemistry 55 (9); 4159-68
Reports
Hawksworth OA, Coulthard LG & Woodruff TM (2013) Complement peptide receptors: C3a
receptor. International Union of Basic and Clinical Pharmacology Database.
http://www.guidetopharmacology.org/GRAC/ObjectDisplayForward?objectId=31
Coulthard LG, Hawksworth OA & Woodruff TM (2013) Complement peptide receptors: C5a
receptor. International Union of Basic and Clinical Pharmacology Database.
http://www.guidetopharmacology.org/GRAC/ObjectDisplayForward?objectId=32
Hawksworth OA, Woodruff TM (2016) Flash News: Complement and microglia mediate early
synapse loss in Alzheimer mouse models Focus in Complement 43; 2
vi
Book Chapters
Coulhard LG, Hawksworth OA, Woodruff TM “Chapters: C3aR, C5aR1, and C5aR2” The
Complement FactsBook 2nd edition, S. Barnum & T. Schein (Ed.) Academic Press, October 2017
International Conference Abstracts
Hawksworth OA, Coulthard LGJ, Taylor SM, Wolvetang EJ & Woodruff TM (2012) Expression
of complement factors and functional C5a receptors in human embryonic stem cells and induced
pluripotent stem cells Immunobiology 217 (11), 1169
Presented at the 24th International Complement Workshop, Chania, Crete, Greece
Winner Aegean Conference Trainee Award (2012)
vii
Publications Included in this Thesis
Chapter 1
Hawksworth OA, Coulthard LG, Woodruff TM (2016) Complement in the fundamental processes
of the cell Molecular Immunology 84; 17-25
Contributor Statement of Contribution Hawksworth OA Researched the paper (100%)
Wrote the paper (95%) Coulthard LG Wrote and edited the paper (5%) Woodruff TM Edited the paper (100%)
Hawksworth OA, Xiang L, Coulthard LG, Wolvetang EJ & Woodruff TM (2017) New concepts on
the therapeutic control of terminal complement receptors Molecular Immunology Epub ahead of print
Contributor Statement of Contribution Hawksworth OA Researched the paper (95%)
Wrote the paper (95%) Xiang L Researched and wrote the paper (5%)
Coulthard LG Edited the paper (25%) Wolvetang EJ Edited the paper (25%) Woodruff TM Edited the paper (50%)
Chapter 2
Hawksworth OA, Coulthard LG, Taylor SM, Wolvetang EJ & Woodruff TM (2014) Complement
C5a promotes human embryonic stem cell pluripotency in the absence of FGF2 Stem Cells 32 (12);
3278-3284
Contributor Statement of Contribution Hawksworth OA Performed the experiments (100%)
Analysed the data (95%) Wrote the paper (80%)
Coulthard LG Analysed the data (5%) Edited the paper
Taylor SM Edited the paper and intellectual input (20%) Wolvetang EJ Edited the paper and intellectual input (40%) Woodruff TM Edited the paper and intellectual input (40%)
viii
Chapter 3
Coulthard LG*, Hawksworth OA*, Li R, Balachandran A, Lee JD, Sepehrband F, Kurniawan N,
Jeanes A, Simmons DG, Wolvetang EJ & Woodruff TM (2017) Complement C5aR1 Signaling
Promotes Polarization and Proliferation of Embryonic Neural Progenitor Cells through PKCζ Journal
of Neuroscience 37 (22); 5395-5407
*These authors contributed equally
Contributor Statement of Contribution Hawksworth OA Performed and analysed the human
experiments (100%) Wrote the paper (75%)
Coulthard LG Performed and analysed the mouse experiments (90%)
Wrote the paper (25%) Li R Mouse behavioural analysis (100%)
Balachandran A Technical and analytical support (100%) Lee JD Performed mouse ELISA experiments (100%)
Sepehrband F Performed mouse MRI experiments (50%) Kurniawan N Performed mouse MRI experiments (50%)
Jeanes A Intellectual input (5%) Simmons DG Edited the paper and intellectual input (10%) Wolvetang EJ Edited the paper and intellectual input (40%) Woodruff TM Edited the paper and intellectual input (50%)
ix
Contributions by others to the thesis
In addition to the contributions of research paper co-authors as listed above, I acknowledge the
contributions of Associate Professor Trent Woodruff and Professor Ernst Wolvetang in reviewing
and editing parts of this thesis.
Statement of parts of the thesis submitted to qualify for the award of another
degree
None
x
Acknowledgements
From the beginning of my PhD in the Woodruff laboratory, to my gradual infiltration of the
Wolvetang group, I have had the opportunity to meet a number of excellent colleagues and friends.
Without them my 5½ years (concurrent MBBS study, not laziness!) of study would have not been the
frankly amazing experience that it was.
Firstly, I would like to thank my principal supervisors, A/Prof Trent Woodruff and Prof Enrst
Wolvetang. Both of you have guided and educated me immensely, and the combined education with
Trent’s guidance and Ernst’s passion provided me with excellent supervision to complete my studies.
Extra thank you to Steve, hope you’re not missing research in-between the chillies and home-brew.
Thank you to the original Woodruff/Taylor group members who have long left especially Mike, Pep,
Liam, and Patrick, for all your support in and out of the lab and making it a fun place to be; and thank
you to the new ones who have kept the lab interesting throughout my ever dwindling visits, especially
Rui, Sammy, Vinod, and Vandana. Thank you as well to the Wolvetangs and Coopies past and
present, in particular Nilay for all his wisdom which I, to my detriment, often ignored (and will
continue to!) and Anu, the best desk buddy one could hope for.
To Liam, you were a horrible honours supervisor, but a great PhD colleague and friend. And Patrick,
a great honours partner, whom without I would have been consumed by my sedentary propensity.
To my family, thank you for all your support and patience in waiting for me to finally get a real job!
Finally, Ilaria, my sugar-mamma. The best thing to come out of my PhD. Thank you for all your love
and support, I’m looking forward to regaining some weekends and our post-PhD adventures together.
xi
Keywords
Complement, C5a, C5aR1, development, pluripotent stem cell, neurogenesis, brain development
Australian and New Zealand Standard Research Classifications (ANZSRC)
060103 Cell Development, Proliferation and Death, 50%
110707 Innate Immunity, 25%
110903 Central Nervous System, 25%
Fields of Research (FoR) Classification
0601 Biochemistry and Cell Biology, 50%
1107 Immunology, 25%
1109 Neurosciences, 25%
xii
Table of Contents
Abstract ............................................................................................................................................................ ii
Declaration by Author ................................................................................................................................. iv
Publications during candidature ................................................................................................................. v
Publications included in this thesis .......................................................................................................... vii
Contributions by others to this thesis ........................................................................................................ ix
Statement of parts of this thesis submitted to qualify for the award of another degree ....................... ix
Acknowledgements ....................................................................................................................................... x
Keywords ...................................................................................................................................................... xi
Australia and New Zealand Standard Research Classifications ............................................................. xi
Fields of Research Classifications .............................................................................................................. xi
List of Tables and Figures ................................................................................................................................ xv
List of Abbreviation’s .................................................................................................................................... xvii
Chapter 1: Introduction ................................................................................................................................... 1
1.1 Introduction ............................................................................................................................................ 1
1.2 The Complement System ....................................................................................................................... 2
Abstract ...................................................................................................................................................... 3
Introduction ................................................................................................................................................ 4
Complement in basic cell processes ........................................................................................................... 6
Migration ............................................................................................................................................... 6
Adhesion ................................................................................................................................................ 7
Morphogenesis ...................................................................................................................................... 8
Proliferation ........................................................................................................................................... 9
Survival ............................................................................................................................................... 14
Synaptic Pruning ................................................................................................................................. 15
Summary .................................................................................................................................................. 17
References ................................................................................................................................................ 18
1.3 C5aR1 .................................................................................................................................................... 28
Signalling ................................................................................................................................................. 28
Ligands ..................................................................................................................................................... 28
Function .................................................................................................................................................... 29
References ................................................................................................................................................ 31
1.4 Pharmacological Modulators of Anaphylatoxin Signalling .............................................................. 34
Abstract .................................................................................................................................................... 35
Introduction .............................................................................................................................................. 36
xiii
Inhibitors of C5/C5a ................................................................................................................................. 38
Inhibitors of C5aR1 .................................................................................................................................. 41
Targeting C3aR ........................................................................................................................................ 44
Targeting of C5aR2 .................................................................................................................................. 45
The future of anaphylatoxin targeted therapeutics ................................................................................... 47
References ................................................................................................................................................ 49
1.5 Pluripotent Stem Cells .......................................................................................................................... 57
Introduction .............................................................................................................................................. 57
Neural differentiation of PSSCs ............................................................................................................... 58
References ................................................................................................................................................ 60
Chapter 2: C5a Signalling in Pluripotent Stem Cells .................................................................................. 62
Abstract ......................................................................................................................................................... 63
Introduction .................................................................................................................................................. 64
Materials & Methods .................................................................................................................................... 65
Results and Discussion ................................................................................................................................. 68
Conclusion .................................................................................................................................................... 74
References .................................................................................................................................................... 75
Chapter 3: C5aR1 in the control of Embryonic Neural Progenitor Cells ................................................. 78
Abstract ......................................................................................................................................................... 79
Introduction .................................................................................................................................................. 80
Materials & Methods .................................................................................................................................... 82
Results .......................................................................................................................................................... 89
Discussion ................................................................................................................................................... 101
References .................................................................................................................................................. 104
Chapter 4: C5aR1 in Pluripotent Stem Cell derived Neurons ................................................................. 109
Introduction ................................................................................................................................................ 109
Metabolism and Cell Survival ........................................................................................................... 109
Complement in Metabolic Regulation ............................................................................................... 110
C5a signalling in post-mitotic neurons .............................................................................................. 111
Materials & Methods .................................................................................................................................. 112
Results ........................................................................................................................................................ 114
Discussion ................................................................................................................................................... 120
References .................................................................................................................................................. 124
xiv
Chapter 5: Discussion and Concluding Remarks ...................................................................................... 128
Introduction ................................................................................................................................................ 128
C5aR1 in the developing brain ................................................................................................................... 129
Therapeutic implications of C5a-C5aR1 inhibition .................................................................................... 130
PPSCs for the study of complement ........................................................................................................... 131
Conclusion .................................................................................................................................................. 133
References .................................................................................................................................................. 135
xv
List of Tables and Figures
Chapter 1: Introduction
Figure 1.2.1 The Complement Cascade
Figure 1.2.2 Complement control of migration, adhesion, and morphogenesis
Figure 1.2.3 Complement control of proliferation, survival, and synaptic pruning
Figure 1.3.1 Dose response curves for human C5a and PMX53
Figure 1.4.1 The complement cascade and drugs available for targeting terminal
complement receptor signalling
Table 1.4.1 Clinical Trials of Eculizumab
Table 1.4.2 Phase II/III clinical trials of C5a-C5aR1 targeted therapeutics under active
development
Figure 1.5.1 Differentiation of hPSCs to neurons
Chapter 2: C5a Signalling in Pluripotent Stem Cells
Figure 2.1 Expression of complement factors C5, C5aR and C5L2 on hESC and hiPSC
Figure 2.2 C5a receptor activation results in transient phosphorylation of ERK and AKT
signalling proteins in the hESC line, H9
Figure 2.3 C5a promotes pluripotency in hESC in the absence of FGF2
Figure 2.4 C5a increases cell number following single cell dissociation of hESC
Chapter 3: C5aR1 in the control of Embryonic Neural Progenitor Cells
Table 3.1 List of PCR primer sequences and conditions
Table 3.2 Table of MRI volume comparison of brain regions for C5aR1-antagonist or
vehicle treated mice
Figure 3.1 Localisation of C5aR1 and ligands
Figure 3.2 Expression of C5aR1 in human embryonic stem cell-derived rosettes
Figure 3.3 C5aR1 signals through PKCζ to maintain cell polarity in vitro
xvi
Figure 3.4 C5aR1 signaling alters neural progenitor division planes and proliferation in
vivo
Figure 3.5 Blockade of C5aR1 signaling at E12.5-14.5 causes behavioral changes in
adult mice
Figure 3.6 Blockade of C5aR1 signaling at E12.5-14.5 results in microstructural
changes in adult brains
Chapter 4: C5aR1 in Pluripotent Stem Cell derived Neurons
Figure 4.1 hESC derived neuronal differentiation
Figure 4.2 C5a is not toxic to C5AR1 expressing neurons
Figure 4.3 C5a does not affect cell survival in the presence of apoptotic inducers
Figure 4.4 Metabolic capacity of hPSC derived neurons
xvii
List of Abbreviations
C Complement factor aHUS Atypical hemolytic-uremic
syndrome AKT Protein kinase B ANLS Astrocyte-neuron lactate shuttle
ATP Adenosine triphosphate Aβ Amyloid beta bad Bcl-2-associated death promoter bak Bcl-2 homologous antagonist/killer
bax Bcl-2-like protein 4 bcl-2 B-cell lymphoma 2 bFGF basic fibroblast growth factor BM Bone Marrow
C3aR Complement factor 3a Receptor C5a Complement factor 5a
C5aR1 Complement factor 5a Receptor 1 C5aR2 Complement factor 5a Receptor 2
C5L2 Complement factor 5a Receptor 2 CD Cluster of differentiation
CNS Central nervous system CPC Cardiac progenitor cell Crry CR1-related gene Y CSF Cerebrospinal fluid CTB Cytotrophoblast DCX Doublecortin ECAR Extracellular acidification rate EGL External granule layer
ERK Extracellular signal related kinases FCCP Carbonyl cyanide-4-
(trifluoromethoxy)phenylhydrazone
GFAP Glial fibrillary acidic protein GPCR G-protein coupled receptor hESC Human embryonic stem cell hiPSC Human induced pluripotent stem
cell HMEC-1
human microvascular endothelial cell
IAM Inner acrosomal membrane IGL Internal granule layer MAC Membrane attack complex
MAPK Mitogen-activated protein kinases MASP Mannan-binding lectin serine
protease MRI Magnetic resonance imaging MSC Mesenchymal stem cell
NCAD Neural-type cadherin NCC Neural crest cell
NFkB Nuclear factor kappa-light-chain-enhancer of activated B cells
NPC Neural progenitor cell
OCR Oxygen consumption rate PCR Polymerase chain reaction pfkfb3 6-phosphofructo-2-kinase/fructose-
2,6-biphosphatase 3 PI3K Phosphoinositide 3-kinase PKC Protein kinase C PKCζ Protein kinase C zeta
PNH Paroxysmal nocturnal hemoglobinuria
PPSC Pluripotent stem cell ROS Reactive oxygen species TUBB3 Tubulin beta-3 chain
ZO-1 Zona occludens 1
1
1.1 Introduction
This chapter presents an overview of the topics relevant to this thesis. This includes subsections
of work published as reviews, and on specific topics relevant to this thesis. Together, these
sections help to introduce the complement system, C5a-C5aR1, and pluripotent stem cells and
neuronal modelling. Section 1.2 provides an introduction to the complement system, and the
actions of this signalling family outside of their traditional roles in immunity. This includes
roles in cell survival, proliferation, and migration, highlighting the diverse nature of
complement. Section 1.3 briefly introduces the receptor C5aR1, the main receptor of interest
in this thesis. Section 1.4 provides an overview of pharmacological tools targeting both C5a
and C3a signalling. This section gives an important overview of the broad therapeutic
applications of C5a-C5aR1 modulation currently under investigation. With targeting of C5a-
C5aR1 signalling proposed for a number of disorders, the investigation for physiological
actions of this receptor is needed to understand the potential consequences of receptor
inhibition. Lastly, section 1.5 provides an introduction to pluripotent stem cells, and their use
as a tool for the study of complement and human neuronal modelling.
2
1.2 The Complement System
Complement in the fundamental processes of the cell Owen A. Hawksworth1,2, Liam G. Coulthard3,4, Trent M. Woodruff1
1School of Biomedical Sciences, The University of Queensland, St Lucia, Brisbane, QLD, 4072, Australia
2Australian Institute for Bioengineering & Nanotechnology, The University of Queensland, St. Lucia,
Brisbane, QLD, 4072, Australia
3School of Medicine, University of Queensland, Herston, Australia
4Royal Brisbane and Women’s Hospital, Herston, Australia
Published in Molecular Immunology
3
Abstract
Once regarded solely as an activator of innate immunity, it is now clear that the complement system
acts in an assortment of cells and tissues, with immunity only one facet of a diverse array of functions
under the influence of the complement proteins. Throughout development, complement activity has
now been demonstrated from early sperm-egg interactions in fertilisation, to regulation of epiboly
and organogenesis, and later in refinement of cerebral synapses. Complement has also been shown to
regulate homeostasis of adult tissues, controlling cell processes such as migration, survival, repair,
and regeneration. Given the continuing emergence of such novel actions of complement, the existing
research likely represents only a fraction of the myriad of functions of this complex family of proteins.
This review is focussed on outlining the current knowledge of complement family members in the
regulation of cell processes in non-immune systems.
4
Introduction
The complement system has long been regarded as the effector arm of innate immunity. After initial
activation of complement, a multitude of split products are able to facilitate the recruitment of
immune cells to sites of inflammation and pathogen clearance via opsonisation or direct destruction.
It is now well established that these actions represent only one part of a diverse array of complement
functions, with emerging research demonstrating the versatility of this phylogenetically conserved
family throughout numerous cell systems and developmental stages.
Traditionally, complement activation has been thought to occur through three pathways; the C1
antibody-antigen complex of the classical pathway, spontaneous C3 hydrolysis of the alternative
pathway, or recognition of damaged or pathogenic surfaces by mannose-binding lectin (MBL)
through the lectin pathway. Pathway activation initiates a cascade resulting in the cleavage of
complement factor 3 (C3) and complement factor 5 (C5) to their active fragments (C3a, C3b, C5a,
C5b). These cleavage fragments represent the foundation of the complement-initiated cellular
immune response (for a comprehensive review, see (Merle et al. 2015a; Merle et al. 2015b)). Both
C3a and C5a are capable of signalling through their respective G-protein coupled receptors, C3aR1
and C5aR1, to regulate the activation of immune cells and their recruitment to sites of tissue injury
and inflammation. C5a can also interact with a second C5a receptor, C5aR2, which despite lacking
G-protein coupling, can alter the response of a cell to C5a (Croker et al. 2016). Additionally, C3b
acts as a powerful opsonin, tagging foreign pathogens and cells for destruction, whilst C5b can
combine with further downstream complement factors, C6, C7, & C9, to form the membrane attack
complex (MAC) capable of disrupting bacterial cell membranes. In the absence of complement
cascade activation, C3 and C5 can also be cleaved by a variety of predominantly cell and blood-
derived serine proteases (Huber-Lang et al. 2006; Amara et al. 2010; Perl et al. 2012). This ‘extrinsic’
pathway provides a mechanism by which complement can be locally activated in the absence of
inflammation, to control a number of immune and non-immune cell processes.
It is now evident that the activation of the innate immune response represents only one arm of the
diverse array of physiological functions that receive contribution from the complement proteins.
Throughout development, complement activity has been demonstrated from early sperm-egg
interactions in fertilisation, to regulation of epiboly and organogenesis, and later in refinement of
cerebral synapses. Complement has also been shown to regulate homeostasis of adult tissues,
controlling cell processes such as migration, survival, repair, and regeneration. Given the continuing
emergence of novel actions of complement, the existing research likely represents only a fraction of
the full role of this complex family of proteins. This review is focussed on outlining the current
5
knowledge on both divergent and conserved actions of complement family members in the regulation
of cell processes in non-immune systems.
Figure 1.2.1 The complement cascade. Complement activation can occur through three pathways; the C1 antibody-antigen complex of the classical pathway, spontaneous C3 hydrolysis of the alternative pathway, or recognition of damaged or pathogenic surfaces by mannose-binding lectin (MBL). Activation results in a cleavage cascade, and the formation of complement fragments C3a, C3b, C5a, and C5b. These fragments represent the main effector components of the complement system. C3 and C5 may also be cleaved directly via the extrinsic pathway.
6
Complement in basic cell processes
Migration
The coordinated migration of cells is a core process in multicellular organisms, facilitating actions
such as embryogenesis, wound healing, and the immune response. The complement system has been
demonstrated to have a broad role in the control of cell migration, extending to, and beyond,
immunity. Through selective expression and activation, complement factors control a number of
migratory processes in the organisation of the developing embryo and in recruitment of adult stem
cell pools. The ability of complement to control cell migration also represents a significant arm of the
complement-mediated immune response. Activation of the complement cascade results in the
cleavage of complement factor 5 (C5) to the active fragment, C5a; a potent mobiliser of immune cell
migration capable of recruiting monocytes and neutrophils to sites of inflammation (Marder et al.
1985; Boneschansker et al. 2014). The action of C5a in recruiting leukocytes is pivotal in the
mounting of host defences against pathogens, however, aberrant activity can also play a role in disease
pathology. Complement control of cell migration can also have anti-inflammatory actions,
moderating the extent of the immune response. This is demonstrated in a model of intestinal ischemia-
reperfusion injury, where C3a/C3aR signalling attenuates neutrophil mobilisation into the circulation,
leading to reduced neutrophil recruitment and tissue damage (Wu et al. 2013). Interestingly, this same
impaired mobilisation response leads to increased tumour growth in cancer models (Nabizadeh et al.
2016).
In the non-immune context, both C3a and C5a have both been demonstrated to induce actin
polymerisation and chemotaxis of mesenchymal stem cells (MSCs) through C3aR1- and C5aR1-
dependent phosphorylation of ERK (Schraufstatter et al. 2009). The mobilisation of MSC pools to
sites of tissue injury is an important step in repair and regeneration, as such is it proposed that
increased C3a and C5a concentrations during inflammation can serve a dual function in both
facilitating acute immune responses, as well as mobilising cell pools such as MSCs for subsequent
tissue repair. A similar function has also been observed in cardiac progenitor cells (CPCs). Here C3a
and C5a, through activation of ERK, PKC, and NFkB pathways, induced transition of CPCs from an
endothelial to a mesenchymal state, promoting migration of the cells to sites of repair (Lara-Astiaso
et al. 2012). In addition, anaphylatoxin signalling increased proliferation of the CPC pool and induced
their maturation towards myofibroblasts, required for repair following cardiac injury.
This action on progenitor cells is not a global phenomenon. Both C3a and C5a also contribute to the
mobilisation of bone marrow hematopoietic stem cells (HPSCs). However, in HPSCs C5a and C3a
demonstrate opposing actions via separate mechanisms. Through indirect activation of granulocytes,
7
C5a, produced via thrombin cleavage of C5, promotes the release of pro-mobilisation factors that
facilitate egress of HPSCs from their bone marrow (BM) niche (Lee et al. 2009). C3a opposes this
action, promoting retention of BM HPSCs. C3 and C3aR1 deficient mice show decreased
mobilisation of HPSCs in response to G-CSF (Ratajczak et al. 2004). Interestingly, this is not a direct
effect, instead C3aR1 signalling sensitises HPSCs to BM stromal cell released SDF-1 (Ratajczak et
al. 2004; Wysoczynski et al. 2009). This effect has also been reported in HPSC derivatives including
myeloid, erythroid, and megakaryocytic progenitors (Reca et al. 2003). However, other reports have
suggested that C3aR1 is not expressed on human HPSCs, with the action of C3a occurring
independently of C3aR1 (Honczarenko et al. 2005). Interestingly, this mechanism extends to neural
progenitor cells (NPCs) in the adult brain. C3a alone had no observed effect on mouse whole brain-
derived NPCs, however it was shown that the presence of C3a increased SDF-1 induced ERK
phosphorylation, resulting in chemotaxis and proliferation of NPCs (Shinjyo et al. 2009). The
underpinning function of this response was again suggested to lie in complement mobilisation of
regenerative/repair responses following injury such as ischemic stroke.
The ability of complement factors to regulate cell migration across a number of systems may also
have pathogenic consequences, with aberrant complement expression linked to the migratory
properties of a number of cancer cells. Increased C5aR1 levels have been reported in squamous cell
carcinomas, adenocarcinomas, and transitional cell carcinoma across a number of tissues. C5aR1
expression was associated with increased cell migration and invasiveness in bile, colon, and renal
cancers (Nitta et al. 2013; Maeda et al. 2015). In addition, both C3a and C5a anaphylatoxins are
capable of driving chemotaxis and adhesion of leukemic cells, primarily through p38 MAPK
dependent downregulation of heme oxygenase 1 (Abdelbaset-Ismail et al. 2016). As well as being
directly chemotactic, C5aR1 has also been shown to promote epithelial to mesenchymal transition in
hepatocellular carcinoma, increasing cell motility and invasiveness (Hu et al. 2016).
Adhesion
Adhesion is a well-known facet of complement action in the immune context. Multiple arms of
complement are involved in the adhesion and extravasation of leukocytes from the circulation to
damaged tissues. However, given the scope of this review, we restrict our focus to the non-immune
context.
CD46 is a membrane protein that acts traditionally as an inhibitor of complement activation, through
the inactivating cleavage of C3b and C4b. However, at the point of conception, expression of CD46
is restricted to the inner acrosomal membrane (IAM) of sperm (Riley et al. 2002a). This unique
8
localisation has been postulated to facilitate the adherence of spermatozoa to the oocyte, permitting
penetration and fertilization (Riley-Vargas et al. ; Anderson et al. 1993; Taylor et al. 1994).
Interestingly, studies in new world monkeys have suggested that the mechanism of action for CD46
is not through traditional C3b binding, but through an alternative binding domain CCP1 which is
selectively expressed in the testes of these animals (Riley et al. 2002b). In support of this, CCP1
blocking antibodies reduced human spermatozoa-egg binding, whereas an antibody against the C3b
binding site of CD46 had no effect (Taylor et al. 1994).
C1q, an initiator of the classical complement cascade, has also been linked with adhesive processes
outside of immunity. Following fertilisation, the developing embryo must implant into the maternal
endometrium. Invasive cytotrophoblasts (CTBs) migrate into the maternal decidua to establish
maternofoetal connections required for nutrient exchange and foetal growth. C1q has been
demonstrated to facilitate this process, with C1q released by invading CTBs mediating gC1qR and
B1 integrin dependent CTB adhesion and decidual migration (Agostinis et al. 2010). Loss of this
process in C1q-deficient mice results in embryonic growth restriction with increased foetal
resorptions and increased foetal weight after 15 days of pregnancy.
Morphogenesis
Complement C3 has been consistently identified as an important signalling factor in the control of
embryonic tissue organisation (Carmona-Fontaine et al. 2011; Broders-Bondon et al. 2016; Szabo et
al. 2016). Within the mammalian embryo, our laboratory has documented the presence of multiple
complement factors during embryogenesis and neurulation (Denny et al. 2013; Hawksworth et al.
2014; Jeanes et al. 2015). The prominence of C3 in these roles is intriguing as C3, along with
activation factors MASP and factor B, are the most evolutionarily primitive components of the
complement system, conserved and present in the common ancestor of eumetazoa potentially more
than 1300 million years ago (Nonaka and Kimura 2006). Whilst this ancient origin is linked to early
immune competence, it is possible that the emergence of C3 was as a controller of a sophisticated
tissue organisation with immune roles following in later evolution.
The developmental actions of C3 have been best characterised in xenopus and zebrafish studies. In
xenopus, C3a/C3aR1 signalling has been implicated in chemotactic processes during gastrulation
(Szabo et al. 2016). During epiboly, morphogenetic processes such as radial intercalation are required
for the organisation and expansion of the embryo. This radial intercalation has been shown to be
driven by C3a/C3aR1 signalling with C3a released from a superficial cell layer a chemoattractant for
9
C3aR1 expressing deep cell layer cells, resulting in the thinning of multilayered deep cells and
expansion of tissue during gastrulation (Szabo et al. 2016).
Through a different mechanism, C3 signalling has also been implicated in the control of neural crest
cell (NCC) migration. Following the formation of the neural tube, NCCs form in the neural folds and
subsequently undergo epithelial to mesenchymal transition. This permits their detachment from the
neuroepithelium and migration throughout the embryo, forming structures such as craniofacial
cartilage and bone, smooth muscle, and peripheral neurons. Interestingly, this transition to a
migratory, mesenchymal state, results in the upregulation of C3aR1. In xenopus and zebrafish models,
NCC release of C3a was shown to mediate coattraction between NCCs, allowing for collective,
coordinated migration (Carmona-Fontaine et al. 2011). Mouse studies have shown conservation of
this function in mammals, with C3a/C3aR1 involvement in collective migration of enteric NCCs
(Broders-Bondon et al. 2016). Through N-Cadherin dependent mechanisms, C3a activation of C3aR1
facilitated coattraction, with perturbation of C3aR1 signalling disrupting migration of enteric NCCs
and gut colonisation. C3a/C3aR1 signalling again plays an important role in the migratory process of
post-natal cerebellar NPCs. C3a subdural injections in P10 rats increased granule cell motility and
migration, resulting in decreased external granule layer (EGL) thickness and increased internal
granule layer (IGL) thickness (Benard et al. 2008). Combined, this evidence supports a novel global
role for the C3a/C3aR1 axis in the normal physiology of development.
Interestingly, a further two complement factors, CL-K1 and MASP1 of the lectin pathway have also
been implicated in the control of NCC migration (Rooryck et al. 2011). Mutations in these factors
have been identified in 3MC patients, a rare disorder resulting in features such as facial dysmorphism,
cleft lip and/or palate, craniosynostosis, learning disability and genital, limb and vesicorenal
anomalies. Animal studies have shown that both these factors serve as guidance cues for migratory
NCCs, with loss of either gene resulting in craniofacial abnormalities as a consequence of defective
NCC migration (Rooryck et al. 2011). Of the two proteins, CL-K1 was also directly identified as a
NCC chemoattractant. Whilst traditionally associated with complement activation following bacterial
infection, the emergence of MASP along with C3 in eumetazoa perhaps points to evolutionary origins
of complement in tissue organisation before immunity.
Proliferation
The complement system has been demonstrated to be capable of not only activating immune and
inflammatory responses, but also of coordinating the activation of cells following injury, mediating
regenerative and repair responses primarily through induction of cell proliferation.
10
An involvement of complement in tissue regeneration was first identified in urodeles, amphibians
capable of regenerating limb and lens tissue. Following limb amputation or lens removal, C3 and C5
are both upregulated in distinct regions, with C3 expression predominately in the limb blastemal, iris
and cornea, and C5 expression mainly in the limb wound epithelium and lens vesicle (Del Rio-Tsonis
et al. 1998; Kimura et al. 2003). These observations strongly suggested an involvement of these
complement factors in urodele tissue regeneration, however, no mechanistic function was
demonstrated. Further studies in chick retina identified the C3 fragment, C3a, as a potent inducer of
regeneration (Haynes et al. 2013). Following retina removal, exogenous C3a, through C3aR1
activation, stimulated retinal progenitor proliferation and retinal regeneration. This effect was
observed to be through activation of a critical regenerative pathway, with C3a/C3aR1 signalling
increasing STAT3 phosphorylation and induction of IL-6, IL-8, and TNFα expression.
The complement anaphylatoxins have also been identified as promotors of liver regeneration.
Following either partial hepatectomy or CCl4 injury, normally quiescent hepatocytes will be induced
to proliferate and regenerate the damaged/loss liver mass. Deficiency in either C3, C5, or both factors
has been observed to result in impairment of this regenerative response (Mastellos et al. 2001; Strey
et al. 2003). Similar to chick retina, loss of complement signalling resulted in impaired activation of
known pro-regenerative pathways including TNFα and IL-6 mRNA expression, and NF-kB and
STAT3 signalling (Strey et al. 2003). Furthermore, in rat studies, C5a/C5aR1 signalling was
associated with upregulation of mitogenic factors HGF and c-met receptor, and increased hepatocyte
proliferation (Daveau et al. 2004). Interestingly, C4 deficient mice (inducing loss of classical and
lectin pathways) and Factor B deficient mice (inducing loss of the alternative pathway) had no
impairment in regeneration, suggesting that cleavage and activation of C3 and C5 occurs via the
extrinsic pathway (Clark et al. 2008).
The involvement of complement in proliferation and regeneration has also been observed in neural
tissue. Developmentally, C5aR1 was shown to stimulate proliferation of immature cerebellar granule
neurons, whilst C3aR1 antagonism was linked with reduced proliferation of neuronal progenitor cells
(Benard et al. 2008). In the adult brain, the action of C3 signalling was extended to the regenerative
response following injury, with mice deficient in C3 having impaired neurogenesis following
ischemic stroke (Rahpeymai et al. 2006). Additionally, in the post-acute phase of spinal cord injury,
C5aR1 signalling reduces pathology and improves recovery of motor functions (Brennan et al. 2015).
The underlying mechanism was demonstrated to be through C5aR1 control of astrocyte proliferation
and glial scar formation, processes necessary for recovery, via STAT3 signalling. In tissues with poor
regenerative capacity, complement signalling following injury has also been associated with
induction of tissue repair responses. Both C3a and C5a, acting through their respective receptors
11
C3aR1 and C5aR1, have been reported to stimulate proliferation of cardiac progenitor cells (CPCs)
whilst pushing these cells towards a myofibroblast state, promoting tissue repair and fibrosis (Lara-
Astiaso et al. 2012).
Figure 1.2.2. Complement control of migration, adhesion, and morphogenesis. Summary of complement factors and
cell types involved for the aforementioned cell processes in non-immune systems. Effect is summarised by positive (+)
and negative (−) modulation of the cell process. HPSC = hematopoietic stem cell, NCC = neural crest cell.
In the context of response to injury, complement factor C1q has been shown to regulate a number of
cell processes in endothelial, CNS, and skeletal muscle cells. Within each cell type, a different
mechanism of action for C1q was identified, highlighting the diverse capabilities of this complement
factor. In the endothelium of blood vessels, C1q is present exclusively during wound healing (Bossi
et al. 2014). Likely acting through its receptor gC1qR, C1q was observed to have angiogenic activity,
12
stimulating endothelial proliferation and new vessel formation. In a human microvascular endothelial
cell line (HMEC-1) similar proliferative and angiogenic effects were seen for C5a/C5aR1 signalling
(Kurihara et al. 2010). C1q has also been shown to act independently of its traditional receptors,
interacting with a number of soluble proteins to regulate biological processes. This is exemplified in
neuronal regeneration
Figure 1.2.3 Complement control of proliferation, survival, and synaptic pruning. Summary of complement factors
and cell types involved for the aforementioned cell processes in non-immune systems. Effect is summarised by positive
(+) and negative (−) modulation of the cell process.
13
following spinal cord injury (SCI), where C1q has been observed to bind and negatively regulate
myelin associated glycoprotein (MAG) (Peterson et al. 2015). Through inhibition of MAG inhibitory
signals, C1q is capable of enhancing cortical neuron outgrowth, promoting recovery following SCI.
Such unique interactions by C1q can also have deleterious effects on tissue regeneration. C1q has
been observed to be capable of binding frizzled receptors to activate Wnt signalling (Naito et al.
2012). In skeletal muscle tissue this interaction results in differential modulation of cell proliferation,
with anti-proliferative effects of C1q on satellite cells, whilst increasing proliferation of fibroblasts.
Overall this lead to impaired regeneration of damaged muscle tissue and increased fibrosis. C1q was
also observed to have antiproliferative effects on malignant cell lines of lymphoid origin
(Ghebrehiwet et al. 1990).
The capacity of complement to drive proliferation also extends to more unexpected members of the
complement family including the terminal complement complex C5b-9 and the complement regulator
CD46. The C5b-9 complex is commonly known for its function as the membrane attack complex,
directly destroying foreign pathogens. However, a number of studies have suggested a pro-
proliferative effect of C5b-9 on host cells during inflammation. C5b-9 has been reported to signal
through G-protein dependent mechanisms, activating second messengers such as ERK and PI3K to
stimulate proliferation of a number of cell types including oligodendrocytes, aortic endothelial cells,
glomerular mesangial cells, and lymphoblastic B cells (Rus et al. 1996; Niculescu et al. 1997;
Niculescu et al. 1999; Fosbrink et al. 2006; Qiu et al. 2012). This proliferative stimulus from C5b-9
generated during inflammatory processes is suggested to be pathogenic, driving sclerotic change in
tissues.
The complement receptor CD46, traditionally a negative complement regulator, is now at the
forefront of emerging complement studies, with a number of roles for this receptor identified
including actions in driving cell proliferation. Acting as a costimulatory molecule, CD46 with CD3
(T-cell co-receptor) strongly promotes T cell proliferation (Astier et al. 2000; Arbore et al. 2016).
CD46 expression is also required for epidermal stem cell proliferation (Tan et al. 2013). Whilst the
mechanism by which CD46 drives epidermal stem cell proliferation was not outlined, it is noteworthy
that the role of CD46 was identified through its association with high expression of the notch ligand,
delta-like 1 (DLL1). In T cell biology, CD46 has been identified as a binder of another notch ligand,
Jagged1 (Le Friec et al. 2012). This interaction was proposed as a mechanism by which Notch1-
Jagged1 interaction is limited by CD46, favouring Notch1 and DLL1 signalling. It is possible that
CD46 is influencing notch signalling, promoting Notch1-DLL1 interaction and cell proliferation.
Considering the significant involvement of notch signalling in development and the ubiquitous
14
expression of CD46, it will be interesting to see whether CD46/notch interactions have as of yet an
undiscovered involvement in the coordinated regulation of developmental processes.
Survival
During the activation of inflammation in response to tissue damage or pathogens, complement factors
are also essential for the survival of host cells. Expression of inhibitory complement receptors such
as CD46, CD55, and CD59 protect host cells from innate immune attack, whilst stimulation of
complement receptors such as C3aR1 can promote cell survival in the presence of pathogenic
infection (Zipfel and Skerka 2009; Mueller-Ortiz et al. 2014). Complement signalling can also
directly promote survival of immune cells during inflammation. Under normal conditions, circulating
neutrophils undergo spontaneous apoptosis, however, C5a signalling, activated during inflammation,
is capable of perturbing these apoptotic signals (Perianayagam et al. 2004). Whilst this may enhance
pathogen destruction, it has also been suggested that C5a induced neutrophil survival can accentuate
organ injury during inflammation (Guo et al. 2006). In addition to these actions, complement
signalling is utilised independently of immunity to control cell survival during neuronal development
and in adult tissues including the CNS, PNS, and hepatic system.
As a potent driver of inflammation, the complement system can have a significant impact on cell
survival. Within the brain, complement activation of inflammation and immunity has implications in
the progression of neurodegenerative conditions such as Alzheimer’s disease, multiple sclerosis, and
motor neuron disease (Woodruff et al. 2006; Woodruff et al. 2008; Ingram et al. 2009), as well as in
acute injury models such as spinal cord injury and stroke (Brennan et al. 2012). Whilst the pathogenic
actions of complement in progression of these diseases resides in the mobilisation of immunity
(Brennan et al. 2016), studies have also identified the ability of complement factors to positively
modulate cell survival pathways in neurons and glia. This dual function of complement may exist to
permit inflammation whilst promoting the survival of host cells.
In the central nervous system, C5a signalling has been shown to be both neuroprotective and
neurodestructive. During glutamate excitotoxicity, activation of neuronally expressed C5aR1
promotes survival, inhibiting apoptotic protein activation such as caspase 3, whilst maintaining
expression of GluR2 receptors (Mukherjee et al. 2008). In development, C5a/C5aR1 signalling has
again been implicated as a promotor of neuronal survival. For example, in developing rat cerebellar
granule neurons, C5aR1 expression was increased, with C5a/C5aR1 signalling reducing in vitro
apoptosis (Bénard et al. 2004). In contrast to neuroprotection in the setting of glutamate toxicity, in
the setting of hypoxic ischemia, C5a/C5aR1 signalling directly induces apoptosis of cortical neurons
15
(Pavlovski et al. 2012). Additionally, C3a signalling has been reported to promote neuronal survival
during glutamate excitotoxicity, however, this effect is indirect, with C3a stimulated astrocytes
providing anti-apoptotic signals for neurons (van Beek et al. 2001). As well as promoting neuron
survival, C3a stimulation of astrocytes has also been shown to directly promote astrocyte survival
under conditions of ischemic stress (Shinjyo et al. 2016).
Complement anaphylatoxins have also been implicated as pro-survival factors in hepatocytes. C3
deficiency, with consequent lack of C3a and C5a production, was associated with dysregulation of
STAT3, AKT, and mTOR signalling, resulting in impaired hepatocyte survival following partial
hepatectomy (Markiewski et al. 2009). This was a direct effect of C3a and C5a signalling, with
supplementation of mice with C3a and C5a able to ameliorate the impaired survival.
In experimental autoimmune encephalomyelitis, an animal model of multiple sclerosis, complement
C5 has been shown to promote cell survival resulting in increased remyelination during recovery
(Niculescu et al. 2004). Rather than through C5a signalling, as was seen in CNS and liver cells, the
action of C5 has been suggested to be through the C5b cleavage fragment in the formation of the C5b-
9 complex (Niculescu et al. 2004). In oligodendrocytes, sublytic C5b-9 was observed to signal
through ERK and AKT to inhibit both Fas/FasL and mitochondrial apoptotic pathways (Soane et al.
2001; Cudrici et al. 2006). Anti-apoptotic signalling by C5b-9 has also been reported in Schwann
cells, with C5b-9 signalling through AKT resulting in negative phosphorylation of BAD and
increased Bcl-xL expression (Hila et al. 2001). C5b-9 has also been observed to promote survival of
smooth muscle cells, stimulating IGF-1 secretion and IGF-1 receptor expression to inhibit Fas/FasL
mediated apoptosis (Zwaka et al. 2003).
Synaptic pruning
One of the hallmark features of the complement response is the ability of complement to control
phagocytosis of pathogens and apoptotic cells. Traditionally, this is undertaken through the binding
of C3b to cell membranes, tagging appropriate cells and fragments for leukocyte phagocytosis, with
protection of host cells through the expression of negative complement regulators such as CD46,
CD55 and Factor H. Through similar mechanisms, complement has been identified as an important
controller of cell survival during brain formation, with complement-mediated phagocytosis resulting
in synapse refinement necessary for correct neural development. Furthermore, aberrant activity of the
involved complement proteins has been implicated in the pathogenesis of disorders such as
schizophrenia and Alzheimer’s disease.
16
In an animal model of synaptic pruning during development, C1q and C3 were both identified as
factors required for the elimination of synapses (Stevens et al. 2007). Whilst not demonstrated in this
study, the mechanism behind this was suggested to be through the capability of these proteins to tag
cells for destruction, in this case potentially tagging synapses with inappropriate electrical activity for
phagocytic elimination by microglia. In support of this it was shown that complement receptor 3
(CR3)/C3 signalling drives microglial phagocytosis of synapses during retinogeniculate pruning
(Schafer et al. 2012).
Further studies showed that an absence of C1q resulted in increased cortical excitatory synapses (Chu
et al. 2010). As a consequence of this increased activity, C1q knockout mice suffered from atypical
absence seizures, highlighting the necessity of complement in synapse refinement and CNS
development (Chu et al. 2010). Furthermore, expression of C1q for synaptic pruning has been shown
to be driven by TGF-β signalling (Bialas and Stevens 2013). In a similar model, C4 was also identified
as a mediator of synapse elimination during postnatal development. In humans, aberrant expression
of C4 is associated with patients affected by schizophrenia (Sekar et al. 2016). The resultant increase
in C4 activity may play a role in the decreased synapse number and loss of grey matter seen in
schizophrenia.
In the post-natal brain, C1q has been observed to have mixed effects on neuronal survival, both
promoting death via complement activation of inflammation, and directly activating neurons to
promote survival. In acute models such as ischemic stroke, C1q knockout mice have reduced
complement activation and inflammation resulting in protection from brain injury (Ten et al. 2005).
Interestingly, this effect of C1q was observed to only occur in neonates, not adult mice. In contrast,
a neurodegenerative model of Alzheimer’s disease identified C1q as a protective factor, with neuronal
upregulation of C1q expression during injury conferring cell survival against amyloid beta (Aβ)
toxicity (Pisalyaput and Tenner 2008). The mechanism of C1q promoted survival was reported to be
both through the ability of C1q to bind and aggregate Aβ fragments, and through C1q induction of
neuronal expression of the protective receptors LRP1B and GPR6 (Benoit et al. 2013). Interestingly,
CNS expression of C1q has been reported to increase significantly during aging, accumulating near
aging synapses (Stephan et al. 2013). C1q deficiency was associated with reduced cognitive decline
suggesting that whilst activating neuroprotective pathways, the multiple actions of C1q may overall
have a detrimental effect on the aging brain, promoting neurodegeneration. In support of this, recent
studies have demonstrated that the aforementioned C1q, C3, and CR3 complement-dependent
synaptic pruning pathways physiologically required during development, are inappropriately
activated in early Alzheimer’s disease, mediating synaptic loss before the appearance of amyloid
plaques (Hong et al. 2016). Additionally, inhibition of the classical pathway of the complement
17
cascade is associated with reduced synaptic degeneration in animal models of glaucoma (Williams et
al. 2016), whilst C3-knockout mice show altered synaptic function and enhanced learning, as well as
protection against age-related hippocampal decline (Perez-Alcazar et al. 2014; Shi et al. 2015).
Summary
In this review we have summarised the current knowledge regarding the role complement proteins
play in basic cell processes of non-immune cells. Such novel roles include the control of tissue
organisation in development, and synaptic refinement in the mammalian brain (refer to Figs. 1.2.2
and 1.2.3 for synopsis). The link of these functions with the pathogenesis of disorders of development
such as 3MC syndrome, neural tube defects, and schizophrenia, and with neurodegenerative disorders
such as Alzheimer’s disease, highlights the importance of complement in regulating cell activity and
the future potential of complement-targeted therapeutics in the regulation of these disease processes
(Brennan et al. 2016). Additionally, the demonstration of complement interactions with other
signalling pathways, such as C1q and CD46 in their regulation of wnt and notch signalling
respectively (Le Friec et al. 2012; Naito et al. 2012), personifies the continuing emergence of
unexpected roles of complement, and the far-reaching potential for complement in vital physiological
and developmental processes.
Once regarded solely as an activator of innate immunity, it is now clear that the complement system
acts in an assortment of cells and tissues, performing a myriad of functions that current research has
only partially defined. With such an array of roles, it is interesting to speculate the original purpose
of such a system. Whilst studies have established C3, MASP, and factor B as the most evolutionarily
ancient components of complement, it remains to be seen whether these proteins initially emerged as
components of early immunity or as controllers of tissue morphogenesis, with immune actions
developing later. Regardless, it is evident that complement system can no longer be simply defined
as an immune cascade, but rather a multi-faceted signalling family that underpins a broad range of
fundamental cell processes in both development and adult tissues.
18
References
Abdelbaset-Ismail, A., S. Borkowska-Rzeszotek, E. Kubis, K. Bujko, K. Brzezniakiewicz-Janus, L.
Bolkun, J. Kloczko, M. Moniuszko, G. W. Basak, W. Wiktor-Jedrzejczak, and M. Z.
Ratajczak. 2016. 'Activation of the complement cascade enhances motility of leukemic cells
by downregulating expression of heme oxygenase 1 (HO-1)', Leukemia.
Agostinis, Chiara, Roberta Bulla, Claudio Tripodo, Angela Gismondi, Helena Stabile, Fleur Bossi,
Carla Guarnotta, Cecilia Garlanda, Francesco De Seta, Paola Spessotto, Angela Santoni,
Berhane Ghebrehiwet, Guillermina Girardi, and Francesco Tedesco. 2010. 'An Alternative
Role of C1q in Cell Migration and Tissue Remodeling: Contribution to Trophoblast
Invasion and Placental Development', The Journal of Immunology, 185: 4420-29.
Amara, Umme, Michael A. Flierl, Daniel Rittirsch, Andreas Klos, Hui Chen, Barbara Acker, Uwe
B. Brückner, Bo Nilsson, Florian Gebhard, John D. Lambris, and Markus Huber-Lang.
2010. 'Molecular Intercommunication between the Complement and Coagulation Systems',
The Journal of Immunology, 185: 5628-36.
Anderson, D J, A F Abbott, and R M Jack. 1993. 'The role of complement component C3b and its
receptors in sperm-oocyte interaction', Proceedings of the National Academy of Sciences,
90: 10051-55.
Arbore, G., E. E. West, R. Spolski, A. A. Robertson, A. Klos, C. Rheinheimer, P. Dutow, T. M.
Woodruff, Z. X. Yu, L. A. O'Neill, R. C. Coll, A. Sher, W. J. Leonard, J. Kohl, P. Monk, M.
A. Cooper, M. Arno, B. Afzali, H. J. Lachmann, A. P. Cope, K. D. Mayer-Barber, and C.
Kemper. 2016. 'T helper 1 immunity requires complement-driven NLRP3 inflammasome
activity in CD4(+) T cells', Science, 352: aad1210.
Astier, Anne, Marie-Claude Trescol-Biémont, Olga Azocar, Barbara Lamouille, and Chantal
Rabourdin-Combe. 2000. 'Cutting Edge: CD46, a New Costimulatory Molecule for T Cells,
That Induces p120CBL and LAT Phosphorylation', The Journal of Immunology, 164: 6091-
95.
Benard, M., E. Raoult, D. Vaudry, J. Leprince, A. Falluel-Morel, B. J. Gonzalez, L. Galas, H.
Vaudry, and M. Fontaine. 2008. 'Role of complement anaphylatoxin receptors (C3aR,
C5aR) in the development of the rat cerebellum', Mol Immunol, 45: 3767-74.
Bénard, Magalie, Bruno J. Gonzalez, Marie-Thérèse Schouft, Anthony Falluel-Morel, David
Vaudry, Philippe Chan, Hubert Vaudry, and Marc Fontaine. 2004. 'Characterization of C3a
and C5a Receptors in Rat Cerebellar Granule Neurons during Maturation:
NEUROPROTECTIVE EFFECT OF C5a AGAINST APOPTOTIC CELL DEATH',
Journal of Biological Chemistry, 279: 43487-96.
19
Benoit, Marie E., Michael X. Hernandez, Minhan L. Dinh, Francisca Benavente, Osvaldo Vasquez,
and Andrea J. Tenner. 2013. 'C1q-induced LRP1B and GPR6 Proteins Expressed Early in
Alzheimer Disease Mouse Models, Are Essential for the C1q-mediated Protection against
Amyloid-β Neurotoxicity', Journal of Biological Chemistry, 288: 654-65.
Bialas, Allison R., and Beth Stevens. 2013. 'TGF-[beta] signaling regulates neuronal C1q
expression and developmental synaptic refinement', Nat Neurosci, 16: 1773-82.
Boneschansker, Leo, Jun Yan, Elisabeth Wong, David M. Briscoe, and Daniel Irimia. 2014.
'Microfluidic platform for the quantitative analysis of leukocyte migration signatures', Nat
Commun, 5.
Bossi, Fleur, Claudio Tripodo, Lucia Rizzi, Roberta Bulla, Chiara Agostinis, Carla Guarnotta,
Carine Munaut, Gustavo Baldassarre, Giovanni Papa, Sonia Zorzet, Berhane Ghebrehiwet,
Guang Sheng Ling, Marina Botto, and Francesco Tedesco. 2014. 'C1q as a unique player in
angiogenesis with therapeutic implication in wound healing', Proceedings of the National
Academy of Sciences, 111: 4209-14.
Brennan, F. H., R. Gordon, H. W. Lao, P. J. Biggins, S. M. Taylor, R. J. Franklin, T. M. Woodruff,
and M. J. Ruitenberg. 2015. 'The Complement Receptor C5aR Controls Acute Inflammation
and Astrogliosis following Spinal Cord Injury', J Neurosci, 35: 6517-31.
Brennan, F. H., J. D. Lee, M. J. Ruitenberg, and T. M. Woodruff. 2016. 'Therapeutic targeting of
complement to modify disease course and improve outcomes in neurological conditions',
Semin Immunol.
Brennan, Faith H., Aileen J. Anderson, Stephen M. Taylor, Trent M. Woodruff, and Marc J.
Ruitenberg. 2012. 'Complement activation in the injured central nervous system: another
dual-edged sword?', Journal of Neuroinflammation, 9: 1-13.
Broders-Bondon, Florence, Perrine Paul-Gilloteaux, Elodie Gazquez, Julie Heysch, Matthieu Piel,
Roberto Mayor, John D. Lambris, and Sylvie Dufour. 2016. 'Control of the collective
migration of enteric neural crest cells by the Complement anaphylatoxin C3a and N-
cadherin', Developmental Biology, 414: 85-99.
Carmona-Fontaine, Carlos, Eric Theveneau, Apostolia Tzekou, Masazumi Tada, Mae Woods,
Karen M Page, Maddy Parsons, John D Lambris, and Roberto Mayor. 2011. 'Complement
Fragment C3a Controls Mutual Cell Attraction during Collective Cell Migration',
Developmental Cell, 21: 1026-37.
Chu, Y., X. Jin, I. Parada, A. Pesic, B. Stevens, B. Barres, and D. A. Prince. 2010. 'Enhanced
synaptic connectivity and epilepsy in C1q knockout mice', Proc Natl Acad Sci U S A, 107:
7975-80.
20
Clark, Amelia, Alexander Weymann, Eric Hartman, Yumirle Turmelle, Michael Carroll, Joshua M.
Thurman, V. Michael Holers, Dennis E. Hourcade, and David A. Rudnick. 2008. 'Evidence
for Nontraditional Activation of Complement Factor C3 during Murine Liver Regeneration',
Mol Immunol, 45: 3125-32.
Croker, D. E., P. N. Monk, R. Halai, G. Kaeslin, Z. Schofield, M. C. Wu, R. J. Clark, M. A.
Blaskovich, D. Morikis, C. A. Floudas, M. A. Cooper, and T. M. Woodruff. 2016.
'Discovery of functionally selective C5aR2 ligands: novel modulators of C5a signalling',
Immunol Cell Biol.
Cudrici, Cornelia, Florin Niculescu, Timothy Jensen, Ekaterina Zafranskaia, Matthew Fosbrink,
Violeta Rus, Moon L. Shin, and Horea Rus. 2006. 'C5b-9 Terminal Complex Protects
Oligodendrocytes from Apoptotic Cell Death by Inhibiting Caspase-8 Processing and Up-
Regulating FLIP', The Journal of Immunology, 176: 3173-80.
Daveau, Maryvonne, Magalie Benard, Michel Scotte, Marie-Therese Schouft, Martine Hiron,
Arnaud Francois, Jean-Philippe Salier, and Marc Fontaine. 2004. 'Expression of a
Functional C5a Receptor in Regenerating Hepatocytes and Its Involvement in a Proliferative
Signaling Pathway in Rat', The Journal of Immunology, 173: 3418-24.
Del Rio-Tsonis, Katia, Panagiotis A. Tsonis, Ioannis K. Zarkadis, Andreas G. Tsagas, and John D.
Lambris. 1998. 'Expression of the Third Component of Complement, C3, in Regenerating
Limb Blastema Cells of Urodeles', The Journal of Immunology, 161: 6819-24.
Denny, K. J., L. G. Coulthard, A. Jeanes, S. Lisgo, D. G. Simmons, L. K. Callaway, B.
Wlodarczyk, R. H. Finnell, T. M. Woodruff, and S. M. Taylor. 2013. 'C5a receptor signaling
prevents folate deficiency-induced neural tube defects in mice', J Immunol, 190: 3493-9.
Fosbrink, M., F. Niculescu, V. Rus, M. L. Shin, and H. Rus. 2006. 'C5b-9-induced endothelial cell
proliferation and migration are dependent on Akt inactivation of forkhead transcription
factor FOXO1', J Biol Chem, 281: 19009-18.
Ghebrehiwet, B., G. S. Habicht, and G. Beck. 1990. 'Interaction of C1q with its receptor on cultured
cell lines induces an anti-proliferative response', Clin Immunol Immunopathol, 54: 148-60.
Guo, Ren-Feng, Lei Sun, Hongwei Gao, Kevin X. Shi, Daniel Rittirsch, Vidya J. Sarma, Firas S.
Zetoune, and Peter A. Ward. 2006. 'In vivo regulation of neutrophil apoptosis by C5a during
sepsis', Journal of Leukocyte Biology, 80: 1575-83.
Hawksworth, O. A., L. G. Coulthard, S. M. Taylor, E. J. Wolvetang, and T. M. Woodruff. 2014.
'Brief report: complement C5a promotes human embryonic stem cell pluripotency in the
absence of FGF2', STEM CELLS, 32: 3278-84.
Haynes, Tracy, Agustin Luz-Madrigal, Edimara S. Reis, Nancy P. Echeverri Ruiz, Erika Grajales-
Esquivel, Apostolia Tzekou, Panagiotis A. Tsonis, John D. Lambris, and Katia Del Rio-
21
Tsonis. 2013. 'Complement anaphylatoxin C3a is a potent inducer of embryonic chick retina
regeneration', Nat Commun, 4.
Hila, S., L. Soane, and C. L. Koski. 2001. 'Sublytic C5b-9-stimulated Schwann cell survival through
PI 3-kinase-mediated phosphorylation of BAD', Glia, 36: 58-67.
Honczarenko, Marek, Mariusz Z. Ratajczak, Anne Nicholson-Weller, and Leslie E. Silberstein.
2005. 'Complement C3a Enhances CXCL12 (SDF-1)-Mediated Chemotaxis of Bone
Marrow Hematopoietic Cells Independently of C3a Receptor', The Journal of Immunology,
175: 3698-706.
Hong, Soyon, Victoria F. Beja-Glasser, Bianca M. Nfonoyim, Arnaud Frouin, Shaomin Li, Saranya
Ramakrishnan, Katherine M. Merry, Qiaoqiao Shi, Arnon Rosenthal, Ben A. Barres,
Cynthia A. Lemere, Dennis J. Selkoe, and Beth Stevens. 2016. 'Complement and microglia
mediate early synapse loss in Alzheimer mouse models', Science.
Hu, Wen-Hao, Zhe Hu, Xian Shen, Li-Yang Dong, Wei-Zhong Zhou, and Xi-Xiang Yu. 2016. 'C5a
receptor enhances hepatocellular carcinoma cell invasiveness via activating ERK1/2-
mediated epithelial–mesenchymal transition', Experimental and Molecular Pathology, 100:
101-08.
Huber-Lang, M., J. V. Sarma, F. S. Zetoune, D. Rittirsch, T. A. Neff, S. R. McGuire, J. D. Lambris,
R. L. Warner, M. A. Flierl, L. M. Hoesel, F. Gebhard, J. G. Younger, S. M. Drouin, R. A.
Wetsel, and P. A. Ward. 2006. 'Generation of C5a in the absence of C3: a new complement
activation pathway', Nat Med, 12: 682-7.
Ingram, G., S. Hakobyan, N. P. Robertson, and B. P. Morgan. 2009. 'Complement in multiple
sclerosis: its role in disease and potential as a biomarker', Clin Exp Immunol, 155: 128-39.
Jeanes, A., L. G. Coulthard, S. Mantovani, K. Markham, and T. M. Woodruff. 2015. 'Co-ordinated
expression of innate immune molecules during mouse neurulation', Mol Immunol, 68: 253-
60.
Kimura, Yuko, Mayur Madhavan, Mindy K. Call, William Santiago, Panagiotis A. Tsonis, John D.
Lambris, and Katia Del Rio-Tsonis. 2003. 'Expression of Complement 3 and Complement 5
in Newt Limb and Lens Regeneration', The Journal of Immunology, 170: 2331-39.
Kurihara, Ryuji, Kunihiro Yamaoka, Norifumi Sawamukai, Shohei Shimajiri, Koichi Oshita,
Sonosuke Yukawa, Mikiko Tokunaga, Shigeru Iwata, Kazuyoshi Saito, Kenji Chiba, and
Yoshiya Tanaka. 2010. 'C5a promotes migration, proliferation, and vessel formation in
endothelial cells', Inflammation Research, 59: 659-66.
Lara-Astiaso, David, Alberto Izarra, Juan Camilo Estrada, Carmen Albo, Isabel Moscoso, Enrique
Samper, Javier Moncayo, Abelardo Solano, Antonio Bernad, and Antonio Díez-Juan. 2012.
'Complement anaphylatoxins C3a and C5a induce a failing regenerative program in cardiac
22
resident cells. Evidence of a role for cardiac resident stem cells other than cardiomyocyte
renewal', SpringerPlus, 1: 1-15.
Le Friec, Gaëlle, Devon Sheppard, Pat Whiteman, Christian M. Karsten, Salley Al-Tilib Shamoun,
Adam Laing, Laurence Bugeon, Margaret J. Dallman, Teresa Melchionna, Chandramouli
Chillakuri, Richard A. Smith, Christian Drouet, Lionel Couzi, Veronique Fremeaux-Bacchi,
Jörg Köhl, Simon N. Waddington, James M. McDonnell, Alastair Baker, Penny A.
Handford, Susan M. Lea, and Claudia Kemper. 2012. 'The CD46 and Jagged1 interaction is
critical for human T helper 1 immunity', Nature immunology, 13: 1213-21.
Lee, H. M., W. Wu, M. Wysoczynski, R. Liu, E. K. Zuba-Surma, M. Kucia, J. Ratajczak, and M. Z.
Ratajczak. 2009. 'Impaired mobilization of hematopoietic stem/progenitor cells in C5-
deficient mice supports the pivotal involvement of innate immunity in this process and
reveals novel promobilization effects of granulocytes', Leukemia, 23: 2052-62.
Maeda, Y., Y. Kawano, Y. Wada, J. Yatsuda, T. Motoshima, Y. Murakami, K. Kikuchi, T.
Imamura, and M. Eto. 2015. 'C5aR is frequently expressed in metastatic renal cell
carcinoma and plays a crucial role in cell invasion via the ERK and PI3 kinase pathways',
Oncol Rep, 33: 1844-50.
Marder, S. R., D. E. Chenoweth, I. M. Goldstein, and H. D. Perez. 1985. 'Chemotactic responses of
human peripheral blood monocytes to the complement-derived peptides C5a and C5a des
Arg', J Immunol, 134: 3325-31.
Markiewski, M. M., R. A. DeAngelis, C. W. Strey, P. G. Foukas, C. Gerard, N. Gerard, R. A.
Wetsel, and J. D. Lambris. 2009. 'The regulation of liver cell survival by complement', J
Immunol, 182: 5412-8.
Mastellos, D., J. C. Papadimitriou, S. Franchini, P. A. Tsonis, and J. D. Lambris. 2001. 'A novel
role of complement: mice deficient in the fifth component of complement (C5) exhibit
impaired liver regeneration', J Immunol, 166: 2479-86.
Merle, Nicolas, Sarah Elizabeth Church, Veronique Fremeaux-Bacchi, and Lubka T. Roumenina.
2015a. 'Complement system part I - molecular mechanisms of activation and regulation',
Frontiers in Immunology, 6.
Merle, Nicolas S., Remi Noe, Lise Halbwachs-Mecarelli1, Veronique Fremeaux-Bacchi, and Lubka
T. Roumenina. 2015b. 'Complement system part II: role in immunity', Frontiers in
Immunology, 6.
Mueller-Ortiz, Stacey L., John E. Morales, and Rick A. Wetsel. 2014. 'The Receptor for the
Complement C3a Anaphylatoxin (C3aR) Provides Host Protection against Listeria
monocytogenes–Induced Apoptosis', The Journal of Immunology, 193: 1278-89.
23
Mukherjee, Piali, Sunil Thomas, and Giulio Maria Pasinetti. 2008. 'Complement anaphylatoxin C5a
neuroprotects through regulation of glutamate receptor subunit 2 in vitro and in vivo',
Journal of Neuroinflammation, 5: 1-7.
Nabizadeh, J. A., H. D. Manthey, F. J. Steyn, W. Chen, A. Widiapradja, F. N. Md Akhir, G. M.
Boyle, S. M. Taylor, T. M. Woodruff, and B. E. Rolfe. 2016. 'The Complement C3a
Receptor Contributes to Melanoma Tumorigenesis by Inhibiting Neutrophil and CD4+ T
Cell Responses', J Immunol, 196: 4783-92.
Naito, Atsuhiko T, Tomokazu Sumida, Seitaro Nomura, Mei-Lan Liu, Tomoaki Higo, Akito
Nakagawa, Katsuki Okada, Taku Sakai, Akihito Hashimoto, Yurina Hara, Ippei Shimizu,
Weidong Zhu, Haruhiro Toko, Akemi Katada, Hiroshi Akazawa, Toru Oka, Jong-Kook Lee,
Tohru Minamino, Toshio Nagai, Kenneth Walsh, Akira Kikuchi, Misako Matsumoto,
Marina Botto, Ichiro Shiojima, and Issei Komuro. 2012. 'Complement C1q Activates
Canonical Wnt Signaling and Promotes Aging-Related Phenotypes', Cell, 149: 1298-313.
Niculescu, F, H Rus, T van Biesen, and M L Shin. 1997. 'Activation of Ras and mitogen-activated
protein kinase pathway by terminal complement complexes is G protein dependent', The
Journal of Immunology, 158: 4405-12.
Niculescu, F., T. Badea, and H. Rus. 1999. 'Sublytic C5b-9 induces proliferation of human aortic
smooth muscle cells: role of mitogen activated protein kinase and phosphatidylinositol 3-
kinase', Atherosclerosis, 142: 47-56.
Niculescu, Teodora, Susanna Weerth, Florin Niculescu, Cornelia Cudrici, Violeta Rus, Cedric S.
Raine, Moon L. Shin, and Horea Rus. 2004. 'Effects of Complement C5 on Apoptosis in
Experimental Autoimmune Encephalomyelitis', The Journal of Immunology, 172: 5702-06.
Nitta, Hidetoshi, Yoshihiro Wada, Yoshiaki Kawano, Yoji Murakami, Atsushi Irie, Keisuke
Taniguchi, Ken Kikuchi, Gen Yamada, Kentaro Suzuki, Jiro Honda, Masayo Wilson-
Morifuji, Norie Araki, Masatoshi Eto, Hideo Baba, and Takahisa Imamura. 2013.
'Enhancement of Human Cancer Cell Motility and Invasiveness by Anaphylatoxin C5a via
Aberrantly Expressed C5a Receptor (CD88)', Clinical Cancer Research, 19: 2004-13.
Nonaka, M., and A. Kimura. 2006. 'Genomic view of the evolution of the complement system',
Immunogenetics, 58: 701-13.
Pavlovski, Dale, John Thundyil, Peter N. Monk, Rick A. Wetsel, Stephen M. Taylor, and Trent M.
Woodruff. 2012. 'Generation of complement component C5a by ischemic neurons promotes
neuronal apoptosis', The FASEB Journal, 26: 3680-90.
Perez-Alcazar, M., J. Daborg, A. Stokowska, P. Wasling, A. Bjorefeldt, M. Kalm, H. Zetterberg, K.
E. Carlstrom, K. Blomgren, C. T. Ekdahl, E. Hanse, and M. Pekna. 2014. 'Altered cognitive
24
performance and synaptic function in the hippocampus of mice lacking C3', Exp Neurol,
253: 154-64.
Perianayagam, M. C., V. S. Balakrishnan, B. J. Pereira, and B. L. Jaber. 2004. 'C5a delays apoptosis
of human neutrophils via an extracellular signal-regulated kinase and Bad-mediated
signalling pathway', Eur J Clin Invest, 34: 50-6.
Perl, M., S. Denk, M. Kalbitz, and M. Huber-Lang. 2012. 'Granzyme B: a new crossroad of
complement and apoptosis', Adv Exp Med Biol, 946: 135-46.
Peterson, Sheri L., Hal X. Nguyen, Oscar A. Mendez, and Aileen J. Anderson. 2015. 'Complement
Protein C1q Modulates Neurite Outgrowth In Vitro and Spinal Cord Axon Regeneration In
Vivo', The Journal of Neuroscience, 35: 4332-49.
Pisalyaput, Karntipa, and Andrea J. Tenner. 2008. 'Complement component C1q inhibits β-
amyloid- and serum amyloid P-induced neurotoxicity via caspase- and calpain-independent
mechanisms', Journal of Neurochemistry, 104: 696-707.
Qiu, Wen, Yan Zhang, Xiaomei Liu, Jianbo Zhou, Yan Li, Ying Zhou, Kai Shan, Mei Xia, Nan
Che, Xuefeng Feng, Dan Zhao, and Yingwei Wang. 2012. 'Sublytic C5b-9 complexes
induce proliferative changes of glomerular mesangial cells in rat Thy-1 nephritis through
TRAF6-mediated PI3K-dependent Akt1 activation', The Journal of Pathology, 226: 619-32.
Rahpeymai, Y., M. A. Hietala, U. Wilhelmsson, A. Fotheringham, I. Davies, A. K. Nilsson, J.
Zwirner, R. A. Wetsel, C. Gerard, M. Pekny, and M. Pekna. 2006. 'Complement: a novel
factor in basal and ischemia-induced neurogenesis', EMBO J, 25.
Ratajczak, J., R. Reca, M. Kucia, M. Majka, D. J. Allendorf, J. T. Baran, A. Janowska-Wieczorek,
R. A. Wetsel, G. D. Ross, and M. Z. Ratajczak. 2004. 'Mobilization studies in mice deficient
in either C3 or C3a receptor (C3aR) reveal a novel role for complement in retention of
hematopoietic stem/progenitor cells in bone marrow', Blood, 103.
Reca, Ryan, Dimitrios Mastellos, Marcin Majka, Leah Marquez, Janina Ratajczak, Silvia Franchini,
Aleksandra Glodek, Marek Honczarenko, Lynn A. Spruce, Anna Janowska-Wieczorek, John
D. Lambris, and Mariusz Z. Ratajczak. 2003. 'Functional receptor for C3a anaphylatoxin is
expressed by normal hematopoietic stem/progenitor cells, and C3a enhances their homing-
related responses to SDF-1', Blood, 101: 3784-93.
Riley-Vargas, Rebecca C., Susan Lanzendorf, and John P. Atkinson. 'Targeted and restricted
complement activation on acrosome-reacted spermatozoa', The Journal of Clinical
Investigation, 115: 1241-49.
Riley, R. C., C. Kemper, M. Leung, and J. P. Atkinson. 2002a. 'Characterization of human
membrane cofactor protein (MCP; CD46) on spermatozoa', Mol Reprod Dev, 62: 534-46.
25
Riley, R. C., P. L. Tannenbaum, D. H. Abbott, and J. P. Atkinson. 2002b. 'Cutting edge: inhibiting
measles virus infection but promoting reproduction: an explanation for splicing and tissue-
specific expression of CD46', J Immunol, 169: 5405-9.
Rooryck, Caroline, Anna Diaz-Font, Daniel P. S. Osborn, Elyes Chabchoub, Victor Hernandez-
Hernandez, Hanan Shamseldin, Joanna Kenny, Aoife Waters, Dagan Jenkins, Ali Al Kaissi,
Gabriela F. Leal, Bruno Dallapiccola, Franco Carnevale, Maria Bitner-Glindzicz, Melissa
Lees, Raoul Hennekam, Philip Stanier, Alan J. Burns, Hilde Peeters, Fowzan S. Alkuraya,
and Philip L. Beales. 2011. 'Mutations in lectin complement pathway genes COLEC11 and
MASP1 cause 3MC syndrome', Nat Genet, 43: 197-203.
Rus, H. G., F. Niculescu, and M. L. Shin. 1996. 'Sublytic complement attack induces cell cycle in
oligodendrocytes', J Immunol, 156: 4892-900.
Schafer, Dorothy P, Emily K Lehrman, Amanda G Kautzman, Ryuta Koyama, Alan R Mardinly,
Ryo Yamasaki, Richard M Ransohoff, Michael E Greenberg, Ben A Barres, and Beth
Stevens. 2012. 'Microglia Sculpt Postnatal Neural Circuits in an Activity and Complement-
Dependent Manner', Neuron, 74: 691-705.
Schraufstatter, I. U., R. G. Discipio, M. Zhao, and S. K. Khaldoyanidi. 2009. 'C3a and C5a are
chemotactic factors for human mesenchymal stem cells, which cause prolonged ERK1/2
phosphorylation', J Immunol, 182.
Sekar, Aswin, Allison R. Bialas, Heather de Rivera, Avery Davis, Timothy R. Hammond, Nolan
Kamitaki, Katherine Tooley, Jessy Presumey, Matthew Baum, Vanessa Van Doren, Giulio
Genovese, Samuel A. Rose, Robert E. Handsaker, Consortium Schizophrenia Working
Group of the Psychiatric Genomics, Mark J. Daly, Michael C. Carroll, Beth Stevens, and
Steven A. McCarroll. 2016. 'Schizophrenia risk from complex variation of complement
component 4', Nature, 530: 177-83.
Shi, Q., K. J. Colodner, S. B. Matousek, K. Merry, S. Hong, J. E. Kenison, J. L. Frost, K. X. Le, S.
Li, J. C. Dodart, B. J. Caldarone, B. Stevens, and C. A. Lemere. 2015. 'Complement C3-
Deficient Mice Fail to Display Age-Related Hippocampal Decline', J Neurosci, 35: 13029-
42.
Shinjyo, N., Y. de Pablo, M. Pekny, and M. Pekna. 2016. 'Complement Peptide C3a Promotes
Astrocyte Survival in Response to Ischemic Stress', Mol Neurobiol, 53: 3076-87.
Shinjyo, Noriko, Anders Ståhlberg, Mike Dragunow, Milos Pekny, and Marcela Pekna. 2009.
'Complement-Derived Anaphylatoxin C3a Regulates In Vitro Differentiation and Migration
of Neural Progenitor Cells', STEM CELLS, 27: 2824-32.
Soane, Lucian, Hyun-Jun Cho, Florin Niculescu, Horea Rus, and Moon L. Shin. 2001. 'C5b-9
Terminal Complement Complex Protects Oligodendrocytes from Death by Regulating Bad
26
Through Phosphatidylinositol 3-Kinase/Akt Pathway', The Journal of Immunology, 167:
2305-11.
Stephan, Alexander H., Daniel V. Madison, José María Mateos, Deborah A. Fraser, Emilie A.
Lovelett, Laurence Coutellier, Leo Kim, Hui-Hsin Tsai, Eric J. Huang, David H. Rowitch,
Dominic S. Berns, Andrea J. Tenner, Mehrdad Shamloo, and Ben A. Barres. 2013. 'A
Dramatic Increase of C1q Protein in the CNS during Normal Aging', The Journal of
Neuroscience, 33: 13460-74.
Stevens, Beth, Nicola J. Allen, Luis E. Vazquez, Gareth R. Howell, Karen S. Christopherson, Navid
Nouri, Kristina D. Micheva, Adrienne K. Mehalow, Andrew D. Huberman, Benjamin
Stafford, Alexander Sher, Alan M Litke, John D. Lambris, Stephen J. Smith, Simon W. M.
John, and Ben A. Barres. 2007. 'The Classical Complement Cascade Mediates CNS Synapse
Elimination', Cell, 131: 1164-78.
Strey, C. W., M. Markiewski, D. Mastellos, R. Tudoran, L. A. Spruce, L. E. Greenbaum, and J. D.
Lambris. 2003. 'The proinflammatory mediators C3a and C5a are essential for liver
regeneration', J Exp Med, 198.
Szabo, A., I. Cobo, S. Omara, S. McLachlan, R. Keller, and R. Mayor. 2016. 'The Molecular Basis
of Radial Intercalation during Tissue Spreading in Early Development', Dev Cell, 37: 213-
25.
Tan, David W. M., Kim B. Jensen, Matthew W. B. Trotter, John T. Connelly, Simon Broad, and
Fiona M. Watt. 2013. 'Single-cell gene expression profiling reveals functional heterogeneity
of undifferentiated human epidermal cells', Development, 140: 1433-44.
Taylor, C.T., M.M. Biljan, C.R. Kingsland, and P.M. Johnson. 1994. 'Inhibition of human
spermatozoon—oocyte interaction in vitro by monoclonal antibodies to CD46 (membrane
cofactor protein)', Human Reproduction, 9: 907-11.
Ten, Vadim S., Sergei A. Sosunov, Sean P. Mazer, Raymond I. Stark, Casper Caspersen, Michael
E. Sughrue, Marina Botto, E. Sander Connolly, and David J. Pinsky. 2005. 'C1q-Deficiency
Is Neuroprotective Against Hypoxic-Ischemic Brain Injury in Neonatal Mice', Stroke, 36:
2244-50.
van Beek, J., O. Nicole, C. Ali, A. Ischenko, E. T. MacKenzie, A. Buisson, and M. Fontaine. 2001.
'Complement anaphylatoxin C3a is selectively protective against NMDA-induced neuronal
cell death', Neuroreport, 12: 289-93.
Williams, Pete A., James R. Tribble, Keating W. Pepper, Stephen D. Cross, B. Paul Morgan, James
E. Morgan, Simon W. M. John, and Gareth R. Howell. 2016. 'Inhibition of the classical
pathway of the complement cascade prevents early dendritic and synaptic degeneration in
glaucoma', Molecular Neurodegeneration, 11: 1-13.
27
Woodruff, T. M., K. J. Costantini, J. W. Crane, J. D. Atkin, P. N. Monk, S. M. Taylor, and P. G.
Noakes. 2008. 'The complement factor C5a contributes to pathology in a rat model of
amyotrophic lateral sclerosis', J Immunol, 181: 8727-34.
Woodruff, Trent M., James W. Crane, Lavinia M. Proctor, Kathryn M. Buller, Annie B. Shek, Kurt
de Vos, Sandra Pollitt, Hua M. Williams, Ian A. Shiels, Peter N. Monk, and Stephen M.
Taylor. 2006. 'Therapeutic activity of C5a receptor antagonists in a rat model of
neurodegeneration', The FASEB Journal, 20: 1407-17.
Wu, M. C., F. H. Brennan, J. P. Lynch, S. Mantovani, S. Phipps, R. A. Wetsel, M. J. Ruitenberg, S.
M. Taylor, and T. M. Woodruff. 2013. 'The receptor for complement component C3a
mediates protection from intestinal ischemia-reperfusion injuries by inhibiting neutrophil
mobilization', Proc Natl Acad Sci U S A, 110: 9439-44.
Wysoczynski, M., R. Reca, H. Lee, W. Wu, J. Ratajczak, and M. Z. Ratajczak. 2009. 'Defective
engraftment of C3aR-/- hematopoietic stem progenitor cells shows a novel role of the C3a-
C3aR axis in bone marrow homing', Leukemia, 23: 1455-61.
Zipfel, Peter F., and Christine Skerka. 2009. 'Complement regulators and inhibitory proteins', Nat
Rev Immunol, 9: 729-40.
Zwaka, Thomas P., Jan Torzewski, Andreas Hoeflich, Marion Déjosez, Steffen Kaiser, Vinzenz
Hombach, and Peter M. Jehle. 2003. 'The terminal complement complex inhibits apoptosis
in vascular smooth muscle cells by activating an autocrine IGF-1 loop', The FASEB Journal.
28
1.3 C5aR1
C5aR1 lies at the heart of the canonical complement mediated response, with novel functions of
C5aR1 signalling also reported in non-immune cells in areas such as regeneration to neuronal survival
(Hawksworth et al. 2016). This thesis is focussed on this pivotal complement receptor, and the
exploration of novel roles of C5a/C5aR1 signalling.
Signalling
C5aR1 is a classical G-protein coupled seven-transmembrane domain receptor. The endogenous
ligand for C5aR1, C5a, interacts with C5aR1 via a two-site model, with biding of both the C5aR1 N-
terminus and transmembrane domains required for receptor activation (Monk et al. 2007).
Following ligand binding and receptor activation, C5aR1 has been demonstrated to couple to Gi/o or
Gq proteins to elicit cell-specific second messenger signalling cascades. This includes mitogen-
activated protein kinase (MAPK), phosphatidylinositol 3 kinase (PI3K), protein kinase C (PKC) and
nuclear factor kappa-light-chain-enhancer of activated B cells (NFkB) signalling pathways
(Monsinjon et al. 2003; Sayah et al. 2003; Monk et al. 2007).
Ligands
A number of ligands for C5aR1 have been reported, with the main endogenous ligand, C5a,
demonstrated to activate C5aR1 with nanomolar potency (Fig 1.3.1). A number of other endogenous
ligands have been reported to have affinity for C5aR1. This includes the C5a metabolite, C5a desArg
which can activate C5aR1, albeit at a 10-100 fold reduced potency (Monk et al. 2007). In addition,
the ribosomal protein S19 and bacterial chaperone Skp have both been reported to bind to C5aR1
(Nishiura et al. 1996; Shrestha et al. 2004).
A number of synthetic C5aR1 agonists have been reported in the literature, which may offer
advantages in terms of stability and cost. However, to date, these agonists lack specificity for C5a
receptors. For example, the best reported peptide, YSFKPMPLaR (EP54), functionally binds both
C5aR1 and C3aR1 (Finch et al. 1997; Scully et al. 2010). Whilst presenting a significant cost
advantage, the lack of specificity of synthetic ligands such as EP54 restricted their selection for use
in this thesis, with commercially available C5a isolated from human donors preferred for
interrogation of C5aR1 function.
29
Greater success has been seen in the development of selective antagonists of C5aR1. A number of
C5aR1 antagonists are now available for research across a number of classes including antibody
inhibitors, peptides, and non-peptidic small molecules (Hawksworth et al. 2017). The available
C5aR1 antagonists, and their use in clinical research, is reviewed in further detail in section 1.4 of
this thesis. Of the available inhibitors, the peptide antagonist, PMX53 (3D53), was selected for use
in this thesis. A specific non-competitive inhibitor of C5aR1, PMX53 remains the most widely
utilised C5aR1 antagonist in preclinical research and is ideal for the in vitro experiments performed
in this thesis.
Figure 1.3.1 Dose response curves for human C5a and PMX53. Data was obtained using calcium
flux analysis of matured U937 cells. A) Response to varied concentrations of C5a. B) Response of
U937 cells to 1 nM C5a following pre-treatment with varied concentrations of the C5aR1 receptor
antagonist, PMX53. Unpublished Data, Owen Hawksworth.
Function
Whilst C5aR1 is now accepted to have diverse functions across a number of systems, the classical
understanding of C5aR1 function is derived from its role in the innate immune response. C5aR1 is
expressed on all leukocytes of the myeloid lineage, co-ordinating their response to tissue injury and
pathogens (Marder et al. 1985; Merle et al. 2015). Broadly, C5aR1 receptor signalling in both immune
lo g [C 5 a ]
No
rma
lise
d R
es
po
ns
e
- 14
-12
-10 -8 -6
0
5 0
1 0 0
lo g [P M X 5 3 ]
-10 -8 -6 -4
0
5 0
1 0 0
A B
30
and non-immune cells has been shown regulate a number of cellular functions including migration,
survival, and effector response (Hawksworth et al. 2016). In neutrophils, C5aR1 signalling has a
bimodal effect, dependent on C5a concentration (Ehrengruber et al. 1994; Boneschansker et al. 2014).
At lower concentrations C5aR1 receptor activation promotes neutrophil chemotaxis, whilst higher
concentrations promote degranulation of neutrophils. Additionally, under normal conditions,
circulating neutrophils undergo spontaneous apoptosis, an effect which is perturbed by C5aR1
signalling to enhance the immunological efficacy of neutrophils (Perianayagam et al. 2004). C5aR1
signalling also promotes degranulation of other myeloid cells, including mast cells and basophils, and
chemotaxis of macrophage cells (Fureder et al. 1995; Haviland et al. 1995; Huber-Lang et al. 2003;
Heimbach et al. 2011).
Of particular interest to this thesis are the non-immune actions of C5aR1 in the central nervous system
(CNS), where a number of functions have been reported. This includes C5aR1 signalling driving
proliferation of immature cerebellar granule neurons (Benard et al. 2004) and astrocytes (Brennan et
al. 2015), and reports of both pro- and anti- apoptotic effects in cortical neurons under physiological
conditions (Benard et al. 2004; Mukherjee et al. 2008; Pavlovski et al. 2012; Hernandez et al. 2017).
The functions of C5aR1 signalling in non-immune cells are discussed further in section 1.2 of this
thesis.
31
References
Benard, M., B. J. Gonzalez, M. T. Schouft, A. Falluel-Morel, D. Vaudry, P. Chan, H. Vaudry, and
M. Fontaine. 2004. 'Characterization of C3a and C5a receptors in rat cerebellar granule
neurons during maturation. Neuroprotective effect of C5a against apoptotic cell death', J Biol
Chem, 279.
Boneschansker, Leo, Jun Yan, Elisabeth Wong, David M. Briscoe, and Daniel Irimia. 2014.
'Microfluidic platform for the quantitative analysis of leukocyte migration signatures', Nat
Commun, 5.
Brennan, F. H., R. Gordon, H. W. Lao, P. J. Biggins, S. M. Taylor, R. J. Franklin, T. M. Woodruff,
and M. J. Ruitenberg. 2015. 'The Complement Receptor C5aR Controls Acute Inflammation
and Astrogliosis following Spinal Cord Injury', J Neurosci, 35: 6517-31.
Ehrengruber, M. U., T. Geiser, and D. A. Deranleau. 1994. 'Activation of human neutrophils by C3a
and C5A. Comparison of the effects on shape changes, chemotaxis, secretion, and respiratory
burst', FEBS Lett, 346: 181-4.
Finch, A. M., S. M. Vogen, S. A. Sherman, L. Kirnarsky, S. M. Taylor, and S. D. Sanderson. 1997.
'Biologically active conformer of the effector region of human C5a and modulatory effects of
N-terminal receptor binding determinants on activity', J Med Chem, 40: 877-84.
Fureder, W., H. Agis, M. Willheim, H. C. Bankl, U. Maier, K. Kishi, M. R. Muller, K. Czerwenka,
T. Radaszkiewicz, J. H. Butterfield, G. W. Klappacher, W. R. Sperr, M. Oppermann, K.
Lechner, and P. Valent. 1995. 'Differential expression of complement receptors on human
basophils and mast cells. Evidence for mast cell heterogeneity and CD88/C5aR expression on
skin mast cells', J Immunol, 155: 3152-60.
Haviland, D. L., R. L. McCoy, W. T. Whitehead, H. Akama, E. P. Molmenti, A. Brown, J. C.
Haviland, W. C. Parks, D. H. Perlmutter, and R. A. Wetsel. 1995. 'Cellular expression of the
C5a anaphylatoxin receptor (C5aR): demonstration of C5aR on nonmyeloid cells of the liver
and lung', J Immunol, 154: 1861-9.
Hawksworth, Owen A., Liam G. Coulthard, and Trent M. Woodruff. 2016. 'Complement in the
fundamental processes of the cell', Mol Immunol.
Hawksworth, Owen A., Xaria X. Li, Liam G. Coulthard, Ernst J. Wolvetang, and Trent M. Woodruff.
2017. 'New concepts on the therapeutic control of complement anaphylatoxin receptors', Mol
Immunol.
Heimbach, L., Z. Li, P. Berkowitz, M. Zhao, N. Li, D. S. Rubenstein, L. A. Diaz, and Z. Liu. 2011.
'The C5a receptor on mast cells is critical for the autoimmune skin-blistering disease bullous
pemphigoid', J Biol Chem, 286: 15003-9.
32
Hernandez, M. X., P. Namiranian, E. Nguyen, M. I. Fonseca, and A. J. Tenner. 2017. 'C5a Increases
the Injury to Primary Neurons Elicited by Fibrillar Amyloid Beta', ASN Neuro, 9:
1759091416687871.
Huber-Lang, M. S., J. V. Sarma, S. R. McGuire, K. T. Lu, V. A. Padgaonkar, E. M. Younkin, R. F.
Guo, C. H. Weber, E. R. Zuiderweg, F. S. Zetoune, and P. A. Ward. 2003. 'Structure-function
relationships of human C5a and C5aR', J Immunol, 170: 6115-24.
Marder, S. R., D. E. Chenoweth, I. M. Goldstein, and H. D. Perez. 1985. 'Chemotactic responses of
human peripheral blood monocytes to the complement-derived peptides C5a and C5a des
Arg', J Immunol, 134: 3325-31.
Merle, Nicolas S., Remi Noe, Lise Halbwachs-Mecarelli1, Veronique Fremeaux-Bacchi, and Lubka
T. Roumenina. 2015. 'Complement system part II: role in immunity', Frontiers in
Immunology, 6.
Monk, P. N., A. M. Scola, P. Madala, and D. P. Fairlie. 2007. 'Function, structure and therapeutic
potential of complement C5a receptors', British Journal of Pharmacology, 152: 429-48.
Monsinjon, T., P. Gasque, P. Chan, A. Ischenko, J. J. Brady, and M. C. Fontaine. 2003. 'Regulation
by complement C3a and C5a anaphylatoxins of cytokine production in human umbilical vein
endothelial cells', FASEB J, 17.
Mukherjee, Piali, Sunil Thomas, and Giulio Maria Pasinetti. 2008. 'Complement anaphylatoxin C5a
neuroprotects through regulation of glutamate receptor subunit 2 in vitro and in vivo', Journal
of Neuroinflammation, 5: 1-7.
Nishiura, H., Y. Shibuya, S. Matsubara, S. Tanase, T. Kambara, and T. Yamamoto. 1996. 'Monocyte
chemotactic factor in rheumatoid arthritis synovial tissue. Probably a cross-linked derivative
of S19 ribosomal protein', J Biol Chem, 271: 878-82.
Pavlovski, Dale, John Thundyil, Peter N. Monk, Rick A. Wetsel, Stephen M. Taylor, and Trent M.
Woodruff. 2012. 'Generation of complement component C5a by ischemic neurons promotes
neuronal apoptosis', The FASEB Journal, 26: 3680-90.
Perianayagam, M. C., V. S. Balakrishnan, B. J. Pereira, and B. L. Jaber. 2004. 'C5a delays apoptosis
of human neutrophils via an extracellular signal-regulated kinase and Bad-mediated signalling
pathway', Eur J Clin Invest, 34: 50-6.
Sayah, S., A.C. Jauneau, C. Patte, M.C. Tonon, H. Vaudry, and M. Fontaine. 2003. 'Two different
transduction pathways are activated by C3a and C5a anaphylatoxins on astrocytes', Mol.
Brain. Res., 112: 53-60.
Scully, C. C., J. S. Blakeney, R. Singh, H. N. Hoang, G. Abbenante, R. C. Reid, and D. P. Fairlie.
2010. 'Selective hexapeptide agonists and antagonists for human complement C3a receptor',
J Med Chem, 53: 4938-48.
33
Shrestha, A., L. Shi, S. Tanase, M. Tsukamoto, N. Nishino, K. Tokita, and T. Yamamoto. 2004.
'Bacterial chaperone protein, Skp, induces leukocyte chemotaxis via C5a receptor', Am J
Pathol, 164: 763-72.
34
1.4 Pharmacological Modulators of Anaphylatoxin Signaling
New concepts on the therapeutic control of complement anaphylatoxin
receptors
Owen A. Hawksworth1,2, Xaria X. Li1, Ernst J. Wolvetang2, Trent M. Woodruff1
Affiliations: 1School of Biomedical Sciences, The University of Queensland, St. Lucia, Australia 2Australian Institute of Bioengineering and Nanotechnology, University of Queensland, St. Lucia, Australia
Published in Molecular Immunology
35
Abstract
The complement system is a pivotal driver of innate immunity, co-ordinating the host response to
protect against pathogens. At the heart of the complement response lie the active fragments, C3a and
C5a, acting through their specific receptors, C3aR, C5aR1, and C5aR2, to direct immune cells. Their
potent function however, places them at risk of damaging the host, with aberrant C3a and C5a
signalling activity linked to a wide range of disorders of inflammatory, autoimmune, and
neurodegenerative aetiologies. As such, the therapeutic control of these receptors represents an
attractive drug target, however, the realisation of this clinical potential remains limited. With the
success of eculizumab, and the progression of a number novel C5a-C5aR1 targeted drugs to phase II
and III clinical trials, there is great promise for complement therapeutics in future clinical practice.
In contrast, the toolbox of drugs available to modulate C3aR and C5aR2 signalling remains limited,
however, the emergence of new selective ligands and molecular tools, and an increased understanding
of the function of these receptors in disease, has highlighted their unique potential for clinical
applications. This review provides an update on the growing arsenal of drugs now available to target
C5, and C5a and C3a receptor signalling, and their utility in both clinical and pre-clinical
development.
.
36
Introduction
From its first description at the end of the 19th century as a single heat-labile effector of antibody-
mediated immunity, knowledge of complement has expanded to reveal a complex and vital family of
proteins, capable of controlling the innate immune response through activation and recruitment of
immune cells, tagging of pathogens for destruction, and the direct lysis of bacterial pathogens
(Kaufmann 2008; Nesargikar, Spiller, and Chavez 2012). The complement system achieves its
function through a number of activating pathways with different triggering mechanisms. This
includes the traditional C1 antibody-antigen complex of the classical pathway, spontaneous C3
hydrolysis of the alternative pathway, or recognition of damaged or pathogenic surfaces through the
lectin pathway; as well as more recently acknowledged extrinsic and intracellular activating
mechanisms (Hawksworth, Coulthard, and Woodruff 2016). These pathways converge to cleave the
central complement factors C3 and C5 to their respective active fragments, C3a and C3b, and C5a
and C5b. These fragments represent the core effector components of the complement response. C3b
covalently binds target cells to instruct phagocytosis and also initiate C5 cleavage, whilst C5b is
capable of directing the formation of the membrane attack complex (MAC) to directly lyse target
cells. The fragments C3a and C5a, traditionally described as anaphylatoxins, but perhaps more
usefully termed inflammatory modulators (Coulthard and Woodruff 2015), exert their effects through
activation of specific receptors, C3aR, C5aR1, and C5aR2. Capable of activating and recruiting
immune cells to sites of inflammation, the powerful function of these receptors as drivers of innate
immunity, also implicates them in the progression of a wide and ever expanding number of disorders
with underlying inflammatory aetiologies.
A significant body of research has ascribed aberrant anaphylatoxin receptor activity, particularly
C5aR1, in driving the pathology of autoimmune, neurodegenerative, and inflammatory conditions
(Morgan and Harris 2015; Brennan et al. 2016). As such, it is unsurprising that there has been great
interest in the therapeutic targeting of anaphylatoxin receptors (Woodruff, Nandakumar, and Tedesco
2011). Despite promising efforts, decades of clinical trials have shown little success for C5aR1-
targeted therapeutics (Morgan and Harris 2015). However, the increased understanding of
complement mutations underlying human pathologies, and the clinical success of the C5-targeted
therapeutic, eculizumab, has only served to increase interest in the study of anaphylatoxin receptor
inhibition. Newer therapeutics targeting the C5a-C5aR1 signalling axis are now entering phase II and
III clinical trials, whilst new preclinical drug development and disease modelling has strengthened
the viability for modulation of C3aR and C5aR2 as a novel therapeutic approach. This review
provides an update on the current landscape of anaphylatoxin targeted therapeutics in both clinical
and preclinical development.
37
Figure 1.4.1: The complement cascade and drugs available for targeting terminal complement receptor signalling.
A number of therapeutics are available for the inhibition of complement anaphylatoxin receptors. Displayed are those
approved for clinical use (silver), in current clinical trials (orange), or available for preclinical research and development
(purple).
38
Inhibitors of C5/C5a
Given the potent inflammatory potential of complement activation, therapeutic targeting of
complement holds great promise for the future treatment of a number of autoimmune and
inflammatory diseases. To date however, the current suite of clinically available specific terminal
complement therapeutics remains limited to just one, the C5 inhibitor, eculizumab, the ‘poster child’
of complement therapeutics. First approved for use in 2007, this humanised monoclonal antibody is
capable of binding C5, preventing its cleavage and formation of C5a and C5b proteins, and
subsequent MAC formation (Rother et al. 2007). Clinically, eculizumab has had great success as the
only disease-modifying treatment for paroxysmal nocturnal hemoglobinuria (PNH) and atypical
haemolytic uremic syndrome (aHUS), with a dramatic effect seen in improving patient morbidity and
mortality. The success of eculizumab in treatment of these diseases has prompted a number of trials
aimed at identifying further therapeutic applications (Table 1.4.1). Clinical trials have shown
promising results in the treatment of neuromyelitis optica, myasthenia gravis, and CD59 deficiency
induced Guillain-Barre syndrome (Pittock et al. 2013; Howard et al. 2013; Mevorach et al. 2016).
Eculizumab has not proven a magic bullet for all inflammatory diseases however, with no significant
efficacy observed in trials for the treatment of macular degeneration, rheumatoid arthritis, or in
improving transplant and coronary bypass outcomes (Verrier et al. 2004; Yehoshua et al. 2014; Garcia
Filho et al. 2014; Rother et al. 2007). This may be due to alternative drivers of disease pathology, or
unfavourable pharmacological characteristics of antibody-based inhibition of C5. Clinical trials of
another monoclonal C5 inhibitor, LFG316, has reported a similar lack of effect in the treatment of
macular degeneration (Reis et al. 2015). In contrast, the C5 inhibitor, Zimura, has reported benefits
in clinical trials for the treatment of age-related macular degeneration, with phase II/III trials for
geographic atrophy and macular degeneration ongoing (ClinicalTrials.gov identifier: NCT02686658)
(Querques et al. 2015). An alternative to antibody-based inhibition of C5, Zimura is a chemically
synthesised aptamer (oligonucleotide-based ligand) which may offer benefits in terms of production
cost, efficacy, and side-effect profiles (Keefe, Pai, and Ellington 2010). Zimura is also in phase II
trials for the treatment of the eye disorder, idiopathic polypoidal choroidal vasculopathy
(NCT02397954).
In addition to poor efficacy in some trials, limitations have been seen on the practical use of
eculizumab, including drug cost, side effects, and a lack of efficacy in patient subpopulations. The
high cost for development and manufacture of antibody therapeutics, in combination with reduced
competition through orphan drug exclusivity rights, has resulted in a hefty price tag for eculizumab
(Shaughnessy 2012; Sharma et al. 2010). The average cost per patient in 2012 was in excess of
400,000 USD per year (Shaughnessy 2012). With the patents covering eculizumab set to begin
39
expiring from 2020, a number of biosimilar antibody inhibitors of C5 are already under trial which
may improve upon the high cost of the drug (Derbyshire 2015). However, with the continued high
cost for development and manufacture of antibody therapeutics, this price reduction is forecast to be
limited to only 20-30% of existing prices (Shaughnessy 2012). It should also be noted that rare C5
polymorphisms have been identified which render patients resistant to eculizumab-C5 binding, and
therefore non-responders to treatment (Nishimura et al. 2014). Future monoclonal antibody
development or alternative C5 inhibition methods may prove beneficial in this patient group.
Increased infection risk is a major a concern with chronic eculizumab treatment (Hillmen et al. 2013),
and remains the most significant side effect reported in treated patients. Whilst opsonisation capacity
through C3b is maintained with eculizumab, the suppression of terminal MAC formation increases
the risk of infection, particularly with encapsulated bacteria (Wong, Goodship, and Kavanagh 2013).
Of the most significant, is the increased rate of life-threatening meningococcal disease (Hillmen et
al. 2013; Dmytrijuk et al. 2008). In diseases such as PNH and aHUS where MAC is hypothesised to
be a key driver of pathology, the risks of MAC inhibition may be inescapable. However, in the
expansion of therapeutic applications for complement inhibitors, more specific targeting of
anaphylatoxin signalling may prove advantageous, treating the underlying inflammatory disease
process whilst preserving bactericidal MAC functionality. To this end, a number of C5a inhibitors
have been developed. Phase II trials for the antibody based C5a inhibitor, IFX-1 have reported
promising results in the treatment of early sepsis (NCT02246595), with trials also being undertaken
for use of IFX-1 for systemic inflammatory response syndrome (SIRS) prophylaxis (NCT02866825),
community acquired pneumonia, and hidradenitis suppurativa (NCT03001622) (Ricklin and Lambris
2016). Another antibody based C5a inhibitor, ALXN1007, is in phase II trials for the treatment of
graft-versus-host disease (NCT02245412), and antiphospholipid syndrome (NCT02128269).
Aptamer technology has also been used to develop C5a inhibitors, NOX-D19 to NOX-D21 (Vater
and Klussmann 2015). An L-RNA aptamer (spiegelmer), the NOX molecules offer increased stability
and bioavailability over natural D-oligonucleotide ligands, and are suggested to be beneficial over
other methodologies due to their highly selective characteristics, low immunogenicity, and potential
for a favourable pharmacokinetic and side effect profile. However, to date, testing of these drugs has
not yet been reported in human trials.
40
Table 1.4.1: Clinical trials of Eculizumab
Disease Clinical Phase
Trial Number Status
Paroxysmal Nocturnal Hemoglobinuria Marketed
Significant effect
Atypical Hemolytic-uremic Syndrome Marketed
Significant effect
Neuromyelitis Optica II NCT02003144 Improvement in patient outcomes
III NCT01892345 Ongoing Refractory Generalized Myasthenia Gravis III NCT01997229 Improved patient quality
of life Cardiac transplant rejection IV NCT02013037 Ongoing Shiga-Toxin Producing Escherichia Coli Hemolytic-Uremic Syndrome
II/III NCT01410916 No results reported
III NCT02205541 Ongoing
Chronic Cold Agglutinin Disease II NCT01303952 Significant effect
Guillain-Barre syndrome II NCT02029378 No results reported CD59 deficiency associated Guillain-Barre syndrome
I/II NCT01579838 Significant effect
Prevention of Delayed Graft Function (DGF) in Kidney Transplantation
II NCT01403389 Ongoing
II NCT01919346 Ongoing
Prevention and Treatment of Kidney Graft Reperfusion Injury
II NCT01756508 Ongoing
Primary membranoproliferative glomerulonephropathy
II NCT02093533 Ongoing
Renal Transplantation in Patients With History of Catastrophic Antiphospholipid Antibody Syndrome
II NCT01029587 Ongoing
Dermatomyositis II NCT00005571 No results reported Mild Allergic Asthma II NCT00485576 No results reported Geographic Atrophy in Age-Related Macular Degeneration
II NCT00935883 No effect in disease progression
Antibody-mediated Rejection Following Renal Transplantation
II NCT01895127 No effect seen
41
Inhibitors of C5aR1
C5a-C5aR1 signalling is a powerful driver of inflammation (Manthey et al. 2009), implicated in the
pathogenesis of many inflammatory disorders. As such, targeting of C5a-C5aR1 is an attractive
option in the treatment of disease. Direct targeting of C5aR1 has a number of theoretical advantages
over inhibition of C5 or C5a. For example, the inhibition of C5aR1 alone would preserve the
bactericidal activity of MAC, reducing potential negative immunosuppressive consequences.
Additionally, direct C5aR1 inhibition permits continued C5a-C5aR2 signalling. Activation of C5aR2
has been reported to have an anti-inflammatory effect through its negative regulation of C5aR1
signalling (Li et al. 2013). As such, maintenance of this signalling pathway may result in increased
efficacy, or reduced dosing requirements, resulting in reduced adverse effects of treatment.
Furthermore, direct inhibition of C5aR1 may provide pharmacodynamic advantages over inhibition
of soluble C5 or C5a.
To date, there has been a strong interest in the development of C5a-C5aR1 inhibitors, with a diverse
number of inhibitors across a number of chemical classes now available. This includes antibody
inhibitors, aptamers, peptides, and non-peptide small molecules. Of these, the cyclic peptide, PMX53
(3D53), was one of the first reported, and remains the most widely studied antagonist of C5aR1.
Modelled off of the first full antagonist of C5aR1 reported by Merck in 1994 (Konteatis et al. 1994),
this peptide is a highly potent and stable non-competitive inhibitor of C5a-C5aR1 activation. This
drug can be administered via a wide variety of routes including orally, and provides long-term
inhibition of C5aR1 signalling (Seow et al. 2016). As such, it has been utilised extensively in animal
studies, significantly expanding our knowledge of C5aR1 in disease. The efficacy of PMX53 has
been reported in preclinical animal studies for the treatment of a multitude of inflammatory
pathologies, including (but most definitely not limited to) inflammatory arthritis, ischemia-
reperfusion injuries, sepsis, inflammatory bowel disease, and neurological disorders (Li et al. 2014;
Woodruff et al. 2006; Woodruff, Nandakumar, and Tedesco 2011; Woodruff et al. 2003; Woodruff
et al. 2002). Translation of these results to the clinic however has been poor. Early phase Ib/IIa trials
for the treatment of rheumatoid arthritis found PMX53 to be safe and well tolerated when
administered orally and topically, but had no clear efficacy in improving patient outcomes (Vergunst
et al. 2007). Factors such as poor oral bioavailability, low patient numbers, short trial duration, and
concomitant therapy with methotrexate and prednisone, have been attributed as potential reasons for
PMX53’s lack of efficacy in these clinical studies (Woodruff, Nandakumar, and Tedesco 2011). A
modified version of PMX53, PMX205, has been more recently developed, with enhanced
lipophilicity, gastrointestinal stability, and in vivo potency (Woodruff et al. 2005). The increased
lipophilicity of PMX205 also allows for a large distribution to the brain and spinal cord, making it a
42
promising future therapeutic for the treatment of neurodegenerative disorders (Lee et al. 2017;
Brennan et al. 2015; Woodruff et al. 2006; Fonseca et al. 2009). Whilst this utility is strongly
supported by animal studies, human trials have yet to commence.
The non-peptidic C5aR1 inhibitor, CCX168 (Avacopan), is the only other reported C5aR1 antagonist
to enter Phase II clinical trials to date (Woodruff, Nandakumar, and Tedesco 2011). In contrast to
PMX53/205, this compound is a competitive inhibitor of C5aR1, and thus prolonged blood exposure
of drug is required to maintain C5aR1 inhibition (Bekker et al. 2016). Phase II clinical trials for
CCX168 have reported success in reducing glucocorticoid requirements in the treatment of ANCA
vasculitis (Jayne et al. 2017). Clinical trials of CCX168 have remained focussed on autoimmune
disorders with renal involvement, with current phase III trials for ANCA vasculitis (NCT02994927),
and trials for aHUS (NCT02464891), IgA nephropathy (NCT02384317), and C3 glomerulopathy.
In more recent years, an increased understanding of GPCR structure has produced an innovative
method of targeting C5aR1 through allosteric inhibition. DF2593A is a compound designed to target
the allosteric “minor pocket” of C5aR1, which is presumed to be highly conserved between C5aR1
and chemokine receptors (Moriconi et al. 2014). DF2593A was shown to have good oral
bioavailability, as well as the ability to cross the blood-brain barrier, inhibiting C5aR1 mediated
nociceptive effects in mouse models of inflammation and nerve injury. Whilst still in preclinical
development, DF2593A highlights the novel approaches being taken in the inhibition of C5a-C5aR1
signalling. Allosteric modulation may prove advantageous, with the potential to dampen C5aR1
signalling, reducing hyperactivity associated with disease, whilst permitting continuation of C5aR1
immune and physiological functions.
The development of antibody therapeutics targeting C5aR1 directly has also been explored. Of this
class, the humanised monoclonal antibody NN0384 (full name, NNC0215-0384) has shown the
greatest progression, with phase I clinical trials showing safety and tolerability of the drug (Wagner
et al. 2014).
43
Table 1.4.2: Phase II/III clinical trials of C5a-C5aR1 targeted therapeutics under active
development
Compound Target Class Disease Clinical Phase
Trial Number Status
ALXN1210 C5 Antibody Paroxysmal Nocturnal Hemoglobinuria
II NCT02946463 Ongoing
Paroxysmal Nocturnal Hemoglobinuria
II NCT03056040 Ongoing
Atypical Hemolytic Uremic Syndrome
II NCT02949128 Ongoing
LFG316 C5 Antibody Wet Age Related Macular Degeneration
II NCT01535950 No results reported
Wet Age Related Macular Degeneration
II NCT01527500 No results reported
Transplant Associated Microangiopathy
II NCT02763644 Ongoing
Paroxysmal Nocturnal Hemoglobinuria
II NCT02534909 Ongoing
Uveitis II NCT01526889 Ongoing Zimura C5 Aptamer Idiopathic Polypoidal
Choroidal Vasculopathy
II NCT02397954 No results reported
Geographic Atrophy Secondary to Dry Age-Related Macular Degeneration
II NCT02686658 Ongoing
Coversin C5 Protein Paroxysmal Nocturnal Hemoglobinuria
II NCT02591862 Ongoing
IFX-1 C5a Antibody Early, Newly Developing Septic Organ Dysfunction
II NCT02246595 No results reported
Cardiac Surgery II NCT02866825 No results
reported Hidradenitis Suppurativa
II NCT03001622 Ongoing
ALXN-1007 C5a Antibody Antiphospholipid Syndrome
II NCT02128269 No results reported
acute graft-versus-host disease
II NCT02245412 Terminated - Unstated reason
CCX168 C5aR1 Small Molecule
aHUS II NCT02464891 Terminated
Anti-Neutrophil Cytoplasmic Antibody (ANCA)-Associated Vasculitis
III NCT02994927 Ongoing
Immunoglobulin A Nephropathy
II NCT02384317 No results reported
44
Targeting C3aR
Whilst the immunogenic potential of C5aR1 signalling has led to the production of an array of
compounds with varied modalities for inhibition, the development of therapeutics for its upstream
homologue, C3aR, remains limited. The full therapeutic potential of targeting C3a receptor signalling
remains unclear, however, animal models have demonstrated the theoretical benefits for both
inhibition and activation of C3aR in the clinical setting (Coulthard and Woodruff 2015). C3a-C3aR
signalling has been demonstrated to have a dual function in the control of inflammation. In the acute
phase, C3aR activation decreases the inflammatory response through prevention of leukocyte
mobilisation (Wu et al. 2013; Nabizadeh et al. 2016). Conversely, in chronic inflammation, C3aR has
been shown to be a driver of disease pathology. Chronic inhibition of C3aR has shown improved
outcomes in a number of animal models including inflammatory arthritis, airway disease, and
inflammatory bowel disease (Banda et al. 2012; Bera et al. 2011; Lajoie et al. 2010; Wende et al.
2013). C3aR inhibition may also have unexpected benefits in the treatment of cancer. C3aR activation
has been shown to directly promote melanoma growth, whilst perturbing the host inflammatory
response to favour tumour growth (Nabizadeh et al. 2016). Additionally, inhibition of C3a-C3aR
signalling has been shown to maintain the blood-CSF barrier, preventing metastatic spread to the
leptomeningeal space (Boire et al. 2017).
The further delineation of C3aR roles in disease has been hindered in part due to a poorer selection
of pharmacological tools for the study of receptor function (Woodruff and Tenner 2015; Coulthard
and Woodruff 2015). Currently, the only reported full antagonist of C3aR is the small molecule,
SB290157. This drug has shown benefit in improving outcomes in multiple animal models (Gu et al.
2016; Rynkowski et al. 2009; Lian et al. 2015). However, both off target effects and full agonist
activity of SB290157 have been reported for this drug (Woodruff and Tenner 2015), limiting the
interpretation of results found with this antagonist. A casual review of the literature identifies the
continued use of this molecule as the sole method for interpreting C3aR function. When not used in
combination with other C3aR modulation techniques such as agonist or knockout studies, the results
of such reports may be equally due to activation or inhibition of C3aR, or off target effects, and should
be approached with caution. The continued use of this compound regardless of its caveats highlights
the need for future development of a specific C3aR antagonist. This would allow for an
uncompromised characterisation of the role for C3aR antagonism therapeutic preclinical studies. To
date, a specific and effective C3aR inhibitor that can be used in animal models has not be described.
Future production of such antagonists would also permit the study of effects of dual C5aR1/C3aR
inhibition. Through the combined use, the beneficial reduction in inflammation could be increased,
or therapeutic effect may be achieved at lower doses leading to reduced side effects.
45
As opposed to chronic inflammation, C3aR activation in acute injury has been reported to have an
anti-inflammatory effect. In animal models of gut ischemia-reperfusion (IR) injury, the presence of
C3aR restricted mobilisation of neutrophils, ameliorating intestinal IR pathology (Wu et al. 2013).
The study also utilised a potent C3aR agonist, WWGKKYRASKLGLAR, to demonstrate a beneficial
effect in wild type, but not C3aR knockout mice. Whilst potent and selective, this linear peptide is
rapidly degraded in vivo, and requires parenteral administration reducing its usefulness in chronic
animal models (Proctor et al. 2004). Neutrophils have been implicated as a key drivers of injury in a
number of tissues (Schofield et al. 2013), as such, C3aR activation to reduce neutrophil driven
pathology has great potential for clinical use. The therapeutic benefit of C3aR activation in acute
injury was also recently demonstrated in an animal model of neonatal hypoxic-ischemic brain injury,
with intranasal delivery of C3a beneficial in amelioration of injury-induced cognitive impairment
(Moran et al. 2017).
More recently, peptides designed against the C-terminus of C5a with serendipitous specific affinity
for C3aR have been reported (Halai et al. 2014). Additionally, the production of potent C3aR agonists
via modelling of previous C3aR ligands has been reported (Reid et al. 2014). The same group have
also reported the production of specific, small molecule, heterocyclic protein mimics of C3a with
high potency for C3aR (Reid et al. 2013). These compounds have been shown to be effective in vitro,
however, in vivo studies of pharmacokinetics and pharmacodynamics, which would determine the
usefulness of these compounds as tools for C3aR study, are awaiting.
Targeting of C5aR2
The targeting of the second receptor for C5a, C5aR2 (C5L2), represents an interesting avenue for
future therapeutic applications. Whilst sharing G-protein coupled receptor homology to C5aR1, this
seven transmembrane receptor couples to β-arrestins, but not G-proteins (Bamberg et al. 2010).
Originally described as a decoy receptor for C5a, C5aR2 has now been shown to signal through β-
arrestins to act both as a negative regulator of C5aR1 signalling, perturbing C5aR1 second messenger
signal transduction, and independently inhibiting the release of proinflammatory cytokines (Croker
et al. 2016). Owing in part to the previously enigmatic functions of C5aR2, and a predominant focus
on C5aR1, the potential for C5aR2 to be targeted therapeutically remains largely unexplored. To date,
animal knockout studies have demonstrated an effect of C5aR2 modulation in spinal injury, allergic
asthma, and sepsis (Biggins et al. 2017; Rittirsch et al. 2008; Zhang et al. 2010; Li et al. 2013).
46
As a negative regulator of C5aR1, targeting of C5aR2 either with or without C5aR1 antagonism may
provide unique therapeutic advantages. The capacity of C5aR2 to reduce the cellular response to
C5aR1 may restrict the progression of inflammatory disorders associated with C5aR1 hyper-activity,
whilst allowing for physiological activity of C5aR1 in aspects such as wound healing and immune
protection (Hawksworth, Coulthard, and Woodruff 2016). Additionally, the combination of C5aR2
activation with C5aR1 blockade may reduce dosing requirements, and therefore negative effects, of
C5a-C5aR1 inhibitors. Pre-clinical research into such uses has been hindered by a lack of
pharmacological tools to modulate C5aR2 signalling. Recently, the first selective agonists of C5aR2
have been reported, peptides P32 and P59, which have activity in vitro and in vivo (Croker et al.
2016). These drugs provide an important tool for the preclinical study of C5aR2 (Kemper 2016;
Arbore et al. 2016).
In animal models of sepsis, a pro-inflammatory effect of C5aR2 has been described (Rittirsch et al.
2008). Here, C5aR2 knockout animals showed reduced cytokine production and improved survival,
suggesting a pathological role of C5aR2 signalling in disease progression. Such results may highlight
potential negative effects of C5aR2 activation, and considerations for any envisioned therapeutic use
of C5aR2 agonists. Additionally, these results show the potential benefit of C5aR2 antagonism in
clinical scenarios. To date however, no specific antagonist of C5aR2 capable for further study of these
functions has been reported.
47
The future of anaphylatoxin targeted therapeutics
Therapeutic targeting of complement has long been proposed for a myriad of inflammatory disorders,
however, the realisation of this potential has been relatively limited. Only one specific terminal
complement therapeutic is currently approved, and only for orphan diseases to date. However, the
range of novel complement targeted drugs now progressing to phase II and III clinical trials is rapidly
increasing, perhaps heralding the relative imminence of an expanded market of approved complement
therapeutics. In the realm of anaphylatoxin-targeted drugs, first generation compounds such as
PMX53 have been superseded by the advancement of newer inhibitors of both C5a and C5aR1, which
have shown greater clinical success than their predecessors. This growing arsenal of C5a-C5aR1
therapies across modalities including humanised antibodies, peptides, small molecules, and aptamers,
leave the question not of if, but when, C5a-C5aR1 targeted therapeutics will be approved for treatment
of both rare and common autoimmune and inflammatory diseases.
Of the other anaphylatoxin receptors, it is perhaps due to the predominant interest in C5aR1 that there
remains only a trickle of studies for the development of C3aR and C5aR2 targeted agents. However,
recently discovered compounds have been described with specific agonist activity for these receptors.
Such drugs have great potential for therapeutic use both as sole agents and in combination with C5aR1
inhibitors, however their benefit remains to be demonstrated in preclinical studies. As such, in the
toolbox of complement targeted agents, there remains a dire need for specific inhibitors of C3aR and
C5aR2, which would greatly improve knowledge for the role of these receptors in disease, and may
both have benefit for applications in specific clinical situations.
The targeting of anaphylatoxin signalling directly is advantageous over inhibition of upstream C3 or
C5 factors, allowing for a specific blockade of disease driving receptors with potential benefits in
efficacy of treatment, and reduced risk of life-threatening infection. The ever expanding
understanding of these complement family members however, warns that significant negative effects
may arise with long term use. Traditionally described as a regulator of innate immunity and
inflammation, it is now clear that complement is involved in the regulation of a wide number of non-
immune functions. For example, C3a and C5a signalling has been shown to play roles in
embryogenesis, wound healing, and cell proliferation (Hawksworth, Coulthard, and Woodruff 2016;
Coulthard et al. 2017). As such, long term inhibition may pose significant risks. Whilst long term
data is still unavailable, it is promising that after a decade of use, no negative effects attributable to
non-canonical complement activity have been described for eculizumab. However, the tissue
distribution of the humanised monoclonal antibody may limit the risk such effects in systems such as
the brain or in foetal development. With the advancement of future therapeutics with improved tissue
48
penetration, increased monitoring for potential adverse effects of non-immune complement inhibition
would be warranted.
These off target effects may also prove unexpected strengths for future anaphylatoxin targeted
inhibitors. For example, both C5aR1 and C3aR signalling have been shown to play unique roles in
the control of a number of non-immune stem cell populations, including prenatal, adult, and cancer
cells (Hawksworth et al. 2014; Hawksworth, Coulthard, and Woodruff 2016). In regulation of these
cell populations, in vivo animal studies have shown benefit of C3aR modulation in the treatment brain
injury (Järlestedt et al. 2013; Rahpeymai et al. 2006; Ducruet et al. 2012), and of both C3aR and
C5aR1 modulation in the control of tumour growth (Nabizadeh et al. 2016; Corrales et al. 2012;
Sayegh, Bloch, and Parsa 2014).
The development of anaphylatoxin targeted therapeutics remains an area of intense research, with
new preclinical and clinical studies strengthening the position of this group of compounds. C5aR1
inhibition remains the most promising target, but there is now evidence that modulation of C3aR and
C5aR2 signalling may provide unique clinical advantages. However two decades after the
development of the first full C5aR1 antagonist, the realisation of direct C5a-C5aR1 targeted therapies
in the clinical is still pending. Nevertheless, with ongoing phase 3 trails, the nebulous future of
anaphylatoxin inhibitors in reaching their long regarded therapeutic potential remains ever promising.
49
References
Arbore, G., E. E. West, R. Spolski, A. A. Robertson, A. Klos, C. Rheinheimer, P. Dutow, T. M.
Woodruff, Z. X. Yu, L. A. O'Neill, R. C. Coll, A. Sher, W. J. Leonard, J. Kohl, P. Monk, M.
A. Cooper, M. Arno, B. Afzali, H. J. Lachmann, A. P. Cope, K. D. Mayer-Barber, and C.
Kemper. 2016. 'T helper 1 immunity requires complement-driven NLRP3 inflammasome
activity in CD4(+) T cells', Science, 352: aad1210.
Bamberg, C. E., C. R. Mackay, H. Lee, D. Zahra, J. Jackson, Y. S. Lim, P. L. Whitfeld, S. Craig, E.
Corsini, B. Lu, C. Gerard, and N. P. Gerard. 2010. 'The C5a receptor (C5aR) C5L2 is a
modulator of C5aR-mediated signal transduction', J Biol Chem, 285.
Banda, N. K., S. Hyatt, A. H. Antonioli, J. T. White, M. Glogowska, K. Takahashi, T. J. Merkel, G.
L. Stahl, S. Mueller-Ortiz, R. Wetsel, W. P. Arend, and V. M. Holers. 2012. 'Role of C3a
receptors, C5a receptors, and complement protein C6 deficiency in collagen antibody-induced
arthritis in mice', J Immunol, 188: 1469-78.
Bekker, Pirow, Daniel Dairaghi, Lisa Seitz, Manmohan Leleti, Yu Wang, Linda Ertl, Trageen
Baumgart, Sarah Shugarts, Lisa Lohr, Ton Dang, Shichang Miao, Yibin Zeng, Pingchen Fan,
Penglie Zhang, Daniel Johnson, Jay Powers, Juan Jaen, Israel Charo, and Thomas J. Schall.
2016. 'Characterization of Pharmacologic and Pharmacokinetic Properties of CCX168, a
Potent and Selective Orally Administered Complement 5a Receptor Inhibitor, Based on
Preclinical Evaluation and Randomized Phase 1 Clinical Study', PLoS One, 11: e0164646.
Bera, Monali M., Bao Lu, Thomas R. Martin, Shun Cui, Lawrence M. Rhein, Craig Gerard, and
Norma P. Gerard. 2011. 'Th17 Cytokines Are Critical for Respiratory Syncytial Virus-
Associated Airway Hyperreponsiveness through Regulation by Complement C3a and
Tachykinins', The Journal of Immunology, 187: 4245-55.
Biggins, P., F. Brennan, S. Taylor, T. Woodruff, and M. Ruitenberg. 2017. 'The alternative receptor
for complement component 5a, C5aR2, conveys neuroprotection in traumatic spinal cord
injury', J Neurotrauma.
Boire, Adrienne, Yilong Zou, Jason Shieh, Danilo G. Macalinao, Elena Pentsova, and Joan Massagué.
2017. 'Complement Component 3 Adapts the Cerebrospinal Fluid for Leptomeningeal
Metastasis', Cell, 168: 1101-13.e13.
Brennan, F. H., R. Gordon, H. W. Lao, P. J. Biggins, S. M. Taylor, R. J. Franklin, T. M. Woodruff,
and M. J. Ruitenberg. 2015. 'The Complement Receptor C5aR Controls Acute Inflammation
and Astrogliosis following Spinal Cord Injury', J Neurosci, 35: 6517-31.
50
Brennan, Faith H., John D. Lee, Marc J. Ruitenberg, and Trent M. Woodruff. 2016. 'Therapeutic
targeting of complement to modify disease course and improve outcomes in neurological
conditions', Seminars in Immunology, 28: 292-308.
Corrales, Leticia, Daniel Ajona, Stavros Rafail, Juan J. Lasarte, Jose I. Riezu-Boj, John D. Lambris,
Ana Rouzaut, Maria J. Pajares, Luis M. Montuenga, and Ruben Pio. 2012. 'Anaphylatoxin
C5a Creates a Favorable Microenvironment for Lung Cancer Progression', The Journal of
Immunology, 189: 4674-83.
Coulthard, L. G., and T. M. Woodruff. 2015. 'Is the complement activation product C3a a
proinflammatory molecule? Re-evaluating the evidence and the myth', J Immunol, 194: 3542-
8.
Coulthard, Liam G. , Owen A. Hawksworth, Rui Li, Anushree Balachandran, John D. Lee, Farshid
Sepehrband, Nyoman Kurniawan, Angela Jeanes, David G. Simmons, Ernst Wolvetang,
and Trent M. Woodruff. 2017. 'Complement C5aR1 Signaling Promotes Polarization and
Proliferation of Embryonic Neural Progenitor Cells through PKCz', Journal of Neuroscience.
Croker, D. E., P. N. Monk, R. Halai, G. Kaeslin, Z. Schofield, M. C. Wu, R. J. Clark, M. A.
Blaskovich, D. Morikis, C. A. Floudas, M. A. Cooper, and T. M. Woodruff. 2016. 'Discovery
of functionally selective C5aR2 ligands: novel modulators of C5a signalling', Immunol Cell
Biol.
Derbyshire, M. 2015. 'Patent expiry dates for best-selling biologicals', Generics and Biosimilars
Initiative Journal, 4: 178-9.
Dmytrijuk, A., K. Robie-Suh, M. H. Cohen, D. Rieves, K. Weiss, and R. Pazdur. 2008. 'FDA report:
eculizumab (Soliris) for the treatment of patients with paroxysmal nocturnal hemoglobinuria',
Oncologist, 13: 993-1000.
Ducruet, Andrew F., Brad E. Zacharia, Sergey A. Sosunov, Paul R. Gigante, Mason L. Yeh, Justin
W. Gorski, Marc L. Otten, Richard Y. Hwang, Peter A. DeRosa, Zachary L. Hickman, Paulina
Sergot, and E. Sander Connolly, Jr. 2012. 'Complement Inhibition Promotes Endogenous
Neurogenesis and Sustained Anti-Inflammatory Neuroprotection following Reperfused
Stroke', PLoS One, 7: e38664.
Fonseca, M. I., R. R. Ager, S. H. Chu, O. Yazan, S. D. Sanderson, F. M. LaFerla, S. M. Taylor, T.
M. Woodruff, and A. J. Tenner. 2009. 'Treatment with a C5aR antagonist decreases pathology
and enhances behavioral performance in murine models of Alzheimer's disease', J Immunol,
183.
Garcia Filho, C. A., Z. Yehoshua, G. Gregori, R. P. Nunes, F. M. Penha, A. A. Moshfeghi, K. Zhang,
W. Feuer, and P. J. Rosenfeld. 2014. 'Change in drusen volume as a novel clinical trial
51
endpoint for the study of complement inhibition in age-related macular degeneration',
Ophthalmic Surg Lasers Imaging Retina, 45: 18-31.
Gu, Hongmei, Amanda J. Fisher, Elizabeth A. Mickler, Frank Duerson, Oscar W. Cummings, Marc
Peters-Golden, Homer L. Twigg, Trent M. Woodruff, David S. Wilkes, and Ragini Vittal.
2016. 'Contribution of the anaphylatoxin receptors, C3aR and C5aR, to the pathogenesis of
pulmonary fibrosis', The FASEB Journal, 30: 2336-50.
Halai, Reena, Meghan L. Bellows-Peterson, Will Branchett, James Smadbeck, Chris A. Kieslich,
Daniel E. Croker, Matthew A. Cooper, Dimitrios Morikis, Trent M. Woodruff, Christodoulos
A. Floudas, and Peter N. Monk. 2014. 'Derivation of ligands for the complement C3a receptor
from the C-terminus of C5a', European Journal of Pharmacology, 745: 176-81.
Hawksworth, O. A., L. G. Coulthard, S. M. Taylor, E. J. Wolvetang, and T. M. Woodruff. 2014. 'Brief
report: complement C5a promotes human embryonic stem cell pluripotency in the absence of
FGF2', STEM CELLS, 32: 3278-84.
Hawksworth, Owen A., Liam G. Coulthard, and Trent M. Woodruff. 2016. 'Complement in the
fundamental processes of the cell', Mol Immunol.
Hillmen, Peter, Petra Muus, Alexander Röth, Modupe O. Elebute, Antonio M. Risitano, Hubert
Schrezenmeier, Jeffrey Szer, Paul Browne, Jaroslaw P. Maciejewski, Jörg Schubert, Alvaro
Urbano-Ispizua, Carlos de Castro, Gérard Socié, and Robert A. Brodsky. 2013. 'Long-term
safety and efficacy of sustained eculizumab treatment in patients with paroxysmal nocturnal
haemoglobinuria', British Journal of Haematology, 162: 62-73.
Howard, J. F., Jr., R. J. Barohn, G. R. Cutter, M. Freimer, V. C. Juel, T. Mozaffar, M. L. Mellion, M.
G. Benatar, M. E. Farrugia, J. J. Wang, S. S. Malhotra, and J. T. Kissel. 2013. 'A randomized,
double-blind, placebo-controlled phase II study of eculizumab in patients with refractory
generalized myasthenia gravis', Muscle Nerve, 48: 76-84.
Järlestedt, Katarina, Catherine I. Rousset, Anders Ståhlberg, Hana Sourkova, Alison L. Atkins, Claire
Thornton, Scott R. Barnum, Rick A. Wetsel, Mike Dragunow, Milos Pekny, Carina Mallard,
Henrik Hagberg, and Marcela Pekna. 2013. 'Receptor for complement peptide C3a: a
therapeutic target for neonatal hypoxic-ischemic brain injury', The FASEB Journal.
Jayne, D. R., A. N. Bruchfeld, L. Harper, M. Schaier, M. C. Venning, P. Hamilton, V. Burst, F.
Grundmann, M. Jadoul, I. Szombati, V. Tesar, M. Segelmark, A. Potarca, T. J. Schall, and P.
Bekker. 2017. 'Randomized Trial of C5a Receptor Inhibitor Avacopan in ANCA-Associated
Vasculitis', J Am Soc Nephrol.
Kaufmann, Stefan H. E. 2008. 'Immunology's foundation: the 100-year anniversary of the Nobel Prize
to Paul Ehrlich and Elie Metchnikoff', Nat Immunol, 9: 705-12.
52
Keefe, Anthony D., Supriya Pai, and Andrew Ellington. 2010. 'Aptamers as therapeutics', Nat Rev
Drug Discov, 9: 537-50.
Kemper, C. 2016. 'Targeting the Dark Horse of complement: the first generation of functionally
selective C5aR2 ligands', Immunol Cell Biol, 94: 717-8.
Konteatis, Z. D., S. J. Siciliano, G. Van Riper, C. J. Molineaux, S. Pandya, P. Fischer, H. Rosen, R.
A. Mumford, and M. S. Springer. 1994. 'Development of C5a receptor antagonists.
Differential loss of functional responses', J Immunol, 153: 4200-5.
Lajoie, Stephane, Ian P. Lewkowich, Yusuke Suzuki, Jennifer R. Clark, Alyssa A. Sproles, Krista
Dienger, Alison L. Budelsky, and Marsha Wills-Karp. 2010. 'Complement-mediated
regulation of the IL-17A axis is a central genetic determinant of the severity of experimental
allergic asthma', Nat Immunol, 11: 928-35.
Lee, J. D., V. Kumar, J. N. Fung, M. J. Ruitenberg, P. G. Noakes, and T. M. Woodruff. 2017.
'Pharmacological inhibition of complement C5a-C5a1 receptor signalling ameliorates disease
pathology in the hSOD1G93A mouse model of amyotrophic lateral sclerosis', Br J
Pharmacol.
Li, G., R. M. Fan, J. L. Chen, C. M. Wang, Y. C. Zeng, C. Han, S. Jiao, X. P. Xia, W. Chen, and S.
T. Yao. 2014. 'Neuroprotective effects of argatroban and C5a receptor antagonist (PMX53)
following intracerebral haemorrhage', Clin Exp Immunol, 175: 285-95.
Li, R., L. M. Coulthard, M. C. L. Wu, S. M. Taylor, and T. M. Woodruff. 2013. 'C5L2: a controversial
receptor of complement anaphylatoxin C5a', FASEB J, 27.
Lian, Hong, Li Yang, Allysa Cole, Lu Sun, Angie C. A. Chiang, Stephanie W. Fowler, David J. Shim,
Jennifer Rodriguez-Rivera, Giulio Taglialatela, Joanna L. Jankowsky, Hui-Chen Lu, and Hui
Zheng. 2015. 'NFκB-activated Astroglial Release of Complement C3 Compromises Neuronal
Morphology and Function Associated with Alzheimer’s Disease', Neuron, 85: 101-15.
Manthey, H. D., T. M. Woodruff, S. M. Taylor, and P. N. Monk. 2009. 'Complement component 5a
(C5a)', Int J Biochem Cell Biol, 41.
Mevorach, Dror, Inna Reiner, Amir Grau, Uri Ilan, Yackov Berkun, Asaf Ta-Shma, Orly Elpeleg,
Zamir Shorer, Simon Edvardson, and Adi Tabib. 2016. 'Therapy with eculizumab for patients
with CD59 p.Cys89Tyr mutation', Annals of Neurology, 80: 708-17.
Moran, J., A. Stokowska, F. R. Walker, C. Mallard, H. Hagberg, and M. Pekna. 2017. 'Intranasal C3a
treatment ameliorates cognitive impairment in a mouse model of neonatal hypoxic-ischemic
brain injury', Exp Neurol, 290: 74-84.
Morgan, B. P., and C. L. Harris. 2015. 'Complement, a target for therapy in inflammatory and
degenerative diseases', Nat Rev Drug Discov, 14: 857-77.
53
Moriconi, Alessio, Thiago M. Cunha, Guilherme R. Souza, Alexandre H. Lopes, Fernando Q. Cunha,
Victor L. Carneiro, Larissa G. Pinto, Laura Brandolini, Andrea Aramini, Cinzia Bizzarri,
Gianluca Bianchini, Andrea R. Beccari, Marco Fanton, Agostino Bruno, Gabriele Costantino,
Riccardo Bertini, Emanuela Galliera, Massimo Locati, Sérgio H. Ferreira, Mauro M. Teixeira,
and Marcello Allegretti. 2014. 'Targeting the minor pocket of C5aR for the rational design of
an oral allosteric inhibitor for inflammatory and neuropathic pain relief', Proceedings of the
National Academy of Sciences, 111: 16937-42.
Nabizadeh, J. A., H. D. Manthey, F. J. Steyn, W. Chen, A. Widiapradja, F. N. Md Akhir, G. M. Boyle,
S. M. Taylor, T. M. Woodruff, and B. E. Rolfe. 2016. 'The Complement C3a Receptor
Contributes to Melanoma Tumorigenesis by Inhibiting Neutrophil and CD4+ T Cell
Responses', J Immunol, 196: 4783-92.
Nesargikar, P. N., B. Spiller, and R. Chavez. 2012. 'The complement system: history, pathways,
cascade and inhibitors', European Journal of Microbiology & Immunology, 2: 103-11.
Nishimura, J., M. Yamamoto, S. Hayashi, K. Ohyashiki, K. Ando, A. L. Brodsky, H. Noji, K.
Kitamura, T. Eto, T. Takahashi, M. Masuko, T. Matsumoto, Y. Wano, T. Shichishima, H.
Shibayama, M. Hase, L. Li, K. Johnson, A. Lazarowski, P. Tamburini, J. Inazawa, T.
Kinoshita, and Y. Kanakura. 2014. 'Genetic variants in C5 and poor response to eculizumab',
N Engl J Med, 370: 632-9.
Pittock, S. J., V. A. Lennon, A. McKeon, J. Mandrekar, B. G. Weinshenker, C. F. Lucchinetti, O.
O'Toole, and D. M. Wingerchuk. 2013. 'Eculizumab in AQP4-IgG-positive relapsing
neuromyelitis optica spectrum disorders: an open-label pilot study', Lancet Neurol, 12: 554-
62.
Proctor, L. M., T. V. Arumugam, I. Shiels, R. C. Reid, D. P. Fairlie, and S. M. Taylor. 2004.
'Comparative anti-inflammatory activities of antagonists to C3a and C5a receptors in a rat
model of intestinal ischaemia/reperfusion injury', Br J Pharmacol, 142.
Querques, G., V. Capuano, P. Frascio, F. Bandello, and E. H. Souied. 2015. 'Emerging Therapeutic
Options in Age-Related Macular Degeneration', Ophthalmic Research, 53: 194-99.
Rahpeymai, Y., M. A. Hietala, U. Wilhelmsson, A. Fotheringham, I. Davies, A. K. Nilsson, J.
Zwirner, R. A. Wetsel, C. Gerard, M. Pekny, and M. Pekna. 2006. 'Complement: a novel
factor in basal and ischemia-induced neurogenesis', EMBO J, 25.
Reid, R. C., M. K. Yau, R. Singh, J. K. Hamidon, A. N. Reed, P. Chu, J. Y. Suen, M. J. Stoermer, J.
S. Blakeney, J. Lim, J. M. Faber, and D. P. Fairlie. 2013. 'Downsizing a human inflammatory
protein to a small molecule with equal potency and functionality', Nat Commun, 4: 2802.
54
Reid, Robert C., Mei-Kwan Yau, Ranee Singh, Johan K. Hamidon, Junxian Lim, Martin J. Stoermer,
and David P. Fairlie. 2014. 'Potent Heterocyclic Ligands for Human Complement C3a
Receptor', Journal of Medicinal Chemistry, 57: 8459-70.
Reis, Edimara S., Dimitrios C. Mastellos, Despina Yancopoulou, Antonio M. Risitano, Daniel
Ricklin, and John D. Lambris. 2015. 'Applying Complement Therapeutics to Rare Diseases',
Clinical immunology (Orlando, Fla.), 161: 225-40.
Ricklin, Daniel, and John D. Lambris. 2016. 'New milestones ahead in complement-targeted therapy',
Seminars in Immunology, 28: 208-22.
Rittirsch, D., M. A. Flierl, B. A. Nadeau, D. E. Day, M. Huber-Lang, C. R. Mackay, F. S. Zetoune,
N. P. Gerard, K. Cianflone, J. Kohl, C. Gerard, J. V. Sarma, and P. A. Ward. 2008. 'Functional
roles for C5a receptors in sepsis', Nat Med, 14.
Rother, Russell P., Scott A. Rollins, Christopher F. Mojcik, Robert A. Brodsky, and Leonard Bell.
2007. 'Discovery and development of the complement inhibitor eculizumab for the treatment
of paroxysmal nocturnal hemoglobinuria', Nat Biotech, 25: 1256-64.
Rynkowski, M. A., G. H. Kim, M. C. Garrett, B. E. Zacharia, M. L. Otten, S. A. Sosunov, R. J.
Komotar, B. G. Hassid, A. F. Ducruet, J. D. Lambris, and E. S. Connolly. 2009. 'C3a receptor
antagonist attenuates brain injury after intracerebral hemorrhage', J Cereb Blood Flow Metab,
29: 98-107.
Sayegh, E. T., O. Bloch, and A. T. Parsa. 2014. 'Complement anaphylatoxins as immune regulators
in cancer', Cancer Med, 3: 747-58.
Schofield, Z. V., T. M. Woodruff, R. Halai, M. C. Wu, and M. A. Cooper. 2013. 'Neutrophils--a key
component of ischemia-reperfusion injury', Shock, 40: 463-70.
Seow, Vernon, Junxian Lim, Adam J. Cotterell, Mei-Kwan Yau, Weijun Xu, Rink-Jan Lohman, W.
Mei Kok, Martin J. Stoermer, Matthew J. Sweet, Robert C. Reid, Jacky Y. Suen, and David
P. Fairlie. 2016. 'Receptor residence time trumps drug-likeness and oral bioavailability in
determining efficacy of complement C5a antagonists', Scientific Reports, 6: 24575.
Sharma, Aarti, Abraham Jacob, Manas Tandon, and Dushyant Kumar. 2010. 'Orphan drug:
Development trends and strategies', Journal of Pharmacy and Bioallied Sciences, 2: 290-99.
Shaughnessy, Allen F. 2012. 'Monoclonal antibodies: magic bullets with a hefty price tag', BMJ :
British Medical Journal, 345.
Vater, Axel, and Sven Klussmann. 2015. 'Turning mirror-image oligonucleotides into drugs: the
evolution of Spiegelmer® therapeutics', Drug Discovery Today, 20: 147-55.
Vergunst, C. E., D. M. Gerlag, H. Dinant, L. Schulz, M. Vinkenoog, T. J. Smeets, M. E. Sanders, K.
A. Reedquist, and P. P. Tak. 2007. 'Blocking the receptor for C5a in patients with rheumatoid
arthritis does not reduce synovial inflammation', Rheumatology (Oxford), 46: 1773-8.
55
Verrier, E. D., S. K. Shernan, K. M. Taylor, F. Van de Werf, M. F. Newman, J. C. Chen, M. Carrier,
A. Haverich, K. J. Malloy, P. X. Adams, T. G. Todaro, C. F. Mojcik, S. A. Rollins, and J. H.
Levy. 2004. 'Terminal complement blockade with pexelizumab during coronary artery bypass
graft surgery requiring cardiopulmonary bypass: a randomized trial', Jama, 291: 2319-27.
Wagner, F., C.F. Lange, M. Nowak, and S. Ignatenko. 2014. 'FRI0315 First Human Dose of the Anti-
C5a Receptor-Targeting, Human Monoclonal Antibody NNC0215-0384 in Patients with
Rheumatoid Arthritis: A Phase 1, Randomised, Double-Blind, Single-Dose, Dose-Escalation
Trial', Annals of the Rheumatic Diseases, 73: 499-99.
Wende, Elisabeth, Robert Laudeley, André Bleich, Eva Bleich, Rick A. Wetsel, Silke Glage, and
Andreas Klos. 2013. 'The Complement Anaphylatoxin C3a Receptor (C3aR) Contributes to
the Inflammatory Response in Dextran Sulfate Sodium (DSS)-Induced Colitis in Mice', PLoS
One, 8: e62257.
Wong, Edwin K. S., Tim H. J. Goodship, and David Kavanagh. 2013. 'Complement therapy in
atypical haemolytic uraemic syndrome (aHUS)', Mol Immunol, 56: 199-212.
Woodruff, T., J. Crane, L. Proctor, K. Buller, A. Shek, K. de Vos, S. Pollitt, H. Williams, I. Shiels,
P. Monk, and S. Taylor. 2006. 'Therapeutic activity of C5a receptor antagonists in a rat model
of neurodegeneration', FASEB J, 20.
Woodruff, T. M., T. V. Arumugam, I. A. Shiels, R. C. Reid, D. P. Fairlie, and S. M. Taylor. 2003. 'A
potent human C5a receptor antagonist protects against disease pathology in a rat model of
inflammatory bowel disease', J Immunol, 171: 5514-20.
Woodruff, T. M., K. S. Nandakumar, and F. Tedesco. 2011. 'Inhibiting the C5-C5a receptor axis',
Mol Immunol, 48.
Woodruff, T. M., A. J. Strachan, N. Dryburgh, I. A. Shiels, R. C. Reid, D. P. Fairlie, and S. M. Taylor.
2002. 'Antiarthritic activity of an orally active C5a receptor antagonist against antigen-
induced monarticular arthritis in the rat', Arthritis Rheum, 46: 2476-85.
Woodruff, Trent M., Sandra Pollitt, Lavinia M. Proctor, Shelli Z. Stocks, Helga D. Manthey, Hua M.
Williams, Indumathy B. Mahadevan, Ian A. Shiels, and Stephen M. Taylor. 2005. 'Increased
Potency of a Novel Complement Factor 5a Receptor Antagonist in a Rat Model of
Inflammatory Bowel Disease', Journal of Pharmacology and Experimental Therapeutics,
314: 811-17.
Woodruff, Trent M., and Andrea J. Tenner. 2015. 'A Commentary On: “NFκB-Activated Astroglial
Release of Complement C3 Compromises Neuronal Morphology and Function Associated
with Alzheimer’s Disease”. A cautionary note regarding C3aR', Frontiers in Immunology, 6:
220.
56
Wu, M. C., F. H. Brennan, J. P. Lynch, S. Mantovani, S. Phipps, R. A. Wetsel, M. J. Ruitenberg, S.
M. Taylor, and T. M. Woodruff. 2013. 'The receptor for complement component C3a mediates
protection from intestinal ischemia-reperfusion injuries by inhibiting neutrophil mobilization',
Proc Natl Acad Sci U S A, 110: 9439-44.
Yehoshua, Z., C. A. de Amorim Garcia Filho, R. P. Nunes, G. Gregori, F. M. Penha, A. A. Moshfeghi,
K. Zhang, S. Sadda, W. Feuer, and P. J. Rosenfeld. 2014. 'Systemic complement inhibition
with eculizumab for geographic atrophy in age-related macular degeneration: the
COMPLETE study', Ophthalmology, 121: 693-701.
Zhang, X., I. Schmudde, Y. Laumonnier, M. K. Pandey, J. R. Clark, P. Konig, N. P. Gerard, C.
Gerard, M. Wills-Karp, and J. Kohl. 2010. 'A critical role for C5L2 in the pathogenesis of
experimental allergic asthma', J Immunol, 185: 6741-52.
57
1.5 Pluripotent Stem Cells
Human pluripotent stem cells (PPSCs), including both human embryonic stem cells (hESCs) and
human induced pluripotent stem cells (hiPSCs), represent a powerful tool in scientific research.
Thomson and colleagues generated the first hESC line in 1998 through the isolation and culture of
inner cell mass cells from preimplantation human blastocysts (Thomson et al. 1998). This was
followed more recently by Takahashi and colleagues (2007), generating hiPSCs through the viral
transduction of adult human fibroblasts with four transcription factors, Oct3/4, Sox2, c-Myc and Klf4,
inducing the cells to reprogram back into a hES-like pluripotent state (Takahashi et al. 2007). The
capability of PPSCs to self-renew indefinitely, whilst maintaining the ability to form any cell type in
the human body, makes them amenable to a wide number of applications. This includes
developmental modelling, tissue engineering, disease modelling, and drug design and development
(Zhu and Huangfu 2013; Yap et al. 2015). This thesis is focussed on the first of these, utilising PPSCs
to recapitulate aspects of human development in vitro to gain insights into the role of C5aR1 in human
development.
Prior to the advent of PPSCs, the majority of our knowledge of human development was extrapolated
from model organisms such as mouse, fruit fly, and zebrafish. These organisms are powerful tools in
developmental research, setting the foundation for our knowledge in embryogenesis, and defining the
function of genes and signalling pathways that control development. However, species-species
variation limits the application of discoveries in animal models to the human environment (Milet and
Monsoro-Burq 2012; Zhu and Huangfu 2013). This also applies to the complement system, with
divergent evolution between rodent an primate species leading to alterations in expression and
function of complement family members. The most striking example of this is seen in the receptors
for C3 fragments, CR1, CR2, CR1-related gene/protein Y (Crry), and CD46. In humans, the receptors
CR1 and CR2 are encoded by separate genes, with separate functions in the regulation of complement
immunity (Jacobson and Weis 2008). In mice however, these receptors are formed via splicing of a
single gene, with expression limited to B cells and follicular dendritic cells (Jacobson and Weis 2008).
Additionally, mouse expression of CD46 is restricted to the testis where it plays a role in the acrosome
reaction. In humans, CD46 is expressed on almost all cell types, with functions as a complement
regulator as well newly discovered roles in T-cell biology (Yamamoto et al. 2013). In mouse, the
complement regulatory functions of human CD46 and CR1 are performed by Crry, which is not
expressed in humans. With regards to C5aR1, the traditional function of this receptor in innate
immunity appears to be conserved between species, however, conservation of non-immune functions
58
of C5aR1 has not been established. It is here where PPSCs provide an exciting platform for the
discovery of novel functions of complement, but also to correlate complement functions seen in
animal models to the human environment. In this thesis, we have used PPSCs to gain insights into
the expression and function of C5aR1 in three developmental stages; in pluripotent stem cells, in
neural progenitor cells, and in post-mitotic cortical neurons.
Neural Differentiation of PPSCs
This thesis has utilised PPSCs as a model of human neurons, as such, it is important to introduce
some of the significant aspects of neural induction of PPSCs. During mammalian development, a
concert of molecular signals direct the progression of cells through germ layer and neurectoderm
formation, to create specific subsets of adult neurons. Both animal and human studies have progressed
the understanding of some of these vital signalling mechanisms, allowing for the development of
chemically defined growth environments to provide the molecular cues for PPSCs to form neurons
in vitro.
Whilst a number of methods are available for PPSC derived neuron generation, the most utilised, with
consistent results and high efficiency, is that of dual SMAD inhibition. First described by Chambers
and colleagues (Chambers et al. 2009), the timed addition of two inhibitors of SMAD signalling such
as noggin and SB431542, restricts PPSC differentiation down mesoderm and endoderm lineages,
guiding the cells towards neuronal specification. Refinement of this protocol has resulted in a high
efficiency generation of neural lineage cells, with the resultant culture approaching 100% neurons or
glia (Shi et al. 2012a). During differentiation, PPSCs have been demonstrated to progress through a
number of vital stages of in vivo mammalian neuronal differentiation. At the initiation of
differentiation, PPSC colonies thicken and form a columnar cell layer similar to the embryonic neural
plate (Krencik and Zhang 2006; Germain et al. 2010). In the embryo, the neural plate then undergoes
a number of morphogenic changes to form the neural tube. This is achieved via a number of
simultaneous and co-ordinated processes including apical constriction, actomyosin contraction, cell
adhesion, proliferation, and convergent extension (Wallingford 2005). Similar processes can be
visualised in vitro, with acquisition of apico-basal polarity and emergence of early neural rosettes
from the thickened columnar cell layer (Elkabetz et al. 2008). The culture of rosettes in the presence
of retinoids directs them towards a cortical progenitor fate (Shi et al. 2012b).These cortical rosettes
display characteristics analogous to the cortical ventricular zone. This includes analogous apico-basal
polarity, with localisation of proteins such as prominin, ZO-1, and N-Cadherin to the apical surface
59
of rosettes (Shi et al. 2012b). Furthermore, the characteristic interkinetic nuclear migration of
ventricular zone cells is seen in the neural progenitor cells of rosettes (Shi et al. 2012b; Ziv et al.
2015). The nuclei of rosette neural progenitors shows cell cycle dependent localisation between basal
and apical surfaces, with symmetric apical M phase division yielding two rosette progenitor cells,
whilst asymmetric division at the basal surface of results in loss of apical attachment, and migration
and maturation of neural progenitors.
Figure 1.5.1 Differentiation of hPSCs to neurons. Graphical representation of the differentiation
protocol for the generation of cortical neurons and glia. After 10 days of dual SMAD inhibition,
human pluripotent stem cells (hPSCs) have progressed to form neuroepithelial progenitors. With
further maturation in the presence of retinoids, formation of cortical rosettes and later, mature neurons
and glia, is seen.
Continued culture of these neural progenitors allows for progressive maturation of neurons, resulting
in cultures of excitatory glutamatergic neurons and glia. This includes spontaneous and induced
depolarisation of neurons, with the formation of functional synapses between neuronal cells (Shi et
al. 2012b). Whilst the efficient derivation of more specific neuronal subtypes represents an ongoing
area of research, it has been shown that subtypes such as dopaminergic and motor neurons can be
60
enriched for in neuronal culture (Wilson and Stice 2006). In this thesis, we utilise an adaptation of
the dual SMAD inhibition protocol to generate both neural rosettes and post-mitotic neurons for the
investigation of C5aR1 expression and function in these cell populations.
References
Chambers, Stuart M., Christopher A. Fasano, Eirini P. Papapetrou, Mark Tomishima, Michel
Sadelain, and Lorenz Studer. 2009. 'Highly efficient neural conversion of human ES and iPS
cells by dual inhibition of SMAD signaling', Nature biotechnology, 27: 275-80.
Elkabetz, Y., G. Panagiotakos, G. Al Shamy, N. D. Socci, V. Tabar, and L. Studer. 2008. 'Human
ES cell-derived neural rosettes reveal a functionally distinct early neural stem cell stage',
Genes Dev, 22: 152-65.
Germain, N., E. Banda, and L. Grabel. 2010. 'Embryonic stem cell neurogenesis and neural
specification', J Cell Biochem, 111: 535-42.
Jacobson, Amanda C., and John H. Weis. 2008. 'Comparative Functional Evolution of Human and
Mouse CR1 and CR2', Journal of Immunology (Baltimore, Md. : 1950), 181: 2953-59.
Krencik, Robert, and Su-Chun Zhang. 2006. 'Stem cell neural differentiation: a model for chemical
biology', Current Opinion in Chemical Biology, 10: 592-97.
Milet, C., and A. H. Monsoro-Burq. 2012. 'Embryonic stem cell strategies to explore neural crest
development in human embryos', Dev Biol, 366: 96-9.
Shi, Y., P. Kirwan, and F. J. Livesey. 2012a. 'Directed differentiation of human pluripotent stem
cells to cerebral cortex neurons and neural networks', Nat Protoc, 7: 1836-46.
Shi, Yichen, Peter Kirwan, James Smith, Hugh P. C. Robinson, and Frederick J. Livesey. 2012b.
'Human cerebral cortex development from pluripotent stem cells to functional excitatory
synapses', Nat Neurosci, 15: 477-86.
Takahashi, K., K. Tanabe, M. Ohnuki, M. Narita, T. Ichisaka, K. Tomoda, and S. Yamanaka. 2007.
'Induction of pluripotent stem cells from adult human fibroblasts by defined factors', Cell,
131: 861-72.
Thomson, J. A., J. Itskovitz-Eldor, S. S. Shapiro, M. A. Waknitz, J. J. Swiergiel, V. S. Marshall,
and J. M. Jones. 1998. 'Embryonic stem cell lines derived from human blastocysts', Science,
282: 1145-7.
Wallingford, J. B. 2005. 'Neural tube closure and neural tube defects: studies in animal models
reveal known knowns and known unknowns', Am J Med Genet C Semin Med Genet, 135c:
59-68.
61
Wilson, P. G., and S. S. Stice. 2006. 'Development and differentiation of neural rosettes derived
from human embryonic stem cells', Stem Cell Rev, 2: 67-77.
Yamamoto, Hidekazu, Antonella Francesca Fara, Prokar Dasgupta, and Claudia Kemper. 2013.
'CD46: The ‘multitasker’ of complement proteins', The International Journal of
Biochemistry & Cell Biology, 45: 2808-20.
Yap, May Shin, Kavitha R. Nathan, Yin Yeo, Lee Wei Lim, Chit Laa Poh, Mark Richards, Wei
Ling Lim, Iekhsan Othman, and Boon Chin Heng. 2015. 'Neural Differentiation of Human
Pluripotent Stem Cells for Nontherapeutic Applications: Toxicology, Pharmacology, and In
Vitro Disease Modeling', Stem Cells International, 2015: 11.
Zhu, Z., and D. Huangfu. 2013. 'Human pluripotent stem cells: an emerging model in
developmental biology', Development, 140: 705-17.
Ziv, Omer, Assaf Zaritsky, Yakey Yaffe, Naresh Mutukula, Reuven Edri, and Yechiel Elkabetz.
2015. 'Quantitative Live Imaging of Human Embryonic Stem Cell Derived Neural Rosettes
Reveals Structure-Function Dynamics Coupled to Cortical Development', PLOS
Computational Biology, 11: e1004453.
62
2. The role of C5aR1 in pluripotency
Complement C5a Promotes Human Embryonic Stem Cell Pluripotency
in the Absence of FGF2 Owen A. Hawksworth1, Liam G. Coulthard1, Stephen M. Taylor1, Ernst J. Wolvetang2,*,
Trent M. Woodruff1,*
1School of Biomedical Sciences, The University of Queensland, St Lucia, Brisbane, QLD, 4072,
Australia
2Australian Institute for Bioengineering & Nanotechnology, The University of Queensland, St. Lucia,
Brisbane, QLD, 4072, Australia
Published in Stem Cells
63
Abstract
The complement activation product, C5a, is a pivotal member of the innate immune response;
however, a diverse number of non-immune functions are now being ascribed to C5a signalling,
including roles during embryonic development. Here we identify the expression of the C5a precursor
protein, C5, as well as the C5a receptors, C5aR and C5L2, in both human embryonic stem cells
(hESCs) and human induced pluripotent stem cells (hiPSCs). We show that administration of a
physiologically relevant dose of purified human C5a (1nM) stimulates activation of ERK1/2 and AKT
signalling pathways, and is able to promote maintenance of pluripotency in the absence of FGF2. C5a
also reduced cell loss following dissociation of human pluripotent stem cells. Our results reveal that
complement C5a signalling supports human stem cell pluripotency and survival, and thus may play
a key role in shaping early human embryonic development.
64
Introduction
The complement system is a fundamental component of the innate immune response, traditionally
associated with the protection of the host against foreign pathogens through the recruitment and
activation of immune cells to sites of infection or injury (Ricklin and Lambris 2013; Woodruff et al.
2009). More recently, varied and complex roles for complement are being uncovered, including roles
in tissue regeneration and cell survival, as well as in embryonic and fetal development (Strey et al.
2003; Kimura et al. 2003; Sayah et al. 2003; Tse et al. 2008; Usami et al. 2010; Denny et al. 2013b).
Complement factor C5 is a major and central member of the complement system. C5 remains inactive
until cleaved by complement convertases, or cell-derived proteases, to generate the fragment C5a, a
potent inflammatory mediator and key component of the innate immune response (Guo and Ward
2005; Manthey et al. 2009; Pavlovski et al. 2012). This anaphylatoxin elicits its effects primarily
through binding the G-protein coupled receptor, C5aR, and subsequent activation of cell specific
signalling pathways, including ERK1/2 and AKT pathways (Sayah et al. 2003; Schraufstatter et al.
2009). C5a can also bind to a second receptor, C5L2, which, though structurally homologous to C5aR,
is not G-protein coupled. As such, the role for C5L2 in C5a mediated-functions is yet to be
conclusively demonstrated (Li et al. 2013).
We recently identified that C5aR is present during prenatal development, facilitating neural tube
closure in mouse models of folic acid deficiency(Denny et al. 2013a). However, it is not yet known
how early in development C5a signalling occurs, and whether such roles extend to human embryonic
development. The present study thus utilised human embryonic stem cells (hESCs) and human
induced pluripotent stem cells (hiPSCs) to determine a potential involvement of C5a signalling in
early human embryogenesis.
65
Materials & Methods
Cell Culture
hESCs and hiPSCs were maintained on Matrigel (BD Biosciences, San Diego, CA,
http:/www.bdbiosciences.com) coated dishes in mouse embryonic fibroblast conditioned KSR
medium (Dulbecco’s modified Eagle’s medium (DMEM)/F12 supplemented with 20% knockout
serum replacement (KOSR), 0.1 mM non-essential amino acids, 1 mM L-glutamine, 0.1 mM β-
mercaptoethanol, and 10ng/ml human basic fibroblast growth factor (FGF2)) as previously
described(Briggs et al. 2013) (all sourced from Life Technologies, Carlsbad, CA,
http://www.invitrogen.com). For some experiments, cells were treated with purified human C5a
(1nM; Comptech, Tyler, TX, http://www.complementtech.com) (Halai et al. 2012), and the C5aR
antagonist, AcF-[OPdChaWR] (PMX53) (Woodruff et al. 2011).
Immunocytochemistry
hPSCs were fixed in 4% paraformaldehyde (Sigma-Aldrich, St. Louis, MO,
http://www.sigmaaldrich.com) for 20min, permeabilised with 0.1% Triton-X-100 (Sigma-Aldrich)
for 20min, blocked with 4% goat serum in phosphate buffered saline (PBS) (Life Technologies) for
30min. Primary antibodies C5 (1:500 Hycult Biotech, Uden, The Netherlands,
http://www.hycultbiotech.com), C5aR (1:250, AbD Serotec, Kidlington, UK,
http://www.abdserotec.com), C5L2 (clone 4C8; 1:500, gift from Charles Mackay, Monash
University, Melbourne, VIC, Australia) or isotype control antibodies (Life Technologies) were
applied overnight at 4°C. After washing with PBS, samples were incubated with Alexa Fluor-
conjugated secondary antibodies (1:1000, Invitrogen, overnight 4°C), counterstained (1µg/ml 4',6-
diamidino-2-phenylindole (DAPI) for 5 min) and mounted using Prolong Gold (Invitrogen). Samples
were imaged using an Olympus BX61 confocal microscope (Olympus, Tokyo, Japan,
http://www.olympus-global.com).
Reverse Transcriptase Polymerase Chain Reaction (RT-PCR)
mRNA was obtained using ISOLATE RNA Mini Kit (Bioline, London, UK,
http://www.bioline.com) and cDNA synthesised using iScript Select cDNA Synthesis Kit (Bio-Rad,
Hercules, CA, http://www.bio-rad.com). RT-PCR was performed using MyTaq Red Mix (Bioline)
using the following primer sequences: C5 fwd GTGGCATTAGCAGCAGTGGACAGTG, C5 rev
GCAGGCTCCATCGTAACAACATTTC; C5aR1 fwd TCCTTCAATTATACCACCCCTGA,
C5aR1 rev GGAAGACGACTGCAAAGATGA; GPR77 fwd CCTGGTGGTCTACGGTTCAG,
GPR77 rev GGGCAGGATTTGTGTCTGTT; ACTB fwd ATGATGATATCGCCGCGCTC, ACTB
66
rev GCGCTCGGTGAGGATCTTCA. RT-PCR products were separated on a 1% w/v agarose gel
and visualised with ethidium bromide staining under UV light.
Flow Cytometry and Sorting
Flow cytometry was performed on a BD CSampler Accuri C6 flow cytometer (BD Biosciences) as
previously described(Laslett et al. 2007) using anti-C5aR (1:250, AbD Serotec) and anti-OCT4
(1:400, Merck Millipore, Darmstadt, Germany, http://www.millipore.com) primary antibodies. For
sorting, pluripotent hPSCs cells were harvested using TrypLE (Invitrogen), live stained with TRA-
160 antibodies (1:400, Merck Millipore) and sorted using FACS Vantage equipment (BD
Biosciences).
Enzyme-linked Immunosorbent Assay (ELISA)
ELISA for human C5a was performed on hPSC lysates using previously described
methods(Pavlovski et al. 2012) with anti-C5a and biotinylated anti-C5a antibodies (both 1:500, R&D
Systems, Minneapolis, MN http://www.rndsystems.com).
Western Blot Analysis
Western blots were performed as described previously (Shinjyo et al. 2009) using anti-phospho-
p44/42 or anti-phospho-AKT antibodies and total-p44/42 and total-AKT antibodies (all 1:1000, Cell
Signalling Technology, Beverly, MA http://www.cellsignal.com). hESCs were serum starved for 6
hours in DMEM/F12 (Life Technologies) + 0.25% BSA (Invitrogen) after which C5a (1nM) or
vehicle control were added. Samples were collected at 0, 5, 10, 30 and 60min post drug addition using
RIPA lysis buffer containing protease and phosphatase inhibitor cocktails (all from Thermo Fisher
Scientific, Waltham, MA, http://www.thermofisher.com). Cell lysates were collected and protein
concentration quantified using a bicinchoninic acid assay (Thermo Fisher). Protein samples were
solubilized in SDS-PAGE sample buffer (62.5 mM Tris-HCl, pH 6.8, 5% β-mercaptoethanol, 2%
SDS, 5% sucrose, 0.005% bromophenol blue) and incubated at 95°C for 5min. Proteins were
separated on 12.5% gels followed by transfer onto a polyvinylidene fluoride membrane. Membranes
were blocked in 5% BSA in TBS-Tween for 1 hour at room temperature and incubated with anti-
phospho-p44/42 or anti-phospho-AKT antibodies in blocking buffer overnight at 4°C. Anti-rabbit
HRP conjugate incubation was then performed for 2 hours at room temperature followed by
chemiluminescent detection (GE Healthcare, Little Chalfont, UK, http://www.gehealthcare.com) and
exposure to x-ray film for visualisation of protein bands. Membranes were then stripped and re-
probed for total-p44/42 and total-AKT (both 1:1000, Cell Signalling), to which phosphorylated
67
protein levels were normalised and analysed using NIH ImageJ software v1.47
(http://rsbweb.nih.gov/ij/).
Pluripotency Assay
After adaption to culture in mTESR medium (Stem Cell Technologies, Vancouver, Canada
http://www.stemcell.com), cells were cultured for 10 days in FGF2-free mTeSR, in the presence or
absence of 1nM C5a, 10ng/ml FGF2, or vehicle control. Pluripotency was assessed in EOS-EGFP
pluripotency reporter hESC16 by GFP flow cytometry, and in hESC using flow cytometric
quantification of Oct-4 following cell dissociation with TrypLE (Invitrogen).
Dissociation induced apoptosis assay
Dissociation induced apoptotic events were quantified as described17 using CyQuant DNA dye
(Invitrogen) according to the manufacturer’s protocol.
Statistical Analyses
Graphing and statistics were performed using GraphPad Prism Software 6.0c (GraphPad
Software, LaJolla, CA, http://www.graphpad.com/), using Student’s t test and one-way ANOVA with
Dunnett post-test for the relevant statistical analysis.
68
Results and Discussion
C5, C5aR and C5L2, are Expressed in Pluripotent Stem Cells. To determine if C5 and C5a
receptors are present in human pluripotent stem cells we performed RT-PCR analysis of TRA-160
sorted hPSCs (three hESC and two hiPSC lines) and identified robust expression of C5, C5aR and
C5L2 in all lines, with higher levels of C5L2 in HES3 and MEL2 hESCs (Fig. 1A). Protein translation
was confirmed by immunocytochemistry in hESC (H9) and hiPSC lines (Fig. 1B), revealing punctate
staining for C5 and C5L2 and more diffuse staining for C5aR. Flow cytometry demonstrated uniform
expression of C5aR in the majority of cells (Fig. 1C&D). The active C5 fragment, C5a, was detected
by ELISA in both hESC (7.5±0.2 ng/ml) and hiPSC (6.6±0.3 ng/ml) cell lysates (Fig. 1E).
C5a Activates ERK1/2 and AKT Signalling. We next aimed to determine if these C5a receptors
were functionally coupled, administering purified human C5a and examining for phosphorylation of
ERK1/2 or AKT proteins, two members of second messenger signalling families through which C5aR
is known to signal and be of importance in adult stem cell biology(Schraufstatter et al. 2009). We
found that a low physiological dose (1nM) of C5a resulted in a significant and transient increase in
of ERK1/2 protein phosphorylation, peaking to a 6-fold increase between 5 to 10 min, and subsiding
by 30 min post-stimulation (Fig. 2A). This level of activation was comparable to that induced by
FGF2, a pivotal hESC signalling protein, suggesting C5a elicited a biologically relevant cellular
response. Pre-treatment with the specific C5aR antagonist PMX53(Woodruff et al. 2011) prior to C5a
addition was able to inhibit this response, demonstrating that ERK1/2 phosphorylation was mediated
through C5aR. A similar activation profile was observed for AKT phosphorylation (Fig 2B),
however, this was not significantly inhibited by PMX53, suggesting an alternate route of activation,
potentially through the second C5a receptor, C5L2. In order to determine whether an increased
concentration of C5a may potentiate second messenger phosphorylation, we next examined AKT
phosphorylation at 10 and 30min with both 1nM and 10nM C5a (Fig. 2D). No increase in either
phosphorylation level or duration was detected. hiPSCs were also examined for second messenger
activation, with a similar profile to hESC observed for AKT phosphorylation (Fig. 2C).
69
Figure 1: Expression of complement factors C5, C5aR and C5L2 on hESC and hiPSC. (A) RT-
PCR analysis for mRNA expression of the complement factors C5, C5aR and C5L2. Expression of
the complement factors was detected across all hESC (H9, HES3, MEL2) and hiPSC (C11, C32) lines
examined. The monocytic cell line, U937, used as a positive control, and no template (-ve) control,
are also shown. Minus reverse transcriptase (-RT) controls were also performed (not shown) (B)
Immunocytochemical detection of complement proteins C5, C5aR and C5L2, and the pluripotent
marker OCT4, in both hESCs (H9) and hiPSCs (C11). Images display both the relevant protein of
interest (green) and the nuclear stain DAPI (blue). Scale bars = 10 µm. (C&D) Flow cytometry results
for the hESC line, H9, demonstrating uniform expression of C5aR within the hPSC population.
70
Figure 2: C5a receptor activation results in transient phosphorylation of ERK and AKT
signalling proteins in the hESC line, H9. (A) ERK1/2 and AKT phosphorylation was induced by
1nM C5a, peaking between 5-10min and subsiding by 30min. ERK1/2 phosphorylation was inhibited
by the C5aR antagonist, PMX53 (1µM), whilst AKT phosphorylation was unaffected. Levels of
phosphorylation were comparable to 10ng/ml FGF2. Error bars represent SEM (n=3); *, p < .05; **,
p <0.01; ***, p <0.001
71
C5a Promotes Pluripotency. Since FGF2-induced ERK1/2 signalling is indispensable for the
maintenance of pluripotency, we next investigated whether C5a was able to support pluripotency in
the absence of FGF2. Using a defined culture medium devoid of FGF2 (mTeSR) we assessed the
ability of 1nM C5a to maintain pluripotency over a 10 day period as compared to 10ng/ml FGF2 using
a HES3 hESC line stably transfected with the EOS-GFP pluripotency reporter(Titmarsh et al. 2013).
As expected, strong GFP expression was maintained in the FGF2 treated cells, whilst in the absence
of FGF2, GFP expression was gradually lost (Fig 3A). Intriguingly, both morphology (Fig 3A) and
flow cytometric quantification of GFP expression (Fig 3B) showed that daily C5a (1nM)
supplementation caused a significant increase in GFP-positive pluripotent cells (69±2.9%), as
compared to vehicle control treated cells (51±6.4%). To verify these data we assessed OCT-4 protein
expression by immunostaining and FACS in the genetically unmodified H9 hESC line following 7-
day culture in the presence or absence of C5a. We again detected significant increase in OCT-4 positive
pluripotent cells (53±3.6%) in the C5a-treated groups as compared to vehicle controls (32±0.6%) (Fig.
3C&D). This result was repeatable in hiPSCs, with a significant increase in OCT-4 positive cells
(53±1.5%) in the C5a-treated groups as compared to vehicle controls (43±2.1%) (Fig. 3F). We
conclude that C5a is able to substitute, at least in part, for FGF2 in maintaining pluripotency of hESC,
likely through C5aR-mediated activation of ERK1/2.
As previously stated, C5a was detected in hPSC lysates, raising the question of endogenous C5aR
activation. The C5a-mediated increase in OCT-4 positive pluripotent cells was able to be inhibited by
the specific C5aR antagonist, PMX53 (Fig. 3E), demonstrating a C5aR mediated response; however,
the addition of PMX53 alone had no effect on OCT-4 positive cells, suggesting the previously detected
endogenous C5a was not able to interact with C5aR in the basal hPSC state.
Evidently, daily addition of a low concentration of C5a is unable to facilitate continued maintenance
in the absence of FGF2. This may suggest that either C5a signalling alone is insufficient to supplant
FGF2 in maintenance of pluripotency of hESCs, or potentially, that a single daily C5a dose is unable
to induce sufficient and repeated activation of ERK signalling due to factors such as receptor
tachyphylaxis and/or C5a degradation(Webster et al. 1982; Naik et al. 1997). Indeed, due to the
relatively rapid degradation of FGF2 in culture, high FGF2 concentrations are necessary to ensure
sufficient ligand concentrations over time for continued ERK1/2 activation(Chen et al. 2012); and less
stable forms of FGF, such as FGF1, are only able to maintain pluripotency when added at increased
frequency (Chen et al. 2012). Higher concentrations of C5a (10nM) were not able to potentiate the
observed phenotype (Fig. 3E); however, as C5a is a short-lived peptide in plasma, and is relatively
instable in culture(Scola et al. 2009; Webster et al. 1982), it is plausible that increased frequency of
C5a administration, or the development of stable C5a agonists may be able to supplant this deficit.
72
Figure 3: C5a promotes pluripotency in hESC in the absence of FGF2. (A) Representative images of HES3 EOS (OCT4/SOX2 GFP reporter) line at 0 and 10 days in custom mTeSR medium in the presence or absence of C5a (1nM) or FGF2 (10ng/ml). GFP-positive cells (green) represent those which remain pluripotent. Scale bars = 250 µm (B) Flow cytometry of cells shown in (A) for GFP positive cells at day 10. A significant increase in remaining pluripotent cells was seen in the C5a (1nM) group in comparison to the vehicle control (n=4). (C&D) Similar results were seen in the hESC line, H9. Representative histogram and quantification of results are shown for remaining OCT-4 positive cells as detected by immunostaining and flow cytometry. A significant increase in OCT-4 positive cells in the C5a (1nM) group in comparison to vehicle control was observed. Data in B&D are normalised to the FGF2 response for each experiment. Error bars represent SEM (n=3 independent experiments); *, p < 0.05.
73
C5a Increases Single Cell Survival. Dissociation of hPSCs to single cells results in extensive
apoptosis(Chen et al. 2010; Ohgushi et al. 2010) due to loss of E-cadherin mediated cell-cell contact
and subsequent activation of rho-associated protein kinase (ROCK) signalling(Ohgushi et al. 2010).
Since C5a can affect regulation of the ROCK pathway, surface expression of integrin and cadherin
family members, and, independent from these functions, can act as a pro-survival factor(Morris et al.
2011; Liu et al. 2011; Strainic et al. 2008; Ulfman et al. 2005), we next examined whether C5a could
have a similar function in hPSC. We therefore treated H9 hESC with 1nM C5a, or vehicle alone, 1
hour prior to enzymatic single cell dissociation and quantified cell survival of these single cell
dissociated cultures after 16 hours. A significant (P<0.001) 25% increase in cell number was observed
in the C5a-treated group as compared to vehicle control (Fig. 4A), suggesting C5a receptor signalling
also impacts cell survival following dissociation events. This result was repeatable in hiPSCs, with
a significant increase in cell number observed in the C5a-treated group in comparison to the control
(135.8±12.7%, Fig. 4B).
Figure 4: C5a increases cell number following single cell dissociation of hESC. H9 hESCs were
enzymatically dissociated to single cells and plated following a 1 hour pre-treatment with 1nM C5a.
After seeding overnight, total cell numbers were quantified using fluorescent DNA dye, and
demonstrate C5a significantly increases cell survival following dissociation. Error bars represent
SEM (n=5 independent experiments); ***, p <0.001
74
Conclusion
This study has identified expression of functional complement C5a receptors in hPSCs, and
demonstrated a novel role for C5a in pluripotency and dissociation-induced apoptotic events. These
studies demonstrate an unexpected role for this highly evolutionarily conserved innate immune
pathway in very early developmental processes, and may inform the development of novel culture
media for human pluripotent stem cells.
75
References
Briggs, J. A., J. Sun, J. Shepherd, D. A. Ovchinnikov, T. L. Chung, S. P. Nayler, L. P. Kao, C. A.
Morrow, N. Y. Thakar, S. Y. Soo, T. Peura, S. Grimmond, and E. J. Wolvetang. 2013.
'Integration-free induced pluripotent stem cells model genetic and neural developmental
features of down syndrome etiology', STEM CELLS, 31: 467-78.
Chen, G., D. R. Gulbranson, P. Yu, Z. Hou, and J. A. Thomson. 2012. 'Thermal stability of fibroblast
growth factor protein is a determinant factor in regulating self-renewal, differentiation, and
reprogramming in human pluripotent stem cells', Stem Cells, 30: 623-30.
Chen, G., Z. Hou, D. R. Gulbranson, and J. A. Thomson. 2010. 'Actin-myosin contractility is
responsible for the reduced viability of dissociated human embryonic stem cells', Cell Stem
Cell, 7: 240-8.
Denny, K. J., L. G. Coulthard, A. Jeanes, S. Lisgo, D. G. Simmons, L. K. Callaway, B. Wlodarczyk,
R. H. Finnell, T. M. Woodruff, and S. M. Taylor. 2013a. 'C5a receptor signaling prevents
folate deficiency-induced neural tube defects in mice', J Immunol, 190: 3493-9.
Denny, K. J., A. Jeanes, K. Fathe, R. H. Finnell, S. M. Taylor, and T. M. Woodruff. 2013b. 'Neural
tube defects, folate, and immune modulation', Birth Defects Res A Clin Mol Teratol, 97: 602-
9.
Guo, Ren-Feng, and Peter A. Ward. 2005. 'role of C5a in inflammatory responses', Annual Review of
Immunology, 23: 821-52.
Halai, Reena, Daniel E. Croker, Jacky Y. Suen, David P. Fairlie, and Matthew A. Cooper. 2012. 'A
Comparative Study of Impedance versus Optical Label-Free Systems Relative to Labelled
Assays in a Predominantly Gi Coupled GPCR (C5aR) Signalling', Biosensors, 2: 273-90.
Kimura, Yuko, Mayur Madhaven, Mindy K. Call, William Santiago, Panagiotis A. Tsonis, John D.
Lambris, and Katia Del Rio-Tsonis. 2003. 'Expression of complement 3 and complement 5 in
newt limb and lens regeneration', Journal of Immunology, 170: 2331-39.
Laslett, A. L., S. Grimmond, B. Gardiner, L. Stamp, A. Lin, S. M. Hawes, S. Wormald, D. Nikolic-
Paterson, D. Haylock, and M. F. Pera. 2007. 'Transcriptional analysis of early lineage
commitment in human embryonic stem cells', BMC Dev Biol, 7: 12.
Li, R., L. G. Coulthard, M. C. Wu, S. M. Taylor, and T. M. Woodruff. 2013. 'C5L2: a controversial
receptor of complement anaphylatoxin, C5a', FASEB J, 27: 855-64.
Liu, F., R. Gou, J. Huang, P. Fu, F. Chen, W. X. Fan, Y. Q. Huang, L. Zang, M. Wu, H. Y. Qiu, and
D. P. Wei. 2011. 'Effect of anaphylatoxin C3a, C5a on the tubular epithelial-myofibroblast
transdifferentiation in vitro', Chin Med J (Engl), 124: 4039-45.
76
Manthey, Helga D., Trent M. Woodruff, Stephen M. Taylor, and Peter N. Monk. 2009. 'Complement
component 5a (C5a)', The International Journal of Biochemistry & Cell Biology, 41: 2114-
17.
Morris, A. C., M. Brittan, T. S. Wilkinson, D. F. McAuley, J. Antonelli, C. McCulloch, L. C. Barr,
N. A. McDonald, K. Dhaliwal, R. O. Jones, A. Mackellar, C. Haslett, A. W. Hay, D. G.
Swann, N. Anderson, I. F. Laurenson, D. J. Davidson, A. G. Rossi, T. S. Walsh, and A. J.
Simpson. 2011. 'C5a-mediated neutrophil dysfunction is RhoA-dependent and predicts
infection in critically ill patients', Blood, 117: 5178-88.
Naik, N., E. Giannini, L. Brouchon, and F. Boulay. 1997. 'Internalization and recycling of the C5a
anaphylatoxin receptor: evidence that the agonist-mediated internalization is modulated by
phosphorylation of the C-terminal domain', J Cell Sci, 110 ( Pt 19): 2381-90.
Ohgushi, M., M. Matsumura, M. Eiraku, K. Murakami, T. Aramaki, A. Nishiyama, K. Muguruma,
T. Nakano, H. Suga, M. Ueno, T. Ishizaki, H. Suemori, S. Narumiya, H. Niwa, and Y. Sasai.
2010. 'Molecular pathway and cell state responsible for dissociation-induced apoptosis in
human pluripotent stem cells', Cell Stem Cell, 7: 225-39.
Pavlovski, D., J. Thundyil, P. N. Monk, R. A. Wetsel, S. M. Taylor, and T. M. Woodruff. 2012.
'Generation of complement component C5a by ischemic neurons promotes neuronal
apoptosis', FASEB J, 26: 3680-90.
Ricklin, D., and J. D. Lambris. 2013. 'Complement in immune and inflammatory disorders:
pathophysiological mechanisms', J Immunol, 190: 3831-8.
Sayah, S., A.C. Jauneau, C. Patte, M.C. Tonon, H. Vaudry, and M. Fontaine. 2003. 'Two different
transduction pathways are activated by C3a and C5a anaphylatoxins on astrocytes', Mol.
Brain. Res., 112: 53-60.
Schraufstatter, I. U., R. G. DiScipio, M. Zhao, and S. K. Khaldoyanidi. 2009. 'C3a and C5a are
chemotactic factors for human mesenchymal stem cells, which cause prolonged ERK1/2
phosphorylation', J. Immunol., 182: 3827-36.
Scola, A. M., K. O. Johswich, B. P. Morgan, A. Klos, and P. N. Monk. 2009. 'The human complement
fragment receptor, C5L2, is a recycling decoy receptor', Mol Immunol, 46: 1149-62.
Shinjyo, Noriko, Anders Ståhlberg, Mike Dragunow, Milos Pekny, and Marcela Pekna. 2009.
'Complement-Derived Anaphylatoxin C3a Regulates In Vitro Differentiation and Migration
of Neural Progenitor Cells', STEM CELLS, 27: 2824-32.
Strainic, M. G., J. Liu, D. Huang, F. An, P. N. Lalli, N. Muqim, V. S. Shapiro, G. R. Dubyak, P. S.
Heeger, and M. E. Medof. 2008. 'Locally produced complement fragments C5a and C3a
provide both costimulatory and survival signals to naive CD4+ T cells', Immunity, 28: 425-
35.
77
Strey, C. W., M. Markiewski, D. Mastellos, R. Tudoran, L. A. Spruce, L. E. Greenbaum, and J. D.
Lambris. 2003. 'The proinflammatory mediators C3a and C5a are essential for liver
regeneration', Journal of Experimental Medicine, 198: 913-23.
Titmarsh, D. M., D. A. Ovchinnikov, E. J. Wolvetang, and J. J. Cooper-White. 2013. 'Full factorial
screening of human embryonic stem cell maintenance with multiplexed microbioreactor
arrays', Biotechnol J, 8: 822-34.
Tse, P. K., Y. L. Lee, W. N. Chow, J. M. C. Luk, K. F. Lee, and W. S. B. Yeung. 2008.
'Preimplantation embryos cooperate with oviductal cells to produce embryotrophic
inactivated complement-3b', Endocrinology, 149: 1268-76.
Ulfman, L. H., J. Alblas, C. W. van Aalst, J. J. Zwaginga, and L. Koenderman. 2005. 'Differences in
potency of CXC chemokine ligand 8-, CC chemokine ligand 11-, and C5a-induced
modulation of integrin function on human eosinophils', J Immunol, 175: 6092-9.
Usami, Makoto, Katsuyoshi Mitsunaga, Atsuko Miyajima, Momoko Sunouchi, and Osamu Doi.
2010. 'Complement component C3 functions as an embryotrophic factor in early
postimplantation rat embryos', International Journal of Developmental Biology, 54: 1277-85.
Webster, R. O., G. L. Larsen, and P. M. Henson. 1982. 'In vivo clearance and tissue distribution of
C5a and C5a des arginine complement fragments in rabbits', J Clin Invest, 70: 1177-83.
Woodruff, T. M., K. S. Nandakumar, and F. Tedesco. 2011. 'Inhibiting the C5-C5a receptor axis',
Mol Immunol, 48: 1631-42.
Woodruff, Trent M., Rahasson R. Ager, Andrea J. Tenner, Peter G. Noakes, and Stephen M. Taylor.
2009. 'The role of the complement system and the activation fragment C5a in the central
nervous system', Neuromolecular Medicine, 12: 179-92.
78
3. C5aR1 Signaling in Neural Progenitor Cells
Complement C5aR1 Signaling Promotes Polarization and Proliferation
of Embryonic Neural Progenitor Cells through PKCζ.
Liam G. Coulthard* a,b, Owen A. Hawksworth* c,d,, Rui Lic, Anushree Balachandrand, John D. Leec,
Farshid Sepehrbande,f, Nyoman Kurniawane, Angela Jeanesc, David G. Simmonsc, Ernst Wolvetangd,2
& Trent M. Woodruffc,2
aRoyal Brisbane and Women’s Hospital, Herston, QLD, Australia bSchool of Medicine, The University of Queensland, Herston, QLD, Australia cSchool of Biomedical Sciences, The University of Queensland, St Lucia, QLD, Australia dAustralian Institute for Bioengineering and Nanotechnology, The University of Queensland, St
Lucia, QLD, Australia eCentre for Advanced Imaging, The University of Queensland, St Lucia, QLD, Australia fLaboratory of Neuro Imaging, USC Mark and Mary Stevens Neuroimaging and Informatics Institute,
Keck School of Medicine, University of Southern California, Los Angeles, CA, USA.
*These authors contributed equally.
2Corresponding authors.
Published in Journal of Neuroscience
The work presented within this chapter represents the combined effort of a number of researchers. This has culminated
in the publication of this research in the Journal of Neuroscience, for which the text of this chapter is of this final published
work. The author contributions have been acknowledged and outlined in the preliminary pages.
79
Abstract
The complement system, typically associated with innate immunity, is emerging as a key controller
of non-immune systems including in development, with recent studies linking complement mutations
with neurodevelopmental disease. A key effector of the complement response is the activation
fragment C5a which, through its receptor C5aR1, is a potent driver of inflammation. Surprisingly,
C5aR1 is also expressed during early mammalian embryogenesis, however no clearly defined
function is ascribed to C5aR1 in development. Here we demonstrate polarized expression of C5aR1
on the apical surface of mouse embryonic neural progenitor cells in vivo, and on human embryonic
stem cell derived neural progenitors. We further show that signaling of endogenous C5a during mouse
embryogenesis drives proliferation of neural progenitor cells within the ventricular zone, and was
required for normal brain histogenesis. C5aR1 signaling in neural progenitors was dependent on
atypical protein kinase C zeta (PKCζ), a mediator of stem cell polarity, with C5aR1 inhibition
reducing proliferation and symmetric division of apical neural progenitors in human and mouse
models. C5aR1 signaling was shown to promote the maintenance of cell polarity, with exogenous
C5a increasing the retention of polarized rosette architecture in human neural progenitors following
physical or chemical disruption. Transient inhibition of C5aR1 during neurogenesis in developing
mice led to behavioral abnormalities in both sexes and MRI-detected brain microstructural alterations,
in studied males, demonstrating a requirement of C5aR1 signaling for appropriate brain development.
This study thus identifies a functional role for C5a-C5aR1 signaling in mammalian neurogenesis, and
provides mechanistic insight into recently identified complement gene mutations and brain disorders.
80
Introduction
The key complement activation fragment, anaphylatoxin C5a, and its primary receptor, C5aR1, play
pivotal roles in inflammation and immune defense. However, it is increasingly recognized that this
evolutionarily ancient system also possesses unexpected roles in development, such as in
morphogenesis, neurogenesis, migration, and neuronal synapse pruning (Hawksworth et al., 2016;
Gorelik et al., 2017). Defects in complement signaling have been associated with neurodevelopmental
abnormalities such as autism, schizophrenia, and 3MC syndrome (Corbett et al. 2007; Rooryck et al.
2011; Sekar et al. 2016)
Despite these emerging developmental roles of complement, the functional role of C5aR1 in
embryonic development remains poorly defined. During organogenesis of Xenopus embryos, C5 is
expressed in the neural plate of the developing nervous system (McLin et al. 2008), and in mice and
humans, C5 and C5aR1 are expressed in the developing neural tube (Denny et al. 2013). Postnatally,
C5a-C5aR1 expression continues in neural stem cells in vitro, is expressed in migrating neuroblasts
in response to ischemia (Rahpeymai et al. 2006), and promotes the proliferation of progenitor cells
within the external granular layer of the post-natal rat cerebellum (Benard et al. 2008). We also
previously demonstrated that C5 and C5aR1 are expressed in human embryonic stem cells, and can
regulate pluripotency (Hawksworth et al. 2014). This early embryonic expression pattern of C5aR1
in the absence of other factors of the canonical pathogen-initiated complement cascade (Jeanes et al.
2015), suggests that C5aR1 signaling has adopted additional roles in mammalian development
beyond innate immunity. However, despite this clear expression of C5a receptors during brain
development, a neurodevelopmental role for C5a remains poorly defined.
To investigate the role of C5aR1 in neural progenitor cell physiology we utilized both mouse models
and human embryonic stem (hES) cells differentiated to a stage resembling the ventricular zone of
the developing brain. In these hES-derived cultures, neural rosettes are formed that display apical
polarization and interkinetic nuclear migration of periluminal cells, similar to that seen during
neurulation and in the cortical ventricular zone (Shi et al. 2012; Ziv et al. 2015). The signaling
mechanisms in the control of rosette polarity are highly conserved and the localization of the
Par3/Par6/PKCζ complex to the apical membrane is essential for self-renewal of neural progenitors
through the orchestration of the balance between symmetric and asymmetric division (Fietz and
Huttner 2011). Here, we show that C5aR1 is a regulator of the apicobasal polarity of neural stem cells
and that the acute pharmacological blockade of C5aR1 signaling during neurogenesis results in
reduced ventricular zone proliferation and cerebral disorganization, leading ultimately to behavioral
alterations. Collectively our data reveal that C5aR1 functions as a regulator of mammalian brain
81
development under normal physiological conditions in both mice and humans. This work
complements recent studies documenting mutations in complement activation pathways that
contribute to an increased risk of neurodevelopmental disorders.
82
Materials & Methods
Reagents
Mouse recombinant C5a (mC5a) was obtained from Sigma Aldrich and reconstituted in 0.25% BSA
in PBS. Human isolated C5a (hC5a) was obtained from CompTech, USA. PMX53 was synthesized
as previously described (Pavlovski et al. 2012), stored lyophilized and reconstituted in purified water
before use.
Tissue Collection and Processing
All animal experiments in this study were performed with prior approval from the animal ethics
committee of the University of Queensland. Animal housing and time-mating of mice was provided,
with thanks, from University of Queensland Biological Resources. Tissues were collected after
sacrifice by cervical dislocation. Tissues preserved for RNA/protein analysis were snap frozen in
liquid nitrogen and stored at -80°C until extraction. Protein was extracted using modified RIPA buffer
prepared in-house. Tissues used for histological analysis were incubated at 4°C overnight in freshly
prepared 4% paraformaldehyde. Tissues were prepared for cryosection by sequential passaging
through serial sucrose solutions (10%, 20%, 30%), removed into OCT for freezing and sectioned at
12μm, unless otherwise stated.
Embryonic cerebrospinal fluid (CSF) was obtained from E13.5 embryos using a pulled glass pipette
attached to a vacuum. Pooled CSF from three litters was used in analysis of mC5a concentration
through ELISA. CSF was treated with EDTA (5mM final concentration) to prevent coagulation and
extrinsic complement activation, and stored at -80°C until analysis.
RT-PCR and qPCR
RNA was extracted using RNeasy plus spin columns (QIAGEN, The Netherlands) and treated for
gDNA contamination using Turbo DNase (Life Technologies, USA). All RNA was additionally
checked for gDNA contamination by PCR analysis. Primer sequences and PCR conditions can be
found in Table 1. qPCR performed using SYBR green PCR mastermix (Ambion, USA) and machine
settings according to the manufacturer's instructions. The ΔΔCt method to assess fold-change of gene
expression was employed and all data points within an individual sample were referenced back to
r18s expression levels.
83
Table 1: List of PCR primer sequences and conditions
Western blot
Protein samples (20μg) were subjected to electrophoresis at 100V on a 10% polyacrylamide gel until
good separation was achieved. Primary antibodies directed against C5aR1 (1:500, HBT clone 10/92,
RRID:AB_10130226), phospho-Erk (1:1000, CST #9106, RRID:AB_331768), total-Erk (1:1000,
CST #9102, RRID:AB_330744) and beta-tubulin (1:2000, Sigma Aldrich clone TUB2.1,
AB_10679259) were diluted in 0.5x odyssey blocking buffer (LiCor, Germany) and incubated with
the membrane rocking overnight at 4°C. Incubation with specific Licor odyssey secondary antibodies
was carried out according to the manufacturer's instructions. Blots were imaged using the Licor
odyssey system and software. Optical densitometry values were derived from analysis of the image
in ImageJ (NIH, MD, USA, RRID:SCR_003070).
Immunofluorescence
Tissues or cells were blocked using 0.1% Triton X-100/4% goat serum in PBS for one hour. In the
case of live staining for NE-4C cultures, primary antibody was added to unfixed cells on ice for 30
minutes prior to fixation. Primary antibodies raised against mC5aR1 (HBT clone 10/92, 1:200,
RRID:AB_10130226), Pax6 (R&D #MAB1260, 1:500, RRID:AB_2159696), Phosphohistone H3
(CST #9706, 1:1000, RRID:AB_331749), doublecortin (CST #4604, 1:500, RRID:AB_561007),
Sox2 (CST #3728, 1:500, RRID:AB_2194037), acetylated alpha-tubulin (Sigma Aldrich #T7451,
1:500, RRID:AB_609894), Zo-1 (Life Technologies, #402300, 1:500, RRID:AB_2533457), hC5aR1
(BD, # 550733, 3µg/mL, RRID:AB_393854), C5 (HBT, clone bb5.1, 1:250, RRID:AB_10992443),
Tubb3 (Millipore, MAB1637, 1:1000, RRID:AB_2210524), NCAD (Sigma Aldrich, C3865, 1:2000,
RRID:AB_262097), Arl13b (NeuroMab, 73-287, 1:200, RRID:AB_11000053), PKCζ (Abcam,
Name Species Use Forward (5’-3’)
Reverse (5’-3’)
Annealing Temp (°C)
Product size
mC5aR1 Mouse RT-PCR
ATGCTGATGCTGATGCTGATCG ATGCTGATGGCTGATCGTCGGATGCTGAT 60 562bp
mActB Mouse RT-PCR
GTGGGCCGCCCTAGGCACCAG CTCTTTGATGTCACGCACGATTTC 60 103bp
mC5aR1 Mouse qPCR GGGATGTTGCAGCCCTTATCA CGCCAGATTCAGAAACCAGATG 60 131bp
mSox2 Mouse qPCR TAGAGCTAGACTCCGGGCGATGA TTTCGTGGTCTTGTTTAAGGCAA 60 296bp
m18s Mouse qPCR GATCCATTGGAGGGCAAGTCT CCAAGATCCAACTACGAGCTT 60 103bp
hC5AR Human qPCR TCCTTCAATTATACCACCCCTGA GGAAGACGACTGCAAAGATGA
60 139bp
hC5 Human qPCR ACTGAATTTGGTTGCTACTCCTC GTATTACTGGGACTCCTCCTACC 60 110bp
hACTB Human qPCR GCGGGAAATCGTGCGTGACATT GATGGAGTTGAAGGTAGTTTGGTG 60 232bp
hCDH2 Human qPCR ATCAACCCCATACACCAGCC GTCGATTGGTTTGACCACGG 60 128bp
84
ab59412, 1:250, RRID:AB_946308) or isotype control antibodies were incubated overnight at 4°C.
Appropriate alexafluor secondary antibodies (Invitrogen, USA, 1:1000) were incubated with the
samples for 2 hours at room temperature before counterstaining (1μg/mL DAPI, 5 min) and mounting.
For C5aR/PKCζ costaining, the issue of using two rabbit antibodies was circumvented with the use
of conjugated Fab fragments and intermediate blocking with unconjugated Fab fragment (Jackson
Lab, USA). All immunofluorescence images were acquired via confocal microscopy (DMi8, Leica
Microsystems, Germany) and processed with ImageJ software. Further image analysis was performed
with either ImageJ or CellProfiler (Broad Institute, MA, USA, RRID:SCR_007358) software, as
stated in the relevant methods sections.
mC5a ELISA
Maternal and embryonic brain sample concentrations were determined by BCA assay
(ThermoScientific, USA). Aliquots of each sample were measured in technical triplicate for mC5a
concentration by enzyme-linked immunosorbent assay (R&D systems, USA, RRID:AB_2067297)
according to manufacturer's instructions. mC5a concentrations were normalized to protein
concentration (ng/mg, brain samples) or volume (ng/mL, CSF).
Neurosphere culture
Telencephalon from litters of E14.5 C57BL6/J mice, RRID:IMSR_JAX:000664, were isolated and
mechanically dissociated. Cells were maintained in DMEM/F12 media supplemented with 1x B27
supplement, L-glutamine 10ng/mL bFGF, 10ng/mL EGF and penicillin/streptomycin. Isolated human
rosettes were maintained in N2B27 throughout the neurosphere assay. To assess the effect of C5aR1
modulation on neurosphere growth 103 cells at passage 3 were seeded into each well of a 96 well
plate in the presence or absence of 10nM mC5a. Wells were imaged after one week in culture and the
number and diameter of neurospheres assessed. Media was replaced every 48 hours. Before treatment
with 10nM mC5a cells were deprived of growth factors (bFGF/EGF) for 6 hours.
NE-4C culture
NE-4C cells were acquired from the American Type Culture Collection (#CRL-2925,
RRID:CVCL_B063) and expanded in MEM (Sigma Aldrich) supplemented with 10% FCS (Lonza,
Switzerland), L-glutamine and Non-essential amino acids (Life Technologies, USA). For transwell
culture, NE-4C cells were plated on poly-L-lysine coated 0.2μm transwell membranes in a 24-well
plate. Cells were maintained in media as described above and treatment (mC5a or vehicle) was added
to the upper compartment 12 hours before fixation for immunofluorescence.
85
Human embryonic stem cell culture and neuronal differentiation
H9 hES cells (RRID:CVCL_9773) were maintained on Matrigel (BD Biosciences, San Diego, CA)
coated dishes in mouse embryonic fibroblast conditioned KSR medium (Dulbecco's modified Eagle's
medium/F-12 supplemented with 20% Gibco KnockOut Serum Replacement, 0.1 mM nonessential
amino acids, 1 mM l-glutamine, 0.1 mM β-mercaptoethanol, and 10 ng/ml human basic fibroblast
growth factor [FGF2] - all sourced from ThermoFisher, USA) as previously described (Briggs et al.
2013). Neuronal induction was performed using an adapted method of dual SMAD inhibition
(Chambers et al. 2009). Briefly, high density H9 cells were incubated for 10 days in N2B27 medium
(1:1 mixture of DMEM/F-12 supplemented with N2 and Neurobasal medium supplemented with
B27, 0.1 mM nonessential amino acids, 1 mM l-glutamine, 0.1 mM β-mercaptoethanol, 50 U/ml
penicillin, and 50 mg/mL streptomycin) supplemented with 1 μM Dorsomorphin and 10 μM
SB431542. At day 10, cultures were bulk passaged using 1 mg/mL dispase solution and seeded on
Matrigel coated plates in N2B27 medium without Dorsomorphin and SB431542. The cultures
passaged again using a similar technique at day 15, maintaining bulk and high density culture. Cells
were supplemented with 2 ng/mL FGF2 from day 16 to day 22 to promote emergence and
proliferation of rosettes. Using this method, rosettes began to emerge around day 16-18, reaching
maturity 7 to 10 days later. In order to ensure purity of neuronal cultures, rosettes were manually
harvested around day 24.
Human neural rosette experiments
Rosette cultures were single cell dissociated with Accutase (ThermoFisher, USA) and seeded at either
high density (3.2x105 cells/cm2) or low density (1.2x105 cells/cm2) for subsequent experiments. At
high density, 100% of cells re-formed rosettes, allowing for experimentation on a pure culture of
uniformly sized rosettes. At low density, the ability of rosette re-formation was limited (see results),
allowing for interrogation of the ability of C5aR1 signaling to promote reestablishment of rosettes
over differentiation.
Low density single cells were grown for 7 days in the presence of 10 nM hC5a, 1 μM PMX53 + hC5a,
or vehicle control, after which cells were fixed in 4% paraformaldehyde and stained for NCAD using
the above immunocytochemistry methods protocol. Acquired images were analyzed using
CellProfiler (RRID:SCR_007358) to quantify rosette number through the measurement and
quantification of NCAD positive rosette lumens (Kamentsky et al. 2011).
High density single cells were cultured for 5 days to allow re-establishment of rosettes after which
cells were tested in DAPT treatment and cell cycle progression experiments. For DAPT treatment,
cells were pre-treated with 10nM hC5a or vehicle control for 1 hour, after which 1µM DAPT was
86
added. Cells were incubated overnight, after which they were fixed, stained for NCAD, imaged, and
analyzed with CellProfiler to quantify rosette number or RNA collected for qRT-PCR. For cell cycle
testing, cells were serum starved overnight in DMEM/F12 + 0.25% BSA, after which 10nM hC5a or
vehicle control was added to the cells. The cells were then incubated overnight after which they were
fixed and stained with anti-pHH3 antibody and DAPI using the above immunocytochemistry methods
protocol. The ratio of pHH3 positive nuclei was calculated using analysis with CellProfiler.
In utero injections
Time-mated dams at E13.5 were anaesthetized under 1% isofluorane for surgery. 1uL of 100nM
mC5a, 10μM PMX53 or respective vehicle control was injected into the ventricular system of the
embryos. Abdominal incisions were closed with sutures and dams were administered 0.1mg/kg
buprenorphine for analgesia post-surgery. Dams were sacrificed and tissues collected at 24-hours
post-surgery for tissue analysis.
For analysis of proliferation the embryonic telencephalon was sectioned coronally and sections at the
level of the preoptic area were used for histological analysis. M-phase cells, as determined by
phosphohistone H3 staining, were counted using ImageJ at the apical surface of the telencephalic
ventricular zone. Phosphohistone H3 positive cells per 100μm was calculated for each individual
embryo and differences between treatment groups analyzed by students T-test.
Treatment of animals for behavioral experiments and MRI
Time-mated dams were acquired from UQBR and housed under standard conditions under the care
of animal house staff. Mice were administered 1mg/kg PMX53 or sterile water vehicle control (n=6
per group) in a 100μL volume via intraperitoneal injection over three days (E12.5 - E14.5). Dams
were allowed to litter down in individual cages. Gestational age at birth was defined as the number
of days after discovery of the vaginal plug (E0.5). Litter number, weight, crown-rump length and
snout-occiput length were taken at birth. In addition, pup weight was tracked over the first five weeks
of life to determine if any differences existed in growth parameters.
At eight weeks of age male and female mice from the litters were randomly selected for participation
in behavioral experiments (n = 8 per group). After behavioral experiments mice were anaesthetized
with zylazine/xoletil cocktail and perfused with PBS followed by 4% PFA via an intracardiac cannula.
Whole heads were incubated in 4% PFA for a further 3 days before washes with PBS and careful
removal of the brain. Brains were stored in fresh PBS until MRI analysis.
87
Grip strength
Mice were assessed for motor weakness using the grip strength test. Briefly, mice gripped a bar
attached to a force transducer. The experimenter gently pulled backwards on the base of the tail until
the mouse dislodged from the bar. The maximum force recorded over three trials was designated as
the grip strength. Both forelimb and hindlimb grip strength was assessed.
Balance Beam
Mice were assessed for higher motor coordination using the balance beam test. The apparatus
consisted of a 70cm (length) x 3mm (width) beam suspended 1m above a surface. The beam was held
in a room with bright overhead lights kept at a constant output of 150 lumens, a covered platform was
set at the end of the beam. Mice were trained, through four training attempts, to move towards the
covered platform through the use of a training beam of 80mm width. After training, mice were
exposed to the test apparatus. Time taken to cross beam and foot fall errors were recorded. A footfall
error was deemed to have occurred if the paw of the animal moved from a position on the beam and
crossed a threshold 10mm beneath the beam.
Open Field Test
The open field test utilized 50 x 50cm infrared photobeam tracking arenas (Med associates, USA) to
measure activity in a novel environment. Mice were placed in the center of the arena and, after a 30s
initiation period, movement in the x, y and z planes was tracked for the following 30 minutes. Arenas
were cleaned with 70% ethanol and allowed to dry between experiments. Thigmotaxis over the
initially 5 minutes was used as a measure of anxiety in the new environment and was assessed as
beam breaks within the center (25 x 25cm) square of the arena.
Y-maze
The Y-maze consisted of a Y shaped maze of opaque white plastic with three identical arms set at
120° angles. The arms were consisted of a home arm, of plain design and two exploratory arms where
the walls were decorated with different repetitive geometric patterns. For the exploratory task, one
exploratory arm was blocked from the maze by use of a plastic divider. A subject was placed in the
home arm and allowed to explore the home arm and remaining exploratory arm for 5 minutes. The
subject was then re-introduced to the maze after a 30-minute period with the arm divider removed,
allowing for entry into the second, novel, exploratory arm. The movement of the mouse around the
maze was tracked with EthoVision video tracking software (Noldus, The Netherlands). Frequency of
entry into the novel arm was used as a measure of short term memory.
88
MRI analysis of brain regions
Brains stored for MRI analysis were washed extensively in PBS, followed by 48h incubation in
gadolinium contrast agent (0.2% Magnevist, Bayer Healthcare Pharmaceuticals, in PBS). Brains were
imaged on 16.4T small animal vertical wide bore NMR spectrometer (Bruker BioSpin) at the Centre
for Advanced Imaging, University of Queensland. Brains were immersed in fomblin oil (Solvay
Solexis, Italy) inside a glass test tube of 10mm diameter and fitted inside a quadrature birdcage coil
(M2M imaging Inc., USA). T1 weighted images and multi-shell diffusion weighted images (DWI)
were obtained within a total scan time of 18 hours as previously described (Sepehrband et al. 2015).
Briefly, DWI datasets were composed of three B0 images and sixty diffusion weighted images for
each shell. Optimally ordered gradient directions with electrostatic energy minimization were
obtained using the Camino software package (Jones, Horsfield, and Simmons 1999; Cook et al. 2007).
Volumetric analysis of the obtained T1 images was achieved using Advanced Normalisation Tools
(ANTs) software. Briefly, all T1 images were warped to produce a common template image. Warp
fields containing Jacobian values for the individual images were subjected to a modified T-test using
the randomize function of FSL (Oxford center for functional MRI of the brain software library,
Oxford, UK) in order to determine significantly different Jacobian value voxels between the vehicle
and PMX53 treated groups. Inverse warp fields were applied to anatomical area mapping of the
common template to generate volumetric values for regions of sample brains. T1 images and
generated anatomical masks were visualized and refined in ITKsnap software (University of
Pennsylvania, USA). Differences in brain regions volume were tested for using Student's T-test.
Images were registered using the FSL linear registration tool in order to compare anatomically similar
voxels between samples. Comparison of each of the diffusion parameters was achieved using the
randomize function of FSL to generate a probability map of differences between vehicle- and
PMX53-treated samples. Probability maps were thresholded to significance (p ≤ 0.05) and displayed
on a generated template image.
Statistical Analyses
Graphing and statistics were performed using GraphPad Prism Software 6.0c (GraphPad Software,
USA) using Student's t test and one-way ANOVA with Dunnett post-test for the relevant statistical
analysis.
89
Results
C5aR1 is expressed in murine neural progenitor cells and is localized to the apical ventricular
zone.
We have previously reported the neuroepithelial expression of C5aR1 during mouse neurulation (7.5-
10.5 dpc) (Denny et al. 2013), but it is unknown if C5aR1 expression continues during the period of
neurogenesis. We therefore examined the temporal expression of C5aR1 in embryos 12.5-18.5dpc.
RT-PCR analysis of whole brain RNA extracts revealed C5ar1 expression during this key period of
brain formation (Fig. 3.1A). Immunohistochemistry analysis indicated that C5aR1 protein was
distinctly localized to the apical surface of the ventricular zone (Fig. 3.1A). The ligand of C5aR1,
mC5a, was detected at very low levels in embryonic and adult brain tissue, however, it was found at
much higher levels in cerebrospinal fluid (CSF) sampled from E14.5 embryonic ventricles, but not
adult mouse CSF (Fig. 3.1D). Human concordance with these results has recently been reported, with
hC5a detected in the CSF of newborn infants (Pataky et al. 2016). Importantly, these embryonic mC5a
CSF concentrations equated to approximately 1.4nM, a functionally active concentration for this
potent signaling peptide (Hawksworth et al. 2014).
We next demonstrated that C5aR1 expression is maintained ex vivo in neurospheres derived from the
telencephalon of E14.5 mice, and the immortalized neural progenitor cell line NE-4C, as determined
by RT-PCR analysis (Fig. 3.1A) and immunocytochemistry (Fig. 3.1B&C). Interestingly,
differentiation of the NE-4C line with retinoic acid, confirmed by downregulation of Sox2, caused a
statistically significant reduction in C5aR1 mRNA between stage II and IV (Fig. 3.1F), a period that
corresponds to the beginning of neurogenesis and migration in the cultures (Schlett and Madarasz
1997). No reduction of C5aR1 protein was detected until stage VI, a period that marks the onset of
gliogenesis (Fig. 3.1E). The discordance in timing between mRNA and protein signal loss reflects
previous measurements of protein half-life in culture (Schwanhausser et al. 2011). Overall, this
indicates that C5aR1 retains a polarized localization in neural progenitor cells ex vivo, and expression
of the receptor reduces as cells differentiate.
90
Figure 3.1: Localization of C5aR1 and ligands. A) C5aR1 (red) is expressed in the developing neocortex at
the apical surface of the ventricular zone from at E14.5 (top row). Counterstain with Pax6 (green), DAPI (blue).
Scale bar = 50µm. Merged images of the ventricular zone at E12.5, E16.5 and E18.5 are shown in the second
row. RT-PCR demonstrates C5aR1 expression in embryonic brain tissue, neurosphere and NE- 4C culture. B)
C5aR expression (red) within sectioned neurosphere. Secondary-only negative controlled labelled ‘Negative’.
Scale bar = 50µm. C) C5aR expression (red) on NE4C cells grown in monolayer. Secondary-only negative
controlled labelled ‘Negative’. Scale bar = 20µm. D) Embryonic CSF contains C5a at significantly greater
concentrations than brain tissue or maternal CSF. E) C5aR1 is detected within NE-4C cultures by western blot
at the predicted molecular weight (50kDa), and decreases at stage VI of differentiation. Stages indicate
morphologically distinct progression of NE-4C differentiation (See Methods). F) Expression of C5aR1 mRNA
decreases with differentiation of NE-4C cells. Progenitor marker Sox2 is assayed as comparison.
91
C5aR1 is apically localized in human embryonic stem cell-derived neural progenitors.
To explore the role of C5aR1 in a human setting, we first assessed whether the mouse apical neural
localization of C5aR1 was conserved in human tissue. We have previously reported C5aR1
expression in a similar localization to mouse, with staining for C5aR1 restricted to the cortical
ventricular zone of Carnegie stage 13 human neural tissue (Denny et al. 2013). To further assess
C5aR1 localization and function in human development, we utilized hES-derived neuronal
progenitors as an in vitro model system. To this end, hES cells were differentiated into cortical neural
rosettes, a stage with characteristics analogous to the cortical ventricular zone (Shi et al. 2012; Ziv et
al. 2015). The cells in these human neural rosettes expressed the neural markers TUBB3 and NCAD,
with strong expression of the tight junction marker ZO-1 on the apical luminal surface of each rosette,
indicative of the distinct apicobasal polarity that defines the rosette architecture (Fig. 3.2A). C5aR1
expression was robustly detected at the apical surface of rosettes, where it co-localized strongly with
the apical membrane marker atypical protein kinase C zeta (PKCζ), but not with markers of cell-cell
junctions (NCAD) or cilia (Arl13b), suggesting that the protein is confined to the apical plasma
membrane (Fig. 3.2A). In neural progenitor cells, the apical membrane attachment acts as an anchor
for determinants of polarity such as the Par3/Par6/PKCζ complex, which together with apical NCAD-
based adherens junctions maintains tissue architecture and apicobasal polarity (Gotz and Huttner
2005). Interestingly, we observed a close correlation between NCAD and C5aR1 expression levels
during the neural differentiation of hES cells. Upregulation of NCAD after neural induction peaked
at the rosette stage and decreased upon further maturation of the cultures. Both C5aR1 and C5 closely
followed this pattern of expression (Fig. 3.2B). C5 protein expression appeared diffuse and punctate
throughout the rosettes (Fig. 3.2A), and the processed form of C5, hC5a, was detectable in the lysate
of rosette cells at a similar time-point (Fig. 3.2C). High lysate levels of C5a may reflect intracellular
stores of C5a, as has been observed and discussed previously for the complement anaphylatoxins
(Pavlovski et al. 2012; Hawksworth et al. 2014; Elvington et al. 2017). These results indicate that
human subcellular and temporal C5aR1 expression during development closely mirrors that observed
in developing mouse brain.
92
Figure 3.2: Expression of C5aR1 in human embryonic stem cell-derived rosettes. A) Immunocytochemistry of human neural rosettes showing staining for neural marker TUBB3, tight junction marker ZO-1, and complement factor 5 (C5). C5aR1 localizes to the apical membrane, colocalizing with PKCζ, but not markers of cilia (Arl13b) or tight junctions (NCAD). Negative controls shown top right. Scale bar = 20µm. B) Transcript expression as human embryonic stem (hES) cells (day 0) are differentiated through the cortical rosette stage (day 28) to a mature neuronal lineage. C5AR1 expression is highest at the rosette stage of neuronal differentiation. C) C5a is detected through ELISA within the lysate of rosette cultures, and is not derived from the exogenous extracellular matrix (Matrigel).
93
C5aR1 signals via PKCζ and Erk in mouse and human neural progenitors to promote
polarization and proliferation.
Intrigued by the unique apical localization of C5aR1 in vivo and in vitro, and the well described
importance of the apical membrane and PKCζ in controlling progenitor pool proliferation, we next
assessed the functional role of C5aR1 in these processes. In mouse neurosphere cultures, mC5a
addition caused an increase in p42/44 (ERK) phosphorylation (Fig. 3.3A), which could be effectively
inhibited through pretreatment with a specific PKCζ pseudosubstrate inhibitor (Fig. 3.3B). Similarly,
in human rosette cultures, treatment with human C5a caused an increase in p42/44 phosphorylation
that was attenuated through pretreatment with either a selective C5aR1 antagonist (C5aR1-A,
PMX53), or with PKCζ inhibition (Fig. 3.3C), indicating that C5aR1 signaling is conserved between
human and mouse. Given the association between ERK signaling and mitogenic activity, we
investigated the ability of C5aR1 signaling to modulate neural progenitor proliferation. Daily addition
of species-specific C5a to neurosphere cultures resulted in an increase in both number and diameter
of mouse and human neurospheres over a 7-day period (Fig 3D/E & F/G respectively). Additionally,
in human neural rosette cultures, addition of C5a led to a 59% increase in phosphorylated histone H3
(pHH3) positive nuclei, indicative of increased mitotic activity within rosettes (Fig. 3.3H).
The observation that C5aR1 signaling is mediated by PKCζ, a component of the Par3/Par6/PKCζ cell
polarity complex, combined with its localization at the apical membrane of neural rosettes, strongly
supports a role for C5aR1 in controlling neural progenitor cell (NPC) polarity. We therefore examined
a role of C5aR1 in NPC polarity signaling pathways. Previous studies have shown that a loss of
paracrine Notch signaling results in downregulation of NCAD and the loss of apicobasal polarity
(Main et al. 2013). Treatment of human neural rosettes with the Notch signaling inhibitor DAPT
significantly decreased the expression of NCAD, leading to a disruption of cell-cell contacts and
induced a loss of rosette architecture (Fig. 3.3I). Interestingly both C5aR1 and C5 expression also
decreased with DAPT treatment, which may indicate polarity-dependent expression of these
complement factors (Fig. 3.3I). Single cell dissociation of rosettes also interferes with paracrine
signaling and cell-cell contact, resulting in loss of cell polarity and impaired rosette formation.
Exogenous addition of hC5a maintained rosette architecture in the presence of DAPT (Fig. 3.3J), and
promoted re-establishment of rosette architecture after dissociation, an effect that was blocked
following C5aR1 antagonism (Fig. 3.3K). We conclude that C5aR1 is not only dependent on, but also
actively promotes, cell polarity.
This promotion of polarity was also observed in mouse-derived NE-4C cells cultured on transwell
plates. Addition of exogenous mC5a led to restriction of the apical surface area by ~50%, as measured
by ZO-1 staining, and microtubule organizing center (MTOC) localization in these cells was
94
significantly closer to the apical center, indicative of the induction of cell polarization (Fig. 3.3L&M).
Collectively, these data confirmed the polarity-dependent expression of C5aR1, an involvement of
C5aR1 signaling in the maintenance of neural progenitor polarity, and subsequently, proliferation.
Figure 3.3: C5aR1 signals through PKCζ to maintain cell polarity in vitro. A) Mouse neurosphere cultures
demonstrate C5a-concentration dependent p42/44 phosphorylation B) The response to 100nM C5a is
prevented by PKCζ inhibition. C) Human rosette cultures demonstrate time-dependent p42/44 phosphorylation
to 10nM hC5a. The response is prevented through pretreatment with C5aR1-A or PKCζ inhibition. D-G)
Mouse and human neurosphere cultures dissociated and grown over a 7-day period demonstrate an increase in
number (D & F respectively) and diameter (E & G respectively) in response to C5a. H-K) Treatment of human
rosettes with 10nM C5a. H) C5a increases M-phase positive cells in neural rosettes as determined by pHH3
immunocytochemical analysis. I) DAPT (grey bars) treatment induced loss of rosettes and decrease in mRNA
of NCAD, C5AR1, and C5 compared to vehicle (black bars) treatment. Maintenance of rosette architecture
following single cell dissociation (K) or DAPT treatment (J) was promoted by exogenous C5a addition.
Adjacent images are representative of DAPT treated rosettes in the presence or absence of C5a. NCAD (white),
and computational outlines (green) of rosette apical lumens are shown. L&M) NE-4C cells grown on transwell
membranes demonstrate reorganisation of the mitotic spindle (L), as determined by acetylated tubulin staining
(green), and reduction in apical surface area (M), outlined by ZO-1 (red) in response to C5a. White arrows are
representative distances from mitotic spindle to calculated cell centre as shown in (L). Scale bar = 20µm.
95
C5aR1 signaling increases the proliferation of neural progenitor cells of the embryonic
ventricular zone in vivo
Having defined a role for C5aR1 in NPC proliferation and establishment of cell polarity in vitro, we
next wished to assess its role in mouse brain development by in utero delivery of mC5a or C5aR1-A
(PMX53) into the embryonic ventricle of embryonic day (E)13.5 mouse embryos (Fig. 3.4A). We
observed that twenty-four hours after a single injection with mC5a there was a 2-fold increase in the
number of apical progenitors in M-phase of the cell cycle, as indicated by pHH3 staining (Fig. 3.4B).
In contrast, blockade of C5aR1 signaling resulted in a decrease in the number of M-phase apical
progenitors after 24 hours (Fig. 3.4B). Analysis of the cleavage plane of actively dividing cells in
these samples demonstrated a significant shift from symmetric to asymmetric division following
C5aR1-A injection (Fig. 3.4C). We conclude that C5aR1 signaling promotes NPC proliferation in
vivo and affects the balance between symmetric and asymmetric division, in concordance with in
vitro observations. Combined with the robust expression of mC5a in embryonic CSF (Fig. 3.1D), this
supports an endogenous physiological role for mC5a-C5aR1 signaling during embryonic
neurogenesis.
96
Figure 3.4: C5aR1 signaling alters neural progenitor division planes and proliferation in vivo. A) Schema
of the in utero injection process. Briefly, 1µL 100nM mC5a, 1µM PMX53 or vehicle was delivered to the
embryonic ventricle in utero. After 24 hours, brains were processed for immunohistochemistry. M-phase cells,
as determined by pHH3 staining, were counted along the ventricular surface of the neocortex. B) In utero
injection of mC5a to the embryonic ventricle increases, whilst blockade of C5aR1 signaling using PMX53
decreases, the number of M-phase apical progenitor cells. C) Cleavage plan analysis demonstrates a shift from
symmetric division towards asymmetric division upon treatment with C5aR1 antagonist. S, Symmetric
division; A, Asymmetric division; O, Oblique division.
97
Blockade of C5aR1 from E12.5-14.5 results in behavioral abnormalities in the adult mouse
Given that acute disruption of C5a-C5aR1 signaling affects proliferation of apical progenitors and
the balance between symmetric and asymmetric cell division, we next determined whether acute
pharmacological blockade of C5aR1 during neurogenesis translates into behavioral abnormalities
later in life. Time-mated dams were intraperitoneally injected daily with 1mg/kg C5aR1-A during the
critical neurodevelopmental window (E12.5-14.5), and resultant litters were subjected to behavioral
testing between 6-8 weeks of age (Fig. 3.5A). We first confirmed that intraperitoneal delivery of
C5aR1-A over the three-day embryonic window resulted in impaired neurogenesis. Compared to
vehicle controls C5aR1-A-treated embryos displayed a reduction in the size of the ventricular zone,
as measured by Sox2 staining, and an increase in the thickness of the maturing cortex, as demonstrated
by the post-mitotic maturing neuron marker doublecortin (DCX) at E16.5. This collectively resulted
in a significant decrease of the Sox2/DCX ratio (Fig. 3.5B). We next assessed whether C5aR1-A
treatment resulted in any gross developmental or pregnancy complications. C5aR1-A treated pups
showed no change in postnatal growth (Fig. 3.5C), litter size (Fig. 3.5D) and snout-occiput length
(Fig. 3.5F), however a minor, but significant, reduction in crown-rump length was observed (Fig.
3.5E).
Adult mice were next subjected to a series of behavioral tests to assess neuromotor and cognitive
function. In utero C5aR1-A treated mice demonstrated significant behavioral abnormalities in
adulthood. In motor control tasks, there was no difference in grip-strength (Fig. 3.5G), however
balance beam testing of centrally-controlled motor coordination tasks showed an increase in both
footfall errors and time taken to cross the beam for C5aR1-A treated mice (Fig. 3.5H, I). In an open
field test, C5aR1-A treated animals of both genders demonstrated a decrease in distance travelled in
the center areas of the cage (Fig. 3.5J), suggesting heightened anxiety in a novel environment. The
Y-maze was used to assess short-term memory, and frequency of entry into the novel arm was reduced
in C5aR1-A treated animals (Fig. 3.5K). Finally, the forced swim test was used to assess depressive-
like symptoms, where C5aR1-A treated animals spent significantly reduced time being immobile
compared to non-treated animals (Fig. 3.5L). These results clearly demonstrated that acute in utero
blockade of C5aR1 signaling over a relatively short time frame led to a range of behavioral
discrepancies that involved several anatomically distinct systems such as memory, coordination and
anxiety.
98
Figure 3.5: Blockade of C5aR1 signaling at E12.5-14.5 causes behavioral changes in adult mice. A)
Schema of the experimental process. Briefly, 1mg/kg/day of the C5aR1 antagonist, PMX53, was delivered by
intraperitoneal injection to pregnant dams at E12.5-14.5. Resultant litters were taken through behavioral testing
from 6-8 weeks, sacrificed and brains prepared for ex vivo MRI. Figures display results for vehicle (V, black
bars) and PMX53 (P, grey bars) treated mice. B) Sox2/DCX ratio of the ventricular zone of E16.5 embryos.
No change in postnatal growth (C), litter size (D), and snout-occiput length (F) was seen. A significant
reduction in crown-rump length was observed (E). G) No difference between treatment groups was found in
grip strength for both forelimb (F) and hindlimb (H). H) Time to cross balance beam was increased in male
animals from PMX53-treated litters. I) Footfall errors crossing balance beam. Distance moved in center of
open field arena (J), Frequency of entry to novel arm Y-maze (K), and Time spent immobile during forced
swim test (L) were significantly different in PMX53-treated litters.
99
In utero blockade of C5aR1 between E12.5-14.5 results in microstructural differences on MRI
analysis
Given the broad behavioral deficits induced by transient in utero C5aR1 antagonism between E12.5-
14.5 of gestation, we next utilized ex vivo 16.4T magnetic resonance imaging (MRI) to identify
structural alterations in the brain that could underlie the observed phenotypes. Firstly, a Jacobian map
was utilized to measure the relative change of each brain structure required to fit to a template image,
therefore identifying any volumetric change in distinct regions between sample groups (Leporé et al.
2007). C5aR1-A treated animals showed significantly increased clusters of Jacobian values
throughout the cortex and striatum (Fig. 3.6) indicating that spatial expansion was required to fit
individual images to the template in these areas (Lepore et al. 2008). However, volumetric analysis
of segmented brain regions (Ma et al. 2005) failed to show significant differences between groups
(Table 2). These areas of volume difference correlated with microstructural difference as shown by
fractional anisotropy (FA). FA values were higher in the frontal cortex, striatum, and hypothalamus
of C5aR1-A treated animals (Fig. 3.6) alluding to increased myelination, increased axonal density or
a reduction in fiber dispersion in these areas (Sepehrband et al. 2015), which may account for the
behavioral differences seen between these two experimental groups (Soares et al. 2013). Overall,
these results demonstrate multiple microstructural differences induced by C5aR1 inhibition in
embryos, which are concordant with the behavioral deficits seen in these mice.
Table 2: Table of MRI volume comparison of brain regions for C5aR1-antagonist or vehicle treated mice.
Vehicle treatment C5aR1-A treatment
Area Volume (mm3) Std Error n Volume (mm3) Std Error n p value Amygdala 10.24 0.1425 7 10.18 0.2929 9 0.8764
Caudate/Putamen 23.25 0.4326 7 22.85 0.5933 9 0.6175 CC and External Capsule 8.213 0.102 7 7.891 0.331 9 0.4203
Central Grey Matter 4.476 0.05 7 4.339 0.07 9 0.1762 Cerebellum 46.96 0.3563 7 42.83 1.764 9 0.0624
Fimbria 2.007 0.028 7 1.928 0.05576 9 0.2702 Globus Pallidus 2.485 0.055 7 2.368 0.046 9 0.1209 Hippocampus 24.71 0.287 7 24.31 0.5846 9 0.5832 Hypothalamus 11.61 0.162 7 11.17 0.284 9 0.234
Neocortex 125.5 1.84 7 121.5 3.45 9 0.3668 Olfactory Bulbs 17.88 0.2216 6 16.53 0.7673 9 0.1858
Thalamus 25.19 0.095 7 24.69 0.732 8 0.5444
100
Figure 3.6: Blockade of C5aR1 signaling at E12.5-14.5 results in microstructural changes in adult brains.
Top row; significance map of jacobian warping projected onto T1 weighted template average. Middle row;
significance map of fractional anisotropy (FA) values projected onto template average. For both maps,
vehicle>PMX53 (C5aR1-A) treatment (blue/purple) and PMX53>vehicle (red/yellow). Color coded p-values
shown at bottom of figure. Bottom row; Anatomical areas labelled; Mot, motor cortex; Orb, orbital cortex;
OB, olfactory bulb; SS, somatosensory cortex; Gust, gustatory cortex; P, piriformis; CP, caudate/putamen;
NA, nucleus accumbens; Pal, pallidum; H, hypothalamus.
101
Discussion
Proteins of the complement system are present during embryogenesis, playing novel roles in
development (McLin et al. 2008; Denny et al. 2013; Jeanes et al. 2015). Our laboratory has previously
demonstrated their presence and function on human embryonic stem cells and mouse neuroepithelial
cells (Denny et al. 2013; Hawksworth et al. 2014). Additionally, we have previously shown C5aR1
expression on the apical neuroepithelium at a similar developmental stage to this study, in non-
pathological human embryos (Denny et al. 2013), raising the question of roles for complement in
normal embryonic development. Here we show that in both human and mouse models, the key
complement effector system, C5a-C5aR1 signaling, functions to control progenitor cell polarity,
proliferation and the symmetry of the cell division. Ultimately, this loss of C5aR1 signaling manifests
as altered cerebral organization and behavioral deficits.
In neural progenitor cells of the ventricular zone, the loss of apical attachment where C5aR1 resides
is associated with decreased expression of factors responsible for the maintenance of stemness.
Asymmetric inheritance of this attachment during mitosis is a catalyst for differentiation toward a
post-mitotic state, with loss of attachment initiating exit from the ventricular zone pool, and
subsequent maturation into neuronal subtypes (Gotz and Huttner 2005; Miyamoto, Sakane, and
Hashimoto 2015). Conversely, symmetric division of the apical membrane maintains both daughter
cells within the ventricular zone progenitor pool, secondary to continued signaling from the apical
membrane. The apically-localized PKCζ is an essential second messenger in the promotion of
symmetric division and the maintenance of neuroepithelial architecture (Ghosh et al. 2008). However,
less is known about the receptors that trigger PKCζ activation. Here we have identified C5aR1 as a
novel prime candidate, with polarized apical expression, for controlling endogenous PKCζ signaling
during mammalian corticogenesis.
In addition, we have shown a plausible biological source for C5aR1 stimulation within the CSF of
the developing embryo, which were at higher concentrations than both embryonic brain tissue and
adult CSF. This may suggest that C5a is actively secreted into the CSF to stimulate proliferation of
progenitor cells, given that concentrations are higher during development than in adulthood. The
source of this C5a will require further delineation, however we demonstrated C5 expression within
neural rosette cultures (Fig 2A). As the CSF was assayed before the advent of ependymal cell
differentiation, this strongly suggests an autocrine production of C5a by neural progenitor cells.
These findings are particularly of interest in light of previous reports demonstrating that, in adult
mice, C5aR1 does not contribute to basal neurogenesis (Bogestal et al. 2007). This appears to contrast
with our study, which identifies a role for C5aR1 in neurogenesis, albeit at an earlier stage of life than
102
investigated by Bogestål and colleagues (2007). However, the receptor has also been demonstrated
on migrating neuroblasts in models of cerebral ischemia (Rahpeymai et al. 2006), leading to some
question of its role on these cells, given an apparent non-contributory role to neurogenesis. Whilst
not directly tested, it could be argued that C5aR1 is responsive on neuroblasts to the higher C5a
concentrations in the ischemic brain, but has a dormant role in the non-pathological, and therefore
low-C5a, setting.
The present discovery adds to previous studies which have identified neurodevelopmental deficits
associated with aberrant complement activity, including in disorders such as autism, schizophrenia,
and epilepsy (Hawksworth, Coulthard, and Woodruff 2016). For example, the fetal neurocognitive
injury associated with maternal malaria infection has been shown to be mediated by C5aR1
(McDonald et al. 2015). Furthermore, allele variations leading to increased complement factor 4A
(C4A) expression have been correlated to increased schizophrenia risk (Sekar et al. 2016). It is
interesting to speculate, given our findings, on whether the behavioral deficits demonstrated in both
diseases are the result of a direct effect of C5aR1 signaling on neural progenitors, altering
corticogenesis, rather than the alternate hypothesis of a generalized inflammation and altered synaptic
pruning. Within this hypothesis, classical complement cascade activation would inescapably lead to
the formation of C5 convertases, and activation of C5. Given our identification of a mechanistic role
for C5aR1 in ventricular zone progenitors and cerebral organization, it could equally be hypothesized
that the increased C4A and classical complement cascade activation increases cerebral C5aR1
signaling, with consequent alterations in progenitor migration driving the complex cortical pathology
associated with schizophrenia risk. Additionally, it is interesting that the short window of C5aR1
blockade used in our studies was also not compensated for later in development, as demonstrated by
the behavioral and brain microstructural differences in adult mice. In contrast, there is a demonstrated
functional compensation of impaired synaptic pruning resulting from other models of complement
deficiency (Perez-Alcazar et al. 2014). This theory is supported by the finding of impaired short term
memory in C5aR1 knockout animals (Gong et al. 2013), indicated that disruption of the receptor
signaling, but not the cascade, is enough to alter neuronal circuitry.
Given the potential disparity between animal and human cognitive development, one focus of this
study was to validate observations made in the mouse model in a human environment. We have
previously shown expression of C5aR1 in human embryos, at Carnegie stage 13, where it is also
localized to the apical neuroepithelium (Denny et al. 2013). The combination of this in vivo
localization with the results presented in this study, demonstrating human neural progenitors
signaling through C5aR1 in a similar manner to the mouse, strongly suggests conservation of C5aR1
function between mouse and human. C5aR1 is already a strong candidate target for direct therapeutics
103
against inflammatory diseases of pregnancy. Maternal complement dysregulation is a factor in the
pathogenesis of preeclampsia and infection-related preterm birth (Lokki et al. 2014; Denny et al.
2015). Interestingly, the humanized IgG2/4 monoclonal antibody directed against C5, eculizimab,
has already been in use in pregnant women affected by paroxysmal nocturnal haemoglobinuria
(PNH). Given the rarity of the disease there have only been a few reports on the safety of this drug in
pregnancy, with no obvious complications at birth nor in early childhood development (Kelly et al.
2015). The effect of eculizimab is fortuitously confined to the maternal circulation by the poor
transfer of IgG2 through the placenta, and comparison of maternal and cord blood from these
pregnancies has shown no effect on the complement system of the fetus (Hallstensen et al. 2015).
However, with the clinical development of small molecule C5aR1 inhibitors, such as CCX-168
(Woodruff, Nandakumar, and Tedesco 2011), it would be prudent to be cautious in the clinical use of
C5aR1 directed therapeutics during pregnancy without prior consideration to fetal transfer and
potential developmental implications of C5aR1 inhibition as highlighted in this study.
This study also adds to emerging work demonstrating a wide developmental role for complement
components in mammalian development. These include roles for complement factors in
developmental processes such as radial intercalation, migration and synaptic pruning (Stevens et al.
2007; Carmona-Fontaine et al. 2011; Szabo et al. 2016; Gorelik A et al. 2017). In this context, it is
interesting to speculate what niche these proteins first filled. The origins of the evolutionarily ancient
system of complement proteins may be as a controller of tissue organization and development, with
utilization of complement in the context of innate immunity following later in evolution
(Hawksworth, Coulthard, and Woodruff 2016).
In conclusion, here we show a novel role for C5aR1 as a modulator of apicobasal polarity in neural
progenitor cells that is highly conserved between mice and humans. Inhibition of C5aR1 signaling
during neurogenesis has deleterious consequences for cerebral organization, resulting in behavioral
abnormalities in adult mice. Our data suggest that the development and use of C5aR1 antagonists as
potential treatments for pregnancy-related inflammatory disease should be approached with extreme
caution.
104
References
Benard, M., E. Raoult, D. Vaudry, J. Leprince, A. Falluel-Morel, B. J. Gonzalez, L. Galas, H. Vaudry,
and M. Fontaine. 2008. 'Role of complement anaphylatoxin receptors (C3aR, C5aR) in the
development of the rat cerebellum', Mol Immunol, 45: 3767-74.
Bogestal, Y. R., S. R. Barnum, P. L. Smith, V. Mattisson, M. Pekny, and M. Pekna. 2007. 'Signaling
through C5aR is not involved in basal neurogenesis', J Neurosci Res, 85: 2892-7.
Briggs, J. A., J. Sun, J. Shepherd, D. A. Ovchinnikov, T. L. Chung, S. P. Nayler, L. P. Kao, C. A.
Morrow, N. Y. Thakar, S. Y. Soo, T. Peura, S. Grimmond, and E. J. Wolvetang. 2013.
'Integration-free induced pluripotent stem cells model genetic and neural developmental
features of down syndrome etiology', STEM CELLS, 31: 467-78.
Carmona-Fontaine, Carlos, Eric Theveneau, Apostolia Tzekou, Masazumi Tada, Mae Woods,
Karen M Page, Maddy Parsons, John D Lambris, and Roberto Mayor. 2011. 'Complement
Fragment C3a Controls Mutual Cell Attraction during Collective Cell Migration',
Developmental Cell, 21: 1026-37.
Chambers, Stuart M., Christopher A. Fasano, Eirini P. Papapetrou, Mark Tomishima, Michel
Sadelain, and Lorenz Studer. 2009. 'Highly efficient neural conversion of human ES and iPS
cells by dual inhibition of SMAD signaling', Nature biotechnology, 27: 275-80.
Cook, P. A., M. Symms, P. A. Boulby, and D. C. Alexander. 2007. 'Optimal acquisition orders of
diffusion-weighted MRI measurements', J Magn Reson Imaging, 25: 1051-8.
Corbett, B. A., A. B. Kantor, H. Schulman, W. L. Walker, L. Lit, P. Ashwood, D. M. Rocke, and F.
R. Sharp. 2007. 'A proteomic study of serum from children with autism showing differential
expression of apolipoproteins and complement proteins', Mol Psychiatry, 12: 292-306.
Denny, K. J., L. G. Coulthard, A. Jeanes, S. Lisgo, D. G. Simmons, L. K. Callaway, B. Wlodarczyk,
R. H. Finnell, T. M. Woodruff, and S. M. Taylor. 2013. 'C5a receptor signaling prevents folate
deficiency-induced neural tube defects in mice', J Immunol, 190: 3493-9.
Denny, K. J., L. G. Coulthard, S. Mantovani, D. Simmons, S. M. Taylor, and T. M. Woodruff. 2015.
'The Role of C5a Receptor Signaling in Endotoxin-Induced Miscarriage and Preterm Birth',
Am J Reprod Immunol, 74: 148-55.
Elvington, M., M. K. Liszewski, P. Bertram, H. S. Kulkarni, and J. P. Atkinson. 2017. 'A C3(H20)
recycling pathway is a component of the intracellular complement system', J Clin Invest, 127:
970-81.
Fietz, S. A., and W. B. Huttner. 2011. 'Cortical progenitor expansion, self-renewal and neurogenesis-
a polarized perspective', Curr Opin Neurobiol, 21: 23-35.
105
Ghosh, S., T. Marquardt, J. P. Thaler, N. Carter, S. E. Andrews, S. L. Pfaff, and T. Hunter. 2008.
'Instructive role of aPKCzeta subcellular localization in the assembly of adherens junctions in
neural progenitors', Proc Natl Acad Sci U S A, 105: 335-40.
Gong, B., Y. Pan, W. Zhao, L. Knable, P. Vempati, S. Begum, L. Ho, J. Wang, S. Yemul, S. Barnum,
A. Bilski, B. Y. Gong, and G. M. Pasinetti. 2013. 'IVIG immunotherapy protects against
synaptic dysfunction in Alzheimer's disease through complement anaphylatoxin C5a-
mediated AMPA-CREB-C/EBP signaling pathway', Mol Immunol, 56: 619-29.
Gorelik A, Sapir T, Haffner-Krausz R, Olender T, Woodruff TM, and Reiner O. 2017.
'Developmental activities of the complement pathway in migrating neurons', Nature
Communications.
Gotz, M., and W. B. Huttner. 2005. 'The cell biology of neurogenesis', Nat Rev Mol Cell Biol, 6: 777-
88.
Hallstensen, R. F., G. Bergseth, S. Foss, S. Jaeger, T. Gedde-Dahl, J. Holt, D. Christiansen, C. Lau,
O. L. Brekke, E. Armstrong, V. Stefanovic, J. T. Andersen, I. Sandlie, and T. E. Mollnes.
2015. 'Eculizumab treatment during pregnancy does not affect the complement system activity
of the newborn', Immunobiology, 220: 452-9.
Hawksworth, O. A., L. G. Coulthard, S. M. Taylor, E. J. Wolvetang, and T. M. Woodruff. 2014. 'Brief
report: complement C5a promotes human embryonic stem cell pluripotency in the absence of
FGF2', STEM CELLS, 32: 3278-84.
Hawksworth, Owen A., Liam G. Coulthard, and Trent M. Woodruff. 2016. 'Complement in the
fundamental processes of the cell', Mol Immunol.
Jeanes, A., L. G. Coulthard, S. Mantovani, K. Markham, and T. M. Woodruff. 2015. 'Co-ordinated
expression of innate immune molecules during mouse neurulation', Mol Immunol, 68: 253-
60.
Jones, D. K., M. A. Horsfield, and A. Simmons. 1999. 'Optimal strategies for measuring diffusion in
anisotropic systems by magnetic resonance imaging', Magn Reson Med, 42: 515-25.
Kamentsky, L., T. R. Jones, A. Fraser, M. A. Bray, D. J. Logan, K. L. Madden, V. Ljosa, C. Rueden,
K. W. Eliceiri, and A. E. Carpenter. 2011. 'Improved structure, function and compatibility for
CellProfiler: modular high-throughput image analysis software', Bioinformatics, 27: 1179-80.
Kelly, Richard J., Britta Höchsmann, Jeff Szer, Austin Kulasekararaj, Sophie de Guibert, Alexander
Röth, Ilene C. Weitz, Elina Armstrong, Antonio M. Risitano, Christopher J. Patriquin, Louis
Terriou, Petra Muus, Anita Hill, Michelle P. Turner, Hubert Schrezenmeier, and Regis
Peffault de Latour. 2015. 'Eculizumab in Pregnant Patients with Paroxysmal Nocturnal
Hemoglobinuria', New England Journal of Medicine, 373: 1032-39.
106
Lepore, N., C. Brun, Y. Y. Chou, M. C. Chiang, R. A. Dutton, K. M. Hayashi, E. Luders, O. L. Lopez,
H. J. Aizenstein, A. W. Toga, J. T. Becker, and P. M. Thompson. 2008. 'Generalized tensor-
based morphometry of HIV/AIDS using multivariate statistics on deformation tensors', IEEE
Trans Med Imaging, 27: 129-41.
Leporé, Natasha, Caroline Brun, Xavier Pennec, Yi-Yu Chou, Oscar L. Lopez, Howard J. Aizenstein,
James T. Becker, Arthur W. Toga, and Paul M. Thompson. 2007. 'Mean Template for Tensor-
Based Morphometry Using Deformation Tensors.' in Nicholas Ayache, Sébastien Ourselin
and Anthony Maeder (eds.), Medical Image Computing and Computer-Assisted Intervention
– MICCAI 2007: 10th International Conference, Brisbane, Australia, October 29 - November
2, 2007, Proceedings, Part II (Springer Berlin Heidelberg: Berlin, Heidelberg).
Lokki, A. I., J. Heikkinen-Eloranta, H. Jarva, T. Saisto, M. L. Lokki, H. Laivuori, and S. Meri. 2014.
'Complement activation and regulation in preeclamptic placenta', Front Immunol, 5: 312.
Ma, Y., P. R. Hof, S. C. Grant, S. J. Blackband, R. Bennett, L. Slatest, M. D. McGuigan, and H.
Benveniste. 2005. 'A three-dimensional digital atlas database of the adult C57BL/6J mouse
brain by magnetic resonance microscopy', Neuroscience, 135: 1203-15.
Main, Heather, Jelena Radenkovic, Shao-bo Jin, Urban Lendahl, and Emma R. Andersson. 2013.
'Notch Signaling Maintains Neural Rosette Polarity', PLoS One, 8: e62959.
McDonald, Chloë R., Lindsay S. Cahill, Keith T. Ho, Jimmy Yang, Hani Kim, Karlee L. Silver, Peter
A. Ward, Howard T. Mount, W. Conrad Liles, John G. Sled, and Kevin C. Kain. 2015.
'Experimental Malaria in Pregnancy Induces Neurocognitive Injury in Uninfected Offspring
via a C5a-C5a Receptor Dependent Pathway', PLOS Pathogens, 11: e1005140.
McLin, V. A., C. H. Hu, R. Shah, and M. Jamrich. 2008. 'Expression of complement components
coincides with early patterning and organogenesis in Xenopus laevis', Int J Dev Biol, 52:
1123-33.
Miyamoto, Y., F. Sakane, and K. Hashimoto. 2015. 'N-cadherin-based adherens junction regulates
the maintenance, proliferation, and differentiation of neural progenitor cells during
development', Cell Adh Migr, 9: 183-92.
Pataky, Rozalia, Forbes A. Howie, Guillermina Girardi, and James P. Boardman. 2016. 'Complement
C5a is present in CSF of human newborns and is elevated in association with preterm birth',
The Journal of Maternal-Fetal & Neonatal Medicine: 1-4.
Pavlovski, Dale, John Thundyil, Peter N. Monk, Rick A. Wetsel, Stephen M. Taylor, and Trent M.
Woodruff. 2012. 'Generation of complement component C5a by ischemic neurons promotes
neuronal apoptosis', The FASEB Journal, 26: 3680-90.
Perez-Alcazar, M., J. Daborg, A. Stokowska, P. Wasling, A. Bjorefeldt, M. Kalm, H. Zetterberg, K.
E. Carlstrom, K. Blomgren, C. T. Ekdahl, E. Hanse, and M. Pekna. 2014. 'Altered cognitive
107
performance and synaptic function in the hippocampus of mice lacking C3', Exp Neurol, 253:
154-64.
Rahpeymai, Y., M. A. Hietala, U. Wilhelmsson, A. Fotheringham, I. Davies, A. K. Nilsson, J.
Zwirner, R. A. Wetsel, C. Gerard, M. Pekny, and M. Pekna. 2006. 'Complement: a novel
factor in basal and ischemia-induced neurogenesis', EMBO J, 25.
Rooryck, Caroline, Anna Diaz-Font, Daniel P. S. Osborn, Elyes Chabchoub, Victor Hernandez-
Hernandez, Hanan Shamseldin, Joanna Kenny, Aoife Waters, Dagan Jenkins, Ali Al Kaissi,
Gabriela F. Leal, Bruno Dallapiccola, Franco Carnevale, Maria Bitner-Glindzicz, Melissa
Lees, Raoul Hennekam, Philip Stanier, Alan J. Burns, Hilde Peeters, Fowzan S. Alkuraya,
and Philip L. Beales. 2011. 'Mutations in lectin complement pathway genes COLEC11 and
MASP1 cause 3MC syndrome', Nat Genet, 43: 197-203.
Schlett, K., and E. Madarasz. 1997. 'Retinoic acid induced neural differentiation in a neuroectodermal
cell line immortalized by p53 deficiency', J Neurosci Res, 47: 405-15.
Schwanhausser, B., D. Busse, N. Li, G. Dittmar, J. Schuchhardt, J. Wolf, W. Chen, and M. Selbach.
2011. 'Global quantification of mammalian gene expression control', Nature, 473: 337-42.
Sekar, Aswin, Allison R. Bialas, Heather de Rivera, Avery Davis, Timothy R. Hammond, Nolan
Kamitaki, Katherine Tooley, Jessy Presumey, Matthew Baum, Vanessa Van Doren, Giulio
Genovese, Samuel A. Rose, Robert E. Handsaker, Consortium Schizophrenia Working Group
of the Psychiatric Genomics, Mark J. Daly, Michael C. Carroll, Beth Stevens, and Steven A.
McCarroll. 2016. 'Schizophrenia risk from complex variation of complement component 4',
Nature, 530: 177-83.
Sepehrband, F., K. A. Clark, J. F. Ullmann, N. D. Kurniawan, G. Leanage, D. C. Reutens, and Z.
Yang. 2015. 'Brain tissue compartment density estimated using diffusion-weighted MRI
yields tissue parameters consistent with histology', Hum Brain Mapp, 36: 3687-702.
Shi, Yichen, Peter Kirwan, James Smith, Hugh P. C. Robinson, and Frederick J. Livesey. 2012.
'Human cerebral cortex development from pluripotent stem cells to functional excitatory
synapses', Nat Neurosci, 15: 477-86.
Soares, J. M., P. Marques, V. Alves, and N. Sousa. 2013. 'A hitchhiker's guide to diffusion tensor
imaging', Front Neurosci, 7: 31.
Stevens, Beth, Nicola J. Allen, Luis E. Vazquez, Gareth R. Howell, Karen S. Christopherson, Navid
Nouri, Kristina D. Micheva, Adrienne K. Mehalow, Andrew D. Huberman, Benjamin
Stafford, Alexander Sher, Alan M Litke, John D. Lambris, Stephen J. Smith, Simon W. M.
John, and Ben A. Barres. 2007. 'The Classical Complement Cascade Mediates CNS Synapse
Elimination', Cell, 131: 1164-78.
108
Szabo, A., I. Cobo, S. Omara, S. McLachlan, R. Keller, and R. Mayor. 2016. 'The Molecular Basis
of Radial Intercalation during Tissue Spreading in Early Development', Dev Cell, 37: 213-25.
Woodruff, T. M., K. S. Nandakumar, and F. Tedesco. 2011. 'Inhibiting the C5-C5a receptor axis',
Mol Immunol, 48.
Ziv, Omer, Assaf Zaritsky, Yakey Yaffe, Naresh Mutukula, Reuven Edri, and Yechiel Elkabetz. 2015.
'Quantitative Live Imaging of Human Embryonic Stem Cell Derived Neural Rosettes Reveals
Structure-Function Dynamics Coupled to Cortical Development', PLOS Computational
Biology, 11: e1004453.
109
4. C5aR1 in Pluripotent Stem Cell derived Neurons
The complement system is now firmly established as a multipotent regulator of biological processes.
This chapter is focussed on exploring an emerging facet of complement function, complement
regulation of cellular metabolism and its interplay with cell survival.
Metabolism and Cell Survival
The regulation of metabolic flux controls not only production of ATP in response to energy
requirements, but the balance between cell death and survival. Here some of more pertinent
mechanistic links between cell metabolism and survival, which may underpin any observed function
of C5a signalling, are introduced.
There is an intuitive link between metabolic rate and cell survival, with glycolytic rate influencing
survival via repression of apoptotic signalling. Reduced glycolysis leads to loss of mitochondrial
membrane potential, swelling, release of pro-death factors such as cytochrome c, and increased ROS
production (Kuznetsov et al. 2004). This process can be mediated by canonical bcl-2 family
signalling, with loss of phosphorylation of bcl-2-associated death promotor (bad) resulting in bax and
bak mediated initiation of apoptosis. Interestingly, the bcl-2 family of proteins have now been
identified as regulators of energy metabolism independent of their apoptotic functions. In hepatocytes
and beta islet cells, bad activates glucokinase to increase glycolysis, whilst bcl-2 and mcl-1 proteins
have been shown to increase mitochondrial respiration and energy production (Giménez-Cassina and
Danial 2015). C5a is known to modulate the activity of bcl-2 family proteins, however, to date this
has only been explored in terms of canonical bcl-2 signalling, with an influence on cell metabolism
largely unexplored (Perianayagam et al. 2004; Perianayagam et al. 2006; Lalli et al. 2008).
With regards to neuronal energy metabolism, a number of studies have outlined a unique link between
energy flux and cell survival. It has been reported that in the rat cortex, neurons express 6-
phosphofructo-2-kinase/fructose-2, 6-bisphosphatase-3 (pfkfb3), a key glycolytic enzyme; however,
this enzyme is subjected to rapid proteosomal degradation, leading to an absence of pfkfb3 protein
(Herrero-Mendez et al. 2009). As would be expected, this lack of pfkfb3 leads to a low glycolytic rate
and an inability of the neurons to increase glycolysis in response to inhibition of mitochondrial
respiration (Almeida et al. 2001). Rather than being detrimental, this has been reported to be an
advantageous adaptation for neurons, with the low neuronal glycolytic rate diverting glucose into the
pentose phosphate pathway, increasing the production of reduced glutathione, a major antioxidant
110
required for ROS homeostasis. As such, when the levels of pfk3b were artificially increased, the
decrease in antioxidant production resulted in increased ROS and apoptosis of the neurons. In such a
model, the prioritisation of antioxidant production over pyruvate formation would lead to a
requirement for a separate source of energy. Within the brain this need is hypothesised be met by
astrocyte production of lactate, which is then taken up by neurons and converted to pyruvate for use
in the TCA cycle and oxidative phosphorylation, in a processes termed the astrocyte-neuron lactate
shuttle (ANLS) hypothesis.
Whilst there is a growing body of evidence in support of the ANLS hypothesis, there remains
considerable dispute in this area of study, with reports of experimental results contradictory to those
expected in an ANLS model (best reviewed in (Dienel 2012; Pellerin and Magistretti 2012)). In
conflict with the above results, it has been reported that similar rat neurons are capable of upregulating
glycolysis to meet energy requirements, negating the low pfkfb3 hypothesis and need for an ANLS
(Dienel 2012; Patel et al. 2014). Such disagreements within the literature highlight that in the study
of a role of C5a in control of neuronal metabolism, the identification of the metabolic capacity of
human neurons may provide serendipitous insights into the validity of the ANLS hypothesis in the
human brain.
Complement in metabolic regulation
Recent work has demonstrated an intrinsic link between complement activation and metabolic flux
in immune cells (recently reviewed by Hess et. al. (Hess and Kemper 2016)). For example, in T-cells,
C3b-C46 signalling has been shown to enhance glycolysis and mitochondrial respiration, whilst
intracellular C3a-C3aR signalling results in the activation of mechanistic target of rapamycin
(mTOR), a central regulator of T-cell metabolism capable of increasing aerobic glycolysis (Kolev et
al. ; Liszewski et al. ; Yang and Chi 2012). C5aR signalling has also been linked with mTOR
signalling in T-cells through AKT phosphorylation (Strainic et al. 2013). Interestingly, AKT
signalling itself can induce glycolysis and inhibit apoptosis through an increase in mitochondrial
associated hexokinase (Gottlob et al. 2001). Given the long history of C5a signalling in promoting
survival, such a mechanism provides a link through which previous observations of pro-survival C5a
signalling may be acting via metabolic regulation, rather than direct inhibition of apoptotic cascades.
Whilst systemic actions of complement on metabolism have been reported (Phieler et al. 2013), the
involvement of complement signalling in cellular metabolism of non-immune types such as neurons
remains poorly defined. One report stated that C5a signalling in pheochromocytoma derived neuron-
like cells retards cell growth through reduced aerobic glycolysis; however, on review of the results
111
of this study, further investigation would be necessary before a comprehensive conclusion could be
made (Martinus and Cook 2011).
C5a signalling in post-mitotic neurons
As outlined in chapter 1, within the central nervous system C5a signalling has been shown to be an
important regulator of survival. Given the strong connection between metabolic pathways and cell
survival, and the recent works linking complement to cell metabolism, it could be postulated that the
mechanism behind the previously defined actions of C5a in neuronal survival lies in the regulation of
neuronal metabolism by complement.
In post-mitotic neurons, animal studies have reported both neuroprotective and neurodestructive
actions of C5a signalling. In the setting of glutamate excitotoxicity, activation of C5aR in mouse
cortico-hippocampal neuronal cultures promotes cell survival through maintenance of glutamate
GluR2 receptor expression and inhibition of apoptosis (Osaka et al. 1999; Mukherjee et al. 2008).
Conversely, it has been reported that addition of C5a to mouse cortical neurons of a similar age
directly induces neuronal apoptosis (Pavlovski et al. 2012). Additionally, in this study it was reported
that apoptosis induced via glucose deprivation was mediated through autocrine C5a signalling, with
survival promoted by antagonism of C5aR. Whilst the results between the studies are in conflict, this
may be in part explained by variations in methodology used for neuron isolation, with the action of
C5aR in more specific neuronal subsets varying between promotion of survival or apoptosis.
A main focus of this chapter was to explore the role of C5a signalling in human embryonic stem cell
derived cortical neurons. More specifically, it was aimed to define the action of C5a in human
neuronal survival, and explore a mechanistic link between C5a function and the regulation of cell
metabolism. The elucidation of a role for C5aR1 in human neuronal survival and/or metabolism,
would aid in the understanding of how this receptor acts in both normal physiology and in neuronal
pathologies such as stroke or Alzheimer’s disease, helping to guide future therapeutic research.
112
Materials and Methods
Cell Culture
H9 hES cells were maintained on Matrigel (BD Biosciences, San Diego, CA) coated dishes in mouse
embryonic fibroblast conditioned KSR medium (Dulbecco's modified Eagle's medium/F-12
supplemented with 20% knockout serum replacement, 0.1 mM nonessential amino acids, 1 mM l-
glutamine, 0.1 mM β-mercaptoethanol, and 10 ng/ml human basic fibroblast growth factor [FGF2] -
all sourced from Life Technologies, Carlsbad, CA) as previously described (Briggs et al. 2013). hES
induction to cortical neurons was performed using an adaptation of the dual-SMAD inhibition method
(Shi et al. 2012a). With this protocol, the induction efficiency is >95% with a population consisting
of 70% TUBB3 positive neurons by day 40 of differentiation (Shi et al. 2012b).
The initial steps of this protocol involve rosette generation as described in chapter 3 of this thesis.
Following rosette generation, purity of cultures was ensured by manual harvesting of rosettes. Cells
were matured in the continued presence of retinoic acid, until day 60, after which they were used for
further experimentation. Cytarabine (1µM, Sigma-Aldrich) was added to cultures with second-daily
media changes from day 43-50. The concentration and timing of cytarabine addition were optimised
and selected as the ideal time for induction of apoptosis of progenitor and contaminant cells, allowing
for the production of a pure population of post-mitotic neurons.
Immunocytochemistry
Differentiated neuronal cultures were fixed and stained using the same methodology as described in
chapter 3 of this thesis. Neurons were stained with antibodies raised against human C5aR1 (BD, #
550733, 3µg/mL), Tubb3 (Millipore, MAB1637, 1:1000), and GFAP (DAKO, PO449, 1:500) and
subsequently with the appropriate alexafluor secondary antibodies (Invitrogen, 1:1000). Secondary
only staining controls were used.
Calcium Flux Analysis
Day 28 neurons were seeded at a density of 3x104 cells per well into a black walled, clear bottom 96
well plate (Sigma-Aldrich, USA) and matured following the above protocol. On the day of
experimentation, cells were incubated for 45min at 37°C in 100uL per well of Fluo-4 NW dye solution
(Invitrogen, USA) consisting of 1x Fluo-4 dye in Hank’s balanced salt solution (HBSS) and 2.5mM
probenecid. The FlexStation 3 microplate reader (Molecular Devices, USA) was used to perform the
113
calcium mobilisation assay. Changes in fluorescence indicative of intracellular calcium changes were
measured every 2 seconds for 2.5min after the addition of a dose range from 100µM-1µM glutamate.
FBS was used as a positive control.
Polymerase Chain Reaction
RT-PCR of post day 60 neuronal cultures was performed using the same methodology as described
in chapter 3 of this thesis. The primer sequences for mRNA detection were, C5AR1 Fwd:
CCTTCAATTATACCACCCCTGA Rev: GGAAGACGACTGCAAAGATGA; ACTB
Fwd:GCGGGAAATCGTGCGTGACATT Rev: GATGGAGTTGAAGGTAGTTTGGTG.
Cell Survival
Neurons seeded at 3x104 cells per well in 96 well plates were used for cell survival studies. Cells
were matured as described above and used post day 60 of differentiation. In order to accurately
interrogate the function of C5a, cells were placed into a chemically defined medium with controlled
levels of metabolic substrates. This base medium consisted of 145mM NaCl, 4mM KCl, 1mM MgCl2,
15mM HEPES, 2g/L Glucose, 2mM CaCl2, and 0.25% BSA (all Sigma-Aldrich). For FCCP and
rotenone treatments, cells were incubated in a dose response of the respective chemicals. For C5a
treatment, cells were pre-treated with 1nM C5a for 1 hour, after which vehicle, FCCP, or rotenone
was added. Cells were analysed 24 hours later using a 1/10 dilution of Alamar Blue (Invitrogen)
according to the manufacturers protocol. With this assay, the rate of colour change of the dye from
blue to pink is directly proportional to the number of live cells. Following incubation, the supernatant
absorbance was measured at 570nm, with 600nm as a reference wavelength.
Metabolic Analysis
Metabolic flux was analysed using the Seahorse bio-analyser (Seahorse Bioscience, USA) according
to the manufacturer’s protocol. Briefly, a concentration range of both cells and chemicals were tested
to identify the optimal concentrations of both. Cells were interrogated using the mito stress test
protocol, with oxygen consumption rate (OCR) and extracellular acidification rate (ECAR) measured
in response to the addition to the chemicals oligomycin, FCCP, and rotenone. An overview of the
function of these chemicals is show in figure 3C.
114
Statistical Analysis
Graphing and statistics were performed using GraphPad Prism Software 6.0c (GraphPad Software,
LaJolla, CA), using Student's t test and one-way ANOVA with Dunnett post-test for the relevant
statistical analysis.
.
Results
Production of hESC derived cortical neurons
In order to investigate the role of C5aR1 signalling in human neurons, hES cells underwent neuronal
induction using an adaption of the previously reported dual-SMAD inhibition protocol (Shi et al.
2012a). The produced cultures contained both neurons and glia, as confirmed with TUBB3 and GFAP
staining respectively (Fig. 1A). It has previously been shown that PPSC derived cortical stem cells
produce post-mitotic neurons prior to the formation of astrocytes (Shi et al. 2012b). This timing was
taken advantage of to purify post-mitotic neurons from glial and contaminant cells. Temporal addition
of the antimetabolite cytarabine induced apoptosis in proliferative cells, leaving a pure population of
post-mitotic neurons for further study (Fig. 1A). Cortical specification was achieved through the
presence of retinoic acid as previously described (Shi et al. 2012b). Consistent with previous reports,
maturation of cortical neuronal cultures resulted in the acquisition of glutamate responsiveness as
detected via calcium flux analysis (Fig. 1B&C).
115
Figure 1: hESC derived neuronal differentiation. (A) Human embryonic stem cells differentiated to neurons using dual SMAD inhibition results in cultures containing both TUBB3 positive (green) neurons and GFAP positive (red) glia. The addition of cytarabine from day 43-50 induced apoptosis of dividing progenitor and contaminant cells, leaving a pure population of post-mitotic neurons. (B) As detected via calcium flux analysis, the neurons showed no response to glutamate at day 44 of differentiation, with acquisition of glutamate invoked depolarisation achieved by day 60 of differentiation (C).
116
Exogenous C5a is not toxic to hESC derived neurons
C5aR1 expression has previously been reported on mouse cortical neurons and human neuronal
subtypes (Hawksworth et al. 2016). Consistent with these reports, mRNA expression of C5AR1 was
seen in hESC derived neurons (Fig. 2B). Protein expression in these neuronal cultures was below the
limits of detection via immunocytochemistry with a C5aR1 specific antibody (clone C85-2506, see
chapter 3). Whilst this limited the ability to assess the distribution of C5aR1 expression within the
culture, this result is concordant with previous studies which showed functional C5aR1 signalling in
mouse neurons where only mRNA expression was detectable (Hernandez et al. 2017). Given the
previous reports of C5aR1 signalling modulating survival of mammalian cortical neurons, we next
sought to assess the ability of C5a to induce neurotoxicity in human neurons. In contrast to previous
reports in mouse neurons, the addition of 10nM C5a to neuronal cultures did not affect neuronal
survival after 24 hours (Fig. 2A). This may reflect species specific effects of C5aR1 in previous rodent
studies which do not translate to human cells.
Figure 2: C5a is not toxic to C5AR1 expressing neurons. (A) Exogenous C5a did not alter cell survival as detected by Alamar Blue analysis after 24 hours incubation with 10nM C5a. (B) Post-day 60 neuronal cultures showed mRNA expression of C5AR1. No-reverse transcriptase (-RT) and ACTB controls are shown.
117
In the previous mouse studies, as well as being directly toxic, C5a was implicated in increased cell
death in the presence of secondary factors such as glucose deprivation and amyloid beta (Aβ)
(Pavlovski et al. 2012; Hernandez et al. 2017). As such, we examined the potential for C5a to enhance
cell death in the presence of a secondary stressor. Given our interest in exploring the link between
C5a function and metabolism, we utilised modulators of the mitochondrial electron transport chain
alone or in the presence of C5a. This allowed for interrogation of both the effect of C5a on neurons
undergoing oxidative stress and apoptosis, and any potential role of C5a in the regulation of neuronal
metabolism.
The inhibitors FCCP and rotenone act on separate complexes in the electron transport chain (Fig. 3C)
to induce cell death through different mechanisms. FCCP collapses the proton gradient across the
mitochondrial inner membrane, reducing the efficiency of aerobic ATP generation which results in
increased respiration to meet ATP requirements (Dispersyn et al. 1999). The dissipation of the inner
membrane potential eventually results in outer membrane instability and release of pro-apoptotic
factors, as well as depletion of intracellular antioxidant capacity (Dispersyn et al. 1999; Han et al.
2009). In contrast, rotenone inhibits complex 1 to prevent mitochondrial respiration and ATP
generation whilst increasing ROS production, resulting in apoptotic cell death (Pei et al. 2003; Radad
et al. 2006).
FCCP showed a dose dependent reduction in cell survival (EC50 = 750 nM), with reduced cell
number as detected with alamar blue after 24 hours treatment (Fig. 3A). The neurons were more
resistant to rotenone induced cell death, with a 30% reduction in cell number after 24 hours (Fig. 3A),
which may reflect a resistance of the neurons to primarily oxidative apoptosis in contrast to the
membrane destabilisation seen with FCCP. As was seen with the C5a alone treatment, the addition
of exogenous C5a to FCCP or rotenone treatments did not alter cell survival (Fig. 3B). There appeared
to be a trend in C5a increasing survival in the presence of FCCP, however, this result was not found
to be statistically significant over multiple repetitions of the experiment. Together these results
suggest that, in this population of human neurons, C5a signalling does not impact on cell survival,
either positively or negatively, and has little effect on metabolic flux.
118
Figure 3. C5a does not affect cell survival in the presence of apoptotic inducers. (A) Dose response curves showing cell survival in response to increasing concentrations of FCCP and rotenone after 24 hours. (B) EC50 concentrations were calculated for FCCP and rotenone. The presence of C5a was unable to alter cell survival in the presence of these mitochondrial inhibitors. (C) Illustration of the mechanism of effect for the mitochondrial inhibitors used in this chapter. Rotenone inhibits complex I of the electron transport chain, whilst FCCP acts to dissipate the proton gradient, reducing the efficiency of ATP generation. n.s.= not significant.
119
hESC derived neurons are capable of increasing glycolysis
Finally, we aimed to examine the metabolic capacity of the cortical neuron cultures. The current
literature remains in conflict as to the capability of neurons to upregulate glycolysis, with some
evidence showing a preference for antioxidant generation and access of metabolic substrates through
the ANLS. The metabolic capacity of the neurons was examined using the Seahorse extracellular flux
analyser to measure oxygen consumption rate (OCR) and extracellular acidification rate (ECAR).
Inhibition of ATP synthase with oligomycin lead to an expected reduction in mitochondrial
respiration and drop in OCR (Fig. 4A). Interestingly, a simultaneous increase in ECAR was seen,
suggestive of an increase in the rate of glycolysis. This result is in conflict with previous reports in
rat studies which showed little increase in ECAR (Almeida et al. 2001), and suggests that neurons are
capable of upregulating glycolysis. As was expected, a respective increase and decrease in OCR for
FCCP and rotenone treatments was seen, confirming the efficacy and mechanism of action of these
molecules in previous results (Fig. 3). Whilst the neurons were capable of increasing glycolysis, the
addition of lactate provided a survival advantage to FCCP induced cell death. This suggests a role for
ANLS under conditions of substrate depletion as may be seen in ischaemic stroke. Additionally, the
ability of lactate to reduce FCCP toxicity confirms that increased energy flux can mitigate the FCCP
induced membrane destabilisation. As such, if C5a were to affect energy flux, or apoptotic pathways,
a difference in FCCP toxicity would have been seen (Fig 3). Whilst this experiment methodology was
optimised to provide a platform to further interrogate the role of C5a in neuronal metabolism and
survival; given the non-significant findings for a role of C5a in these functions in previous
experiments, C5a treatment with seahorse analysis was not performed.
120
Figure 4. Metabolic capacity of hPSC derived neurons. Neurons were subjected to seahorse flux analysis in the presence of modifiers of mitochondrial respiration (see fig 3C). An illustration of the significance of each chemical use is shown in A. Interestingly, ECAR increased in the presence of oligomycin, suggesting a capacity for the neurons to increase the rate of glycolysis. (B) Lactate addition was able to reduce FCCP induced apoptosis, as detected via alamar blue after 24 hours treatment. OCR = Oxygen consumption rate, ECR = Extracellular acidification rate. ** p≤0.01, ****p≤0.0001
Discussion
The complement anaphylatoxin, C5a, and its receptor C5aR1 have been demonstrated to act not only
in the potentiation of the immune response, but in a wide number of non-immune systems. Within
the brain, C5aR1 expression has been reported on both glia and neurons with functions of C5aR1
observed both under physiological and pathological conditions (Woodruff et al. 2011; Hawksworth
et al. 2016). More specifically, in mature neurons, the effect of C5a has been centred on its actions
in cell survival. Reports from separate groups have demonstrated that C5aR1 activation in vitro
121
induces apoptosis of mouse cortical neurons (Pavlovski et al. 2012; Hernandez et al. 2017).
Additionally, C5a was shown to enhance toxicity of insults such as glucose deprivation and amyloid
beta exposure. This is in contrast to earlier studies on SH-SY5Y cells which showed an effect of C5a
in reducing Aβ induced toxicity (O'Barr et al. 2001), which has been suggested to be an artefact of
the mutated neuroblastoma cell line (Hernandez et al. 2017).
Here we have utilised hESCs differentiated to post-mitotic cortical neurons to determine the action
of C5a signalling in human neurons. In our experimental model, exogenous C5a both alone or in the
presence of metabolic/pro-apoptotic stressors, had little effect on neuronal survival. This is in contrast
to previous animal studies where a direct neurotoxic effect was seen with exogenous C5a. Our results
add to previous observations in terminally differentiated SH-SY5Y neuroblastoma cells, where C5a
was reported to ameliorate Aβ induced toxicity (O'Barr et al. 2001). Given the cancerous origins of
the SH-SY5Y line, its ability to faithfully recapitulate normal neuronal properties has been rightfully
questioned, with the results in conflict to more recent primary mouse studies suggested to be due to
an artefact of the mutated cell line. Our observations in hESC derived neurons, in addition to the SH-
SY5Y study, may highlight an important discordance in C5aR1 function between rodent and human
brains.
Such differences in the complement system between mammalian species are not unprecedented, with
the receptors for C3 fragments providing the most striking illustration of mouse-human variation. In
humans, the receptors CR1 and CR2 are encoded by separate genes, with the receptors playing
separate roles in immune regulation (Jacobson and Weis 2008). In mice however, these receptors are
formed via splicing of a single gene, with limited expression. Mice instead express CR1-related gene
Y (Crry), which was lost in primate evolution, with the function of Crry replaced in primates by CR1
and CD46. In mice, CD46 expression is restricted to the testis with roles in the acrosome reaction
(Jacobson and Weis 2008). In contrast, CD46 in humans is found on all nucleated cells, with
additional roles in both regulation of complement and modulation of adaptive immunity (Yamamoto
et al. 2013). For C5aR1, the gene shares only 65% sequence homology between mouse and human
(Gerard et al. 1992), and whilst there is conservation of function in innate immune actions, our results
may suggest a divergence of non-immune functions in post-mitotic neurons. This is in contrast to
neural progenitor cells, where in chapter 3 of this thesis, C5aR1 function was seen to be conserved
between mouse and human models of neurogenesis.
Whilst these results strongly suggest a lack of involvement of C5aR1 signalling in both neuronal cell
survival and metabolism, there are a number of confounding factors which limit the interpretation of
these results, including a poor determination of receptor distribution in the cultures, and limitations
of the current capabilities of hESC modelling. The human cortical neurons expressed C5AR1 mRNA,
122
with low protein levels below the threshold of immunocytochemical detection. This has been reported
previously in mouse cortical neurons (Hernandez et al. 2017). Additionally, in chapter 3 of this thesis,
apical concentration of C5aR1 receptor allowed for protein detection, however, with the addition of
DAPT, loss of apical localisation and receptor redistribution lead to loss of protein signal even in the
known presence of C5aR1 protein. Taken with these previous results, lack of protein detection does
not exclude uniform distribution of C5aR1 expression, however, it may equally be that the expression
of C5aR1 was limited to a specific sub-population of cells. The lack of conclusive determination of
protein expression hinders the interpretation of subsequent observations, particularly when
interpreting negative results such as those obtained in this study.
Additionally, interpretation of the significance of the results of this study is limited by the capacity
of PPSC modelling to faithfully reproduce neurons analogous to adult in vivo human neurons. The
current state of the field in neuronal modelling with PPSCs is rapidly advancing and provides a
powerful tool for both development and disease modelling (Zhu and Huangfu 2013). Improvements
in methods for differentiation of PPSCs has resulted in the production of a matured network of post-
mitotic neurons capable of both spontaneous and neurotransmitter invoked depolarization (Shi et al.
2012b). Specification of neurons to a cortical phenotype and into further subtypes such as
dopaminergic neurons have produced models capable of recapitulating disease phenotypes, allowing
for analysis of human development and disease which would otherwise be limited to animal studies
(Zhu and Huangfu 2013; Yap et al. 2015). This model provides a number of advantages over animal
or mutant cell studies, however, current differentiation protocols are limited in their ability to
faithfully produce postnatal neurons. Functional studies have reported PPSC derived neurons such as
those used in this chapter display a phenotype resembling foetal and early postnatal rodent neurons
(Livesey et al. 2016). Additionally, transcriptomic studies have reported PPSC derived neurons
display expression profiles with the highest correlation to midgestational human foetal brain tissue
(Stein et al. 2014). Whilst this is a significant improvement over other in vitro cell types such as SH-
SY5Y (Livesey et al. 2016), these results show that the current state of the field in PPSC neuronal
modelling is limited in its capacity to produce neurons of an adult, or potentially even postnatal,
phenotype. As such, the observation of a lack of a role for C5a signalling in human neuronal
metabolism and survival, as seen in this study, may not accurately reflect the function of C5a in the
adult brain. Regardless of the studies caveats, the addition of these results to those seen in animal and
mutant line studies offers another piece in the puzzle behind the functional role of C5a signalling in
human neurons.
The experimental results of this study also allowed for the exploration of the capacity of PPSC derived
neurons to regulate metabolic pathways. In contrast to the ANLS hypothesis demonstrated in rat
123
neurons, the human neurons displayed a capacity to increase glycolysis in response to metabolic need.
Again, this result may reflect species variations between rodent and human neurons. Additionally, if
the effect of C5aR1 in mouse neuronal apoptosis was due to an underlying regulation of metabolic
flux, the increased capacity of the human neurons to auto-regulate metabolism may be playing a part
in the lack of effect seen for C5a-C5aR1 signalling.
It is obvious that further work is required before a sound conclusion can be made on the role of C5aR1
in human adult neurons. With the rapid progression of PPSC differentiation techniques, it is hoped
that the maturation of neurons to a cell type more analogous to human adult neurons will be achieved,
allowing for repetition and validation of the results of this chapter. In conclusion, the results obtained
in this chapter suggest that, in contrast to mouse studies, C5a signalling in cortical neurons has little
effect on survival or metabolic signalling pathways. Furthermore, whilst a protective role for lactate
can be seen in support of an ANLS hypothesis, the human neurons in this model displayed capacity
to upregulate glycolysis, which supports research disputing ANLS validity (Dienel 2012; Patel et al.
2014).
124
References
Almeida, A., J. Almeida, J. P. Bolanos, and S. Moncada. 2001. 'Different responses of astrocytes
and neurons to nitric oxide: the role of glycolytically generated ATP in astrocyte protection',
Proc Natl Acad Sci U S A, 98: 15294-9.
Briggs, J. A., J. Sun, J. Shepherd, D. A. Ovchinnikov, T. L. Chung, S. P. Nayler, L. P. Kao, C. A.
Morrow, N. Y. Thakar, S. Y. Soo, T. Peura, S. Grimmond, and E. J. Wolvetang. 2013.
'Integration-free induced pluripotent stem cells model genetic and neural developmental
features of down syndrome etiology', STEM CELLS, 31: 467-78.
Dienel, G. A. 2012. 'Brain lactate metabolism: the discoveries and the controversies', J Cereb Blood
Flow Metab, 32: 1107-38.
Dispersyn, Gwenda, Rony Nuydens, Rich Connors, Marcel Borgers, and Hugo Geerts. 1999. 'Bcl-2
protects against FCCP-induced apoptosis and mitochondrial membrane potential
depolarization in PC12 cells', Biochimica et Biophysica Acta (BBA) - General Subjects,
1428: 357-71.
Gerard, C., L. Bao, O. Orozco, M. Pearson, D. Kunz, and N. P. Gerard. 1992. 'Structural diversity
in the extracellular faces of peptidergic G-protein-coupled receptors. Molecular cloning of
the mouse C5a anaphylatoxin receptor', The Journal of Immunology, 149: 2600.
Giménez-Cassina, Alfredo, and Nika N. Danial. 2015. 'Regulation of mitochondrial nutrient and
energy metabolism by BCL-2 family proteins', Trends in Endocrinology & Metabolism, 26:
165-75.
Gottlob, K., N. Majewski, S. Kennedy, E. Kandel, R. B. Robey, and N. Hay. 2001. 'Inhibition of
early apoptotic events by Akt/PKB is dependent on the first committed step of glycolysis
and mitochondrial hexokinase', Genes Dev, 15: 1406-18.
Han, Yong Hwan, Suhn Hee Kim, Sung Zoo Kim, and Woo Hyun Park. 2009. 'Carbonyl cyanide p-
(trifluoromethoxy) phenylhydrazone (FCCP) as an O2− generator induces apoptosis via the
depletion of intracellular GSH contents in Calu-6 cells', Lung Cancer, 63: 201-09.
Hawksworth, Owen A., Liam G. Coulthard, and Trent M. Woodruff. 2016. 'Complement in the
fundamental processes of the cell', Mol Immunol.
Hernandez, M. X., P. Namiranian, E. Nguyen, M. I. Fonseca, and A. J. Tenner. 2017. 'C5a Increases
the Injury to Primary Neurons Elicited by Fibrillar Amyloid Beta', ASN Neuro, 9:
1759091416687871.
Herrero-Mendez, A., A. Almeida, E. Fernandez, C. Maestre, S. Moncada, and J. P. Bolanos. 2009.
'The bioenergetic and antioxidant status of neurons is controlled by continuous degradation
of a key glycolytic enzyme by APC/C-Cdh1', Nat Cell Biol, 11: 747-52.
125
Hess, Christoph, and Claudia Kemper. 2016. 'Complement-Mediated Regulation of Metabolism and
Basic Cellular Processes', Immunity, 45: 240-54.
Jacobson, Amanda C., and John H. Weis. 2008. 'Comparative Functional Evolution of Human and
Mouse CR1 and CR2', Journal of Immunology (Baltimore, Md. : 1950), 181: 2953-59.
Kolev, Martin, Sarah Dimeloe, Gaelle Le Friec, Alexander Navarini, Giuseppina Arbore,
Giovanni A Povoleri, Marco Fischer, Réka Belle, Jordan Loeliger, Leyla Develioglu,
Glenn R Bantug, Julie Watson, Lionel Couzi, Behdad Afzali, Paul Lavender, Christoph
Hess, and Claudia Kemper. 'Complement Regulates Nutrient Influx and Metabolic
Reprogramming during Th1 Cell Responses', Immunity, 42: 1033-47.
Kuznetsov, Andrey V., Manickam Janakiraman, Raimund Margreiter, and Jakob Troppmair. 2004.
'Regulating cell survival by controlling cellular energy production: novel functions for
ancient signaling pathways?', FEBS Letters, 577: 1-4.
Lalli, P. N., M. G. Strainic, M. Yang, F. Lin, M. E. Medof, and P. S. Heeger. 2008. 'Locally
produced C5a binds to T cell-expressed C5aR to enhance effector T-cell expansion by
limiting antigen-induced apoptosis', Blood, 112: 1759-66.
Liszewski, M. Kathryn, Martin Kolev, Gaelle Le Friec, Marilyn Leung, Paula G Bertram,
Antonella F Fara, Marta Subias, Matthew C Pickering, Christian Drouet, Seppo Meri,
T. Petteri Arstila, Pirkka T Pekkarinen, Margaret Ma, Andrew Cope, Thomas Reinheckel,
Santiago Rodriguez de Cordoba, Behdad Afzali, John P Atkinson, and Claudia Kemper.
'Intracellular Complement Activation Sustains T Cell Homeostasis and Mediates Effector
Differentiation', Immunity, 39: 1143-57.
Livesey, Matthew R., Dario Magnani, Giles E. Hardingham, Siddharthan Chandran, and David J. A.
Wyllie. 2016. 'Functional properties of in vitro excitatory cortical neurons derived from
human pluripotent stem cells', The Journal of Physiology, 594: 6573-82.
Martinus, R. D., and C. J. Cook. 2011. 'The effect of complement C5a on mitochondrial functions
of PC12 cells', Neuroreport, 22: 581-5.
Mukherjee, Piali, Sunil Thomas, and Giulio Maria Pasinetti. 2008. 'Complement anaphylatoxin C5a
neuroprotects through regulation of glutamate receptor subunit 2 in vitro and in vivo',
Journal of Neuroinflammation, 5: 1-7.
O'Barr, S. A., J. Caguioa, D. Gruol, G. Perkins, J. A. Ember, T. Hugli, and N. R. Cooper. 2001.
'Neuronal expression of a functional receptor for the C5a complement activation fragment', J
Immunol, 166: 4154-62.
Osaka, H., P. Mukherjee, P. S. Aisen, and G. M. Pasinetti. 1999. 'Complement-derived
anaphylatoxin C5a protects against glutamate-mediated neurotoxicity', J Cell Biochem, 73.
126
Patel, A. B., J. C. Lai, G. M. Chowdhury, F. Hyder, D. L. Rothman, R. G. Shulman, and K. L.
Behar. 2014. 'Direct evidence for activity-dependent glucose phosphorylation in neurons
with implications for the astrocyte-to-neuron lactate shuttle', Proc Natl Acad Sci U S A, 111:
5385-90.
Pavlovski, Dale, John Thundyil, Peter N. Monk, Rick A. Wetsel, Stephen M. Taylor, and Trent M.
Woodruff. 2012. 'Generation of complement component C5a by ischemic neurons promotes
neuronal apoptosis', The FASEB Journal, 26: 3680-90.
Pei, Wei, Anthony K. F. Liou, and Jun Chen. 2003. 'Two caspase-mediated apoptotic pathways
induced by rotenone toxicity in cortical neuronal cells', The FASEB Journal, 17: 520-22.
Pellerin, L., and P. J. Magistretti. 2012. 'Sweet sixteen for ANLS', J Cereb Blood Flow Metab, 32:
1152-66.
Perianayagam, M. C., V. S. Balakrishnan, B. J. Pereira, and B. L. Jaber. 2004. 'C5a delays apoptosis
of human neutrophils via an extracellular signal-regulated kinase and Bad-mediated
signalling pathway', Eur J Clin Invest, 34: 50-6.
Perianayagam, M. C., N. E. Madias, B. J. Pereira, and B. L. Jaber. 2006. 'CREB transcription factor
modulates Bcl2 transcription in response to C5a in HL-60-derived neutrophils', Eur J Clin
Invest, 36: 353-61.
Phieler, J., R. Garcia-Martin, J. D. Lambris, and T. Chavakis. 2013. 'The role of the complement
system in metabolic organs and metabolic diseases', Semin Immunol, 25: 47-53.
Radad, Khaled, Wolf-Dieter Rausch, and Gabriele Gille. 2006. 'Rotenone induces cell death in
primary dopaminergic culture by increasing ROS production and inhibiting mitochondrial
respiration', Neurochemistry International, 49: 379-86.
Shi, Y., P. Kirwan, and F. J. Livesey. 2012a. 'Directed differentiation of human pluripotent stem
cells to cerebral cortex neurons and neural networks', Nat Protoc, 7: 1836-46.
Shi, Yichen, Peter Kirwan, James Smith, Hugh P. C. Robinson, and Frederick J. Livesey. 2012b.
'Human cerebral cortex development from pluripotent stem cells to functional excitatory
synapses', Nat Neurosci, 15: 477-86.
Stein, Jason L, Luis de la Torre-Ubieta, Yuan Tian, Neelroop N Parikshak, Israel A Hernández,
Maria C Marchetto, Dylan K Baker, Daning Lu, Cassidy R Hinman, Jennifer K Lowe,
Eric M Wexler, Alysson R Muotri, Fred H Gage, Kenneth S Kosik, and Daniel H
Geschwind. 2014. 'A Quantitative Framework to Evaluate Modeling of Cortical
Development by Neural Stem Cells', Neuron, 83: 69-86.
Strainic, Michael G., Ethan M. Shevach, Fengqi An, Feng Lin, and M. Edward Medof. 2013.
'Absence of signaling into CD4+ cells via C3aR and C5aR enables autoinductive TGF-
[beta]1 signaling and induction of Foxp3+ regulatory T cells', Nat Immunol, 14: 162-71.
127
Woodruff, T. M., K. S. Nandakumar, and F. Tedesco. 2011. 'Inhibiting the C5-C5a receptor axis',
Mol Immunol, 48.
Yamamoto, Hidekazu, Antonella Francesca Fara, Prokar Dasgupta, and Claudia Kemper. 2013.
'CD46: The ‘multitasker’ of complement proteins', The International Journal of
Biochemistry & Cell Biology, 45: 2808-20.
Yang, Kai, and Hongbo Chi. 2012. 'mTOR and metabolic pathways in T cell quiescence and
functional activation', Seminars in Immunology, 24: 421-28.
Yap, May Shin, Kavitha R. Nathan, Yin Yeo, Lee Wei Lim, Chit Laa Poh, Mark Richards, Wei
Ling Lim, Iekhsan Othman, and Boon Chin Heng. 2015. 'Neural Differentiation of Human
Pluripotent Stem Cells for Nontherapeutic Applications: Toxicology, Pharmacology, and In
Vitro Disease Modeling', Stem Cells International, 2015: 11.
Zhu, Z., and D. Huangfu. 2013. 'Human pluripotent stem cells: an emerging model in
developmental biology', Development, 140: 705-17.
128
5. Discussion and Concluding Remarks
The complement system has long stood as a controller of innate immunity. From its first description
at the end of the 19th century as a single heat-labile effector of antibody-mediated immunity,
knowledge of complement has expanded to reveal a complex and vital family of proteins, capable of
controlling the innate immune response through activation and recruitment of immune cells, tagging
of pathogens for destruction, and the direct lysis of bacterial pathogens (Kaufmann 2008; Nesargikar
et al. 2012). The regard of complement solely as a controller of innate immunity was maintained for
almost a century, until the early 90s, with the discovery of seminal complement proteins and the
actions of complement C3b and CD46 in facilitating sperm-oocyte interactions, broadening the
perspective of complement beyond innate immunity (Anderson et al. 1993). This perspective of
complement has rapidly shifted, with the complement system now widely accepted as a multi-faceted
family of proteins, capable of not only innate and adaptive immune regulation, but of facilitating a
broad number of non-immune actions including the control of tissue morphogenesis, wound healing,
and synaptic pruning (Hawksworth et al. 2016). It apparent however, that even with such discoveries,
the current knowledge of the full array of complement functions remains limited. Recent examples
of the continued surprises which complement can throw at researchers includes the discovery of novel
modes for autocrine complement activation, with the discovery of intracellular cleavage of C3 and
C5 to activate intracellular complement receptor signalling (Arbore and Kemper 2016; Kolev et al.
2014).
This thesis further explored novel actions of C5a-C5aR1 signalling in development. Through the
utilisation of human pluripotent stem cells (PPSCs) for in vitro modelling, the main aims of this thesis
were to investigate C5aR1 expression and function at three points in development; in PPSCs
representative of the blastocyst inner cell mass, in neural rosettes representative of the developing
ventricular zone, and in matured post-mitotic cortical neurons. Overall, the experimental results
identified a number of novel functions of C5aR1. In PPSCs, C5aR1 was found to be expressed across
a number of PPSC lines, with exogenous C5a promoting maintenance of pluripotency as well as
survival following colony dissociation. In neural rosettes, C5aR1 expression was distinctly localised
to the apical surface of rosettes, with receptor activation co-ordinating maintenance of cell polarity
and cell division under a number of conditions. Whilst in post-mitotic cortical neurons, mRNA
expression of C5aR1 was detected, with little effect seen for C5aR1 in modulating either survival or
metabolic flux of this neuronal population. In this chapter, these results are contextualised with the
current literature, with discussions of their clinical relevance and future directions of this work.
129
C5aR1 in the developing brain
The work in this thesis adds to the current knowledge for the non-immune function of C5aR1
signalling in the developing brain. The expression of C5aR1 on neurons under physiological
conditions was first described in 2001 by O’Barr et al., with C5aR1 expression identified in human
adult cortical, hippocampal, and cerebellar neurons (O'Barr et al. 2001). Since this time, studies
have identified functions of C5aR1 on both neuronal stem cells and in adult neurons (Hawksworth
et al. 2016). In combining these results, a consistent role for C5aR1 in foetal neurogenesis is seen,
whilst in the adult brain the function of C5aR1 expressed on neurons remains less clear.
In pre-natal development, both this thesis and previous studies have shown C5aR1 signalling to
promote proliferation of neural stem cell populations (Rutkowski et al. 2010; Coulthard et al. 2017).
Additionally, in chapter 3, a novel function of apically expressed C5aR1 was identified in
maintaining polarity and promoting symmetrical division of neural progenitor cells. As a
consequence of this function, the perturbation of physiological C5aR1 activity during foetal
development, either through pharmacological inhibition or gene deletion, has been shown to
negatively impact on neurogenesis, increasing neural tube defect rates, and later, impacting cerebral
organisation and cognitive capacity of mice (Gong et al. 2013; Denny et al. 2013; Coulthard et al.
2017). The identification of such a function serves as a herald for increased caution in the use of
emerging complement therapeutics during pregnancy. Additionally, it may inform on recent
observations of a role for C5aR1 in the neural pathology of prenatal inflammatory conditions.
In contrast to the positive role in neurogenesis which we have described, under states of
inflammation, C5aR1 activity has been reported to have a negative impact on neurogenesis. For
example, maternal infection with malaria has been linked to C5a-C5aR1 dependent neurocognitive
deficits in uninfected offspring (McDonald et al. 2015). Elevated C5a levels have also been
observed in the cerebrospinal fluid of preterm neonates, with the inhibition of C5aR1 protective
against foetal cortical injury in inflammation/infection associated preterm birth (Pataky et al. 2016;
Pedroni et al. 2014). These studies may suggest that a balance of C5aR1 activity is required, with
either loss or over-activity of C5aR1 signalling negatively impacting brain development.
Alternatively, and perhaps more likely, these studies could highlight at the broader functions of
C5aR1. For example, in astrocytes and microglia, a role for C5aR1 in driving inflammation and
pathology in the brain has been described in adult neurodegeneration (Woodruff et al. 2010).
In the post-natal brain, whilst there are clear roles for C5aR1 in chronic neuro-inflammation, the
physiological action of C5aR1 signalling on neurons remains more ambiguous. Studies have
suggested that the function of C5aR1 in driving neurogenesis may have less of a role in maintaining
130
adult neurogenesis (Bogestal et al. 2007). Additionally, in mouse post-mitotic neurons, C5aR1 has
been suggested to directly induce apoptosis of neurons, whilst this thesis and others have found
either little role, or a protective function of C5aR1 in human neurons of a similar type (Hernandez
et al. 2017; O'Barr et al. 2001). As discussed in chapter 4, this may reflect species variations in
C5aR1 functioning in adult neurons, or may be a consequence of comparing diverse model systems.
Nevertheless, the full function of C5aR1 in the adult brain under physiological or acute disease
settings remains poorly defined, and an area of interest for future study.
Therapeutic implications of C5a-C5aR1 inhibition
The potent inflammatory action of C5a-C5aR1 signalling has led to the implication of this pathway
in a number of disorders with underlying inflammatory aetiologies (Morgan and Harris 2015;
Brennan et al. 2016). As such, the pharmacological inhibition of C5a-C5aR1 presents an attractive
option in the treatment of a number of disorders with autoimmune, neurodegenerative, and chronic
inflammatory pathologies. A current review of the therapeutic potential and clinical trials of C5a-
C5aR1 inhibitors was presented in chapter 1 of this thesis. From this review, it can be seen that there
remains a strong interest in the development of C5a-C5aR1 targeted drugs, with an array of molecules
in either preclinical development or clinical trials. This includes classes such as peptides, non-peptidic
small molecules, aptamers, and monoclonal antibodies. The application of these drugs for the
treatment of currently intractable diseases would provide a great therapeutic benefit. However, there
remains a growing body of evidence for roles of C5aR1 signalling outside of inflammation and
immunity. Within this thesis we have outlined actions of C5aR1 signalling in non-immune cells such
as pluripotent stem cells and neural progenitors, which highlights the potential deleterious
consequences of C5aR1 inhibition during gestation. Whilst the demonstration of functional
expression of C5aR1 in pluripotent stem cells is an interesting discovery, it could be argued that such
an in vitro study would poorly reflect the in vivo blastocyst physiology and any potential in vivo action
of C5aR1. However, the demonstration of a role for C5aR1 signalling in human neural rosettes, in
combination with in vivo mouse studies showing a detrimental effect of C5aR1 inhibition, strongly
suggests a physiological role for C5aR1 signalling during human in vivo neurogenesis.
Currently, the only clinically approved therapeutic targeting C5a-C5aR1 remains the humanised
antibody eculizumab, granted orphan status for the treatment of paroxysmal nocturnal
hemoglobinuria (PNH) and atypical haemolytic uraemic syndrome (aHUS) (Morgan and Harris
2015). Raised against C5, this antibody prevents C5 cleavage to the active fragments, C5a and C5b,
with dramatic improvements in patient outcomes for these complement driven diseases. As an
131
antibody therapeutic, the innate restriction of antibody placental transfer may be advantageous for
eculizumab, preventing potential neurodevelopmental consequences. Placental transfer of IgG is
mediated by Fc receptors, and is dependent on maternal IgG concentration, gestational age, placental
integrity, IgG subclass, and nature of antigen (Palmeira et al. 2012). In normal pregnancy, transfer
begins at 16 weeks gestation (10% maternal levels), reaching maternal IgG levels at 26 weeks
gestation (Saji et al. 1999). Any transfer of eculizumab to the placenta would therefore be restricted
during the earlier gestational stages examined in this thesis, limiting potential negative developmental
consequences. This has been supported by studies reporting safety of eculizumab in pregnant mothers
(Kelly et al. 2015; Miyasaka et al. 2016). Additionally, low detection of eculizumab has been reported
in newborns from eculizumab-treated mothers, suggesting poor placental transfer of this antibody
even in late gestation (Hallstensen et al. 2015). However, long term data to comprehensively
demonstrate the safety of this molecule during pregnancy is awaiting.
Newer therapeutics of varied classes, such as the C5aR1 antagonist CCX168 which is currently in
phase II trials, may not possess the same advantageous pharmacokinetic properties as the antibody
eculizumab. As such, placental crossing and monitoring of foetal developmental consequences would
require close examination before utilising such potentially disease modifying therapeutics during
pregnancy.
As discussed previously, animal studies have reported the inhibition of C5aR1 signalling to be
protective in preventing foetal cortical injury under inflammatory and infective maternal conditions.
Whilst this thesis has identified a physiological role in cortical development, the time period studied
corresponds to the first trimester of pregnancy. There is little evidence for negative consequences of
C5aR1 inhibition later in pregnancy, however, additional functions of C5aR1 during this time period
cannot yet be excluded. Late gestation inhibition of C5aR1 remains a therapeutic option for future
consideration in the treatment of inflammatory maternal and foetal/neonatal pathologies.
PPSCs for the study of complement
The development of pluripotent stem cell (PPSC) technology has significantly altered the landscape
of scientific discovery, providing a tool for the investigation of developmental processes and study
of disease which would otherwise be limited to animal models. This includes the capacity for
generation of PPSCs from patients with complex diseases, allowing for the direct study of
pathological processes in human disease populations. Within this thesis, PPSCs have been utilised
as an in vitro model of human development, to study the expression and functional role of C5aR1 in
human PPSCs, neural progenitors, and post-mitotic neurons. To our knowledge, this is the first
132
utilisation of PPSCs to investigate the actions of the complement system. There exists a great
potential for the future use of PPSCs for the investigation of complement factors and their function
in both in development and disease. This includes the study of novel complement signalling
pathways, correlation of animal results to human models, interrogation of human-specific
complement factors, and the use of patient derived PPSCs for disease modelling. Here, some of
these potential uses are discussed in relation to this thesis.
As discussed in chapter 1, a number of complement proteins have been identified to have novel
interactions with non-complement signalling families. Notably, this includes the role of CD46 in
modulating notch signalling in T-cells (Le Friec et al. 2012), and C1q activating wnt signalling in
cells of skeletal muscle tissue (Naito et al. 2012). These two signalling families have a significant
importance in the coordination of a number of developmental processes. However, the exploration
for a role of complement in directing these signalling pathways during development has not been
described. PPSC modelling provides an ideal platform for the interrogation of such roles, with any
discoveries then able to be compared to animal models to allow for discoveries of both human and
in vivo significance. The capacity of PPSCs to provide a human model for the study of
development, and correlation of animal studies to the human environment, has proven advantageous
in this thesis. For example, in chapter 3, the concordance between human and mouse models are
supportive of a significant role of C5aR1 in human neurogenesis. Alternatively, the poor correlation
of mouse and human models seen in chapter 4 may be suggestive of species variation in the role of
C5aR1 in post-mitotic neurons. Additionally, complement proteins such as CD46, with drastically
varied tissue distribution and function between rodent and human, are difficult to study in animal
models (Yamamoto et al. 2013). PPSC modelling provides a great tool for the study of this
complement protein, which has a number of signalling functions outside of complement regulation
and likely developmental functions awaiting discovery.
Whilst there is an obvious wealth of potential PPSC technology, the capability of researchers
harness this potential remains in its relative infancy. For example, the field of neuronal modelling
utilised in this thesis has shown a rapid progression in understanding and techniques required to
efficiently generate neuronal populations. This has allowed researchers to progress the
understanding of developmental processes and the pathogenesis of neuronal diseases, as well as
aiding in the discovery of new therapeutic targets (Zhu and Huangfu 2013; Yap et al. 2015). Whilst
advantageous over animal models, the current differentiation techniques remain limited in their
ability to faithfully recapitulate characteristics of the human brain, as was discussed in chapter 4.
Considering the relative infancy of this field, it is foreseeable that the progression of newer 3d
culture systems, and mixed cultures of neurectoderm, microglial, and vascular cells, to model
133
developmental and pathological conditions, will become available, circumventing some of the
current limitations of PPSC neuronal modelling (Muffat et al. 2016).
In terms of the study of complement, such advances would be of great interest. In particular, the
future capability of PPSCs to model interactions between neurons, glia, and microglia. Animal
models have implicated complement proteins in physiological synaptic pruning by microglia, as
well as in the pathogenesis of neuroinflammatory disorders such as Alzheimer’s and motor neuron
disease (Woodruff et al. 2011). More refined mixed culture systems would allow the investigation
of these functions and potential therapeutics in the human environment. A specific example can be
identified in the recent literature, where genetic schizophrenia risk has been linked to increased
complement levels (Sekar et al. 2016). It has been hypothesised that the altered complement activity
may lead to reduced synapse numbers, which is partly supported by animal studies. The ability to
use patient derived PPSCs from schizophrenia patients, and model synapse formation and pruning
in vivo would provide a unique insight into the pathogenesis of this disorder and the involvement of
complement (Quadrato et al. 2016). This example is only one of a vast number of potential
applications of PPSCs for the future study of complement in development and disease.
Conclusion
The complement system remains an intriguing family of proteins. Traditionally described as an
immune regulator, complement can now be seen as a broad-functioning group of proteins capable
of controlling a number of systems. Phylogenetically, the first components of the complement
system to emerge are C3, factor B, and MASP, as early as 1300 million years ago in the common
ancestor of eumetazoa, (Nonaka and Kimura 2006). Whilst linked to early immune competence, it
is possible that the emergence of these proteins was as a controller of sophisticated tissue
organisation, as discussed in chapter 1, with immune roles following later in evolution. Regardless
of evolutionary origins, complement can now be considered as a family of proteins capable of
controlling the proliferation, migration, and survival of a broad number of cell populations, of
which just one part lies in immunity. Consistent with this, this thesis has again demonstrated
functions of complement in the control of tissue organisation and stem cell populations. The pivotal
complement receptor, C5aR1, was demonstrated to be expressed in PPSCs, acting as a regulator of
the pluripotent state in vitro, with the in vivo consequence of this function remaining an area of
interest for future research. C5aR1 was also shown to act in neural progenitor cells to control
proliferation and maintenance of polarity, with loss of C5aR1 resulting in behavioural and structural
134
brain abnormalities. Lastly, the role of C5aR1 in post-mitotic neurons was explored, with little
neurotoxic or neuroprotective effect seen, incongruous with previous animal studies. With the wide
functions of complement, PPSCs are a powerful tool for the future study of complement proteins in
both human development and disease. Capable of exploring novel signalling pathways such as
CD46-notch and C1q-wnt in development, as well as providing a modelling system for the
delineation of complement involvement in a number of neurodevelopmental and neurodegenerative
disorders.
Together, this work adds to the growing body of work identifying novel actions of complement
outside of immunity. With the increasing development of C5aR1 targeted therapeutics, this work
has a direct clinical significance for guiding the understanding and consideration of potential
negative effects of C5aR1 inhibition during pregnancy, particularly early in gestation. With new
discoveries of complement functions ever emerging, the full function of complement in
development remains unclear. This thesis provides another piece of the puzzle, however, it is likely
that the current research has only begun to scratch the surface in delineating the full potential of this
complex protein family.
135
References
Anderson, D J, A F Abbott, and R M Jack. 1993. 'The role of complement component C3b and its
receptors in sperm-oocyte interaction', Proceedings of the National Academy of Sciences,
90: 10051-55.
Arbore, Giuseppina, and Claudia Kemper. 2016. 'A novel “complement–metabolism–
inflammasome axis” as a key regulator of immune cell effector function', European journal
of immunology, 46: 1563-73.
Bogestal, Y. R., S. R. Barnum, P. L. Smith, V. Mattisson, M. Pekny, and M. Pekna. 2007.
'Signaling through C5aR is not involved in basal neurogenesis', J Neurosci Res, 85: 2892-7.
Brennan, Faith H., John D. Lee, Marc J. Ruitenberg, and Trent M. Woodruff. 2016. 'Therapeutic
targeting of complement to modify disease course and improve outcomes in neurological
conditions', Seminars in Immunology, 28: 292-308.
Coulthard, Liam G. , Owen A. Hawksworth, Rui Li, Anushree Balachandran, John D. Lee,
Farshid Sepehrband, Nyoman Kurniawan, Angela Jeanes, David G. Simmons, Ernst
Wolvetang, and Trent M. Woodruff. 2017. 'Complement C5aR1 Signaling Promotes
Polarization and Proliferation of Embryonic Neural Progenitor Cells through PKCz', Journal
of Neuroscience.
Denny, K. J., L. G. Coulthard, A. Jeanes, S. Lisgo, D. G. Simmons, L. K. Callaway, B.
Wlodarczyk, R. H. Finnell, T. M. Woodruff, and S. M. Taylor. 2013. 'C5a receptor signaling
prevents folate deficiency-induced neural tube defects in mice', J Immunol, 190: 3493-9.
Gong, B., Y. Pan, W. Zhao, L. Knable, P. Vempati, S. Begum, L. Ho, J. Wang, S. Yemul, S.
Barnum, A. Bilski, B. Y. Gong, and G. M. Pasinetti. 2013. 'IVIG immunotherapy protects
against synaptic dysfunction in Alzheimer's disease through complement anaphylatoxin
C5a-mediated AMPA-CREB-C/EBP signaling pathway', Mol Immunol, 56: 619-29.
Hallstensen, R. F., G. Bergseth, S. Foss, S. Jaeger, T. Gedde-Dahl, J. Holt, D. Christiansen, C. Lau,
O. L. Brekke, E. Armstrong, V. Stefanovic, J. T. Andersen, I. Sandlie, and T. E. Mollnes.
2015. 'Eculizumab treatment during pregnancy does not affect the complement system
activity of the newborn', Immunobiology, 220: 452-9.
Hawksworth, Owen A., Liam G. Coulthard, and Trent M. Woodruff. 2016. 'Complement in the
fundamental processes of the cell', Mol Immunol.
Hernandez, M. X., P. Namiranian, E. Nguyen, M. I. Fonseca, and A. J. Tenner. 2017. 'C5a Increases
the Injury to Primary Neurons Elicited by Fibrillar Amyloid Beta', ASN Neuro, 9:
1759091416687871.
136
Kaufmann, Stefan H. E. 2008. 'Immunology's foundation: the 100-year anniversary of the Nobel
Prize to Paul Ehrlich and Elie Metchnikoff', Nat Immunol, 9: 705-12.
Kelly, Richard J., Britta Höchsmann, Jeff Szer, Austin Kulasekararaj, Sophie de Guibert, Alexander
Röth, Ilene C. Weitz, Elina Armstrong, Antonio M. Risitano, Christopher J. Patriquin, Louis
Terriou, Petra Muus, Anita Hill, Michelle P. Turner, Hubert Schrezenmeier, and Regis
Peffault de Latour. 2015. 'Eculizumab in Pregnant Patients with Paroxysmal Nocturnal
Hemoglobinuria', New England Journal of Medicine, 373: 1032-39.
Kolev, Martin, Gaelle Le Friec, and Claudia Kemper. 2014. 'Complement [mdash] tapping into new
sites and effector systems', Nat Rev Immunol, 14: 811-20.
Le Friec, Gaëlle, Devon Sheppard, Pat Whiteman, Christian M. Karsten, Salley Al-Tilib Shamoun,
Adam Laing, Laurence Bugeon, Margaret J. Dallman, Teresa Melchionna, Chandramouli
Chillakuri, Richard A. Smith, Christian Drouet, Lionel Couzi, Veronique Fremeaux-Bacchi,
Jörg Köhl, Simon N. Waddington, James M. McDonnell, Alastair Baker, Penny A.
Handford, Susan M. Lea, and Claudia Kemper. 2012. 'The CD46 and Jagged1 interaction is
critical for human T helper 1 immunity', Nature immunology, 13: 1213-21.
McDonald, Chloë R., Lindsay S. Cahill, Keith T. Ho, Jimmy Yang, Hani Kim, Karlee L. Silver,
Peter A. Ward, Howard T. Mount, W. Conrad Liles, John G. Sled, and Kevin C. Kain. 2015.
'Experimental Malaria in Pregnancy Induces Neurocognitive Injury in Uninfected Offspring
via a C5a-C5a Receptor Dependent Pathway', PLOS Pathogens, 11: e1005140.
Miyasaka, Naoyuki, Osamu Miura, Tatsuya Kawaguchi, Nobuyoshi Arima, Eriko Morishita,
Kensuke Usuki, Yasuyoshi Morita, Kaichi Nishiwaki, Haruhiko Ninomiya, Akihiko Gotoh,
Shinsaku Imashuku, Akio Urabe, Tsutomu Shichishima, Jun-ichi Nishimura, and Yuzuru
Kanakura. 2016. 'Pregnancy outcomes of patients with paroxysmal nocturnal
hemoglobinuria treated with eculizumab: a Japanese experience and updated review',
International Journal of Hematology, 103: 703-12.
Morgan, B. P., and C. L. Harris. 2015. 'Complement, a target for therapy in inflammatory and
degenerative diseases', Nat Rev Drug Discov, 14: 857-77.
Muffat, Julien, Yun Li, and Rudolf Jaenisch. 2016. 'CNS disease models with human pluripotent
stem cells in the CRISPR age', Current Opinion in Cell Biology, 43: 96-103.
Naito, Atsuhiko T, Tomokazu Sumida, Seitaro Nomura, Mei-Lan Liu, Tomoaki Higo, Akito
Nakagawa, Katsuki Okada, Taku Sakai, Akihito Hashimoto, Yurina Hara, Ippei Shimizu,
Weidong Zhu, Haruhiro Toko, Akemi Katada, Hiroshi Akazawa, Toru Oka, Jong-Kook Lee,
Tohru Minamino, Toshio Nagai, Kenneth Walsh, Akira Kikuchi, Misako Matsumoto,
Marina Botto, Ichiro Shiojima, and Issei Komuro. 2012. 'Complement C1q Activates
Canonical Wnt Signaling and Promotes Aging-Related Phenotypes', Cell, 149: 1298-313.
137
Nesargikar, P. N., B. Spiller, and R. Chavez. 2012. 'The complement system: history, pathways,
cascade and inhibitors', European Journal of Microbiology & Immunology, 2: 103-11.
Nonaka, M., and A. Kimura. 2006. 'Genomic view of the evolution of the complement system',
Immunogenetics, 58: 701-13.
O'Barr, S. A., J. Caguioa, D. Gruol, G. Perkins, J. A. Ember, T. Hugli, and N. R. Cooper. 2001.
'Neuronal expression of a functional receptor for the C5a complement activation fragment', J
Immunol, 166: 4154-62.
Palmeira, P., C. Quinello, A. L. Silveira-Lessa, C. A. Zago, and M. Carneiro-Sampaio. 2012. 'IgG
placental transfer in healthy and pathological pregnancies', Clin Dev Immunol, 2012:
985646.
Pataky, Rozalia, Forbes A. Howie, Guillermina Girardi, and James P. Boardman. 2016.
'Complement C5a is present in CSF of human newborns and is elevated in association with
preterm birth', The Journal of Maternal-Fetal & Neonatal Medicine: 1-4.
Pedroni, Silvia M. A., Juan M. Gonzalez, Jean Wade, Maurits A. Jansen, Andrea Serio, Ian
Marshall, Ross J. Lennen, and Guillermina Girardi. 2014. 'Complement inhibition and
statins prevent fetal brain cortical abnormalities in a mouse model of preterm birth',
Biochimica et Biophysica Acta (BBA) - Molecular Basis of Disease, 1842: 107-15.
Quadrato, Giorgia, Juliana Brown, and Paola Arlotta. 2016. 'The promises and challenges of human
brain organoids as models of neuropsychiatric disease', Nat Med, 22: 1220-28.
Rutkowski, M. J., M. E. Sughrue, A. J. Kane, S. A. Mills, S. Fang, and A. T. Parsa. 2010.
'Complement and the central nervous system: emerging roles in development, protection and
regeneration', Immunol Cell Biol, 88.
Saji, F., Y. Samejima, S. Kamiura, and M. Koyama. 1999. 'Dynamics of immunoglobulins at the
feto-maternal interface', Reviews of Reproduction, 4: 81-89.
Sekar, Aswin, Allison R. Bialas, Heather de Rivera, Avery Davis, Timothy R. Hammond, Nolan
Kamitaki, Katherine Tooley, Jessy Presumey, Matthew Baum, Vanessa Van Doren, Giulio
Genovese, Samuel A. Rose, Robert E. Handsaker, Consortium Schizophrenia Working
Group of the Psychiatric Genomics, Mark J. Daly, Michael C. Carroll, Beth Stevens, and
Steven A. McCarroll. 2016. 'Schizophrenia risk from complex variation of complement
component 4', Nature, 530: 177-83.
Woodruff, T. M., R. R. Ager, A. J. Tenner, P. G. Noakes, and S. M. Taylor. 2010. 'The role of the
complement system and the activation fragment C5a in the central nervous system',
Neuromolecular Med, 12.
Woodruff, T. M., K. S. Nandakumar, and F. Tedesco. 2011. 'Inhibiting the C5-C5a receptor axis',
Mol Immunol, 48.
138
Yamamoto, Hidekazu, Antonella Francesca Fara, Prokar Dasgupta, and Claudia Kemper. 2013.
'CD46: The ‘multitasker’ of complement proteins', The International Journal of
Biochemistry & Cell Biology, 45: 2808-20.
Yap, May Shin, Kavitha R. Nathan, Yin Yeo, Lee Wei Lim, Chit Laa Poh, Mark Richards, Wei
Ling Lim, Iekhsan Othman, and Boon Chin Heng. 2015. 'Neural Differentiation of Human
Pluripotent Stem Cells for Nontherapeutic Applications: Toxicology, Pharmacology, and In
Vitro Disease Modeling', Stem Cells International, 2015: 11.
Zhu, Z., and D. Huangfu. 2013. 'Human pluripotent stem cells: an emerging model in
developmental biology', Development, 140: 705-17.