University of DebrecenCentre for Agricultural and Applied
Economics ScienceFaculty of Agricultural and Food
Sciences and Environmental Management
Effect of Stearoyl-COA desaturase gene polymorphism on milk production traits of Hungarian Holstein Friesian cows
By : Tegegn Gudeta, Jaleta (MSc thesis)
Debrecen , Hungary,May
2012
IntroductionMarker Assisted selection in modern dairyNumber of studies conducted in large scale on
candidate genes in dairy breedingSCD is hypothesiszed candidate gene
It catalyze Cis∆-9 desaturation Mapped to chromosome 26 in bovine SCD 1 and SCD5 Associated with milk fatty acid composition
Studies of SCD gene not conducted in HHF
Objectives of the study
To estimating allele and genotype frequencies of SCD gene polymorphism(878 C/T)
To determining the effect of SCD gene polymorphism on cows milk production traits
Materials and Methods1) Animals and Milk data Hair root samples (8-10) were collected
from 277 HHF in Tedej Dairy Farm located 15 km north of Debrecen
One lactation milk record data were collected for 277 HHF cows-305 day average milk yield (kg), fat yield (kg), fat percentage(%), protein yield (kg), protein percentage (%) and SCC (10,000 cell/ml)
2) Study MethodsMolecular Laboratory of UDDNA isolation from Hair root
3-5 hair root+ 100 µL Lysis buffer+1.5 ProteinK Water bath for 60 min at 60 0c , for 20 min at
95 oc water bath, stored at -20 oc
Spectrophotometrical Analysis-Nanodrop
RT-PCR 7300 Spectrophotometer
3) DNA Amplification and Sequencing7300 RT-PCR machine (Applied Biosystem)Reaction mix(10µL): 1µl DNA, 5µl 1xTaqMan
MasterMix (PN 4371355, USA), 0.25µl 1xSNP probe and 3.75µl dH2O.
TaqMan probe sequence:The fluorescent probe VIC:
ACTTACCCACAGCTCC The fluorescent probe FAM:
TTACCCGCAGCTCC
SCD Primers (625µl 40x mix, Warington, UK, WA37PB):Forward Primer: CCCCGAGAGAATATTCTGGTTTCCReverse primer : CCACTAGACGTGGTCTTGCT
Amplification and Sequencing protocolInitial steps: Activation at 950C for 10
minutes (AmpliTaq Gold DNA polymerase), Melting for 15 sec at 920C, Annealing/Extension at 600C for 1 minute (40 cycles).
The SNP 878 C/T was used in this study and the nucleotide substitution was identified according to Tanguichi et al., (2004).
4.) Data Analysis
a)Descriptive Statistics using R software (Version: R-2.14.2)
b)Hardy-Weinberg Equation c)Analysis of Variance (ANOVA) using R
software (Version: R-2.14.2)
Results and Discussion1. Genotypes and Allele Frequencies of SCD gene
Polymorphisms
Amplification curve for CC(left) and CT(right) genotypes
Result of amplification curve for TT genotype (Green line)
Allelic discrimination of SCD genotypes (Blue-CC, Green-CT, and Red-TT)
No of Animals (Genotype
Frequencies in %)
SCD
Allele %
P value X2
CC CT TT0.04695
3.947
Observed 94(34) 148(53) 35(13) C(0.61)
Expected 102(37) 132(48) 43(15) T(0.39)
Genotype and allele frequencyy of the SCD gene in the investigated Hungarian Holsteins cow population
2. Effects of SCD Genotypes on Recorded Milk Production Traits
Parameter Genotype
CC CT TT P value
Fat (%) 3.76±0.41 3.8±0.43 3.7±0.38 0.2272
Protein (%) 3.22±0.178 3.22±0.178 3.23±0.14 0.998
SCC(X103 cell/ml) 136±106.4 116±70.2 119±72.7 0.2264
305 MY (kg) 8277.5±1301 8468.5±1542 8463.4±1294 0.5805
305 FY (kg) 310.6±52.4 321.9±55.2 313±50.6 0.2505
305 PY (kg) 266.1±38.5 272.1±45.8 272.3±36.2 0.5315
Mean and standard deviation of milk production traits and its association with SCD genotypes.
Conclussions
Higher C allele(0.61) frequency and lower T allele (0.39) frequency was reported in this study
The SCD genotypes frequency in HHF herds under this study were not in Hardy-Weinberg equilibrium, the possible reason for this result may be small numbers of animals included in this study and indicating the herds were not in a random mating system
SCD-878 C/T locus cannot be considered as candidate gene in milk production traits
Further studies will be necessary on large number of animals to confirm the current result