Draft
Phylogenetic relationships among low ploidy Poa species
using chloroplast sequences
Journal: Genome
Manuscript ID gen-2016-0110.R1
Manuscript Type: Article
Date Submitted by the Author: 17-Oct-2016
Complete List of Authors: Joshi, Alpana; USDA-ARS, FRRL Bushman, Shaun; USDA-ARS, FRRL Pickett, Brandon; USDA-ARS, FRRL Robbins, Matthew; US Department of Agriculture, Agricultural Research Service, Forage and Range Research Laboratory, Staub, Jack; USDA ARS, Forage & Range Research Laboratory
Johnson, Paul; Utah State University, Plant, Soils, and Climate
Keyword: Poa, flow cytometry, phylogeny, Kentucky bluegrass
https://mc06.manuscriptcentral.com/genome-pubs
Genome
Draft
1
Phylogenetic relationships among low ploidy Poa species using chloroplast sequences
Alpana Joshi, B. Shaun Bushman*, Brandon Pickett, Matthew D. Robbins, Jack E. Staub, Paul G.
Johnson
Alpana Joshi, B. Shaun Bushman*, Brandon Pickett, Matthew D. Robbins, and Jack E.
Staub. USDA-ARS Forage and Range Research Unit, 695 N 1100 E, Logan, UT 84322-6300.
Paul G. Johnson. Department of Plants, Soils, and Climate, Utah State University, 4820 Old
Main Hill, Logan, UT 84322-4820.
Corresponding author email: [email protected]
Abbreviations: TLF is trnT-trnF chloroplast region
Keywords: Poa, flow cytometry, phylogeny, Kentucky bluegrass
Page 1 of 62
https://mc06.manuscriptcentral.com/genome-pubs
Genome
Draft
2
Abstract
Species in the Poa genus are taxonomically and genetically difficult to delineate due to high and
variable polyploidy, aneuploidy, and challenging breeding systems. Approximately 5% of the
proposed species in Poa are considered to include or comprise diploids, but very few of those
diploids are represented in seed collections. Recent phylogenetic studies of Poa have included
some diploid species to elucidate Poa genome relationships. In this study we build upon that
foundation of diploid Poa relationships with additional confirmed diploid species and accessions,
and with additional chloroplast sequences. We also include a sample from P. pratensis and P.
arachnifera to hone in on possible ancestral genomes in these two agronomic and highly
polyploidy species. Relative to most of the Poa species, Poa section Dioicopoa (P. ligularis, P.
iridifolia, and P. arachnifera) contained relatively large chromosomes. Phylogenies were
constructed using the TLF gene region and five additional chloroplast genes, and the placement
of new species and accessions fit within chloroplast lineages reported in Soreng et al. (2010)
better than by taxonomic subgenera and sections. Low ploidy species in the “P” chloroplast
lineage, such as P. iberica and P. remota, grouped closest to P. pratensis.
Page 2 of 62
https://mc06.manuscriptcentral.com/genome-pubs
Genome
Draft
3
Introduction
Poa is the largest genus of grasses, comprising 5 subgenera, 13 sections, and up to 500 species
(Gillespie and Soreng 2005). The genus is taxonomically and genetically difficult to delineate,
and interspecific hybridization, high and variable polyploidy, and facultative apomixis have been
major sources of variation (Stebbins 1950; Clausen 1961; Tzvelev 1976; Hunziker and Stebbins
1987; Soreng 1990; Gillespie and Soreng 2005). Because of the high degree of polyploidy in the
genus, it is believed that many Poa species originated through allopolyploidy (Stebbins 1950;
Darmency and Gasquez 1997; Brysting et al. 2000, 2004; Patterson et al. 2005). Additionally,
genomic redundancy and rampant aneuploidy among highly polyploid taxa suggests some degree
of autopolyploidy. Many taxa within Poa include a range of polyploid levels, from diploids to
octaploids (Kelley et al. 2009) or tetraploids to duo-decaploids in the same species (Bowden
1961; Barkworth et al. 2003; Soreng 2005, 2007). With a basic chromosome number of x=7
(Gould 1968), Poa has been referred to as one large polyploid complex (Stebbins 1950). Given
the challenging diversity in ploidy among and within species, flow cytometry has been used to
quantify the DNA content in a several other Poa species (Eaton et al. 2004; Patterson et al. 2005;
Kelly et al. 2009; Raggi et al. 2015).
Sectional and infra-sectional taxonomy of Poa is complicated and has been the subject of
major revisions by taxonomists over the years. (Tzvelev 1976; Hunziker and Stebbins 1987;
Phillips 1989; Gillespie et al. 2007). Consideration of section Ochlopoa has switched back and
forth between a subgenus and genus designation (Hylander 1953; Soreng 1990; Gillespie and
Boles 2001; Bohling and Scholz 2003). Poa section Dioicopoa was initially considered as
subgenus (Nicora 1977, 1978) but later it recognized as section within the Poa subgenus (Soreng
1998; Gillespie et al. 2007). Arctopoa was initially considered a section (Tzvelev 1964) or a
Page 3 of 62
https://mc06.manuscriptcentral.com/genome-pubs
Genome
Draft
4
subgenus (Probatova 1971) of Poa, but then later recognized as a separate genus (Probatova
1974; Gillespie et al. 2008). When polyploid complexes within species are added to this
taxonomic murkiness, which complexes can show substantial morphological differences (e.g.,
Speckmann and Van Dijk 1972), resolution of Poa taxa can in many cases be challenging.
However, DNA sequence analysis, particularly from chloroplast regions, has been used to aid in
delineation of Poa sections and species (Gillespie and Soreng 2005; Patterson et al. 2005;
Gillespie et al. 2007; Raggi et al. 2015). Soreng et al. (2010) used the chloroplast TLF region
(Taberlet et al. 1991) to classify diploid species into four of the Poa subgenera: Ochlopoa, Poa,
Pseudopoa, and Stenopoa. The distribution of those diploids are mainly concentrated in Eurasia
(Edmondson et al. 1980; Moore et al. 1982), with very few represented in seed collections.
Some Poa species are widely cultivated as forage and turf grasses (Balasko et al. 1995;
Weddin and Huff 1996; Huff 2003), with P. pratensis (Kentucky bluegrass) and P. arachnifera
(Texas bluegrass) as two heavily utilized species for turf. Poa pratensis was examined
cytologically to determine its somatic chromosome number, and 91% of the P. pratensis taxa had
chromosome numbers ranging from 2n=24–124 (Bowden 1961; Love and Love 1975), with the
most common ploidy levels of 56, 63, 70, and 77 (Speckmann and Van Dijk 1972). Similarly,
polyploid P. arachnifera chromosome numbers have ranged from 2n=42-91 (Brown 1939;
Gould 1958; Kelley et al. 2009), with the most common chromosome numbers of 2n=8x=56
(Hartung 1946; Patterson et al. 2005). Interspecific hybridization between P. arachnifera and P.
pratensis have been made, taking advantage of the apomixis in P. pratensis and the dioecy in P.
arachnifera, for the development of hybrid turfgrass cultivars (Read et al. 1999; Meyer et al.
2005; Rose-Fricker et al. 2007; Smith and Meyer 2009). However, despite an analysis done by
Meeks and Chandra (2015) showing unique sequences in the thioredoxin region of P.
Page 4 of 62
https://mc06.manuscriptcentral.com/genome-pubs
Genome
Draft
5
arachnifera compared to P. pratensis, the genomic relationship responsible for their ability to
form interspecific hybrids is not yet well understood.
The purposes of this study were to confirm chloroplast lineage analyses of Soreng et al.
(2010) in diploid Poa species, and build upon that framework with the addition of more
chloroplast region sequences and further diploid species and accessions. Additionally, we
include samples of high-polyploid P. pratensis and P. arachnifera with the aim to hone in on
possible diploid progenitors of those species. Because of ploidy inconsistencies in published
literature, we use chromosome counts and flow cytometry to assure ploidy levels, and further
highlight relationships within sections of Poa that contain P. pratensis and P. arachnifera.
Materials and methods
Plant materials and sampling. Twenty-one accessions of Poa were obtained from the National
Plant Germplasm System (USA), the Margot Forde Germplasm Centre (New Zealand), and the
IPK Genebank (Germany). The accessions included sampling of putative diploid Poa species,
and several tetraploid Poa species for Poa subgenera where diploids were unavailable. The
sampling included the three main Poa subgenera and eight sections (Table 1). Additionally,
certified sod-quality seed of the P. pratensis cultivar ‘Midnight’ was sampled, as was a
collection of P. arachnifera obtained from J. Goldman (USDA-ARS, Woodward, OK). Ten
seeds of each accession were planted in Sunshine Mix #2 (Sun Gro Horticulture, Agawam, MA)
and five healthy plants of each accession were selected and maintained in a greenhouse in Logan,
UT. For a few accessions, less than five plants germinated such that only those plants were used
in analyses (Table 1).
Page 5 of 62
https://mc06.manuscriptcentral.com/genome-pubs
Genome
Draft
6
Flow cytometry and cytological analysis. Flow cytometry was performed on the plants from
each accession. Young, fully expanded leaves weighing 100 mg were collected and finely
chopped in Petri dishes containing 1 mL of freshly made chopping buffer (10 mM MgSO4, 50
mM KCl, 5 mM Hepes). Leaf nuclei were filtered through 30 µm nylon mesh into test tubes,
centrifuged at 200 × g for 5 min, and resuspended in 1 mL of fresh chopping buffer with the
addition of 100 mg L−1
dithiothreitol, 16.5 mg L−1
of ribonuclease A and 100 mg L−1
propidium
iodide. Tubes were incubated at 37°C for 15 min after which 3 µL of chicken erythrocyte nuclei
(CEN) singlets (Biosure, Grass Valley, CA) were added to each tube, serving as an internal
control for each sample. Samples were analyzed at 488 nm (FL2A filter) with a BD Accuri™ C6
Flow Cytometer (BD Biosciences, San Jose, CA). For each sample, the plant nuclear 2C DNA
content, measured in picograms (pg), was determined by multiplying the relative 2C DNA
content (plant sample peak mean/CEN peak mean) to the CEN 2C DNA content of 2.5 pg. The
process was repeated to confirm original 2C values. Diploid plants (2x=14) were tested with and
without the CEN standard to determine if their flow cytometry peak overlapped with the CEN
peak. In those cases where the CEN and plant peak were inseparable, a genome size of 2.5 pg
was assigned.
Because of the possibility of varying chromosome sizes, chromosome counting of root tip
cells at the metaphase stage was performed to confirm ploidy level (Table 1). Root tips were
collected approximately 3 hour after sunrise directly into cold 2mm 8-hydroxyquinoline solution,
refrigerated for 3 to 4 hours, then transferred to an aceto-orcein solution for 48 hours. Samples
were then squashed on a glass slide containing one drop of 45% acetic acid, and examined under
a 1000× light microscope (Zeiss, Germany). Two to three roots per accession were analyzed to
verify ploidy.
Page 6 of 62
https://mc06.manuscriptcentral.com/genome-pubs
Genome
Draft
7
DNA extraction and sequencing of the TLF region. A representative plant from each of the 21
accessions, based on ploidy analysis, was selected for DNA sequencing and phylogenetic
analysis. Total genomic DNA was isolated from 25 mg of lyophilized leaf tissue using DNeasy
Plant Mini kits (QIAGEN Inc., Valencia, CA). The chloroplast TLF region was amplified in the
samples using primers ‘‘a’’ (5′- CATTACAAATGCGATGCTCT), ‘‘f’’ (5′-
ATTTGAACTGGTGACACGAG), “b” (5′- TCTACCGATTTCGCCATATC), “c” (5′-
CGAAATCGGTAGACGCTACG), “d” (5′- GGGGATAGAGGGACTTGAAC) and “e” (5′-
GGTTCAAGTCCCTCTATCCC) (Taberlet et al. 1991). PCR products were purified using
ExcelaPure-UF purification kits (Edge BioSystems, Gaithersburg, MD) and sequenced on an
ABI3730 using BigDye Terminator v3.1 (Thermo Fisher, Waltham, MA). Sequences were
assembled and edited manually using Sequencher v5.1 (Gene Codes Corporation, Ann Arbor,
Michigan, USA). Additional diploid and tetraploid Poa TLF sequences reported in Soreng et al.
(2010) were included from the NCBI Nucleotide database for comparison with sequences from
the new taxa. Informative InDels across all samples were scored following the simple InDel
coding method described by Simmons and Ochoterena (2000).
Additional chloroplast gene sequencing. To obtain additional chloroplast sequences, leaf tissue
of the 21 samples was collected, flash frozen in liquid nitrogen, and total RNA extracted using
Zymo Direct-zol RNA extraction kits (Zymo, Irvine, CA). cDNA sequencing libraries were
constructed using the KAPA stranded mRNA-Seq kit (Kapa Biosystems, Wilmington, MA).
Samples were barcoded and pooled into groups of four for sequencing. After pooling into groups
of six, the libraries were sequenced on an Ion Torrent PGM instrument using the Ion PI
Sequencing 200 Kit v3. Resulting sequences were sequentially trimmed and de-multiplexed by
Page 7 of 62
https://mc06.manuscriptcentral.com/genome-pubs
Genome
Draft
8
barcode using the Torrent Suite software (Life Technologies, Grand Island, NY), and again with
TRIMMOMATIC (Bolger et al. 2014). Trimmed sequence reads from each library were
assembled using TRINITY software (Grabherr et al. 2011), with default kmer and bubble sizes.
Assembled sequences were aligned to the barley (Hordeum vulgare L.) chloroplast genome with
BLASTn searches at E-value thresholds of e-20
. Sequences from the 21 Poa species with hits to
the same barley chloroplast gene, and with a similar barley gene start position to ensure sequence
overlap, were aligned with each other. Once gene regions were selected based on those criteria,
each individual gene category was aligned and analyzed manually in Sequencher v5.1. Aligned
sequences were deposited into the National Center for Biotechnology Information Popset
database, with BioProject ID (accession no: TLF (KX522653-KX522673), ndhJ (KX513004-
KX513024), psaC (KX513025-KX513045), psbM (KX513046-KX513066), rbcL (KX513067-
KX513087) and rps2 (KX513088-KX513108).
Phylogenetic analysis. Phylogenetic analyses were conducted using Maximum Likelihood (ML)
and Maximum Parsimony (MP) in PAUP v4.0 (Swofford 2002). Fast stepwise addition and full
Heuristic searches were conducted depending on the run time with the tree-bisection-
reconnection (TBR), Collapse and MulTrees options, and MaxTrees set at 1,000. One thousand
bootstrap replications were conducted for nodal support. jModelTest v. 3.7 (Posada and Crandall
1998) was used to select best-fit models of nucleotide substitution using the Akaike Information
Criterion (AIC) framework.
Results
Page 8 of 62
https://mc06.manuscriptcentral.com/genome-pubs
Genome
Draft
9
Twenty one Poa species were included, with particular interest in diploids and tetraploids when
diploids were not available, including a sample of P. pratensis and P. arachnifera. The lower
ploidy species included three different Poa subgenera; Ochlopoa, Poa, and Stenopoa. The genus
Arctopoa, with a single A. tibetica sample, was included as an outgroup (Table 1). The A.
tibetica had a 2C value of 12.8 pg in a tetraploid plant (Table 1).
In subgenus Ochlopoa section Alpinae, P. badensis and P. pumila were both diploid with
2x=14 chromosomes and a similar average genetic content of 2.5 pg (Table 1). In subgenus and
section Stenopoa, root tip chromosome counting confirmed that the P. araratica, P. nemoralis,
and P. palustris accessions were tetraploids with 4x=28, and had 2C values ranging from 5.7–6.6
pg (Table 1). Two accessions of P. trivialis (PI 594396, GR 4757), classified in section
Pandemos of Stenopoa, were diploid at 2x=14 and approximate 2C contents of 2.5 pg (Table 1).
From subgenus Poa, taxa from Macropoa, Homalopoa, Madropoa, and Dioicopoa sections
were sampled, and included the high polyploid P. pratensis and P. arachnifera, five diploid
species, and six tetraploid species. All the diploids showed overlapping peaks with the CEN
internal standard, such that their 2C values were approximately 2.5 pg. Section Macropoa
contained one tetraploid species, P. iberica, with an average 2C value of 5.9 pg. From section
Homalopoa, the P. remota plants were tetraploids with an average 2C value of 5.35 pg and a
range from 5.0–5.5 pg. From section Madropoa, the tetraploid P. nervosa had a smaller average
2C content of 3.15 pg than other tetraploids Poa. The polyploid P. arachnifera and two
tetraploid (P. ligularis and P. iridifolia) species were sampled from section Dioicopoa. The mean
2C values in both tetraploids were larger than those of other Poa sections with respect to their
chromosome counts, 7.60 pg for P. ligularis and 8.12 pg for P. iridifolia. Poa arachnifera had a
2C value of 12.3 pg with approximately 56 chromosomes. The Poa section contained only
Page 9 of 62
https://mc06.manuscriptcentral.com/genome-pubs
Genome
Draft
10
polyploid P. pratensis cv. Midnight, which had approximately 63 chromosomes and a 2C value
of 8.2 pg. Although the sheer number of small chromosomes in the cells precluded exact counts
in P. pratensis, its chromosome number did exceed 56 while its 2C value was substantially lower
than that of P. arachnifera.
The final aligned TLF data matrix contained 2,120 nucleotides of which 1,835 characters
were constant, 195 nucleotide positions were parsimony informative, and 54 InDels were present
(Supplemental Table 1). Using jModeltest, the “GTR+G” substitution model exhibited the lowest
AIC value, and the ML phylogeny detected four main clades of the Poa genus that generally
corresponded to species in subgenera Ochlopoa, Stenopoa, Poa, and a fourth eclectic clade
containing species from subgenera Nanopoa, Stenopoa and Ochlopoa (Figure 1).
An Ochlopoa clade consisted of taxa from sections Alpinae and Micrantherae, and were
grouped together with 96% bootstrap support (Figure 1). The two diploid accessions, P. badensis
and P. pumila, grouped with other section Alpinae diploid and tetraploid species that were
previously reported (P. ligulata, P. molinerii), and confirmed taxonomic placement and identity
of the two newly analyzed accessions. The chloroplast genome lineages described by Soreng et
al. (2010) also supported this taxa grouping, where “M” and “A” lineages formed sub-clades
with 100% and 99% bootstrap support, respectively. The newly analyzed accessions of P. pumila
and P. badensis grouped with other taxa of section Alpinae carrying the “A” lineage. These
Ochlopoa samples were the most distal Poa species with respect to the P. pratensis sample.
The three newly analyzed tetraploid samples in the subgenus Stenopoa (P. nemoralis, P.
palustris, and P. araratica), which are categorized as section Stenopoa, grouped with previously
reported diploid taxa in subgenus Stenopoa section Abbreviatae (P. lettermanii and P.
pseudoabbreviata) that were unavailable as live plants (Figure 1). Our Poa ligularis sample
Page 10 of 62
https://mc06.manuscriptcentral.com/genome-pubs
Genome
Draft
11
(subgenus Poa section Dioicopoa) shared two INDELs and several SNPs with Stenopoa species
in “V” and “S” lineages rather than other members of sect. Dioicopoa in “H” lineage
(Supplemental Table 1). These five taxa from subgenus Stenopoa shared the chloroplast “S”
lineage. Poa trivialis samples have been classified in a Pandemos section (Ascherson and
Graebner 1898‑1902) and given a unique “V” chloroplast lineage (Soreng et al. 2010) because
of their chloroplast phylogenetic groupings with subgenus Stenopoa (Zhu et al. 2006; Soreng
2007) yet nuclear phylogenetic groupings with Ochlopoa (Soreng et al. 2010). Both newly
analyzed P. trivialis accessions and the previously reported P. trivialis TLF sequences from
Genbank grouped as expected in a sub-clade next to Stenopoa taxa. All four accessions of P.
trivialis included in this analysis shared 11 InDels not present in any other Poa taxa (data not
shown).
A Poa clade was also resolved with bootstrap support (91%), and included all diploid,
tetraploid, and higher ploidy members of subgenus Poa (Figure 1). Our present analysis placed
newly analyzed diploid (P. bucharica, P. sibirica, and P. asiae-minoris), tetraploid (P. iberica
and P. remota), and nonaploid P. pratensis accessions with other taxa from sections Macropoa
and Homalopoa. These taxa grouped into the “P” chloroplast lineage sub-clade with 86%
bootstrap support together with previously reported species from sections Macropoa (P.
siberica) and Homalopoa (P. remota). The newly analyzed tetraploid P. remota was grouped in
same “P” lineage clade with previously published P. remota sequences (GQ324451 and
GQ324452), but carried a unique 17 nucleotide InDel and grouped closer to P. pratensis cv.
Midnight than the other P. remota sequences. Diploid and tetraploid taxa of sections Homalopoa
(P. chaixii and P. hybrida), Madropoa (P. macrantha and P. nervosa), and Dioicopoa (P.
Page 11 of 62
https://mc06.manuscriptcentral.com/genome-pubs
Genome
Draft
12
iridifolia and P. arachnifera) formed respective groups and contained the “H” chloroplast
lineage. Section Homalopoa species thus spanned both “P” and “H” chloroplast lineages.
The fourth clade represented taxa of “N” chloroplast lineage, and included subgenera
Nanopoa, Stenopoa, and an Ochlopoa species. This “N” lineage clade, although eclectic (Soreng
et al. 2010), was included in this study to test if any newly analyzed samples would group with
any of these previously reported taxa. The Genbank accessions corresponding to P. trichophylla
(subgenus and section Nanopoa), P. dolosa (subgenus Stenopoa and section Orienos), and P.
media (subgenus Ochlopoa and section Alpinae) grouped together with 56% bootstrap support.
No newly analyzed Poa species grouped with these taxa.
In addition to the TLF region, five novel chloroplast DNA fragments were aligned among the
21 new samples, comprising an additional 4,198 nut of chloroplast sequence (Table 2). All five
had the same “GTR+G” DNA substitution model as the TLF region, were combined into one
analysis, and resulted in 69 parsimony informative characters and 6 InDels (Supplemental Table
1). Unlike the TLF region, these additional sequences were of coding sequences rather than
intergenic regions, and thus contained fewer informative characters. A consensus phylogeny
showing bootstrap support values over 50% at nodes is shown in Figure 2.
Three main clades were detected that corresponded to subgenera Ochlopoa, Stenopoa, and
Poa (Figure 2). Similar to the TLF phylogeny, Ochlopoa taxa were the first to separate from the
A. tibetica outgroup and the most distal clade to the P. pratensis sample. Both P. badensis and P.
pumila grouped into this clade with 100% support and again represented the “A” chloroplast
lineage. The Stenopoa clade had bootstrap support of 83% and consisted of tetraploid P.
araratica, P. nemoralis, and P. palustris from the Stenopoa section and “S” chloroplast lineage;
and both P. trivialis sequences from the Pandemos section and “V” lineage. Adjacent to this
Page 12 of 62
https://mc06.manuscriptcentral.com/genome-pubs
Genome
Draft
13
clade was the sequence from P. nervosa (subgenus Poa section Madropoa), which grouped with
Stenopoa species in “V” and “S” lineages rather than with other sect. Madropoa species in the
“H” lineage. The Poa clade separated into two sub-clades, which associated with chloroplast
lineages “H” and “P”, but with only moderate bootstrap support. Similar to the TLF phylogeny,
the “H” lineage sub-clade included taxa from sections Dioicopoa, Madropoa, Homalopoa.
Within this sub-clade, the higher ploidy and North American P. arachnifera grouped with South
American Dioicopoa tetraploids P. iridifolia and P. ligularis with 97% nodal support. The “P”
lineage contained taxa from Homalopoa, Macropoa, and the P. pratensis cultivar Midnight
(Figure 2), and this lineage group was congruent with the TLF phylogeny as well. However, the
P. pratensis cv. Midnight grouped closest to the tetraploid P. iberica (Figure 2), rather than P.
remota in the TLF phylogeny (Figure 1).
Discussion
Since counting the number of P. pratensis chromosomes is difficult due to the high numbers
of small chromosomes and frequent aneuploidy, we also conducted flow cytometry to estimate
the average genome content (Eaton el al. 2004; Wieners et al. 2006; Murovec et al. 2009). This
allowed for a more complete understanding of the correlation between ploidy level and genome
size variation in the four Poa subgenera taxa that we sampled. Huff and Bara (1993) reported a
significant correlation between DNA content and chromosome number in Kentucky bluegrass.
Our analysis also generally observed a correlation between ploidy level of taxa of and their
genome contents (r =0.75, P < 0.05), with diploid taxa 2C values similar to our CEN internal
standard of approximately 2.5 pg, and tetraploid samples slightly higher than 5 pg. Notable
exceptions were P. nervosa, P. ligularis, and P. iridifolia, where the P. nervosa samples had a
Page 13 of 62
https://mc06.manuscriptcentral.com/genome-pubs
Genome
Draft
14
relatively small average 2C value of 3.15 pg while the 2C contents in tetraploid P. ligularis and
P. iridifolia were larger than expected at approximately 8 pg. Tetraploid Arctopoa tibetica, the
closely related but separate genus used as an outgroup, exhibited even larger chromosomes with
an average 2C value of 12.8 pg for tetraploid plants.
The genome size of higher ploidy Poa samples, P. arachnifera and P. pratensis, were
consistent with the genome size of lower ploidy Poa samples that grouped near them in
phylogenetic analyses. The octaploid P. arachnifera showed similarly large chromosomes to P.
iridifolia, and grouped with P. iridifolia in phylogenetic analyses, such that it may share genomic
ancestry with P. iridifolia. The nonaploid P. pratensis cv. Midnight sample, however, possessed
small chromosomes similar to P. nervosa, but did not group near the P. nervosa sample with
either chloroplast phylogeny dataset. Although common nuclear genomes cannot be ruled out, it
is unlikely that P. pratensis shares a chloroplast genome with P. nervosa.
Because chloroplast phylogenies have been generally based on a similar small set of regions,
amplifiable by universal PCR primers, we also aimed to confirm the TLF region sequence with
additional chloroplast sequences obtained from cDNA next-generation sequencing. This
sequencing allowed us to align five additional sequence segments, corresponding photosystem II
protein M (psbM), photosystem I subunit VII (psaC), ribulose-1,5-bisphosphate
carboxylase/oxygenase large subunit (rbcL), NADH-plastoquinone oxidoreductase subunit J
(ndhJ), and ribosomal protein S2 (rps2) genic regions (Table 2). These data more fully
established the maternal relationship among low ploidy Poa samples, and between low ploidy
Poa samples and P. pratensis. Both the TLF and combined chloroplast sequence analyses
generally confirmed the previously reported phylogenies (Soreng 1990; Gillespie and Boles
Page 14 of 62
https://mc06.manuscriptcentral.com/genome-pubs
Genome
Draft
15
2001; Gillespie and Soreng 2005; Patterson et al. 2005; Gillespie et al. 2007; Soreng et al. 2010),
and place samples into similar chloroplast lineages as reported in Soreng et al. (2010).
Two notable exceptions were detected between previous reports and the current study, but
only between one of the two phylogenies in the current study. Poa nervosa, a member of sect.
Madropoa, was placed near Stenopoa species in our 5-gene combined phylogeny (Figure 2)
while grouping with other sect. Madropoa taxa as expected in the TLF phylogeny (Figure 1).
Poa ligularis, a member of sect. Dioicopoa, tended to group with sect. Stenopoa taxa in the TLF
phylogeny (Figure 1) while grouping with strong support with other sect. Dioicopoa taxa as
expected in the 5-gene combined phylogeny (Figure 2). As both species grouped by taxonomic
section and chloroplast lineage in one of the two phylogenies, their disparate groupings are
possibly a result of insufficient discriminating sequence polymorphisms rather than incorrect
taxonomic identity. Further sampling of P. nervosa and P. ligularis accessions, and further
chloroplast sequencing, would be necessary to better understand the distribution of sequence
polymorphism across these species.
In this study, additional species and accessions were added to the known phylogeny of lower
ploidy Poa species. Our analysis added new species to the available information; P. asiae-
minoris, P. bucharica, P. ligularis, and P. araratica. The former two grouped in the “P”
chloroplast lineage with P. pratensis, and the latter two grouped with either Stenopoa species in
the “S” lineage or other Dioicopoa species in the “H” lineage. New accessions of species
previously considered in phylogenetic analyses included P. badensis, P. pumila, P. sibirica, P.
iberica, P. remota, P. chaixii, P. macrantha, P. arachnifera, and P. trivialis (Table 1). All these
accessions grouped with other sources of the same species, consistent with previous reports,
confirming their taxonomic identity and building upon the foundation of low ploidy maternal
Page 15 of 62
https://mc06.manuscriptcentral.com/genome-pubs
Genome
Draft
16
relationships. Interestingly, all plants analyzed in our accessions of P. pumila, P. sibirica, and P.
chaixii were diploid, despite these species sometimes comprising a polyploid series. Conversely,
our P. remota collection putatively contained both diploids and tetraploids but our analysis only
identified tetraploid plants. Regardless, these newly analyzed P. remota and P. sibirica samples
grouped in the same clade and chloroplast lineage as P. pratensis, and provide low-ploidy
genomes for future comparison to wider arrays of P. pratensis sampling.
One aim of this study was to hone in on maternal relationships between polyploid P.
pratensis cv. Midnight and lower ploidy Poa species, including tetraploids where diploid species
were not available. Little is known regarding P. pratensis evolution, genome composition, or
intraspecific phylogenetic relationships because of reticulation from allo- and auto-polyploidy,
facultative apomixis, population dynamics, and frequent aneuploidy among plants. The P.
pratensis sample in this study grouped with five diploid and tetraploid species with a “P”
chloroplast lineage that spanned both Macropoa and Homalopoa sections. In the TLF phylogeny,
P. pratensis grouped closest to the tetraploid P. remota while in the 5-gene combined phylogeny
it grouped closest to tetraploid P. iberica. Although P. iberica, P. remota, and P. pratensis have
not been previously assessed together, the grouping of P. pratensis with P. iberica in this study
is consistent with Soreng (1990) and Patterson et al. (2005), while the grouping of P. pratensis
with P. remota was reported by Gillespie et al. (2009). Closest diploids to P. pratensis cv.
Midnight were P. asiae-minoris, P. bucharica, and (as mentioned above) P. sibirica, which also
spanned both Macropoa and Homalopoa sections but associated with the “P” chloroplast
lineage. These data show a close relationship of P. pratensis with P. remota and P. iberica as
well as several diploid Poa species, and confirm that the “P” chloroplast lineage contains the
likely maternal ancestors of P. pratensis.
Page 16 of 62
https://mc06.manuscriptcentral.com/genome-pubs
Genome
Draft
17
The relationship established in our present study is based on chloroplast genes that represent
the maternal inheritance. We brought together newly analyzed low-ploidy species, and new
accessions of species previously considered, in the taxonomic sections and chloroplast lineages
that would be closest to P. pratensis. This study provides phylogenetic evidence that newly
analyzed species in the “P” lineage first reported in Soreng et al. (2010) showed a close
relationship with P. pratensis. Although further sampling may be needed to identify the exact
genome ancestor(s) of P. pratensis, these data provide a lineage and candidate species that may
be related to this agronomic and high-ploidy Poa species.
Acknowledgements
We would like to acknowledge the assistance of Lisa Michaels in the data collection.
Page 17 of 62
https://mc06.manuscriptcentral.com/genome-pubs
Genome
Draft
18
References
Ascherson, P., and Graebner, P. 1898‑1902. Synopsis der Mitteleuropaischen Flora. 2(1).
Familie 22. Gramina. Leipzig: W. Engelmann.
Balasko, J.A., Evers, G.W., and Duell, R.W. 1995. Bluegrasses, ryegrasses, and bentgrasses. In
R.F. Barnes, D.A. Miller, C.J. Nelson, M. Collins, and K.J. Moore (eds.) Forages. Vol. 1. An
introduction to grassland agriculture forages. Iowa State Univ. Press, Ames. pp. 357–371.
Barkworth, M.E., Capels, K.M., Long, S., and Anderton, L.K. (ed.). 2003. Flora of North
America: Magnoliophyta: Commelinidae (in part): Poaceae, part 1: North of Mexico.
Bohling, N., and Scholz, H. 2003. The Gramineae (Poaceae) flora of the Southern Aegean
islands (Greece). Checklist, new records, internal distribution. – Ber. Inst. Landschafts-
Pflanzenokologie Univ. Hohenheim, Beih. 16.
Bolger, A.M., Lohse, M., and Usadel, B. 2014. Trimmomatic: a flexible trimmer for Illumina
sequence data. Bioinformatics, 30: 2114–2120.
Bowden, W.M. 1961. Chromosome numbers and taxonomic notes on northern grasses. IV. Tribe
Festuceae: Poa and Puccinellia. Canadian Journal of Botany, 39: 123–138.
Brown, W.L. 1939. Chromosome complements of five species of Poa with an analysis of
variance in Poa pratensis. Amer. Jour. Bot. 26: 717–723.
Brysting, A.K., Fay, M.F., Leitch, I.J., and Aiken, S. 2004. One or more species in the arctic
grass genus Dupontia? – A contribution to the Panarctic Flora project. Taxon, 53: 365–382.
Brysting, A.K., Holst-Jensen, A., and Leitch, I. 2000. Genomic origin and organization of the
hybrid Poa jemtlandica (Poaceae) verified by genomic in situ hybridization and chloroplast
DNA sequences. Annals of Botany, 85: 439–445.
Clausen, J. 1961. Introgression facilitated by apomixis in polyploid Poa. Euphytica, 10: 87–94.
Page 18 of 62
https://mc06.manuscriptcentral.com/genome-pubs
Genome
Draft
19
Darmency, H., and J. Gasquez. 1997. Spontaneous hybridization of the putative ancestors of the
allotetraploid Poa annua. New Phytologist, 136: 497–501.
Eaton, T., Curley, J., Williamson, R., and Jung, G. 2004. Determination of the level of variation
in polyploidy among Kentucky bluegrass cultivars by means of flow cytometry. Crop
Science, 44: 2168–2174.
Edmondson, J.R. 1980. Poa L. In Flora Europaea, vol. 5, eds. Tutin, T.G., Heywood, V.H.,
Burges, N.A., Moore, D.M., Valentine, D.H., Walters, S.M., and Webb, D.A. Cambridge,
UK: Cambridge University Press. pp. 159–167.
Gillespie, L.J., and Boles, R. 2001. Phylogenetic relationships and infraspecific variation in
Canadian Arctic Poa based on chloroplast DNA restriction site data. Canadian Journal of
Botany, 79: 679–701.
Gillespie, L.J., and Soreng, R.J. 2005. A phylogenetic analysis of the bluegrass genus Poa L.
(Poaceae) based on cpDNA restriction site data. Systematic Botany, 30: 84–105.
Gillespie, L.J., Archambault, A., and Soreng, R.J. 2007. Phylogeny of Poa (Poaceae) based on
trnT-trnF sequence data: major clades and basal relationships. Aliso, 23: 420–434.
Gillespie, L.J., Soreng, R.J., and Jacobs, S.W.L. 2009. Phylogenetic relationships of Australian
Poa (Poaceae: Poinae), including molecular evidence for two new genera, Saxipoa and
Sylvipoa. Australian Systematic Botany, 22: 413–436.
Gould, F.W. 1958. Chromosome Numbers in Southwestern Grasses. American Journal of
Botany, 45: 757–767.
Gould, F.W. 1968. Grass Systematics. McGraw-Hill, Inc. New York.
Grabherr, M.G., Haas, B.J., Yassour, M., Levin, J.Z., Thompson, D.A., Amit, I., Adiconis, X.,
Fan, L., Raychowdhury, R., Zeng, Q., Chen, Z., Mauceli, E., Hacohen, N., Gnirke, A., Rhind,
Page 19 of 62
https://mc06.manuscriptcentral.com/genome-pubs
Genome
Draft
20
N., di Palma, F., Birren, B.W., Nusbaum, C., Lindblad-Toh, K., Friedman, N., and Regev, A.
2011. Full-length transcriptome assembly from RNA-seq data without a reference genome.
29: 644–652.
Hartung, M.E. 1946. Chromosome numbers in Poa, Agropyron, and Elymus. Am. J. Bot. 33:
516–531.
Huff, D. 2003. Kentucky Studies on the origin, evolution and distribution of the Gramineae. IV.
The genus Poa L bluegrass. In: Casler M, Duncan R, editors. Turfgrass biology, genetics,
and breeding. John Wiley and Sons Hoboken, NJ. pp. 27–38.
Huff, D.R., and Bara, J.M. 1993: Determining genetic origins of aberrant progeny from
facultative apomictic Kentucky bluegrass using a combination of flow cytometry and silver-
stained RAPD markers. Theor. Appl. Genet. 87, 201–208.
Hunziker, J.H., and Stebbins, G.L. 1987. Chromosomal evolution in the Gramineae, In T. R.
Soderstrom, K.W. Hilu, C.S. Campbell, and M.E. Barkworth [eds.] Grass systematics and
evolution. Smithsonian Institution Press, Washington, D.C., USA. pp. 179–187.
Hylander, N. 1953. Taxa et nomina nova in opere meo: Nordisk Karlvaxtflora I. Botaniska
Notiser 1953: 352–259.
Kelley, A.M., Johnson, P.G., Waldron, B.L., and Peel, M.D. 2009. A survey of apomixis and
ploidy levels among Poa L. (Poaceae) using flow cytometry. Crop Sci. 49: 1395–1402.
Love, A., and Love, D. 1975. Cytotaxonomical atlas of the Arctic flora. Vaduz: J. Cramer.
Meeks, M. and Chandra, A. 2015. The application of flow cytometry and a thioredoxin-like
nuclear gene for breeding Poa arachnifera x Poa pratensis hybrids. Plant Breeding, 134,
612–622.
Page 20 of 62
https://mc06.manuscriptcentral.com/genome-pubs
Genome
Draft
21
Meyer, W., Hignight, K., and Tubbs, S. 2005. Boutique Kentucky bluegrass. U.S. plant variety
protection cert. no. 200200112.
Moore, D.M (ed.). 1982. Flora Europaea check-list and chromosome index. Cambridge, U.K.:
Cambridge University Press.
Murovec, J., Kastelec, D., and Vilhar, B. 2009. High variability of nuclear DNA content in
cultivars and natural populations of Poa pratensis L. in relation to morphological characters.
Acta Biologica Cracoviensia, 51: 45–52.
Nicora, E.G. 1977. Gramineas Argentinas nuevas. Hickenia, 1: 99–107.
Nicora, E.G. 1978. Gramineae. Flora Patagónica 8:1–583. Colect. Cient. INTA, Buenos
Aires.Oxford University Press.
Patterson, J.T., Larson, S.R., and Johnson, P.G. 2005. Genome relationships in polyploid Poa
pratensis and other Poa species inferred from phylogenetic analysis of nuclear and
chloroplast DNA sequences. Genome, 48: 76–87.
Phillips, S.M. 1989. The genus Poa (Gramineae) in Ethiopia. Kew Bulletin, 44: 127–137
Posada, D., and Crandall, K.A. 1998. Modeltest: testing the model of DNA substitution.
Bioinformatics, 14: 817–818.
Probatova, N.S. 1971. New species of meadow grass of the genus Poa L. from Yakutia. Novosti
Sist. Vyssh. Rast. 8: 25–27.
Probatova, N.S. 1974. De genere novo Arctopoa (Griseb.) Probot. (Poaceae). Novosti Sist.
Vyssh. Rast. 11: 44–54.
Raggi, L., Bitocchi, E., Russi, L., Marconi, G., Sharbel, T.F., Beronesi, F., and Albertini, E.
2015. Understanding genetic diversity and population structure of a Poa pratensis worldwide
collection through morphological, nuclear and chloroplast diversity analysis. Plos One, 10(4).
Page 21 of 62
https://mc06.manuscriptcentral.com/genome-pubs
Genome
Draft
22
Read, J.C., Reinert, J.A., Colbaugh, P.F., and Knoop, W.E. 1999. Registration of ‘Reveille’
hybrid bluegrass. Crop Sci. 39: 590.
Rose-Fricker, C.A., Smith, D.A., Bonos, S.A., and Meyer, W.A. 2007. Longhorn Kentucky
bluegrass. U.S. Plant variety protection application no. 200700091. Applied for.
Simmons, M.P., and Ochoterena, H. 2000. Gaps as characters in sequence-based phylogenetic
analysis. Systematic Biology, 49: 369–381.
Smith, D.A., and Meyer, W. A. 2009: Spitfire Kentucky bluegrass. U.S. Plant variety protection
application no.200900426.
Soreng, R.J. 1990. Chloroplast DNA phylogenetics and biogeography in a reticulating group:
study in Poa (Poaceae). American Journal Botany 77: 1383–1400.
Soreng, R.J. 1998. An infrageneric classification for Poa in North America, and other notes on
sections, species, and subspecies of Poa, Puccinellia, and Dissanthelium (Poaceae:Poeae).
Novon, 8: 187–202.
Soreng, R.J. 2005. Miscellaneous chromosome number reports for Poa (Poaceae) in North
America. Sida, 21(4): 2195–2203.
Soreng, R.J. 2007. Poa L. in Flora of North America, vol. 24, Magnoliophyta: Commelinidae (in
part): Poaceae, part 1. Flora of North America North of Mexico, vol. 24. Oxford University
Press, New York, 486−601.
Soreng, R.J., Bull, R.D., and Gillespie, L.J. 2010. Phylogeny and reticulation in Poa L. based on
plastid trnTLF and nrITS sequences with attention to diploids. In: Seberg, O., Petersen, G.,
Barfod, A.S. and Davis, J.I. (Eds.) Diversity, Phylogeny, and Evolution in the
monocotyledons, Aarhus University Press, Aarhus, 619–643.
Page 22 of 62
https://mc06.manuscriptcentral.com/genome-pubs
Genome
Draft
23
Speckmann, G.J., and Van Dijk, G.E. 1972. Chromosome number and plant morphology in some
ecotypes of Poa pratensis L. Euphytica 21:171–180.
Stebbins, G.L. 1950. Variation and evolution in plants. Columbia University Press, New York.
Swofford, D.L. 2002. PAUP* Phylogenetic Analysis Using Parsimony (*and Other Methods).
Sinauer Associates, Sunderland, Massachusetts.
Taberlet, P., Gielly, L., Pautou, G., and Bouvet, J. 1991. Universal primers for amplification of
three non-coding regions of chloroplast DNA. Plant Molecular Biology, 17: 1105–1109.
Tzvelev, N.N. 1964. Poa. In Arkticheskaya Flora SSSR, vol. 2, Gramineae, eds. O.V.
Rebristaya, A.K. Skvortsov, A.I. Tomachev, N.N. Tzvelev, and B.A. Yurtsev. [English
translation: 1995. Flora of the Russian Arctic, vol. 1, Polypodiaceae—Gramineae, eds. A.I.
Tolmachev and J.G. Packer, translator G.C.D. Griffiths. Edmonton: University of Alberta
Press.]. pp. 182–224.
Tzvelve, N.N. 1976. Zlaki SSSR. Nauka Publishers, Leningrad, Russia. [English translation:
1983. Grasses of the Soviet Union, Vol. 1 and 2. Amerind Publishing Co., New Delhi, India.
1196.
Weddin, W., and Huff, D.R. 1996. Bluegrasses. In L.E. Moser et al. (ed.) Cool-season forage
grasses. ASA, CSSA, and SSSA, Madison, WI.
Wieners, R.R., Fei, S., and Johnson, R.C. 2006. Characterization of a USDA Kentucky Bluegrass
(Poa pratensis L.) Core Collection for Reproductive Mode and DNA Content by Flow
Cytometry. Genet. Resour. Crop Evol. 53: 1531–1541.
Zhu, G.H., Liu, L., Soreng, R.J., and Olonova, M.V. 2006. Poa L. In Flora of China. vol. 22,
Poaceae, eds. Flora of China Editorial Committee. Saint Louis, Missouri, U.S.A.: Missouri
Botanical Garden Press. pp. 257–309.
Page 23 of 62
https://mc06.manuscriptcentral.com/genome-pubs
Genome
Draft
24
Table 1. Poa subgenera, sections, chloroplast lineages, and species sampled for sequence and
ploidy analysis.
*The chloroplast lineage is listed similar to Soreng et al. (2010).
†Somatic chromosome count.
‡Mean 2C content of up to five plants. Where only a single plant was sampled, no upper or lower
bounds are shown.
Subgenus Section Cp
lineage* Species
Source /
Accession Origin N 2n†
Mean
2C (pg)‡
Range
2C (pg)
Ochlopoa Alpinae A badensis PI 659654 Czech Republic 5 14 2.5 2.5
Ochlopoa Alpinae A pumila PI 662326 Turkey 4 14 2.5 2.5
Poa Macropoa P bucharica PI 659940 Kyrgyzstan 5 14 2.5 2.5
Poa Macropoa P sibirica W6 21559 Mongolia 5 14 2.5 2.5
Poa Macropoa P iberica GR 5932 Soviet Union 3 28 5.9 5.4-6.5
Poa Homalopoa P asiae-
minoris
R. Soreng Turkey 3 14 2.5 2.5
Poa Homalopoa P remota W6 30378 Kyrgyzstan 4 28 5.35 5-5.5
Poa Homalopoa H chaixii GR 11720 Germany 5 14 2.5 2.5
Poa Homalopoa H hybrida PI 249765 Greece 5 14 2.5 2.5
Poa Madropoa H nervosa PI 232352 Wyoming, USA 4 28 3.15 2.9-3.4
Poa Madropoa H macrantha W6 26828 California, USA 5 28 5.96 5.4-6.4
Poa Dioicopoa H ligularis PI 284255 Argentina 1 28 7.6 -
Poa Dioicopoa H iridifolia PI 284254 Argentina 5 28 8.12 7.6-8.4
Poa Dioicopoa H arachnifera J. Goldman Texas, USA 1 56 12.3 -
Poa Poa p pratensis cv. Midnight n/a 1 63 8.2 -
Stenopoa Stenopoa S nemoralis PI 371759 Alaska, USA 4 28 6.2 6-6.6
Stenopoa Stenopoa S palustris PI 232351 Montana, USA 3 28 5.8 5.7-5.9
Stenopoa Stenopoa S araratica GR 7280 Afghanistan 5 28 5.88 5.8-6
Stenopoa Pandemos V trivialis-1 GR 4757 Germany 5 14 2.5 2.5
Stenopoa Pandemos H trivialis-2 PI 594396 United States 5 14 2.5 2.5
- - - A. tibetica W6 30476 Kyrgyzstan 1 28 12.8 -
Page 24 of 62
https://mc06.manuscriptcentral.com/genome-pubs
Genome
Draft
25
Table 2. Chloroplast gene regions sequenced for 21 Poa species.
Gene Name Gene/Region
ID
Total
Length
Num. Pars.
Inf. Char.
Num.
InDels
trnT-trnL-trnF TLF 2120 195 54
Photosystem II protein M psbM 497 10 2
Photosystem I subunit VII psaC 551 11 1
Ribulose-1,5-bisphosphate carboxylase /
oxygenase
rbcL 1670 19 2
NADH-plastoquinone oxidoreductase
subunit J
ndhJ 719 19 1
Ribosomal protein S2 rps2 761 10 0
Page 25 of 62
https://mc06.manuscriptcentral.com/genome-pubs
Genome
Draft
26
Figure 1. Maximum likelihood phylogram of 29 Poa species based on a TLF gene region
listed in Table 2. Alphabetical groupings and black vertical bars correspond to chloroplast
lineages reported in Soreng et al. (2010). Gray vertical bars represent clades mentioned in the
text. Numbers represent bootstrap support for nodes.
Figure 2. Maximum likelihood phylogram of 21 Poa species based on a 5-gene combined
region listed in Table 2. Alphabetical groupings and black vertical bars correspond to
chloroplast lineages reported in Soreng et al. (2010). Gray vertical bars represent clades
mentioned in the text. Numbers represent bootstrap support for nodes.
Page 26 of 62
https://mc06.manuscriptcentral.com/genome-pubs
Genome
Draft
236x355mm (300 x 300 DPI)
Page 27 of 62
https://mc06.manuscriptcentral.com/genome-pubs
Genome
Draft
245x373mm (300 x 300 DPI)
Page 28 of 62
https://mc06.manuscriptcentral.com/genome-pubs
Genome
Draft
Supplemental Table I. Variable characters for the six chloroplast gene regions.
TLF
Po
siti
on
con
tig
ara
chn
ife
ra
ara
rati
ca
asi
ae
-min
ori
s
ba
de
nsi
s
bu
cha
rica
cha
ixii
hy
bri
da
ibe
rica
irid
ifo
lia
lig
ula
ris
ma
cra
nth
a
mid
nig
ht
ne
mo
rali
s
ne
rvo
sa
pa
lust
ris
pu
mil
a
rem
ota
sib
iric
a
7 A C X X
9 : A A A A A A X X A A
14 G X X
17 A : : G X : X : G
21 A : X : X :
34 T G X X G
39 T G X X
56 C X X A
60 G T X X T
64 T C X X
66 : T X X
77 : C X X
78 C X X A
97 G X X
105 A T X X T T
115 T X : X
117 : A X X A
120 A : : X X : : :
126 A : : X X : : :
127 C : : X X : : :
128 T : : X X : : :
129 T : : X X : : :
130 A : : X X : : :
131 T : : X X : : :
132 : X A X A
159 G T X X
161 T A X X
162 A T X X
189 A G X X C G
198 T : X X :
205 C A X X A
212 T G G X : G G G
222 A X
226 T X G G
228 C X T T
234 A X T
235 T X A
238 T A X A A : A
Page 29 of 62
https://mc06.manuscriptcentral.com/genome-pubs
Genome
Draft
239 A T T X T T T : T T
240 T X A :
241 T X :
242 T X :
243 : A X A A A
244 : T X T T T
245 : T X T T T
246 : T X T T T
250 T G X G
256 G X C
262 G T X
265 T G X
278 G X T
281 T X A
294 A C X
306 : G G X G
307 : G G X G
308 : A A X A
309 : A A X A
310 : A A X A
311 : A A X A
312 : T T X T
323 T X C
327 A G X G
329 T X G G
347 G T X T
350 C G X G G G
358 T G X
374 A T X T
377 : A X A
386 : T X T
387 : A X A
388 : T X T
389 : A X A
390 : T X T
391 : A X A
392 : T X T
393 : G X G
394 : A X A
395 : A X A
396 : A X A
397 : G X G
398 : A X A
399 : T X T
400 : A X A
401 : T X T
402 : A X A
Page 30 of 62
https://mc06.manuscriptcentral.com/genome-pubs
Genome
Draft
403 : A X A
404 : T X T
405 : A X A
406 : A X A
407 : A X A
408 : G X G
433 G X T T
451 A G G X G G G G
463 G A X A
476 T A X
482 T A X
495 T G X
512 G T X
519 A C C X C C C C
520 C G G X G G G
523 : T X T
524 : C X C
525 : G X G
526 : A X A
527 : C X C
528 : T X T
529 : C X C
530 : G X G
531 : A X A
532 : A X A
533 : G X G
534 : G X G
535 : G X G
536 : C X C
537 : T X T
538 : G X G
539 : C X C
540 : C X C
541 : A X A
542 : T X T
543 : T X T
544 : A X A
545 : G X G
546 : T X T
547 : G X G
548 : T X T
549 : T X T
550 : T X T
551 : C X C
552 : T X T
553 : T X T
554 : G X G
Page 31 of 62
https://mc06.manuscriptcentral.com/genome-pubs
Genome
Draft
558 C X
567 G T X T
576 G A X A
579 A G X G
584 A G X G
585 A X G
586 A : X
588 A X
595 C X T T
596 T G G X G G G
602 T C X
608 G T X T
615 T X G G
617 A T X T T T
618 A T X T T T
619 A X
620 : G X G G G
621 : A X A A A
622 : A X A A A
623 : A X A A A
624 : A X A A A
625 : A X A A A
626 : A X A A A
627 : T X T T T
628 : A X A A A
629 : A X A A A
630 : A X A A A
631 : A X A A A
662 A X T
663 G T T X T T T T
670 T C X C
671 T X A
672 A T X
673 A X
684 A C T X C C C
685 A T G X
686 G X A A
688 G A A X A A A
692 G A X A A A
696 G T X T
755 A T X
760 T C X C
766 T G X G
781 G A X A A
786 C X A
792 C X
804 G A X A
Page 32 of 62
https://mc06.manuscriptcentral.com/genome-pubs
Genome
Draft
806 C A A X A A A
812 G C C X C C C
822 C X
824 C G X G G G
832 G T T X T T T
842 A T X
845 C A X
854 : X
855 C A X
873 T : : X
881 A G X G
889 G T T X
890 T X C X
891 C X : X
892 T X : X
893 C X : X
894 : X A X
895 : X G X
896 : X G X
897 : X T X
898 : X C X
899 : X C X
900 : X A X
901 : X G X
902 : X C X
903 : X A X
904 : X T X
905 : X A X
906 : X G X
907 : X G X
908 : X T X
909 : X A X
912 A X C X C C C
916 G X X X T
945 : T X X
968 T X C
1,074 G A A
1,165 G
1,178 C T
1,181 C T T
1,182 G : :
1,183 A : :
1,184 A : :
1,185 A : :
1,186 T : :
1,187 T : :
1,188 C : :
Page 33 of 62
https://mc06.manuscriptcentral.com/genome-pubs
Genome
Draft
1,189 T : :
1,190 A : :
1,191 A : :
1,192 A : :
1,193 A : :
1,194 A : :
1,195 G : :
1,196 A : :
1,197 A : :
1,198 G : :
1,199 G : :
1,200 G : :
1,201 C : :
1,202 T : :
1,203 T : :
1,204 T : :
1,205 A : :
1,206 T : :
1,207 : T
1,208 : T
1,209 : T
1,210 : A
1,211 : T
1,212 A : :
1,213 C : :
1,214 A : :
1,215 G : :
1,216 C : :
1,217 T : :
1,231 A C C
1,238 G T T
1,240 G C C
1,263 G A A A A A
1,267 A : : : : : :
1,268 T : : : : : :
1,269 A : : : : : :
1,270 T : : : : : :
1,271 T : : : : : :
1,275 A T T T T T T
1,278 T G
1,284 T
1,308 G : :
1,309 A : C : C
1,310 A : :
1,311 A : :
1,312 T : : : : : :
1,313 T : : : : : :
Page 34 of 62
https://mc06.manuscriptcentral.com/genome-pubs
Genome
Draft
1,314 T : : : : : :
1,315 G : : : : : :
1,316 A : : : : : :
1,317 A : : : : : :
1,318 A : : : : : :
1,319 T : :
1,320 A : :
1,321 G : :
1,322 A : :
1,323 A : :
1,324 A : :
1,325 T : :
1,326 G : :
1,327 A : :
1,328 T : :
1,329 T : :
1,330 A : :
1,331 T : :
1,344 T G
1,346 A T
1,347 T G G
1,357 A C C
1,366 G
1,367 T
1,368 G
1,408 A G G G G G G G
1,411 C T T T
1,414 A
1,420 G T
1,426 T G G G
1,449 C T T T
1,486 C T T T
1,531 A C
1,537 C T
1,563 C :
1,570 T C C C
1,572 C
1,586 T
1,590 : A A
1,591 : G G
1,592 : T T
1,593 : A A
1,594 : T T
1,597 C T T T T T T T
1,598 T A A A A A A A
1,601 A T T T T T T T
1,602 T A A A A A A A
Page 35 of 62
https://mc06.manuscriptcentral.com/genome-pubs
Genome
Draft
1,604 C : : : : : : :
1,605 C : : : : : : :
1,606 C : : : : : : :
1,607 T : : : : : : :
1,608 A : : : : : : :
1,609 A : : : : : : :
1,610 C : : : : : : :
1,611 T : : : : : : :
1,612 T : : : : : : :
1,613 A : : : : : : :
1,614 T : : : : : : :
1,615 A : : : : : : :
1,616 G : : : : : : :
1,617 T : : : : : : :
1,618 A : : : : : : :
1,619 T : : : : : : :
1,620 T : : : : : : :
1,621 T : : : : : : :
1,622 A : : : : : : :
1,623 T : : : : : : :
1,630 T :
1,631 : T
1,648 : G G G
1,649 : T T T
1,650 : C C C
1,651 : A A A
1,652 : A A A
1,653 : T T T
1,697 G
1,702 G A A A
1,735 A C C
1,751 :
1,752 :
1,753 :
1,754 :
1,755 :
1,756 :
1,757 :
1,758 :
1,759 :
1,760 :
1,761 :
1,763 G
1,764 A G G
1,768 T
1,769 C
1,770 G
Page 36 of 62
https://mc06.manuscriptcentral.com/genome-pubs
Genome
Draft
1,771 G
1,772 G
1,773 A
1,774 A
1,775 G
1,776 G
1,779 T C C
1,782 C
1,783 G
1,784 G
1,785 T
1,786 T
1,787 A
1,788 T
1,789 T
1,790 C
1,791 A
1,792 A
1,793 T
1,794 C
1,795 T
1,796 A C C C C C C C
1,797 T
1,798 T
1,799 T
1,800 T
1,801 T
1,802 T
1,803 C
1,804 A
1,805 G
1,806 : T T
1,807 : T T
1,808 : T T
1,809 : T T
1,810 : T T
1,811 : T T
1,812 : C C
1,813 : A A
1,814 : G G
1,815 T
1,816 A
1,817 T
1,818 T
1,819 A
1,820 T
1,821 T
Page 37 of 62
https://mc06.manuscriptcentral.com/genome-pubs
Genome
Draft
1,822 A
1,823 A
1,824 G
1,825 T
1,826 A
1,827 A
1,828 A
1,829 C
1,830 C
1,852 T C C C C C
1,853 C T T T
1,858 : C C
1,859 : C C
1,860 : C C
1,861 : C C
1,862 G
1,864 T A
1,869 A
1,875 A : :
1,876 G : :
1,877 A : :
1,878 A : :
1,879 T : :
1,880 T : :
1,881 T : :
1,901 A
1,905 T
1,993 G A
Total Differences 41 93 17 215 28 8 30 1 41 60 16 12 93 19 92 180 13 16
psbM
62 A C
74 A G G
97 A G
131 A G G G
137 C T T T T T T
143 T G G
156 C G
160 C T T
186 C T T T
256 G C C C C C C
263 T C C
326 C T
416 T X G
439 T X
444 G T X T
464 T X :
Page 38 of 62
https://mc06.manuscriptcentral.com/genome-pubs
Genome
Draft
465 A : : : : X : :
466 A : : : : X : :
467 A : : : : X : :
468 T A A A A X A A
Total Differences 3 1 5 5 6 0 0 4 1 1 0 4 4 2 4 7 6 5
psaC
32 G X X
108 A X
170 G
344 T A A A
345 G C C
420 T G G G G
424 C A
436 C X T
437 T C X C C
442 G A X A A A A A
479 T X X X
484 T X X X G
493 C X X X A
500 A X X X G
501 : X X X
502 : X X X
503 T X X X
505 C X X X
507 : X X X
516 A X X G X X
547 A X X X G X
Total Differences 2 1 0 2 0 2 1 1 1 1 2 0 2 2 2 5 0 1
rbcL
50 A X X X C
57 T : X X X
58 T : X X X
59 T : X X X
60 C : T X X X
61 G : X X X
62 T : X X X
63 T : X X X
64 T : X X X
65 A : X X X C
66 T : X X X
67 T : X X X
68 T : X X X
69 T : X X X
70 T : X X X
71 T : X X X
Page 39 of 62
https://mc06.manuscriptcentral.com/genome-pubs
Genome
Draft
72 A : X X X
73 : X X X T
74 T : X X X
75 T : X X X
76 T : X X X
77 A : X X X
78 G : X X X
79 A : X X X G
80 C : X X X
81 C : X X X
82 T : X X X
83 T : X X X
84 C : X X X
85 T : X X X : : :
86 T : X X X : : :
87 T : X X X : : :
88 A : X X X : : :
89 T : X X X : : :
90 A : X X X : : :
91 T : X X X : : :
92 T : X X X : : :
93 T : X X X : : :
94 A : X X X : : :
95 G : X X X : : :
96 T : X X X : : :
97 T : X X X : : :
98 T : X X X : : :
99 T : X X X : : :
100 A : X X X : : :
101 T : X X X : : :
102 C : X X X : : :
103 T : X X X : : :
104 A : X X X : : :
105 G : C X X X T : : C :
106 T : X X X
107 T : X X X
108 A : X X X
109 T : X X X
110 C : X X X
123 C T X X X T
124 G T X X X T
125 G A X X X A
126 C T : X X X : T T
127 T X X X : :
128 C X X X : :
129 : G X X X G G G G
130 : A X X X A A A A
Page 40 of 62
https://mc06.manuscriptcentral.com/genome-pubs
Genome
Draft
131 : T X X X T
132 : A X X X A A A A
133 : G X X X G
134 : T X X X T
135 : A X X X A
136 : T X X X T
137 : C X X X C
138 : T X X X T
139 : A X X X A
140 : C X X X C
141 : C X X X C
142 : G X X X G
143 : G X X X G
144 : C X X X C
145 : T X X X T T T
146 : C X X X C C C
147 G X X X : : :
148 A X X X : : :
149 A X X X : : :
318 T X X X
391 G X X :
443 T A X X A A
463 : A X X
475 G X X A
484 G A X X A A A A
487 : X X T T T
506 G A
533 C A
574 C A A A
588 : C
642 T C
721 C G G G
794 C T T T T
804 A C C C C
867 A G G G
891 A G G G
943 : T T
978 G : X
985 C X T
1,007 : X T T
1,008 T X
1,028 T X :
1,100 A X G G
1,120 T X : :
1,126 C T X T T
1,481 G A X A A A
1,519 G T X T
Page 41 of 62
https://mc06.manuscriptcentral.com/genome-pubs
Genome
Draft
1,557 A X G
1,644 T X X X
1,650 T X X G X
1,651 A X X T X
1,652 T X X A X
1,653 : X X A X C
1,654 : X X A G X G
1,655 : X X A T X T
1,656 : X X A X
1,657 : X X A X A
1,658 : X X T X A
1,659 : X X A A X A
1,660 : X X T X
1,661 C X X A : X :
1,662 G X X : X :
1,663 T X X : X :
1,664 A X X : X :
1,668 C X A X X :
Total Differences 60 27 2 6 1 1 1 32 26 5 1 32 20 12 11 20 1 29
ndhJ
25 G T X X T
59 A G X X G
62 G T X T T X
86 G X X
189 G A X
212 C X T
272 G C X C
311 A C C C C X C
341 A G G
397 A X
404 C X T T
446 G X A A
455 A X G G
470 T X G G A
476 T X C
553 G X T
559 C X A
565 C X T
572 A X C C
573 C X A A
586 G X T T
591 T X G
621 G X A
636 A X G G
649 C X T T
668 C X G X
Page 42 of 62
https://mc06.manuscriptcentral.com/genome-pubs
Genome
Draft
707 A X T T T X
709 A X T T T X
710 A X C C C X
711 T X A A A X
712 G X T T T X
715 C X T T T X
Total Differences 1 6 1 10 2 0 0 2 6 6 1 1 4 2 6 10 2 2
rps2
1 T C X X
2 C X X A
109 A G
161 :
178 T G G G G G G
238 : A
389 A G X X G
392 A G X X G
403 A T X X T
479 C X T X
512 C X X T
572 G X A X
620 A C C X C X C
629 A T X X T
638 T X X
642 A : X X
656 G X X
699 T C X C C X
707 C T X X T
754 C A X X
760 C T X X T
Total Differences 2 1 2 8 2 0 1 1 0 0 0 1 2 3 1 7 3 1
Page 43 of 62
https://mc06.manuscriptcentral.com/genome-pubs
Genome
Draft
Page 44 of 62
https://mc06.manuscriptcentral.com/genome-pubs
Genome
Draft
Page 45 of 62
https://mc06.manuscriptcentral.com/genome-pubs
Genome
Draft
tib
eti
ca
triv
iali
s-1
triv
iali
s-2
Nu
mb
er
of
Va
ria
nts
X 1
X 8
A X 1
X : 7
X 3
X 3
X 1
X 1
X 3
X 1
X 1
X 1
X 1
T X 1
X T 4
X 1
A X A 5
: X : 8
: X : 8
: X : 8
: X : 8
: X : 8
: X : 8
: X : 8
X 2
X 1
X 1
X 1
X 4
X 3
A X 4
G X G 9
X 1
X 2
X 2
X 1
X 1
X A 6
Page 46 of 62
https://mc06.manuscriptcentral.com/genome-pubs
Genome
Draft
X T 10
X 2
X 1
X 1
X A 5
X T 5
X T 5
X T 5
X 3
X 1
X 1
X 1
X 1
X 1
X 1
X 3
X 3
X 3
X 3
X 3
X 3
X 3
X 1
G X 4
X 2
X 3
X 4
X 1
X 3
X 3
X T 3
X A 3
X C 3
X A 3
X T 3
X A 3
X G 3
X A 3
X A 3
X A 3
X A 3
X G 3
X A 3
X A 3
X T 3
X A 3
X A 3
Page 47 of 62
https://mc06.manuscriptcentral.com/genome-pubs
Genome
Draft
X T 3
X A 3
X 2
X 2
X 2
X 2
X 2
G X G 9
X 3
X 1
X 1
X 1
X 1
C X C 9
X 5
X 3
X 3
X 3
X 3
X 3
X 3
X 3
X 3
X 3
X 3
X 3
X 3
X 3
X 3
X 3
X 3
X 3
X 3
X 3
X 3
X 3
X 3
X 3
X 3
X 3
X 3
X 3
X 3
X 3
X 3
X 3
X 3
Page 48 of 62
https://mc06.manuscriptcentral.com/genome-pubs
Genome
Draft
X G 1
X 3
X 3
X 2
X 3
X 1
X 1
C X 1
X 2
X G 6
X 1
X 3
A X 3
X T 5
X T 5
: X 1
X G 5
X A 5
X A 5
X A 5
X A 5
X A 5
X A 5
X A 5
X A 5
X A 5
X 4
X 4
X 1
X T 7
C X 4
X 1
X 1
T X 1
C X C 7
X 2
X 2
A X A 8
X A 5
X 3
X 1
X 2
X 3
X A 4
X 1
T X 1
X 2
Page 49 of 62
https://mc06.manuscriptcentral.com/genome-pubs
Genome
Draft
X 5
X 5
A X 1
X 4
X 5
X 1
A X 2
A X A 2
X 1
X 2
G X 4
X 2
X 1
X 1
X 1
X 1
X 1
X 1
X 1
X 1
X 1
X 1
X 1
X 1
X 1
X 1
X 1
X 1
X 1
X 1
X 1
X 1
X C 5
X 2
X 1
X 1
X 3
X 1
X 1
X 3
T X 4
X 3
X 3
X 3
X 3
X 3
X 3
Page 50 of 62
https://mc06.manuscriptcentral.com/genome-pubs
Genome
Draft
G X 4
X 3
X 3
X 3
X 3
X 3
X 3
X 3
X 3
X 3
X 3
X 3
X 3
X 3
X 3
X 3
X 3
X 3
X 1
X 1
X 1
X 1
X 1
X 3
X 3
X 3
T X 4
X 3
X 3
X 3
X 3
C X 4
A X A 8
: X : 9
: X : 9
: X : 9
: X : 9
: X : 9
T X T 9
X 1
A X 1
T X 4
T X 6
X 3
G X 4
A X : 9
A X : 9
Page 51 of 62
https://mc06.manuscriptcentral.com/genome-pubs
Genome
Draft
X : 8
X : 8
X : 8
X : 8
X : 8
X 3
X 3
X 3
X 3
X 3
X 3
X 3
X 3
X 3
X 3
X 3
X 3
X 3
X 1
T X 2
G X 4
X 3
X T 1
G X 1
A X 1
X 7
X 3
X G 1
X 1
X 3
X 3
X 3
X 1
X 1
X 1
X C 4
X : 1
X G 1
X 2
X 2
X 2
X 2
X 2
X T 9
X A 9
X T 9
X A 9
Page 52 of 62
https://mc06.manuscriptcentral.com/genome-pubs
Genome
Draft
X : 9
X : 9
X : 9
X : 9
X : 9
X : 9
X : 9
X : 9
X : 9
X : 9
X : 9
X : 9
X : 9
X : 9
X : 9
X : 9
X : 9
X : 9
X : 9
X : 9
X : 2
X 1
X G 4
X T 4
X C 4
X A 4
X A 4
X T 4
X A 1
X A 4
X 2
X T 1
X C 1
X A 1
X G 1
X T 1
X A 1
X T 1
X T 1
X A 1
X T 1
X T 1
X : 1
X 2
X : 1
X : 1
X : 1
Page 53 of 62
https://mc06.manuscriptcentral.com/genome-pubs
Genome
Draft
X : 1
X : 1
X : 1
X : 1
X : 1
X : 1
X : 3
X : 1
X : 1
X : 1
X : 1
X : 1
X : 1
X : 1
X : 1
X : 1
X : 1
C X : 2
X : 1
X : 1
X : 1
X : 8
X : 1
X : 1
X : 1
X : 1
X : 1
X : 1
X : 1
X : 1
X : 1
X 3
X 3
X 3
X 3
X 3
X 3
X 3
X 3
X 3
X : 1
X : 1
X : 1
X : 1
X : 1
X : 1
X : 1
Page 54 of 62
https://mc06.manuscriptcentral.com/genome-pubs
Genome
Draft
X : 1
X : 1
X : 1
X : 1
X : 1
X : 1
X : 1
X : 1
X : 1
C X C 8
X T 4
X 3
X 3
X 2
X 2
A X 1
X 1
C X 1
X 3
X 3
X 3
X 3
X 3
X 3
X 3
X C 1
X 1
X 1
52 176
1
2
1
G G 5
T T 8
2
1
2
3
C C C 9
2
1
1
C C 2
2
1
Page 55 of 62
https://mc06.manuscriptcentral.com/genome-pubs
Genome
Draft
6
6
6
6
1 4 4
T 1
T 1
A 1
A A 5
2
G G 6
A 2
1
C 4
6
A A 2
1
1
1
A A 2
C C 2
C C 2
A A 2
A A 2
1
1
4 9 8
C 2
1
1
1
2
1
1
1
1
2
1
1
1
1
1
1
Page 56 of 62
https://mc06.manuscriptcentral.com/genome-pubs
Genome
Draft
1
T 2
1
1
1
1
1
2
1
1
1
1
1
4
4
4
4
4
4
4
4
4
4
4
4
4
4
4
4
4
4
4
4
C 8
1
1
1
1
1
2
2
2
T T 7
2
2
5
5
Page 57 of 62
https://mc06.manuscriptcentral.com/genome-pubs
Genome
Draft
2
5
2
2
2
2
2
2
2
2
2
2
2
2
4
4
3
3
3
C 1
1
A 4
1
A A 3
A A A 8
T T 5
1
1
A 4
1
1
3
T T 6
C C 6
G 4
G 4
2
1
1
2
: : 2
: : 3
2
2
T 4
A A 6
2
Page 58 of 62
https://mc06.manuscriptcentral.com/genome-pubs
Genome
Draft
1
C 1
1
C 2
1
A A 4
G G 5
T T 5
A A 3
A A 4
A A 4
A A 5
C C 3
: : 5
: : 4
: : 4
: : 4
2
12 21 21
2
G 3
T T 5
T 1
1
1
2
5
2
: 1
2
2
2
A A 5
1
1
1
T T 3
2
A A 4
2
G G 3
A A 3
G 3
2
G G 3
Page 59 of 62
https://mc06.manuscriptcentral.com/genome-pubs
Genome
Draft
3
3
3
3
3
3
3 8 7
X 1
X 1
X 1
X T 1
X 6
X A 2
X 2
X 2
T 3
X 1
X 1
X 1
C X C 6
X 2
A X 1
X 1
T X 1
X C 4
X 2
X 1
X 2
4 0 4
Page 60 of 62
https://mc06.manuscriptcentral.com/genome-pubs
Genome
Draft
Page 61 of 62
https://mc06.manuscriptcentral.com/genome-pubs
Genome
Draft
Page 62 of 62
https://mc06.manuscriptcentral.com/genome-pubs
Genome