DNA ProfilingDNA ProfilingForensic ScienceForensic Science
FlorioFlorio
Learning SequenceLearning Sequence History, DNA Structure, ChromosomesHistory, DNA Structure, Chromosomes
Sources of DNASources of DNA
DNA and the Crime SceneDNA and the Crime Scene
Methods of DNA TypingMethods of DNA Typing
Process of DNA TypingProcess of DNA Typing
CODISCODIS
Brief HistoryBrief History 1980 - 1980 - American American
researchers researchers discovered non-coding discovered non-coding regions of DNAregions of DNA
1984 - 1984 - Professor Alec Professor Alec Jeffreys developed the Jeffreys developed the process of DNA process of DNA profilingprofiling
1987 - 1987 - First conviction First conviction based on DNA based on DNA evidenceevidence
DNADNA What is DNA?What is DNA? How does DNA work?How does DNA work? Why test DNA?Why test DNA? Where can DNA be Where can DNA be
located?located?• Biological tissues?Biological tissues?• Evidence collection?Evidence collection?
How can DNA be used How can DNA be used to potentially identify to potentially identify an individual?an individual?
Can DNA evidence be Can DNA evidence be destroyed or destroyed or contaminated?contaminated?
To what extent is DNA To what extent is DNA profiling accurate?profiling accurate?
What is DNA?What is DNA? Double stranded Double stranded
helixhelix PolymerPolymer NucleusNucleus
• MitochondriaMitochondria Sugar, phosphate Sugar, phosphate
and 4 types of bases and 4 types of bases (A,T,C,G) = (A,T,C,G) = NUCLEOTIDENUCLEOTIDE
-Hydrogen bonds-Hydrogen bonds
Skin cell
Skin cell DNA
What is DNA?What is DNA?
What is DNA?What is DNA?ChromosomesChromosomes
From mom From dad
22 pairs total (traits) +X,Y or XX
Male Female
Important DefinitionsImportant Definitions
GenesGenes – DNA – DNA sequences that sequences that have instructions have instructions that determine our that determine our inherited traitsinherited traits
AlleleAllele – one of two – one of two or more alternative or more alternative forms of a gene (1 forms of a gene (1 from mom, 1 from from mom, 1 from dad)dad)
PolymorphismPolymorphism – – differences in DNA differences in DNA sequences; vary in sequences; vary in length, bases, and length, bases, and number of repeatsnumber of repeats
Review of DNAReview of DNA• What does DNA do?What does DNA do?
• Make proteins!Make proteins!• DNA DNA mRNA mRNA
ProteinsProteins
• How is it copied How is it copied during mitosis?during mitosis?• DNA Replication!DNA Replication!
Why Test DNA?Why Test DNA?Human Identity TestingHuman Identity Testing
Forensic cases -- Forensic cases -- matching suspect with matching suspect with evidenceevidence
Paternity testing -- Paternity testing -- identifying fatheridentifying father Historical investigationsHistorical investigations Missing persons investigationsMissing persons investigations Mass disasters -- Mass disasters -- putting pieces back putting pieces back
togethertogether Military DNA Military DNA ““dog tagdog tag”” Convicted felon DNA databasesConvicted felon DNA databases
Where can DNA be located?Where can DNA be located?(Biological tissue)(Biological tissue)
BloodBlood SemenSemen SalivaSaliva UrineUrine HairHair TeethTeeth BoneBone TissueTissue
DNA and the Crime SceneDNA and the Crime Scene
You could have a scene You could have a scene that looks like this…that looks like this…
DNA and the Crime SceneDNA and the Crime Scene
Or a scene that looks like this…
What are some sources of DNA What are some sources of DNA at this scene?at this scene?
Sources of DNA EvidenceSources of DNA Evidence
EvidenceEvidence Possible Location of DNA on the Possible Location of DNA on the EvidenceEvidence Source of DNASource of DNA
baseball bat or similar baseball bat or similar weaponweapon handle, endhandle, end sweat, skin, blood, tissue sweat, skin, blood, tissue
hat, bandanna, or maskhat, bandanna, or mask insideinside sweat, hair, dandruffsweat, hair, dandruff
eyeglasseseyeglasses nose or ear pieces, lensnose or ear pieces, lens sweat, skinsweat, skin
facial tissue, cotton swabfacial tissue, cotton swab surface areasurface area mucus, blood, sweat, semen, ear mucus, blood, sweat, semen, ear waxwax
dirty laundrydirty laundry surface areasurface area blood, sweat, semenblood, sweat, semen
toothpicktoothpick tipstips salivasaliva
used cigaretteused cigarette cigarette buttcigarette butt salivasaliva
stamp or envelopestamp or envelope licked arealicked area salivasaliva
tape or ligaturetape or ligature inside/outside surfaceinside/outside surface skin, sweatskin, sweat
bottle, can, or glassbottle, can, or glass sides, mouthpiecesides, mouthpiece saliva, sweatsaliva, sweat
used condomused condom inside/outside surfaceinside/outside surface semen, vaginal or rectal cellssemen, vaginal or rectal cells
blanket, pillow, sheetblanket, pillow, sheet surface areasurface area sweat, hair, semen, urine, salivasweat, hair, semen, urine, saliva
"through and through" bullet"through and through" bullet outside surfaceoutside surface blood, tissueblood, tissue
bite mark bite mark person's skin or clothingperson's skin or clothing salivasaliva
fingernail, partial fingernailfingernail, partial fingernail scrapingsscrapings blood, sweat, tissueblood, sweat, tissue
DNA and the Crime SceneDNA and the Crime Scene
The Method of DNA The Method of DNA Typing depends on…Typing depends on…
1)1)How much DNA you How much DNA you have (# of cells)have (# of cells)
2)2)Condition of the DNACondition of the DNA
3)3)Nature of the crimeNature of the crime
DNA and The Crime SceneDNA and The Crime Scene
DNA and The Crime SceneDNA and The Crime Scene
PackagingPackaging1)1)All clothing packaged separately in All clothing packaged separately in breathable bags or boxesbreathable bags or boxes
2)2)Dried blood – remove with moisten Dried blood – remove with moisten cotton swabcotton swab
3)3)Acquire a Acquire a substrate control substrate control – – unstained portion of surface on unstained portion of surface on which bio material has been which bio material has been deposited – compare to stained areadeposited – compare to stained area
Packaging DNAPackaging DNA
DNA and The Crime SceneDNA and The Crime Scene
PackagingPackaging1)1)All swabs and evidence must be All swabs and evidence must be air driedair dried!!
2)2)Refrigerated Refrigerated
3)3)Obtain Obtain buccal swabs buccal swabs from from suspectssuspects
Polymorphism critical to distinguish individuals
A.• GATCTAGCTAGCTACCTAGCTATCCTAGC• GATCTAGCTTGCTACGTAG-TATCCTAGC
eg Single Nucleotide Polymorphism B.
• GCTGCTGCTGCTGCTGCTGCTGCTGCT• GCTGCTGCT---------------GCT
eg Repeat unit (including Short Tandem Repeats - STRs)
Individuals differ on average by 0.1% at the DNA level = 3.4 million base pairs
What patterns do we observe in our genomes?
AGCTGACTGACTTTCAGCTAGCTACACGTACGCTAGCTAGCTAGACTAGCATGCATGCCATGCCATGCCATGCCATGCCATGCCATGCCATGCCATGCCCATGCTAACTTGATCGGACCGCGCGCTAGCTAGCTAGCTACACTGCTAGCCCGATCGCTAGCCTAGCAGCTGGT
What is DNA Profiling?What is DNA Profiling?
DNA PROFILINGDNA PROFILING• A process or A process or
technique of technique of analysis revealing analysis revealing unique patterns of unique patterns of an individualan individual’’s DNA s DNA involving non-involving non-coding regionscoding regions
Not enough DNA? PCR is the Not enough DNA? PCR is the answer!answer!
Polymerase chain reaction Polymerase chain reaction (PCR)(PCR)
Small quantities of DNA/broken pieces Small quantities of DNA/broken pieces of DNA can be copiedof DNA can be copied
Use enzyme Use enzyme DNA PolymeraseDNA Polymerase1 DNA molecule 1 million DNA molecules
Sample size
PCRPCR
What part of the DNA is What part of the DNA is amplified?amplified?
Short repeated segments Short repeated segments (STRs) – region of DNA molecule (STRs) – region of DNA molecule that contains short segments of that contains short segments of repeating bases (3-7 base pairs)repeating bases (3-7 base pairs)
PCRPCRPurpose – Quickly make many copies of a region of a DNA molecule
Method – Multiple rounds of DNA replication using a Thermal Cycler
* each cycle doubles amount of DNA until millions of copies are produced
Methods of AnalysisMethods of Analysis
1)Restriction Fragment Length Polymorphism (RFLP)
2)Short Tandem Repeat (STR)
* Y-STR3)Mitochondrial DNA
(Restriction Fragment Length (Restriction Fragment Length Polymorphisms - RFLP)Polymorphisms - RFLP)
9-80 bases in 9-80 bases in
lengthlength Non-coding regionsNon-coding regions Pieces cut by Pieces cut by
restriction enzymesrestriction enzymes Number of repeats Number of repeats variesvaries from one from one person to the nextperson to the next
STRsSTRs
Short Tandem Repeat Short Tandem Repeat (STR) (STR) • Repeats of 2-5 or 3-7 bases (dependent Repeats of 2-5 or 3-7 bases (dependent
on source) on source) • Shorter than samples needed for RFLPShorter than samples needed for RFLP• High degree of polymorphismHigh degree of polymorphism
Greater variation in # of repeatsGreater variation in # of repeats• More preferred method of analysisMore preferred method of analysis
Larger the strand, harder it is to Larger the strand, harder it is to separate sequencesseparate sequences
What makes Short Tandem Repeats(STR) good markers?
Repetitive sequences on all human chromosomes
High degree of genetic variability Sensitive and rapid detection Several loci can be combined in a
single test
Collect Tissue Sample
Identifying an individual?
The Big Picture
>1000 cells
RFLP PCR AnalysisPCR Analysis(STR)
>20 cells
Multiplex PCR Over 10 Markers Can Be Over 10 Markers Can Be
Copied at OnceCopied at Once Sensitivities to levels Sensitivities to levels
less than 1 ng of DNAless than 1 ng of DNA Ability to Handle Ability to Handle
Mixtures and Degraded Mixtures and Degraded SamplesSamples
Different Fluorescent Different Fluorescent Dyes Used to Dyes Used to Distinguish STR Alleles Distinguish STR Alleles with Overlapping Size with Overlapping Size RangesRanges
Y STR Analysis
Locates STRs on the Locates STRs on the Y chromosomeY chromosome
Look for about 17 Look for about 17 STRsSTRs
Helpful with sexual Helpful with sexual assaults or when assaults or when more than 1 male more than 1 male involvedinvolvedVaginal swabsVaginal swabsSalivaSalivaBloodBlood
Mitochondrial DNA AnalysisMitochondrial DNA Analysis
Inherited from Inherited from mothermother
Single mito Single mito contains many contains many loops of DNAloops of DNA
Each cell contains Each cell contains 100-1000 mito100-1000 mito
Useful when nDNA Useful when nDNA is degradedis degraded
Mitochondrial DNA AnalysisMitochondrial DNA Analysis
Charred remainsCharred remains Old remainsOld remains HairHair Mass DisastersMass Disasters Historic Historic
InvestigationsInvestigations Need living Need living
maternal relative maternal relative for a matchfor a match
Mitochondrial DNA AnalysisMitochondrial DNA Analysis
Constructed in Constructed in circular loop circular loop
Single mito Single mito contains many contains many loops of DNAloops of DNA
Each cell contains Each cell contains 100-1000 mito100-1000 mito
Useful when nDNA Useful when nDNA is degradedis degraded
The Process of DNA AnalysisThe Process of DNA Analysis
1) Extraction2) Amplification (if needed)3) Enzyme Digestion (restriction
enzymes)4) Gel or Capillary
Electrophoresis
STAGES INVOLVEDSTAGES INVOLVED
Cells broken down Cells broken down to release DNAto release DNA
DNA strands cut DNA strands cut into fragmentsinto fragments
Fragments Fragments separatedseparated
Pattern of Pattern of fragments fragments analyzedanalyzed
DNA ExtractionDNA Extraction
Enzyme DigestionEnzyme Digestion
Enzyme DigestionEnzyme Digestion
• Restriction enzymes Restriction enzymes added to sample added to sample DNADNA
• DNA cleaved at DNA cleaved at specific sitesspecific sites
• Due to varying Due to varying number of repeated number of repeated segments at these segments at these sites, DNA will be sites, DNA will be cut in varying cut in varying lengthslengths
Identifying an individual?Identifying an individual?
Techniques?Techniques?• RFLP analysisRFLP analysis
• STR analysisSTR analysis
We need more DNA!!!!!!!We need more DNA!!!!!!!Polymerase chain reaction (PCR)Polymerase chain reaction (PCR)
DNA ProfilingDNA ProfilingRFLPRFLP
Extract DNA sampleDigest DNA sample
Separate fragments by (via charge)molecular weight
Label andanalyze
Collect DNA
Gel electrophoresis
DNA ProfilingDNA ProfilingPCR/STRsPCR/STRs
Extract DNA sample
Collect DNA
PCR amplification
Capillary electrophoresis
Gel ElectrophoresisGel Electrophoresis
Fragments Fragments separated byseparated by
lengthlength DNA (negativelyDNA (negatively charged)charged) Moves towards +veMoves towards +ve terminalterminal Shorter fragments Shorter fragments
move fastermove faster
Gel TransferGel Transfer DNA split into single strands DNA split into single strands
using alkaline solutionusing alkaline solution
DNA fragments transferred DNA fragments transferred from gel to filter paper or from gel to filter paper or nylon membrane. (This is nylon membrane. (This is called Southern blotting)called Southern blotting)
Gel, with filter paper Gel, with filter paper attached, is removed & attached, is removed & separatedseparated
X-ray film
Revealing a pattern of bandsRadioactive probe in solution binds to DNA
DNA Probes
How Do DNA Probes Work?How Do DNA Probes Work?
Capillary ElectrophoresisCapillary Electrophoresis Used with STR analysisUsed with STR analysis Quick and can be automatedQuick and can be automated
• Carried out in thin, glass capillary columnCarried out in thin, glass capillary column• 2 reservoirs hold buffers connected to high 2 reservoirs hold buffers connected to high
voltagevoltage ProcessProcess
1)1) DNA injected into capillary tubeDNA injected into capillary tube
2)2) STR fragments move b/c of electrical STR fragments move b/c of electrical potentialpotential
3)3) DNA segments move through DETECTOR DNA segments move through DETECTOR
4)4) Data displayed on ELECTROPHEROGRAMData displayed on ELECTROPHEROGRAM
Capillary ElectrophoresisCapillary Electrophoresis
ABI Prism 310 Genetic Analyzer
capillary
Syringe with polymer solution
Autosampler tray
Outlet buffer
Injection electrode
Inlet buffer
ElectropherogramElectropherogram
Electropherogram with Electropherogram with amelogenin – determines sexamelogenin – determines sex
SensitivitySensitivity
• Can perform STR analysis on as little as 125 picograms• Human cell = 7 pg• You need about 18 cells
• New modification to technology allow for even fewer (9 cells)• DNA below the normal level of
detection = LOW COPY NUMBER• Sources – touch DNA, licked
envelopes
Low Copy NumberLow Copy Number
Challenges with DNA Challenges with DNA profilingprofiling
•Mixtures must be resolved (2 people in a fight, blood is mixed)
•Contamination
•DNA is often degraded
•Inhibitors to PCR are often present (dirt, soils, dyes)
Degradation of DNADegradation of DNA
HeatHeat UV lightUV light Contaminating bacteriaContaminating bacteria
FBIFBI’’s CODIS DNA Databases CODIS DNA Database
CoCombined mbined DDNA NA IIndex ndex SSystemystem Used for linking serial crimes and Used for linking serial crimes and
unsolved cases with repeat offendersunsolved cases with repeat offenders Launched October 1998Launched October 1998 Links all 50 statesLinks all 50 states Requires >4 RFLP markersRequires >4 RFLP markers and/or 13 core STR markersand/or 13 core STR markers Current backlog of >600,000 samplesCurrent backlog of >600,000 samples
13 Core Loci13 Core Loci
13 regions on various chromosomes13 regions on various chromosomes High variable regionsHigh variable regions Frequency that 2 people will have the Frequency that 2 people will have the
same sequence at that region is raresame sequence at that region is rareDepends on ethnicity/raceDepends on ethnicity/race
Odds of two caucasian individuals Odds of two caucasian individuals possessing the same 13 STRs = 1 in possessing the same 13 STRs = 1 in 575 trillion and 1 in 900 trillion in 575 trillion and 1 in 900 trillion in African Americans)African Americans)