Transcript
Page 1: Divine Mercy Parish · Worship Apostolate meets in Room 104 Rosary Society meets four mes a year Filipino Community Mass every 3rd Sunday of the month with the Filipino Choir, 5:00

Divine Mercy Parish Parroquia Divina Misericordia

Formerly St. Mary’s and St. Mark’s Roman Catholic Churches Serving Jesus Christ since 1854 and 1871 232 Central Avenue, Rahway NJ 07065

h ps://www.divinemercyrahway.church

New Mass Schedule Effec ve June 21, 2020

Weekday 12:00 pm Monday to Friday Martes 7:00 pm Misa en Español Saturday 9:00 am, 4:00 pm (Vigil Mass) Sunday 8:00 am, 9:30 am, 11:00 am, 12:30 pm Misa en Español Holydays 6:00 pm (Vigil Mass) 12:00 pm, 6:00 pm, 7:00 pm Misa en Español

Rev. Alexander T. Cruz

Pastor, extn 103 Email:[email protected]

Rev. Jozef Krajnak, Ph.D. Resident Priest, extn 104

Email:[email protected] Joseph Keefe Arlene Mione

Trustees

Twenty-first Sunday in Ordinary Time

August 23, 2020

Parish Membership

Our parish embraces diversity. We may come from different origins but we are

one in faith, love & devo on to the merciful Heart of Jesus. Everyone is

welcome to join our growing communi-ty. Please email or visit our office to

register. Parish Office/Rectory

Hours: Monday to Friday 9 am - 3 pm

Email: [email protected] Tel (732)388-0082, (732)388-0083

CCD (732)382-0004

The Perfect Prayer in time of Covid19

Eternal God, in whom mercy is endless and the treasury of com-

passion inexhaustible, look kindly upon us, and increase Your mercy in us, that in difficult moments, we might not despair nor become despondent, but with great confi-dence, submit ourselves to Your

holy will, which is Love and Mercy itself.

Amen.

Jesus, I Trust in You

Page 2: Divine Mercy Parish · Worship Apostolate meets in Room 104 Rosary Society meets four mes a year Filipino Community Mass every 3rd Sunday of the month with the Filipino Choir, 5:00

TWENTY-FIRST SUNDAY IN ORDINARY TIME AUGUST 23, 2020

GIFTS AND OFFERINGS

The TTabernacle Lamp is being offered for Ϯ Albert F. Reitenmeyer. The AAltar Bread is being offered for Ϯ John R. Reitenmeyer. The AAltar Wine is being offered for Ϯ Margaret Reitenmeyer The AAltar Candles are being offered for Ϯ Albert F. Reitenmeyer .

Sacramental Schedule Confession Saturdays 3:00 pm to 4:00 pm or call

the priest for an appointment

Bap sm Call the parish office to make an ap-pointment with a priest

Marriage Couples planning marriage must no fy the Parish rectory a year in advance for date and requirement. Call the parish office to make an appointment with a priest.

Anoin ng of the Sick Contact a priest at any me. Hospital visits are s ll suspended due to Covid19.

Holy Communion For anyone who are homebound and would like to receive Holy Communion please contact the parish office or rectory.

Divine Mercy Parish Community Worship Apostolate meets in Room 104 Rosary Society meets four mes a year

Filipino Community Mass every 3rd Sunday of the month with the Filipino Choir, 5:00 pm to 6:30 pm at the Church

Divine Mercy Ministry of Jesus Meets at the Vigil Mass on every 4TH Saturday of the month

Spanish Community Reuniones Hispanas Eucaris a Dominical 12:30 pm Bau sos Por favor llamar la oficina de Lunes a Viernes. Matrimonio Feligreses registrados enen que presentarse un

año antes de la boda. Reconciliación Cada Martes Despues de la Misa 12:00 pm Y de

la 7:00 pm, Cada Miercoles Despues de la Misa de la 12:00pm

Unción de los Enfermos Por favor llamar a la oficina para visitas a las casa o hospital.

Mensajeras del Amor de Cristo Visitan los enfermos Diana (732)535-0278 Educación Religiosa llamada (732)382-0004 Movimiento Juan XXIII Jueves 8:00 pm Parish School #104 Grupo Guadalupano Martes 7:00 pm Iglesia Grupo Juvenil "Angeles de Jesús" Sábado 4:00pm - 6:00pm Aula 202 Grupo de Oración Sábado 7:00 pm Connell Hall

“Grupos Voluntarios Limpian La Iglesia” Mil Ave Marias - Cada Primera Semana del mes, Miercoles

manana Juan XXIII - Cada Segunda Semana del mes, Sábado Guadalupanos - Cada Tercera semana del mes, Sábado Grupo de Oracion– Cada Cuarta semana del mes, Sábado

DUE TO COVID 19 ALL MEETINGS ARE TEMPORARILY SUSPEND-

ED. MEETINGS WILL START TO RESUME SEPTEMBER 2020.

CDC and Archdiocesan Guidelines in Celebra ng Mass during Pandemic

1. Everyone MUST WEAR MASK all the me while inside the church.

2. Front of every available seats are marked with a WHITE TAPE. Seats without the white tape should be le vacant.

3. To follow and maintain social distancing 70 to 80 peo-ple only will be allowed inside the church.

4. Keep social distancing at all mes (6 feet apart from each other) Couples and families living in one roof may seat next to each other

5. NO SHAKING OF HANDS and NO KISSING during the giving of the sign of peace. NOD and WAVING of HANDS are the methods acceptable in giving the sign of peace.

6. Use the middle aisle to receive Holy Communion. Stay on the floor markings to keep social distancing. Use the le or right aisle to return to the pew.

7. Communion by hands are highly recommended and encouraged at this me.

8. Anyone who feels the need to step out of the church during mass for a moment to breath may do so and may return to the seat a er.

9. The Chapel at the le side of the church will be used as extension of the church during mass and will open for people with special condi on and to those in need of space and flexibility. The chapel has a maximum capacity of 6 people at this me. Communion will be served to all occupants by a Eucharis c minister.

10. Please maintain social distancing when leaving the church.

11. Congrega ng a er the mass inside the church is not allowed.

12. Please follow all the guidelines religiously. Thank you very much for your coopera on

and understanding.

Page 3: Divine Mercy Parish · Worship Apostolate meets in Room 104 Rosary Society meets four mes a year Filipino Community Mass every 3rd Sunday of the month with the Filipino Choir, 5:00

TWENTY-FIRST SUNDAY IN ORDINARY TIME AUGUST 23, 2020

SATURDAY, AUGUST 22 ( Vigil Mass ) 4:00 pm (V) Ϯ Elizabeth Pierre & Cler cia Philippe

SUNDAY, AUGUST 23 Twenty-first Sunday in Ordinary Time

8:00 am Ϯ Elizabeth Pierre and Cler cia Philippe 9:30 am Ϯ Louis Griffone 11:00 am (FBL) Ϯ Pierre 12:30 pm (SP, FBL) Ϯ Lucila Freire (Death Anniversary)

MONDAY, AUGUST 24 Feast of Saint Bartholomew

12:00 pm People of the Parish

TUESDAY, AUGUST 25 Feast of Saints Louis & Joseph Calasanz

12:00 pm Ϯ Elizabeth Pierre (Death Anniversary) 7:00 pm (SP) Ϯ Leovardo Torres and Maria Rosendo

WEDNESDAY, AUGUST 26 12:00 pm Ϯ Blanca S. Pimentel (Deceased/Birthday)

THURSDAY, AUGUST 27 Feast of Saint Monica

12:00 pm † Marina Tinana

FRIDAY, AUGUST 28 Feast of Saint Augus ne

12:00 pm Ϯ Elizabeth Pierre

SATURDAY, AUGUST 29 The Passion of Saint John the Bap st

9:00 am Ϯ Elizabeth Pierre and Cler cia Philippe 4:00 pm (V) Ϯ Jean Joseph Pressage Pierre

SUNDAY, AUGUST 30 8:00 am Ϯ Elizabeth Pierre

9:30 am Ϯ Be e Thornton 11:00 am (FBL) Ϯ Timothy Albert Veloso 12:30 pm (SP, FBL) Ϯ Paulina Vargas Legend: (V) Vigil Mass , (SP) Spanish Mass, (F) Filipino Mass

(FBL) Facebook Livestreamed Mass @ the parish Facebook account Divine Mercy Parish, Rahway NJ

Bap sm Let’s welcome and pray for the newly Bap zed

of our parish community Nicholas Aaron Pres a II, Mary Louise Perez & Liam Manuel Garcia.

For the Recently Deceased of the Parish Dear brothers and sisters in Christ, let’s pray for the soul of Alejandro Ne Nacho. Eternal rest grant unto him, O Lord and let perpetual light shine upon him.

May he rest in peace Amen.

FOLLOWING THE DIRECTIVES OF THE ARCHDIOCESE OF NEWARK (PHASE 3)

Started June 21, 2020 The Church will be reopened for SUNDAY Masses. Includes everything that reopened and all direc ves on Phase 2 and Phase 1 Only 50% capacity of the Church or 70 people only are allowed inside the Church excess will be turned away.

STRICT OBSERVANCE OF THE CARDINAL’S DIRECTIVE

BELOW FOR REOPENING IS WITHOUT EXCEPTION 1. Dispensa on from the obliga on to a end Mass on Sun-

days and Holy Days will remain in effect. No one will be required to a end Mass when public celebra ons resume.

2. A endance will be limited to 20% for Phase 2 & 50% for Phase 3.

3. Social distancing should be strictly observed while inside the church (6 apart from each other).

4. NO MASK NO ENTRY. Mask should be worn inside the church at all mes

5. Parishioners should take their temperature before coming to Mass. Anyone with any symptoms of sickness must stay home.

6. Liturgical changes will be in placed.

PARISH RELIGIOUS EDUCATION PROGRAM SY 2020 - 2021

CCD To register for CCD, please visit h ps://www.divinemercyrahway.church/ccd & select “Program Infor-ma on.” To register in person, please visit the CCD office on Sundays from 12-12:30 PM, or the Rectory Monday to Friday from (9am to 3pm). For any inquiries please email [email protected]. Please be advised that star ng August 1, 2020 a $10 late fee will be added to the registra on fee. Classes will start on Sept. 13, 2020. RCIA Inquiry sessions are ongoing for RCIA (English and Spanish). Rite of Chris an Ini a on for Adults (age 18 & old-er) is the process by which adults are fully ini ated into the Catholic faith community. For Adults who would like to grow in their faith and would like to receive the sacraments in 2021, please visit h ps://www.divinemercyrahway.church/rcia and select RCIA informa on and registra on. August 31, 2020 is the last day of registra on.

Page 4: Divine Mercy Parish · Worship Apostolate meets in Room 104 Rosary Society meets four mes a year Filipino Community Mass every 3rd Sunday of the month with the Filipino Choir, 5:00

TWENTY-FIRST SUNDAY IN ORDINARY TIME AUGUST 23, 2020

FROM THE PASTOR’S DESK

Dearest Parishioners,

I am very happy to inform all of you that we will start the addi on of new restrooms for our church. The es mated cost of the project is around $25,000. As of August 25, 2020 the total dona on is $11,280. Please help us pray and raise funds for the success of this project.

DONORS Ilda Monterroso - $500 Grupo de Oracion - $1,000 Spanish Group - $1,000 Dinner Dance - $3,595 Susan Barrone - $20 Genevieve Norante - $500 Juana Sandoval - $20 Mil Ave Marias - $1,000 Barbara Rusk - $75 Maria Fine - $100 Ϯ Irene McElroy - 150 Eleanor Orpilla - $50 Edward Montoya - $20 Irma Lopez - 200 Dorothy Yuhas - $100 Mercedes Gamboa - $300 Maria Wilms - $200 Julio Biel - $1000 Anonymous 1 - $450 Anonymo dela Comunidad Espana - $1,000

Thank you very much for your generosity and con n-ued support. May God bless you all. Yours in Christ, Rev. Alexander T. Cruz

Please remember to include our parish in your prayers. Every-one can s ll send weekly offerings for our Parish by signing up @ Parish Giving online. It is fast, secure and easy. Thank you

and be safe everyone. God bless.

THIS WEEK AT DIVINE MERCY

SATURDAY, AUGUST 22 11:00 AM Bap sm Liam Manuel Garcia & Mary Louise Lopez (Church) 11:00 AM BLD (208) 12:00 PM Bap sm Nicholas Aaron Pres a II 3:00 PM Divine Mercy Chaplet ( Church)

SUNDAY, AUGUST 23 12:00 PM Food Pantry (Annex)

TUESDAY, AUGUST 25 7:00 PM Guadalupano (Church)

FRIDAY, AUGUST 28 10:30 PM BLD (Church) 11:00 PM BLD (103, 104, 105)

SATURDAY, AUGUST 29 1:00 PM Bap sm Ma as Francis Acosta Valadez

All parish schedules are now posted at the Parish web Site h ps://divinemercyrahway.church Events & News.

Pray for us!

“Pray this during communion of our LIVE streamed mass @ our Facebook account Divine Mercy Parish, Rahway NJ

Every Sunday at 11:00 am & 12:30 pm.”

Page 5: Divine Mercy Parish · Worship Apostolate meets in Room 104 Rosary Society meets four mes a year Filipino Community Mass every 3rd Sunday of the month with the Filipino Choir, 5:00

TWENTY-FIRST SUNDAY IN ORDINARY TIME AUGUST 23, 2020

Isaiah 22 : 19 - 23 Psalms 138 : 1 - 2, 2 - 3, 6 - 8

Romans 11 : 33 - 36 Gospel from Ma hew 16 : 13 - 20

GOSPEL REFLECTION

In today’s gospel, Peter declares faith in Jesus and is promised the keys of the kingdom.

Shepherd and Rock Above the sanctuary of Saint Peter’s basilica in Rome, in huge lettering of gold mosaic, stands the promise of Jesus to his chief apostle: “You are Peter, and upon this rock I will build my church.. I will give to you the keys of the kingdom of heav-en.” These words are taken by Catholics as the basis for the papacy, as applying also to the bishop of Rome as Peter’s suc-cessor and chief spokesman for the church’s living faith, hold-ing the “power of the keys”. We need not insist that the Roman way is the only way of tak-ing Christ’s words. Still, this Gospel deserves close attention for what it says about faith, enlightenment and leadership, and guidance for our own lives. Each must make a personal answer to Our Lord’s question: “Who do you say that I am?’ although Peter’s credo is a solid basis from which to begin. Notice the phrase “Son of the Living God,” expressing more richly what “Christ” means. Peter’s worshipful faith comes to him as gift from above, not from his own ability. Why was the blessing given to him in particular? Perhaps because his humble, contrite spirit made him best prepared to receive it? Or because God chooses whom He wills, irrespec-tive of their merits? It is to this Peter that Jesus entrusts what-ever is meant by the keys of the Kingdom of Heaven. Upon his solid, dedicated faith the Church will always rely, for unity and encouragement. Keys are mainly for opening; many doors lock by themselves. We could re lect further on Peter’s task, as seen in other Gospel passages (Mat. 14:28ff; 17:24ff; Lk. 22:32; Jn. 21:15-17), and in the Acts (1:1 5ff, 2: 14ff; 3:1 2ff). The one appointed to “feed the lambs and sheep” of Christ, to “con irm his brethren,” and welcome the irst pagan convert into the Church, was not a born saint. Weakness of faith (when he began to sink), rash self-con idence and eventual

denial are also portrayed by him. But these serve only to underline the grandeur of his conversion, when with a new clarity of self-knowledge he turns and says to Jesus: “You know that I love you.” The task is not one of stern domi-nance, or just for the ef icient organization of Christ’s Church. Pastor and penitent at once, convert and the support for other converted sinners, he leads the faithful by witness and example. This pastoral understanding of authority inds a lovely echo in the irst epistle of Peter. Elders or leaders are asked to “tend the lock of God, not as domineering over those in your charge, but being examples to the lock” (5:13.) Just so, Peter tended the early church by sharing his deep faith in Christ the Risen Lord. So, he kept them united in a community of mutual love, and in faithful obedience to the Gospel. Such an ideal situation of harmony in the Church is brie ly sketched for us in the Acts (2:42ff; 4:32f.) What of today’s Church, spread through our world, united under the leadership of pope Francis? How can this work of teaching, encouraging and uniting so many millions of bap-tized believers be carried on? Jesus remains at the center, as the Christ, Son of the Living God, and he continues to be the Church’s true Rock. We today, just as much as in the time of St Peter, need the ministry of faithful apostles, entrusted by Christ to build up his people, witness to the faith, and pro-vide leadership in Christian love. Pope, bishops, priests and other ministries exist in order to serve. But in some sense, we get the service that we deserve. It is for us to make known to our pastors both our appreciation and our loyal criticisms; especially to pray for them, for their courage and perseverance. Today we particularly remember the present successor of Peter, our Pope; that God may establish him in faith and wisdom; that being strong in himself, he may con-irm the brethren; and that as Chief Shepherd he may help us

on our way to the Kingdom. Gospel re lection from h ps://

www.associa onofcatholicpriests.ie/

Page 6: Divine Mercy Parish · Worship Apostolate meets in Room 104 Rosary Society meets four mes a year Filipino Community Mass every 3rd Sunday of the month with the Filipino Choir, 5:00

671 Divine Mercy Parish, Rahway, NJ John Patrick Publishing Company • www.jppc.net • 1-800-333-3166

Spin Central Laundromat519 Avenel Street, Avenel, NJ 07001 (Next to Krauszers) 732-326-9696

Earn Free Washes!!Earn Free Washes!!

Plumbing & HeatingSewer & Drain Cleaning

Fax: (732) 738-1156 Member of the Parish24 Hour EMERGENCY Service

Call Toll Free 1-866-81CRAIG 2 7 2 4 4

Craig Lehman Plumbing License Number 11122

FULLY INSURED& BONDED

N.J. LIC. NO. 4183 “A Family Tradition of Dignifi ed Service Since 1832” N.J. LIC. NO. 3786

PRE-ARRANGEMENT CENTER • CREMATION SERVICESWilliam G. Davis Jr., Manager • John W. Tluchowski, Director371 West Milton Ave. • Rahway, NJ 07065 • P: 732.388.0038

F: 732.388.7998 • www.pettitdavisfuneralhome.com

Pettit-DavisPettit-DavisFuneral HomeFuneral Home

Est. 1832Est. 1832

Heating & Air Conditioning • Over 35 Years Experience

685 Saint George Ave., Woodbridge, NJ 07095 • www.AirtecServiceInc.com

We Service All Makes & ModelsFurnaces • Air Conditioning • Indoor Air Quality • Boilers

Duct Fabricating • Maintenance ContractsCommercial Leasing • Residential Financing Available

732-634-4188Daniel McKenzie

[email protected]

Italian Restaurant

Christenings • Bridal ShowersEngagement Parties • ShowersFuneral Repast • Anniversaries

Birthdays and Much More.732-726-3355

Fax: 732-726-9335453 Avenel St., Avenel, NJ 07001 • www.dominics-italian.com

What’s My Name?The #WHATSMYNAME Movement asks everyone to simply ask drivers “What’s my name?” before entering their vehicle to make sure it is the car they

are supposed to enter.

In Rememberance of Samantha Josephson

#WHATSMYNAME

Mallory’s Army FoundationUnited Together In The Fight Against Bullying...

Don’t Just Teach Kindness... BE KINDNESS!www.MallorysArmy.com

(973) 440-8657 • [email protected] It’s easy to join our mailing list! Just send

your email address by text message: Text MALLORYSARMY to 22828 to get started.

Message and data rates may apply.

Private & Public Healthcare - Law Enforcement, Public Safety - Offi cers & First Responders - Food & Agri-culture - Energy Sector - Waste & Waterwaste - Transportation & Logis-tics - Public Works & - Infrastructure - Communications & Information Technology Workers - Community & Government Workers - Critical Man-ufacturing - Chemical & Hazardous Materials Financial Services - Defense Industrial Base - Commercial Facili-ties Workers - Residential & Shelter Services & Facilities - Hygiene Prod-ucts & Services - Private & Public Healthcare - Law Enforcement, Public Safety - Offi cers & First Responders - Food & Agriculture - Energy Sec-tor - Waste & Waterwaste - Trans-portation & Logistics - Public Works & - Infrastructure - Communications & Information Technology Workers - Community & Government Work-ers - Critical Manufacturing - Chemi-cal & Hazardous Materials Financial Service - Private & Public Healthcare - Law Enforcement, Public Safety - Of-fi cers & First Responders - Food & Agriculture - Energy Sector - Waste & Waterwaste - Transportation & Logis-tics - Public Works & - Infrastructure - Communications & Information Technology Workers - Community & G W k C i i l M

To all those essential workers keeping us safe,

yourservice is

invaluable & appreciated.

& Public Healthcarent Public Safety O

oy &

MaM nrdrdrdrdrdrddddouddrd

eeefefefensl FacilShelte

ene Prod& Publi

ment, PubliResponder

Energy Secwaste - Trans- Public Work

Communicationhnology Worker

overnment Workufacturing - ChemM t i l Fi i

yournicationnicationWorkerWorke

service isovernment Workovernment Workacturing Chemacturing Chem

nvaluable &Materials FinanciaMaterials Financia& Public Healthcar& Public Healthcar

ent, Public Safety - OSafety - OervLaw EnEEE fo

dustrial Baes Workerservices & cts & Seealthcarafety -Food r - W

orta- II

CC

acturing - C

First Responders -y Se

Waterwaste - Transpcs - Public Works

Communicationechnology Work

Wo

To all thosenforcement, Public Sanforcement, Public Sa

essentiallture - Energylture - EnergyWater aste TraWater aste Tra

workerscs - Public Wors - Public WorCommunicatioCommunicatio

keepingechnology Wochnology Woovernment Wovernment W

us safe,acturing Caterials Finaaterials Fina

ficererereafety --- OffiOffiOffiOffiOffiOffiOffiOffiOffiOffiOffiOffiOffiOffiOf cercercercercecece- Food & d & d & d &d &d &d &d &d &d d d d d d AgAgAAAAgAgAgAgrAgrAgrAgAgAgrAg

ector - WaWaWaWaWaWaWaWaWaWaWaWaWaWaWastestestestestesteteestestestestestestest &sportatatatttttttttion ionion ionioionion ioniononion onion & L& L& L& L& L& L& L& Lo& L& L& L& L& & giss & - Infrnfrnfrnfrnfrnfrnfnfnfnfnfrnfrnfrnfrnfrastructuucucucucucucuc r

ons & IIIIIIIIIIIIIIInfornfornfornfornfornfornfornfornfornfornfornfornfornfornformatimammmmmmammmmmm orkers - ComComComComComComComComComComComComComComCommunimumumummmmmmm ty

Workers -s -s -s -s -s -s -s -s -s -s --- CriCriCriririririiiiriiticacaticacacaticaticaticaticaticaticaticaticaticatical Ml Ml Ml Ml Ml Ml Ml Ml Ml Ml Ml l Ml MChemical &&&&&&&&&&&l &l & l & l & HazaHazaHazaHazaHazaHazaHazaHazaHazaHazaHHHH rrrrrrrrrncial Services - DDDDDDDDDeeeeeeeee

ase - Commercialrssrssssss - RResidesidesidesidesidesidesidesididesidesidesidesideentientientientientientientientientiential &aaaaaaaa

& FFFFFFFFFFFFFFFaciaciacilacilacilacilacilacilacilcilaciacilacilacilacilitieitieitieitieitieitietieitietieitieies -s -s - - - - - HyHyHygiHyHyHyHyHyHyHyHyHH enervices es esesesesesesesesessss - Pr- Pr- Pr- Pr- Pr- Pr- Pr- Pr- Pr- Pr- Pr- Pr- Priiiiivivivivivivivaivaivativ e

are - Lawawawawawawawawawaw EnfEnfEnfnfnfnffnfnffffffforcorcorcorcorcorcorcorcorcorcorcorceorc m- Officercercercercerererercercers &&&s &s &s &s &s &s &s &s &s &s &s &s & FiFiFiFFirsFFFFFFFFF t R

d & Agrgrgrgrrrrriculiculiculiculiculiculiculiculiculiculicuiculiculicic turturturturturturureturturturturturtutut - Waste e eee ee & Wa& Wa& Wa& Wa& Wa& Wa& Wa& Wa& Wa& Wa& Wa& Wa& Wa& Wa& ttttterwtttettt

ation &&&&& & && & &&&&&& LogiLogiLogiLogiLogiogiogiogiLogiLogLogLogiLogLogLog stististststststisticststststsss s - Infrastrtrrrrrrrrrrrrrrucucucucucuctctctuucucucucuctucuc re -e e e ee e Co

Informatioatioatioiooooooioooooonnn Tn Tn Tn Tn Tn Tn Tn Tn Tn Tn Tn Tn TechCoCoCoCoCoCoCoCoCoCoCoCoCoCoCommunmmunmmunmmunmmunmmunmmunmmunmmunmmunmmunmmunmmunmmunmmunity ity ity ity ity ity ity ity ity ity ity ity ityityity & Go&&&&&&&&&&&s - CrCrCrCrCrCrCrCrCrCrCrCrCrCrCriticiticiticticiticiticticiticiticticiiticiticiticitical al Mal Mal Mal Mal Mal Mal Mal a anufl l ll & Ha& Ha& H& H& H& H& H& H& H& H&&&&& zardzardzardzardzardzardardardardardardardzardardardooooooous ooooooo

ervrvrvvvvice ice ice ice ice iceicicice icicicicicic - P- Pr- Pr- P- P- P- P- - - P- - - - ivativaivivvvvvvv e Enforcforcforcffforcforcforcforcforcforcforceeme

e SaSa

gWe,

Canan

inus us e &e

methan

k yo

u

g gyWatateatttatatatattaaaaaa rwaswaswawaswaswawwwaswaswwwwwasswasawaw ste -tettttttttttteee Transportation & Log

cccscccccc - PPPPPPPPPPPPPPubliubliubliubliublililublibbliububuubuuubu c c WoWoc WoWWWoWoWoWWoWWWoWc oc WoWWc Woc WWc WWWWccc rks rksrrksrkskrkrkkkkkrr & - & -& -&& -&& -&&&& -&& -&&&&& -&&&& -&& InfrInfInfrnfrInfInfrnfrIInffI ffInI fnfI fInfnfInnnfn astructuCCoCoCoCoCoCoCCoCCoCCCoooCCCCCCCC mmunmmunmmmmmmunmmm nmmmm nmmmmm nmmmm nnm nm nmmmm nicatcaticaticatcatcatcatcattcatcatcatcattcatcatcatcatccacatcccacc ionsionsionsonsionononsonsiooionssonsonsonsiononoooon & I&&& I&& I&&& I& II& I& I& I&& nfornfornfornfornfornforforfornfornforforfnfnfornfornfornfornforfofornfornforrrfornnfforrmatimatimatmatmatiamatimatmattimatiatitimatiattatmatmatimattattmattmmmatim

echhhhhhhhhnolonononoonnoloonolonnoln lonolonoooloonnnn onolonoln oonoo ggy Wgggg orkers - Community

Wedding InvitationsWedding Invitations Holiday CardsHoliday Cards

Log ontoLog onto www.JPPC.netwww.JPPC.net conveniently from your home or office.conveniently from your home or office.

ONLINE CATALOG - ONLINE ORDERING - ONLINE PROOFINGONLINE CATALOG - ONLINE ORDERING - ONLINE PROOFING

All Major Credit Cards Accepted All Major Credit Cards Accepted FREE UPS GROUND SHIPPINGFREE UPS GROUND SHIPPING!

Local, trusted, proven, effective, supportive, referrals, relationships, affordable, repetitious, versatile, lasting.

This describes the power of...

Placing an ad in the parish bulletin supports the parish while building your business - THAT’S A WIN WIN!

Call 1.800.333.3166 TODAY!


Recommended