Linköping University | Department of Physics, Chemistry and Biology Bachelor thesis, 15 hp | Biology programme: Physics, Chemistry and
Biology Spring or Autumn term 2018 | LITH-IFM-G-EX--18/3526--SE
Identifying variation in the OMT gene in Pisum sativum and its relevance regarding protein content
Louise Carlsson
Examinator, Urban Fridberg, IFM Biologi, Linköpings universitet Tutor, Jenny Hagenblad, IFM Biologi, Linköpings universitet
2
Datum
Date
2018-05-30
Avdelning, institution
Division, Department
Department of Physics, Chemistry and Biology
Linköping University
URL för elektronisk version
ISBN
ISRN: LITH-IFM-x-EX--18/3526--SE
______________________________________________________
___________
Serietitel och serienummer ISSN
Title of series, numbering
___________________________
___
Språk
Language
Svenska/Swedish
Engelska/English
________________
Rapporttyp
Report category
Licentiatavhandling
Examensarbete
C-uppsats D-uppsats
Övrig rapport
____________
Titel
Title Identifying variation in the OMT gene in Pisum sativum and its relevance regarding protein content
Författare
Author Louise Carlsson
Nyckelord
Keywords
Meat consumption, environment, alternative protein sources, Pisum sativum, OMT gene, QTL
Sammanfattning
Abstract
As global meat consumption is rising, the negative impact the animal husbandry sector has on the
environment will increase. Greenhouse gas emissions have increased by 40 % during the last 200
years, and the animal husbandry sector is today responsible for 18 % of the total greenhouse gas
emissions from food production. More environmentally friendly protein sources, such as soy and
pea, must therefore be developed. Pisum sativum can (unlike the most popular meat alternative –
soy) be grown all over Europe and might thus be a good alternative that allows for locally sourced
alternatives to meat protein. Identifying genes with important agricultural properties might aid the
development of pea cultivars with a more reliable protein content. One such gene was
hypothesised to be the OMT gene, which is strongly expressed during the embryonic development
of P. sativum and seems involved in functions such as seed storage and protein synthesis. Thirty-
one accessions of P. sativum were tested to see if different improvement types differed from each
other regarding protein content and seed weight, but no such differences were found. DNA was
extracted from all accessions, sequenced, and successful sequences were tested to determine if
variation in the gene correlated with protein content. Two haplotypes were identified, but there
was no correlation between them and protein content found. Based on the results of this study,
there is little evidence that the OMT gene correlates with protein content in the studied accessions.
3
Contents
1 Abstract ............................................................................................... 4
2 Introduction ......................................................................................... 4
3 Material and methods .......................................................................... 6
3.1 Preparation of test sample and DNA extraction .......................... 6
3.2 PCR .............................................................................................. 7
3.3 Sequencing and processing of sequences .................................... 7
3.4 Statistical analysis ........................................................................ 7
4 Results ................................................................................................. 8
5 Discussion ........................................................................................... 9
5.1 Social and ethical aspects ........................................................... 11
5.2 Conclusion.................................................................................. 12
6 Acknowledgements ........................................................................... 12
7 References ......................................................................................... 13
8 Appendix ........................................................................................... 15
4
1 Abstract
As global meat consumption is rising, the negative impact the animal
husbandry sector has on the environment will increase. Greenhouse gas
emissions have increased by 40 % during the last 200 years, and the
animal husbandry sector is today responsible for 18 % of the total
greenhouse gas emissions from food production. More environmentally
friendly protein sources, such as soy and pea, must therefore be
developed. Pisum sativum can (unlike the most popular meat alternative –
soy) be grown all over Europe and might thus be a good alternative that
allows for locally sourced alternatives to meat protein. Identifying genes
with important agricultural properties might aid the development of pea
cultivars with a more reliable protein content. One such gene was
hypothesised to be the OMT gene, which is strongly expressed during the
embryonic development of P. sativum and seems involved in functions
such as seed storage and protein synthesis. Thirty-one accessions of P.
sativum were tested to see if different improvement types differed from
each other regarding protein content and seed weight, but no such
differences were found. DNA was extracted from all accessions,
sequenced, and successful sequences were tested to determine if variation
in the gene correlated with protein content. Two haplotypes were
identified, but there was no correlation between them and protein content
found. Based on the results of this study, there is little evidence that the
OMT gene correlates with protein content in the studied accessions.
Key words: Meat consumption, environment, alternative protein sources,
Pisum sativum, OMT gene, QTL
2 Introduction
Global meat consumption is predicted to rise due to urbanization and
rising incomes (Tillman and Clark, 2014). Global greenhouse gas
emissions from all sectors, such as the transport and food production
sectors, have increased by over 40 % over the last 200 years (Steinfeld et
al., 2006), and it is estimated that the increase in meat consumption will
contribute to an 80 % increase in greenhouse gas emissions from food
production alone by the year of 2050 (Tillman and Clark, 2014). Today,
the animal husbandry sector produces 18 % of the global greenhouse gas
emissions, and meat production from ruminant animals emit 250 times
more greenhouse gas emissions per kilo protein than legumes do
(Steinfeld et al., 2006; Tillman and Clark, 2014). The production and
consumption of meat substitutes based on plant protein, such as soy and
5
pea, is thus an environmentally more sustainable alternative (Elzerman et
al., 2013; Davis et al., 2010).
Soy-based products are the oldest and most well-known meat
substitutes, and soy has an average protein content of about 400 g
protein/kg dry seed matter (Vollman et al., 2000). Soy provides roughly
60 % of the world’s current supply of vegetable protein (Vollman et al.,
2000), where the majority of the soy grown today is used as a protein
source for animals in the animal husbandry sector (Davis et al., 2010).
However, soy grown in northern climates suffers from a reduced protein
content and large seasonal variations due to low temperatures and high
amounts of precipitation (Vollman et al., 2000). Thus, soy can be grown
in many parts of Europe, such as Italy, France and Croatia (Vollman et
al., 2000), but the South America climate is more suitable for it, so soy is
primarily grown there (Vollman et al., 2000). This is however not
without environmental problems (Davis et al., 2010). The large-scale
production of soy in South America causes soil erosion, deforestation and
elevated pressure on the remaining rainforests (Davis et al., 2010). The
increased global transport of soy also causes a rise in transport-linked
emissions (Davis et al., 2010). Due to these issues, locally produced
sources of plant protein, that are adapted to the northern climate, would
be a more environmentally sustainable alternative.
Pisum sativum, also called pea, is one of the most important
cultivated pea plants in Europe, and it is known to have a high protein
content (Krajewski et al., 2012). The pea is an important human food
source containing fibre, protein, vitamins and important minerals, and it
contains less anti-nutritive molecules, such as protease inhibitors, than
soy does (Olle et al., 2015; Barac et al., 2015). According to Nemecek et
al. (2008), peas can easily be grown in many parts of Europe, reducing
the need for long transports and thus making them a more suitable and
sustainable alternative to meat than soy.
The mean protein content in Pisum sativum is generally 230 gram
protein/kg, but this is strongly influenced by genetic and environmental
factors (Olle et al., 2015; Barac et al., 2015). This means that cultivated
varieties of Pisum sativum can exhibit very different protein contents
from year to year, making it more difficult to predict the protein content
of the finished product (Krajewski et al., 2012). Research focused on
identifying genes which determine protein content is thus needed
(Krajewski et al., 2012). The gene 2-oxyglutarate/malate translocator
(OMT) is strongly expressed during Pisum sativum’s embryonal
development and it plays an important role during seed storage
(Riebeseel et al., 2010). OMT-knockouts have delayed expressions of
6
storage proteins and mature OMT-knockout seeds have lower protein
contents compared to mature seeds with OMT, suggesting that OMT
regulates seed maturation, seed weight and the conversion of
carbohydrates to protein and amino acids (Riebeseel et al., 2010). The
OMT gene thus seems to have important protein content properties.
Agriculture itself accounts for 2,5 times more emissions than
global transport does (Smetana et al., 2015), so to reach the goal of the
Paris agreement (to not increase the global temperature by more than 1,5
degrees Celsius and a maximum of 2 degrees Celsius above the pre-
industrialised temperature), all measures to decrease global greenhouse
gas emissions must be taken. In the light of this an increased
understanding of how OMT influences the nutritional content in peas
could be beneficial, so that new varieties of pea that are adapted to the
Nordic climate (thus reducing the need for long transports from South
America to Europe) can be developed. This study intends to determine if
variation in the OMT gene correlates with protein content and to
determine if the OMT gene affects protein content, compare the OMT
gene between different accessions of pea that are in different
improvement stages.
3 Material and methods
DNA and nutritional data regarding protein content, and data
regarding seed weight, was available from thirty-one pure line accessions
of pea plants that had been grown in a common garden. An accession is a
specific plant material collected from a particular area. All accessions
were natively from different locations around Europe and in different
improvement stages – namely wild, cultivar, European landrace and
Swedish landrace (Appendix 1). An improvement stage refers to how
much the plant has been improved, where for example the improvement
stage “wild” has not been improved at all. The seeds grown and used for
DNA extraction and sequencing came from the gene banks Nordgen and
John Innes center. The accession NGB-103517 was grown and used as a
test sample to optimize the PCR protocol used for the remaining plant
material.
3.1 Preparation of test sample and DNA extraction
NGB-103517 seeds were planted and grown for two weeks. When
the leaves were about 1x1 cm large, two leaves were dried with silica gel
in Eppendorf-tubes to prepare them for DNA extraction. The DNA was
extracted with the Qiagens DNeasy plant miniprep kit. Already extracted
7
DNA was available from the remaining accessions. Partial sequence data
for 25 of the accessions was likewise available.
3.2 PCR
PCR was run using a Bio-Rad S1000 Thermal cycler. The primers
used in the PCR-reactions were omt-2 Forward
(AATCTGGTTTCTTCCCACTCC) and omt-2 Reverse
(CCCAAGTCCAAGCCAGATTAT). For the PCR reactions, the primer
concentration was 0.3 mM and the dNTP concentration was 10 mM.
Long-range Taq-polymerase (5 U/µl) from Fermenta was used with its
accompanying 10X long-PCR buffer with MgCl2. The PCR protocol used
was 94 degrees Celsius for 2.30 minutes, 94 degrees Celsius for 15
seconds, 58 degrees Celsius for 40 seconds, 72 degrees Celsius for 3
minutes, then 94 degrees Celsius for 15 seconds to 72 degrees Celsius for
3 minutes was repeated for 34 cycles, and lastly 72 degrees for 10
minutes.
3.3 Sequencing and processing of sequences
PCR-products from successful PCR-reactions were purified from
unincorporated primers and nucleotides by adding exonuclease (20 U µl),
Fast AP (1 U/ µl) and ddH2O to each PCR-reaction. This mixture was
then run for 30 minutes in 37 degrees Celsius in the PCR-machine,
followed by 5 minutes in 95 degrees. The sequencing primers used were
omt-2 Forward (sequence AATCTGGTTTCTTCCCACTCC), omt-2
Reverse (sequence CCCAAGTCCAAGCCAGATTAT), omtF-inter
(CCCTCCTACCATGAAATCTAGTC) omtR-inter
(GGGTGCATCAGGACTAGATTTC), omtseqF2
(TTTACCAGGTGGGACTTTGG) and omtseqR2
(CATGTGTCCAGTGGTTGATTTG).
The software Geneious, version 11.1.4 from Biomatters Ltd. was used for
visual examination of the resulting sequences.
3.4 Statistical analysis
The mean values and standard deviations of protein content and seed
weight for all accessions were calculated, using Excel version 1803, for
the different pea accessions in various improvement stages, and a one-
way ANOVA was performed using SPSS statistics version 24 to
determine if there was any difference in protein content between the
different improvement stages. An independent samples t-test was
performed using SPSS Statistics in order to determine whether the protein
content differed between groups of accessions. In order to find out if
8
there has been selection on the gene, a Tajima’s D test was performed
using the software DnaSP on all landrace accessions.
4 Results
The minimum seed weight of all accessions was 2.91 g, the
maximum was 12.62 g, and the mean seed weight of all thirty-one
accessions was 8.51 g. No significant difference regarding seed weight
between the different breeding types was found (ANOVA, F (3) = 1.466; P
= 0.246). The minimum protein content of all accessions was 191 g/kg
dry substance, the maximum was 338 g/kg dry substance and the mean
was 264 g/kg dry substance (Figure 1). There was no significant
difference in the mean protein content between the four breeding types
(ANOVA, F (3) = 1.161; P = 0.343).
Figure 1. Protein content in g/kg dry substance and standard deviations for each accession. All accessions are organised after breeding type. From left to right: European landrace (EL), Swedish landrace (SL), Cultivar (C) and Wild (W)
Sequencing generated twelve partial sequences: JIC1031,
NGB13138, NGB13469, NGB17871, NGB20117, NGB101997,
NGB103517, NGB103567, NGB13487, NGB10660, NGB102123 and
NGB14639. For unknown reasons, sequencing of the remaining
accessions failed. Appendix 2 shows all the sequenced accessions. Visual
examination of an alignment of all twelve accessions showed that
NGB10660, NGB102123 and NGB14639 shared a number of indels in
the same region. No other variation that separated groups of accessions
from each other was found, so, based on the indels, accessions were
-
50
100
150
200
250
300
350
400
450
JIC
10
31
(EL
) J
IC1
52
5 (
EL)
JIC
17
78
(EL
) N
GB
10
28
14
(EL
) N
GB
17
87
1 (
EL)
NG
B1
78
83
(EL
) N
GB
17
88
4 (
EL)
NG
B2
01
17
(EL
) N
GB
20
12
3 (
EL)
NG
B1
01
81
9…
NG
B1
03
51
7 (
SL)
NG
B1
03
51
8 (
SL)
NG
B1
03
59
0 (
SL)
NG
B1
34
69
(SL
) N
GB
13
48
7 (
SL)
NG
B1
41
53
(SL
) N
GB
14
15
4 (
SL)
NG
B1
41
55
(SL
) N
GB
14
63
9 (
SL)
NG
B1
46
42
(SL
) N
GB
17
86
8 (
SL)
NG
B1
78
73
(SL
) N
GB
17
88
1 (
SL)
NG
B1
01
99
7 (
C)
NG
B1
03
07
1 (
C)
NG
B1
06
60
(C
) N
GB
13
13
8 (
C)
NG
B4
01
8 (
C)
NG
B1
02
02
7 (
W)
NG
B1
02
12
3 (
W)
NG
B1
03
56
7 (
W)
Pro
tein
co
nte
nt
(g/k
g d
ry s
ub
stan
ce)
Accessions
9
grouped into two haplotypes. The mean value of the haplotype with
indels was 249 g/kg dry substance, and the mean for the haplotype
without indels was 259 g/kg dry substance. There was no significant
difference in protein content between the two haplotypes (t-test, F (10) =
0.595; p = 0.458). Sequences from the entire OMT gene was obtained
from 7 accessions: JIC1778, NGB10660, NGB13487, NGB14639,
NGB20117, NGB103517 and NGB103567. The minimum protein
content in this group of 7 accessions was 267 g/kg dry substance, the
maximum was 338 g/kg dry substance and the mean was 292 g/kg dry
substance. Visual examination of an alignment of these 7 sequences
showed that the accession NGB14639 was genetically deviant from the
other accessions. NGB14639 exhibited the lowest protein content in that
group, suggesting a relationship between the OMT gene and a lower
protein content.
All of the partial sequences from the accessions with breeding
types European landrace and Swedish landrace, namely NGB103517,
NGB13469, NGB13487, NGB14639, JIC1031, NGB17871 and
NGB20117, were grouped together and a Tajima’s D value was
calculated (D = -1,531; p > 0.05). The non-significant p-value shows that
no selection could be detected for the sequenced parts of the OMT gene
for these accessions. No selection was found on the gene in the fully-
sequenced landraces NGB103517, NGB13487, NGB14639, NGB20117
and JIC1778 either (D = -1.227; p > 0.05).
5 Discussion
In Sweden, Pisum sativum has been improved since the late 19th
century, but focus was not on protein content but on perfecting properties,
such as taste and how it boiled, that would make a good pea soup
(Lyhagen, 2016). During the second World War, cultivation and
improvement of peas increased, since peas were an important native
protein source (Sjödin, 1997). Again, though, focus was not on protein
content but rather on how to increase homogeneity in all pea cultivars and
on properties that allow for a good soup (Sjödin, 1997). Thus, in Sweden,
protein content has not been a primary goal during the improvement of
Pisum sativum, and the results of this study supports just that.
Based on the results from the material used in this study, no selection
on protein content during the improvement stages of Pisum sativum could
be detected. This is indicated by the lack of a significant difference when
comparing the protein content between the four different breeding types.
10
If protein content had been selected for, one would have expected that the
cultivated accessions would have had a significantly higher (or lower)
protein content than for example the wild accessions.
In general, negative Tajima’s D values might depend on selection or
population growth, and in Pisum sativum, population growth is expected
since the plant spread from the Mediterranean to the rest of Europe (Olle
et al., 2015). However, the results from this study cannot detect this, and
no selection on the OMT gene can be detected either, since the p-values
were non-significant. These results agree with the fact that there doesn’t
seem to have been any selection on protein content between the different
breeding types.
Strong evidence presented by Riebeesel et al. (2010) indicate that the
OMT gene is involved in several biochemical pathways related to protein
synthesis. In spite of this, the two haplotypes from the 12 partially
sequenced accessions did not differ in protein content, meaning that the
OMT gene probably has limited effect on protein content in these 12
accessions. During examination of the entire OMT gene, as was possible
for 7 fully-sequenced accessions, it was found that NGB14639 deviates
the most genetically from the remaining 6 accessions. The protein content
in NGB14639 is lower than in the other fully-sequenced accessions, and
one explanation could be that the genetic deviance shown in the OMT
gene of NGB14639 is responsible. The small sample size would however
have made a statistical test unreliable, so a larger sample size for a fully-
sequenced OMT gene is needed to determine if the variance shown in
NGB14639 actually does correlate with a low protein content.
Results from Riebeesel et al. (2010) suggests that the OMT gene
regulates the conversion of carbohydrates to protein and amino acids,
thus indicating that the OMT gene might in part play a role regarding
protein content in pea. In the future, it would be interesting to see if
similar results as these would be attained with all accessions fully
sequenced. Also, if evidence shows that an allele in the OMT gene does
affect the protein content in P. sativum, does the allele affect it in a
negative (i.e. provides a lower protein content) or in a positive (i.e.
provides a higher protein content) way?
This study did not find a connection between genetic variation in the
OMT gene and protein content, but this does not mean that the accessions
used do not have other genes that can have important agricultural
properties. Also, the accessions used in this study generally had a high
protein content, with the mean protein content in all accessions being 264
g/kg dry substance, which can be compared to the general mean protein
11
content in Pisum sativum, which is 230 g/kg dry substance (Olle et al.,
2015). This implies that, despite the fact that the OMT gene does not
seem to provide this raised protein content, the material used in this study
is appropriate for further improvement.
As previously mentioned, a more consistent nutritional content is
needed in the pea. If the results of this study are correct, that the OMT
gene does not affect protein content, even when data from all accessions
is available, one way to move forward could be the localisation of
quantitative trait loci (QTLs). QTL can be localised to specific regions of
the genome, meaning that their effects can be estimated individually
(Tar’an et al.,2004). Molecular markers may also allow for early
selection of breeding lines, quickening the development rate of pea
cultivars with desirable traits (Tar’an et al.,2004). By mapping and
refining QTLs, genetic areas that affect nutritional content might be
found, which might help with identifying more nutritional genes. More
focus on QTL localisation might thus be valuable in the search for genes
that provide important agricultural properties, such as a raised protein
content, in Pisum sativum.
Identifying so called “nutrition genes”, as attempted in this study, is
important, but given the sensitivity to environmental conditions found in
the already identified genes (Tar’an et al.,2004), it is possible that
nutrition genes found in the future will share the same environmental
sensitivity. Since our climate is changing and becoming less predictable,
mainly due to global warming, more focus is needed not only on finding
nutrition genes but also on refining them, so that pea cultivars that are
consistent despite unpredictable weather can be engineered.
5.1 Social and ethical aspects
Evidence that a plant-based diet is more beneficial to human health
than a meat-based diet is piling up. According to Satija et al. (2016), a
plant-based diet reduces the risk of type 2 diabetes and coronary heart
disease. A plant-based diet is also associated with a healthier weight and
lower cholesterol- and blood sugar levels compared to a meat-based diet,
as well as a reduced risk of premature death from cancer (Dinu et al.,
2017; Tillman and Clark, 2014). If the human consumption of meat
products is not reduced, this will eventually have serious negative
impacts on human health.
Meat production has another backside. The animals, seen as
products rather than sentient beings, suffer tremendously in the growing
12
industrialisation of meat production (Pluhar, 2010). To support the global
demand for meat today, many animals are kept in factory farms where
they are stressed and unable to carry out natural behaviours (Pluhar,
2010).
This study, and studies like it, could aid in the development of new
and improved varieties of meat substitutes. In a way, this can be
considered as the development of a genetically modified organism –
something many people take issue with. However, studies like this one
are important, because reducing the human climate footprint is a must if
the goals of the Paris agreement are to be met (which is needed to reduce
global warming). Since finding nutritional genes in plants can lead to the
development of more nutritional plants, and these improved plants (with
for example a raised protein content) can possibly outcompete certain
animal products, this will hopefully lead to the reduction of greenhouse
gases in our atmosphere and thus reduce global warming.
To sum up: Studies like this one can eventually help improve
human health, reduce suffering for many animals and reduce global
warming – simply by aiding in the development of a better source of
plant protein.
5.2 Conclusion
This study did not suggest that there has been any selection for
protein content or seed weight between the four breeding types European
landrace, Swedish landrace, wild and cultivar. In addition, no correlation
between variation in the OMT gene and protein content was found, and
no significant selection on the OMT gene was detected. Since genes
might have the same effect in all material, this study shows how
important it is to study properties, such as nutritional content, in different
materials with various genetic backgrounds and in many different genes.
This will increase the understanding of the functional properties of
nutrition genes and thus aid in the development of alternative protein
sources to animal protein.
6 Acknowledgements
I am grateful to Erika Andersson, who is carrying out a very similar
project but with a different gene, for her guidance and for many hours of
useful discussions. I am also thankful to Maria Lundqvist for giving me
13
inspirational talks when needed and for guiding me when examining
DNA-sequences. I am especially grateful to my tutor, Jenny Hagenblad,
who has spent many hours answering emails, finding reagents/templates,
analyzing results from the gel electrophoresis and for giving excellent
encouragement and motivation when the PCR-reactions did not go my
way. I am also thankful to my examinator, Urban Friberg, and to my
classmates who have reviewed this article.
7 References
Barac, M.B., Pesic, M., Stanojevic, S.P., Kostic, A.Z., Cabrilo, S.B.
(2015). Techno-functional properties of pea (Pisum sativum) protein
isolates – a review. APTEFF. 46: 1-18
Dinu, M., Abbate, R., Gensini, G.F., Casini, A., Sofi, F. (2016)
Vegetarian, vegan diets and multiple health outcomes: a systematic
review with meta-analysis of observational studies. Critical Review Food
Science Nutrition. 57: 3640-3649
Krajewski, P., Bocianowski, J., Gawlowska, M., Kaczmarek, Z.,
Pniewski, T., Święcicki, W., Wolko, B. (2012). QTL for yield
components and protein content: a multienvironment study of two pea
(Pisum sativum L.) populations. Euphytica. 183: 323-336
Lyhagen, R. (2016). Plant breeding and variety development at the Svalöf
and Weibull companies during 130 years (part 3). Journal of the Swedish
Seed Association. 6-36
Ma, Y., Coyne, C.J., Grusak, M.A., Mazourek, M., Cheng, P., Main, D.
and McGee, R.J. (2017). Genome-wide SNP identification, linkage map
construction and QTL mapping for seed mineral concentrations and
contents in pea (Pisum sativum L.). BMC Plant Biology. 17: DOI
10.1186/s12870-016-0956-4
Nemecek, T., von Richthofen, J.S., Dubois, G., Casta, P., Charles, R.,
Pahl, H. (2008). Environmental impacts of introducing grain legumes into
European crop rotations. European Journal of Agronomy. 28: 380-393
Olle, M., Narits, L. and Williams, I.H. (2015). The influence of variety on
the yeild and content of protein and nutrients of peas (PISUM
SATIVUM). Research for rural development. 1: 45-50.
14
Pluhar, E.B. (2010). Meat and Morality: Alternatives to Factory Farming.
Journal of Agricultural and Environmental Ethics. 23: 455-468
Riebeseel, E., Häusler, R.E. Radchuk, R., Meitzel, T., Hajirezaei, M.,
Emery, R.J.N., Kuster, H., Nunes-Nesi, A., Fernie, A.R., Weschke, W.,
Weber, H. (2010) The 2-oxoglutarate/malate translocator mediates amino
acid and storage protein biosynthesis in pea embryos. The Plant Journal.
61: 350-363.
Satija, Ambika (2016) Plant-Based Diets and Risk of Type 2 Diabetes
and Coronary Heart Disease. Doctoral dissertation, Harvard T.H. Chan
School of Public Health
Steinfeld, H., Gerber, P., Wassenaar, T., Castel, V., Rosales, M., de Haan,
C. (2006) Livestock’s Long Shadow – Environmental issues and options.
FAO – Food and Agriculture Organization of the United Nations, Rome.
ISBN: 978-92-5-105571-7.
Sjödin, J. (1997) Trindsäd. In: Olsson G (ed) Den svenska
växtförädlingens historia. Kungliga Skogs- och Lantbruksakademien,
Stockholm. 215–222 (in Swedish)
Tar’an, B., Warkentin, T., Somers, D.J., Miranda, D., Vandenberg, A.,
Blade, S. and Bing, D. (2004) Identification of quantitative trait loci for
grain yield, seed protein concentration and maturity in field pea (Pisum
sativum L.). Euphytica. 163: 297-306
Tillman, D. and Clark, M. (2014) Global diets link environmental
sustainability and human health. Nature. 515: 518-522
Vollman, J., Fritz, C.N., Wagentristl, H., Ruckenbauer, P. (2000).
Environmental and genetic variation of soybean seed protein content
under Central European growing conditions. Journal of the Science of
Food and Agriculture. 80: 1300-1306. https://doi-
org.e.bibl.liu.se/10.1002/1097-0010(200007)80:9%3C1300::AID-
JSFA640%3E3.0.CO;2-I
15
8 Appendix
Appendix 1. All accessions used in this study, their native countries and their breeding types, seed weight and protein content. Accessions were available from the gene banks Nordgen and John Innes center.
Accession Native country Breeding type Seed weight (g) Protein content g/kg DS
JIC1031 Germany European landrace 9,3 235,3
JIC1525 Greece European landrace 6,9 294,8
JIC1778 France European landrace 10,8 291,8
NGB102814 Poland European landrace 9,7 307,8
NGB17871 Latvia European landrace 4,2 191,3
NGB17883 Latvia European landrace 9,6 246,2
NGB17884 Latvia European landrace 5,2 232,3
NGB20117 Denmark European landrace 5,1 268,7
NGB20123 Denmark European landrace 9,0 200,0
NGB101819 Sweden Swedish landrace 8,0 214,4
NGB103517 Sweden Swedish landrace 9,2 273,0
NGB103518 Sweden Swedish landrace 8,7 224,0
NGB103590 Sweden Swedish landrace 2,9 277,2
NGB13469 Sweden Swedish landrace 8,2 260,0
NGB13487 Sweden Swedish landrace 11,3 299,0
NGB14153 Sweden Swedish landrace 9,9 276,8
NGB14154 Sweden Swedish landrace 10,6 300,5
NGB14155 Sweden Swedish landrace 11,8 298,3
NGB14639 Sweden Swedish landrace 10,8 266,8
NGB14642 Sweden Swedish landrace 8,1 268,2
NGB17868 Sweden Swedish landrace 6,7 253,0
NGB17873 Sweden Swedish landrace 12,6 272,2
NGB17881 Sweden Swedish landrace 12,4 298,4
NGB101997 Sweden Cultivar 9,9 253,6
NGB103071 Germany Cultivar 12,5 227,2
NGB10660 Sweden Cultivar 4,0 307,3
NGB13138 Sweden Cultivar 6,9 212,0
NGB4018 Sweden Cultivar 10,4 247,6
NGB102027 Turkey Wild 8,5 287,0
NGB102123 Israel Wild 5,9 261,7
NGB103567 Bulgaria Wild 4,6 338,3
16
Appendix 2. All partially- and fully-sequenced accessions.
Partially sequenced accessions Fully-sequenced accessions
JIC1031 NGB103567
NGB13138 NGB10660
NGB13469 NGB14639
NGB17871 NGB13487
NGB20117 NGB103517
NGB101997 NGB20117
NGB103517 JIC1778
NGB103567 NGB13487 NGB10660 NGB102123 NGB14639