Download pdf - Comparison of different RT-qPCR assays for the detection of human and bovine group A rotaviruses and characterization by sequences analysis of genes encoding VP4 and VP7 capsid proteins

ORIGINAL ARTICLE

Comparison of different RT-qPCR assays for the detectionof human and bovine group A rotaviruses andcharacterization by sequences analysis of genes encodingVP4 and VP7 capsid proteinsP. Ward1, E. Poitras1, D. Leblanc1, C.A. Gagnon2, J. Brassard1 and A. Houde1

1 Agriculture and Agri-Food Canada, Food Research and Development Centre, Saint-Hyacinthe, QC, Canada

2 Groupe de recherche sur les maladies infectieuses du porc, Facult�e de m�edecine v�et�erinaire, Universit�e de Montr�eal, Saint-Hyacinthe, QC,

Canada

Keywords

capsid protein sequences, detection, group A

rotaviruses, phylogenetic analysis, RT-qPCR

assays.

Correspondence

Pierre Ward, Agriculture and Agri-Food

Canada, Food Research and Development

Centre, 3600 Casavant blvd West,

Saint-Hyacinthe, QC J2S 8E3, Canada.

E-mail: [email protected]

2013/1876: received 18 October 2012,

revised 11 January 2013 and accepted 23

January 2013

doi:10.1111/jam.12165

Abstract

Aims: The aim of this study was to compare the performance of four RT-qPCR

assays for the detection of human and bovine group A rotaviruses and to

characterize the positive samples by sequence analysis of VP4 and VP7 genes.

Methods and Results: RNA extracted from eight human rotavirus strains, and

a panel of 33 human and 25 bovine faecal samples was subjected to different

RT-qPCR detection systems. Among these assays, only RT-qPCR primers and

probe systems B and C were able to detect all human rotavirus strains from

cell culture solutions and faecal samples. However, the results showed that the

system C was generally more sensitive by one or two logs than the other

RT-qPCR assays tested. With the bovine faecal samples, the most efficient

RT-qPCR systems were B and A with the detection in 100 and 92% of samples

tested, respectively. Human group A rotavirus G1P[8] and bovine G6P[11]

were the most frequently used strains identified in this study. A G3P[9] strain,

closely related to a feline rotavirus isolated in the USA, was also discovered in

a human rotavirus infection.

Conclusion: The RT-qPCR system B was the only TaqMan assay evaluated in

this study able to detect rotavirus RNA in all positive human and bovine faecal

samples.

Significance and Impact of the Study: Utilization of only one RT-qPCR for

the detection of human and bovine group A rotaviruses and the possibility of

human infection by a feline rotavirus strain.

Introduction

Rotaviruses were first identified in 1973 as an important

cause of gastroenteritis in children (Bishop et al. 1973).

As is often the case with gastrointestinal diseases, rotavi-

ruses are transmitted through the faecal–oral route. Rota-viruses are the most common agents of diarrhoeal illness

in infants and young children worldwide, and in 2008,

diarrhoea attributable to rotavirus infection resulted in

453 000 deaths worldwide in children younger than five

years. More than half of all fatal rotavirus infections

occurred in five countries: Democratic Republic of the

Congo, Ethiopia, India, Nigeria and Pakistan (Tate et al.

2012). Rotaviruses are also an important cause of neona-

tal bovine diarrhoea (Maes et al. 2003; Swiatek et al.

2010) and are responsible for significant economic losses

(Alfieri et al. 2004).

Rotaviruses are nonenveloped icosahedral viruses

whose genome consists of 11 double-stranded RNA seg-

ments encoding six structural proteins (VP1, VP2, VP3,

VP4, VP6, VP7) and six nonstructural proteins (NSP1-

NSP6). The genome is enclosed in a triple-layered cap-

sid of 70 nm in diameter. The outer layer is composed

of VP4 and VP7 proteins; VP6 protein forms the inner

layer; and VP1, VP2 and VP3 proteins form the core

capsid layer (Min et al. 2006; Matthijnssens et al. 2008;

© Her Majesty the Queen in Right of Canada [2013]. 114, 1435--1448

Reproduced with the permission of the Minister of Agriculture and Agri-food Canada. 1435

Journal of Applied Microbiology ISSN 1364-5072

Kottaridi et al. 2012). Viruses of the genus Rotavirus

belong to the family Reoviridae and are classified into

five defined species (A to E) and two tentative species

(F and G), which are recognized by the International

Committee on Taxonomy of Viruses (ICTV) (Raming

et al. 2005). A potential new rotavirus species,

ADRV-N, has been recently described and was tenta-

tively assigned to species H (Matthijnssens et al. 2012).

The rotavirus species are also commonly referred to as

rotavirus groups. Groups A, B and C have been

detected in human and animal samples, including swine

and bovine (Maes et al. 2003), but groups D, E, F and

G infect only animals (Rahman et al. 2005; Matthijns-

sens et al. 2012). Group A rotaviruses are the most

commonly isolated rotavirus strains. These strains can

be divided into three genogroups (Wa, DS-1 and

AU-1) and have been classified into 27 G types and 35

P types based on the sequence diversity of the genes

encoding the two outer capsid proteins, VP4 and VP7,

respectively (Matthijnssens et al. 2011). In human

group A rotavirus, G1P[8], G2P[4] and G4P[8] are

generally the most prevalent genotypes (Gentsch et al.

2005; van der Heide et al. 2005; Ahmed et al. 2006).

Among bovine rotavirus strains, the most prevalent

genotypes worldwide are G10P[11], G10P[5] and G10P

[1] (Steyer et al. 2010). Group C rotavirus has been

associated with sporadic diarrhoeal illness in different

parts of the world and could be an emerging pathogen

in humans (Abid et al. 2007).

Group A rotavirus is widespread in wild and domestic

animal species, and it has been suggested that zoonotic

transmission plays a substantial role in the introduction of

novel strains into the human population (Banyai et al.

2009). Evidence for zoonotic transmission of bovine rota-

virus strains to humans and genetic reassortment between

human and animal rotaviruses has been described in the

literature (Khamrin et al. 2006; Martella et al. 2010; Steyer

et al. 2010). Recently, a new complete genome classifica-

tion system was developed for group A rotavirus strains.

This nucleotide sequence-based system assigns a specific

genotype to each of the 11 genome segments and has

increased the recognition of homology between animal and

human rotavirus strains (Matthijnssens et al. 2011).

It is known that raw food, treated water, untreated

water and irrigation water can represent possible sources

of contamination by rotaviruses. These viruses are very

stable in the environment, can be spread by faecal mate-

rial from sick people or animals and may remain infec-

tious for many weeks (Brassard et al. 2005; Leung et al.

2005). Just a few viral particles appear to be sufficient to

trigger infection in humans. To put this into perspective,

there can be as many as 108 to 1011 particles ml�1 of

stool in infected patients (Koopmans and Duizer 2004).

Transmission electron microscopy (TEM) and antigen

detection kits, such as enzyme immunoassay and latex

agglutination, are the most frequently used methods for

the detection of rotavirus. However, these methods are

generally less sensitive than molecular techniques such as

RT-PCR or RT-qPCR. Approximately 106 viral particles

ml�1 of sample are required for detection by TEM

(Logan et al. 2006; Jothikumar et al. 2009). In the past

ten years, many RT-qPCR tests using SYBR Green or

hydrolysis probes targeting the NSP3, VP2, VP4, VP6 or

VP7 genes have been developed for the detection of rota-

virus RNA (Schwarz et al. 2002; Kang et al. 2004; Pang

et al. 2004, 2011; Logan et al. 2006; Min et al. 2006; Free-

man et al. 2008; Guti�errez-Aguirre et al. 2008; Zeng et al.

2008; Jothikumar et al. 2009; Plante et al. 2011; Kottaridi

et al. 2012). The sensitivity of these detection assays can

be affected by the quality of the extracted RNA, by RNase

contamination and by RT-PCR inhibitors in environmen-

tal and clinical samples, especially in faecal material

(Escobar-Herrera et al. 2006; Rutjes et al. 2007; Scipioni

et al. 2008), as well as by the genomic variability of rota-

virus strains in the target regions used in the detection

tests. Failure to amplify the viral RNA owing to these fac-

tors may result in false-negative results. The use of a

sample process control artificially added to the samples

prior to concentration of the viral particles and RNA

extraction can be extremely useful for monitoring the

quality of the extraction procedure and for identifying

the potential presence of RT-PCR inhibitors that interfere

with the amplification reactions (Jones et al. 2009; Matti-

son et al. 2009; Ward et al. 2009). In Canada, Health

Canada’s Technical Group on Virology has recommended

the use of feline calicivirus (FCV) as a sample process

control for detection methods (Houde et al. 2009).

Due to the low infectious dose, the zoonotic issues and

the possibility of recovering rotavirus not only from clini-

cal samples but also from environmental and food sam-

ples, it is important to have a sensitive detection method

that can detect both human and animal strains. The aim

of this study was to compare the performance of four

previously published RT-qPCR assays, targeting the VP6,

VP7 or NSP3 gene, for the detection of human and

bovine group A rotavirus strains and to characterize the

positive samples by sequence analysis of genes encoding

VP4 and VP7 outer capsid proteins.

Materials and methods

Strains and faecal samples collected between 2005 and

2009

Eight human rotavirus strains from the American Type

Culture Collection (ATCC) were used in this study [WA


1436 Reproduced with the permission of the Minister of Agriculture and Agri-food Canada.

Detection and characterization of RV P. Ward et al.

(ATCC VR-2018)/G1, 1-9-12/77/S (ATCC VR-1546)/G2,

89-12C2 (ATCC VR-2272)/G3, 408 (ATCC VR-2273)/G1,

248 (ATCC VR-2274)/G4, WISC2 (ATCC VR-2417)/G1,

DS-1 (ATCC VR-2550)/G2, WI61 (ATCC VR-2551)/G9].

Viral strains were propagated to produce stock suspen-

sions, as recommended by ATCC. A panel of 65 faecal

specimens from Facult�e de m�edecine v�et�erinaire, Univer-

sit�e de Montr�eal, Saint-Hyacinthe (Canada), Chinook

Regional Hospital, Lethbridge (Canada) and the Hospital

for Sick Children, Toronto (Canada) was also used. This

panel included 13 rotavirus-positive faecal samples col-

lected from children, 10 human faecal samples from

patients of different age groups with fulminant gastroen-

teritis and negative for rotavirus, 10 human faecal samples

from healthy individuals and negative for rotavirus, 13

bovine faecal samples positive for rotavirus and 12 bovine

faecal samples negative for rotavirus. Positive samples

have been confirmed by transmission electron microscopy

or by RT-PCR. In addition, the assays were tested for any

cross-reactivity that may have occurred using a wide range

of viral and bacterial pathogens present in the stool. These

viral pathogens included strains of norovirus GI and GII,

swine hepatitis E virus, hepatitis A virus and adenovirus

40/41. Bacterial DNA from Escherichia coli O157:H7,

Campylobacter jejuni LSPQ 3234, Salmonella thyphimur-

ium ATCC 14028, Staphylococcus aureus ATCC 25923 and

Listeria monocytogenes ATCC 7644 were kindly provided

by Evelyne Gu�evremont (Agriculture and Agri-Food

Canada, Food Research and Development Center, Saint-

Hyacinthe, Canada).

Viral RNA extraction

Faecal samples were diluted 1 : 5 (w/v) in sterile PBS, pH

7�2 (Life Technologies Inc., Burlington, ON, CA) before

centrifugation for 20 min at 4000 g. The clarified stool

suspensions or the stock solutions of each rotavirus strain

were adjusted to reach 1% sodium dodecyl sulfate

(Sigma-Aldrich, Oakville ON, Canada) and 100 lg ml�1

of Proteinase K (QIAGEN, Mississauga, ON, Canada).

Mixtures were incubated at 37°C for 1 h. To monitor the

RNA extraction process, 3�2 9 103 PFU of feline calicivi-

rus (FCV) were added to 140 ll of the resulting suspen-

sions as sample process control (Ward et al. 2009). Viral

RNA was extracted with QIAamp� Viral RNA mini

(QIAGEN) protocols adapted for the QIAcube robotic

workstation (QIAGEN) using QIAamp� Viral RNA body

fluid: manual lysis protocol. To protect the extracted

RNA from exogenous RNases, RNase inhibitor (RNase-

Out, Life Technologies Inc.) was added to the final QIA-

GEN AVE elution buffer. Recovered RNA was frozen at

�80°C until further use.

Primers and probes

All primers (IDT, Coralville, IA, USA) and hydrolysis

probes (IDT and Life Technologies Inc. for MGB probes)

used in this study are listed in Table 1.

Conventional RT-PCR

The full-length VP7 segment from human and bovine

samples was amplified with Beg-9 and End-9 primers,

according to the parameters described by Gouvea et al.

(1990). The partial VP4 segment from human samples

was amplified with Con 2 and Con 3 primers with

cycling conditions described by Gentsch et al. (1992).

Primers used for bovine samples were Bov4Com 5 and

Bov4Com 3 with conditions described by Isegawa et al.

(1993). RT-PCR was performed using a QIAGEN� One-

Step RT-PCR Kit (QIAGEN), and the amplified products

were separated on a 1% agarose gel with amplicons

visualized with ethidium bromide staining.

Construction of plasmid DNA standards for RT-qPCR

reactions

Conventional RT-PCR were carried out in a total volume of

20 ll using the QIAGEN�OneStep RT-PCR kit (QIAGEN),

according to the manufacturer’s recommendations in an

Eppendorf Mastercycler gradient system (Brinkman Instru-

ments Canada Ltd., Mississauga, ON, Canada). Amplifica-

tions were performed using group A rotavirus strain WA

(ATCC VR-2018), and the different primer sets described in

Table 1. RT-PCR fragments of 145, 87, 131 and 194 bp cor-

responding to TaqMan amplification primer system A

(Logan et al. 2006), B (Zeng et al. 2008), C (Jothikumar

et al. 2009) and D (Plante et al. 2011), respectively, were

excised from the gel and purified using the QIAquick� Gel

Extraction kit (QIAGEN). PCR products were cloned into

pCR� 2�1 TOPO� vector using TOPO TA Cloning� kit

(Life Technologies Inc.) with One Shot� TOP10 electro-

competent cells in accordance with the manufacturer’s

recommendations. The recombinant plasmid stocks

were quantified using the NanoDrop spectrophotometer

ND–1000 according to the manufacturer’s instructions

(NanoDrop Technologies Inc., Wilmington, DE, USA) and

converted into copy number. The copy number of plasmid

was calculated as: copy number = [(concentration of linear-

ized plasmid)/(molar mass)] 9 (6�023 9 1023). These

DNA plasmids were used for the generation of standard

curves and as positive controls.

RT-qPCR assays

The RT-qPCR assays were carried out in 25 ll of a reactionmixture comprising 2�5 ll of extracted RNA and 22�5 ll of



P. Ward et al. Detection and characterization of RV

Table

1Prim

ersan

dprobes

usedin

thisstudy

MolecularMethod

Prim

ersorprobe

Sequen

ce5′–3′

Tm(°C)

Polarity

Location

Referen

ce

RT-qPC

R

FCVdetection

FCV3-Q

-AGACACCTC

CGACGAGTTATGC

57�6

+299–3

19

Mattisonet

al.(2009)

FCV3-Q

-1CCGGGTG

GGACTG

AGTG

G60�6

�383–3

66

FCV3-Q

Cy5

–CGCCTTACGGATA

TGAGCAGCCACATTAAC–IBRQ

62�2

�361–3

32

RT-qPC

R

RotavirusA

VP6

(system

A)

RotaA-F1

GGATG

TCCTG

TACTC

CTTGTC

AAAA

56�7

+26–5

0Logan

etal.(2006)

RotaA-F2

GGAGGTTCTG

TACTC

ATTGTC

AAAAA

55�3

+26–5

1

RotaA-R1

TCCAGTTTG

GAACTC

ATTTC

CA

54�4

�170–1

49

RotaA-R2

TCCAGTTTG

AAAGTC

ATTCCATT

53�2

�170–1

47

RotaA-P1

FAM

–ATA

ATG

TGCCTTCGACAAT–MGB/BNFQ

�93–7

5

RotaA-P2

FAM

–AATA

TAATG

TACCTTCAACAAT–MGB/BNFQ

�93–7

2

RT-qPC

R

RotavirusA

NSP3(system

B)

Forw

ard

ACCATC

TWCACRTR

ACCCTC

TATGAG

57�7

+963–9

88

Zenget

al.(2008)

Reverse

GGTC

ACATA

ACGCCCCTA

TAGC

57�3

�1049–1

028

Probe

VIC

–AGTTAAAAGCTA

ACACTG

TCAAA

–MGB/BNFQ

67�0

+995–1

017

RT-qPC

R

RotavirusA

NSP3(system

C)

JVKF

CAGTG

GTTGATG

CTC

AAGATG

GA

57�2

+17–3

9Jothikumar

etal.(2009)

JVKR

TCATTGTA

ATC

ATA

TTGAATA

CCCA

50�3

�147–1

23

JVKP

FAM

–ACAACTG

CAGCTTCAAAAGAAGWGT–BHQ

57�5

+96–7

2

RT-qPC

R

RotavirusA

VP7

(system

D)

Q-Rota-A

TGGATA

TCRATG

GGATC

ATC

ATG

53�3

+598–6

20

Plan

teet

al.(2011)

Q-Rota-1

TTTC

GAATA

GTA

CATG

TCGTAGTTG

52�8

�791–7

67

Rota-VP7

-QFA

M–AAATTAGCTA

TAGTG

GATG

TCGTTGATG

GG

–BHQ

58�3

+715–7

44

RT-PC

R

RotavirusVP7

(serotypeG)

Beg

9GGCTTTA

AAAGAGAGAATTTC

CGTC

TGG

57�8

+1–2

8Gouveaet

al.(1990)

End9

GGTC

ACATC

ATA

CAATTCTA

ATCTA

AG

51�7

�1062–1

036

RT-PC

R

RotavirusVP4

(serotypeP)

human

Con3

TGGCTTCGCCATTTTATA

GACA

54�5

+11–3

2Gen

tsch

etal.(1992)

Con2

ATTTC

GGACCATTTA

TATA

ACC

47�7

�887–8

68

RT-PC

R

RotavirusVP4

(serotypeP)

bovine

Bov4Com

5TTCATTATTGGGACGATTCACA

52�1

+1067–1

088

Iseg

awaet

al.(1993)

Bov4Com

3CAACCGCAGCTG

ATA

TATC

ATC

53�5

�1930–1

909




master mix. Master mix was prepared using the OneStep

Brilliant II QRT-PCR core reagent kit (Agilent Technologies

Canada, Mississauga, ON, Canada) and contained

5�0 mmol l�1 of MgCl2, 600 nmol l�1 of both forward and

reverse primers and 250 nmol l�1 of hydrolysis probe for

system A (Logan et al. 2006); or 400 nmol l�1 of both for-

ward and reverse primers and 200 nmol l�1 of hydrolysis

probe for system B (Zeng et al. 2008); or 250 nmol l�1 of

forward and reverse primers and 100 nmol l�1 of hydrolysis

probe for system C (Jothikumar et al. 2009); or

300 nmol l�1 of forward and reverse primers and

200 nmol l�1 of hydrolysis probe for system D (Plante et al.

2011). For the FCV assay, 5�0 mmol l�1 of MgCl2,

300 nmol l�1 of forward and reverse primers and

200 nmol l�1 of hydrolysis probe were included in the mas-

ter mix (Mattison et al. 2009). RT-PCR amplifications were

run in a Stratagene Mx3005P system (Agilent Technologies

Canada) in a 96-well format under the following conditions:

30 min at 50°C for reverse transcription, 95°C for 10 min

for initial denaturation then followed by 45 cycles of ampli-

fication with denaturation at 95°C for 15 s and annealing

and extension at 60°C for 1 min. A standard curve for each

system was generated using 10-fold serial dilution (108 to

100 genomic equivalents) in a 5 ng ml�1 salmon sperm

DNA solution of appropriate purified DNA plasmid.

Cloning and sequencing of RT-PCR product

RT-PCR amplicons for VP4 and VP7 segments were excised

from the gel and purified using the QIAquick Gel Extraction

kit (Qiagen). Purified PCR products were cloned into pCR

2�1 TOPO vector using TOPO TA Cloning kit (Life

Technologies Inc.) with TOP10 electrocompetent cells in

accordance with the manufacturer’s recommendations.

Sequencing was performed on recombinant plasmids in

both directions using a CEQTM 8000 Genetic Analysis System

(Beckman Coulter, Fullerton, CA, USA) and a CEQ Dye

Terminator Cycle sequencing kit (Beckman Coulter) with

M13 forward and reverse primers. Nucleotide alignment

was undertaken with the CLUSTAL W (http://www.ebi.ac.

uk/clustalw) program. The phylogenetic tree was created by

the neighbour-joining method using CLC sequence viewer 6

software (http://www.clcbio.com). Bootstrap analysis was

employed to determine the statistical confidence of the phy-

logenetic relationships. All sequences were deposited in

GenBank under accession numbers JX470485 – JX470523.

Results

Efficiency evaluation of different RT-qPCR assays

A standard curve was established for each RT-qPCR

system using the corresponding cloned amplicon, which

was serially diluted from 1 9 108 to 1 9 100 copies and

amplified in triplicate. The quantification cycle number

values (Cq) were plotted against genomic equivalent cop-

ies. The standard curves obtained showed an efficiency of

99�1%, a regression coefficient of 0�993, a slope of

�3�344 and an intercept of 39�01 for system A; an effi-

ciency of 98�3%, a regression coefficient of 0�999, a slope

of �3�363 and an intercept of 39�79 for system B; an effi-

ciency of 99�1%, a regression coefficient of 0�996, a slope

of �3�343 and an intercept of 39�32 for system C; and an

efficiency of 100�2%, a regression coefficient of 0�996, aslope of �3�318 and an intercept of 40�99 for system D

(data not shown). These standard curves indicated that

the four assays could detect 2�5 copies per reaction.

Detection of rotavirus RNA by conventional RT-PCR

and RT-qPCR assays

All extracted RNA samples were first individually tested

for FCV. The 3�2 9 103 PFU of FCV added to the clari-

fied stool suspensions as a sample process control before

RNA extraction were detected in all samples with a mean

Cq of 25�75. These results were correlated with the Cq of

26�16 obtained for the extraction control with FCV alone

(data not shown). These results showed the efficiency of

the sample genome extraction process and showed that

the RT-PCR reactions were not affected by inhibitors.

The different rotavirus molecular detection assays were

evaluated and compared in parallel using the same RNA

extracts. Each molecular assay included a negative control

(RNAse-free water) and a positive control (cloned ampli-

con). All RT-PCR products obtained on ethidium bro-

mide-stained agarose gel were of the correct size, and no

bands were visible in the negative controls (data not

shown). The detection results obtained with the four dif-

ferent RT-qPCR assays performed on human and animal

rotavirus strains are presented in Table 2. RT-qPCR sys-

tems B and C detected rotavirus RNA in 100% (21/21) of

the human rotavirus–positive samples, including eight

strains from the American Type Culture Collection

(ATCC) with G serotype, which are frequently detected

in clinical samples. Systems A and D detected rotavirus

RNA in 86% (18/21) and 81% (17/21) of the samples,

respectively. With the bovine rotavirus–positive samples,

system B was the best detection system, achieving 100%

detection (13/13) compared with 92% (12/13), 46% (6/

13) and 0% (0/13) for systems A, C and D, respectively.

All negative samples were found to be negative with the

different detection assays, except with system A, where a

positive amplification result was observed in 20% of

human rotavirus–negative samples. The positive fluores-

cence signal observed for these negative samples was in

the 35–39 Cq range, which corresponds to the single-




copy range for this detection system. These positive

signals may be due to a nonspecific reaction or probe dis-

ruption at the end of the amplification process in the

absence of target cDNA, because no amplification was

observed with the other rotavirus detection systems

tested. This phenomenon has also been reported in stud-

ies on norovirus and HAV RT-qPCR assays using hydro-

lysis probes (Loisy et al. 2005; Houde et al. 2007).

Furthermore, with the different detection systems, no

positive detection signals were observed for human noro-

virus GI (3 samples), norovirus GII (3 samples), swine

HEV (3 samples), adenovirus 40/41 (3 samples), HAV

HM-175, E. coli O157:H7, Salm. thyphimurium (ATCC

14628), Camp. jejuni LSPQ 3234, Staph. aureus (ATCC

25923) or L. monocytogenes (ATCC 7644) or for the neg-

ative controls. In this experiment, system B showed a

higher detection performance for human and bovine

rotavirus RNA than the other RT-qPCR assays tested.

Sensitivity of the different RT-qPCR systems evaluated

The analytical sensitivity of the different RT-qPCR assays

was evaluate using four human and four bovine samples

known to be positive for rotavirus. The RNA extractions

were serially diluted to 10�7 (Table 3). For each dilution,

the same RNA extract was tested in duplicate using the

four RT-qPCR assays. The limits of detection (LODs) for

the four human rotavirus samples were generally 10 to

100 times higher with system C than with the other sys-

tems, except in the case of strain HRV 89-12C2 and sam-

ple STHY-125, where detection system D showed

equivalent or greater sensitivity than system C. For the

bovine samples, the limits of detection were also 10 to

100 times higher with RT-qPCR system C than with sys-

tems A and B. However, the LODs were identical for sys-

tems A and C and strains FMV 1094847 and FCV

1081508.

Sequence analysis of partial VP4 and VP7 segments

The G genotypes were identified by comparison with the

VP7 sequences with the reference strains. Among the 27

different G types, the human isolates from faecal material

in this study were related to G1 (6 strains), G3 (3 strains)

and G4 (1 strain) types (Fig. 1). One strain sequence,

identified as a G3, showed similarity to two feline rotavi-

rus strains, ITA/BA222 (GenBank accession number

GU827411) and USA/Cat2 (GenBank accession number

EU708961), having 98 and 95% similarity. The VP7

sequences of six bovine samples were related to G6

strains, while another four were related to G10 strains.

To identify the P genotype, a partial VP4 segment of 887

Table 2 Detection of rotavirus RNA with four different RT-qPCR assays

RT-qPCR assays

Rotavirus System

A (Logan

et al. 2006)

Rotavirus

System B

(Zeng

et al. 2008)

Rotavirus

System C

(Jothikumar

et al. 2009)

Rotavirus

System D

(Plante

et al. 2011)

Human rotavirus strains from ATCC (%) 6/8 (75) 8/8 (100) 8/8 (100) 7/8 (88)

WA (ATCC VR-2018)/G1 + + + +

1-9-12/77/S (ATCC VR-1546)/G2 � + + �89-12C2 (ATCC VR-2272)/G3 + + + +

408 (ATCC VR-2273)/G1 + + + +

248 (ATCC VR-2274)/G4 + + + +

WISC2 (ATCC VR-2417)/G1 � + + +

DS-1 (ATCC VR-2550)/G2 + + + +

WI61 (ATCC VR-2551)/G9 + + + +

Children faecal samples positive

for rotavirus (%)

12/13 (92) 13/13 (100) 13/13 (100) 10/13 (77)

Total (%) 18/21 (86) 21/21 (100) 21/21 (100) 17/21 (81)

Human faecal samples from individuals

with fulminant gastroenteritis and

negative for rotavirus (%)

0/10 (0) 0/10 (0) 0/10 (0) 0/10 (0)

Human faecal samples from healthy

individuals and negative for rotavirus (%)

4/10 (40) 0/10 (0) 0/10 (0) 0/10 (0)

Total (%) 4/20 (20) 0/20 (0) 0/20 (0) 0/20 (0)

Bovine faecal samples positive for rotavirus(%) 12/13 (92) 13/13 (100) 6/13 (46) 0/13 (0)

Bovine faecal samples negative for rotavirus (%) 0/12 (0) 0/12 (0) 0/12 (0) 0/12 (0)




Table 3 Analytical sensitivity comparison of the four RT-qPCR in one human rotavirus collection strain, three human and four bovine faecal

samples contaminated with rotavirus

RNA Dilution

RT-qPCR assays

Rotavirus A

System A

Logan et al.

(2006) (Cq)

Rotavirus A

System B

Zeng et al. (2008) (Cq)

Rotavirus A

System C

Jothikumar et al.

(2009) (Cq)

Rotavirus A

System D

Plante et al.

(2011) (Cq)

Human rotavirus strain HRV 89-12C2 (ATCC VR-2272)

10�1 24�62 24�7 29�5 29�35 21�94 21�95 23�58 23�2910�2 27�61 28�18 33�42 32�98 25�32 25�43 26�67 26�6410�3 31�5 31�15 37�47 36�58 28�56 28�54 29�64 30�0110�4 34�7 35�02 No Cq No Cq 31�78 31�68 33�54 32�7810�5 No Cq No Cq No Cq No Cq 34�67 33�90 36�50 36�2310�6 No Cq No Cq No Cq No Cq No Cq No Cq 37�63 39�0310�7 No Cq No Cq No Cq No Cq No Cq No Cq No Cq No Cq

Human (children) faecal sample W44279 (HSC Toronto) STHY-125

10�1 25�27 24�9 30 30�25 22�18 22�26 24�54 24�4310�2 28�44 28�83 33�08 33�76 25�29 25�23 28�55 29�1310�3 32�26 31�47 36�83 41�52 28�76 28�43 31�91 31�9210�4 35�57 35�58 No Cq No Cq 31�56 31�82 35�94 35�6810�5 No Cq No Cq No Cq No Cq 37�28 34�97 37�63 39�3010�6 No Cq No Cq No Cq No Cq No Cq No Cq No Cq No Cq

10�7 No Cq No Cq No Cq No Cq No Cq No Cq No Cq No Cq

Human (children) faecal sample H71374 (HSC Toronto) STHY-126

10�1 23�98 25�56 29�07 28�83 21�03 20�98 25�24 25�6310�2 28�75 29�09 32�39 32�47 24�42 24�5 29�54 29�4510�3 33�12 32�84 34�95 35�29 28�09 28�02 32�39 33�0210�4 37�57 37�64 38�30 39�24 31�4 31�32 37�03 35�6610�5 No Cq No Cq No Cq No Cq 35�04 34�89 No Cq No Cq



Human (children) faecal sample (CRH Lethbridge) CHR-7

10�1 30�41 30�74 36�43 35�18 27�32 27�41 31�41 31�610�2 33�76 34�1 No Cq No Cq 30�21 30�01 35�28 35�4510�3 38�21 35�97 No Cq No Cq 33�2 33�03 No Cq No Cq





Bovine faecal sample (FMV St-Hyacinthe) FMV1094847

10�1 26�99 27�07 27�2 27�51 23�29 23�13 No Cq No Cq

10�2 31�43 30�47 30�81 31�5 26�57 26�43 No Cq No Cq

10�3 33�48 33�65 34�96 35�69 29�83 29�66 No Cq No Cq

10�4 36�61 37�33 No Cq No Cq 33�32 33�87 No Cq No Cq





10�1 23�98 24�37 28�24 28�19 22�01 22�02 No Cq No Cq

10�2 27�44 27�24 31�52 31�25 25�49 25�31 No Cq No Cq

10�3 31�27 31�22 34�59 35�01 28�76 28�63 No Cq No Cq





(Continued )




nt was sequenced and compared with 35 established P

genotypes. The human strains isolated from faecal mate-

rial were associated with three different P genotypes: 2

strains with P[6], 6 with P[8] and 1 with P[9] (Fig. 2).

The P[9] strain showed 95% homology with strain

EU708961 USA/Cat2. The bovine strains revealed two P

genotypes P[11] and P[5], with P[11] corresponding to

six strains and P[5] to three strains (Fig. 3). The two tar-

geted gene segments for G-P genotype combinations

(Table 4) were successfully amplified and sequenced for

only 8 of 13 human samples. Rotavirus G1P[8] was the

most common combination observed in human infec-

tions (4/8; 50%), followed by G1P[6] (2/8; 25%), G4P[8]

(1/8; 12�5%) and G3P[9] (1/8; 12�5%). In bovine sam-

ples, VP7 and VP4 genotypes were identified in 62% (8/

13) of rotavirus-positive samples: G6P[11] (4/8; 50%)

and G6P[5] (2/8; 25%), followed by G10P[11] (1/8;

12�5%) and G10P[5] (1/8; 12�5%).

Discussion

The majority of rotavirus amplification assays target the

VP4 and VP7 capsid genes and are generally used for

genotyping, while most of the detection assays target the

NSP3 or VP6 gene. NSP3 is a highly conserved nonstruc-

tural protein, and homologous sequences from this pro-

tein have been found in bovine, simian, porcine and

human group A rotaviruses (Pang et al. 2004). This

genomic region was found to be a good target region for

PCR amplification of various rotavirus strains. RT-qPCR

assays targeting the NSP3 gene have been proposed for

the detection of rotavirus (Pang et al. 2004; Zeng et al.

2008; Jothikumar et al. 2009). RT-qPCR assays are now

widely recognized as being very sensitive and rapid, auto-

matable approaches that can provide a relative viral load.

In the present study, four different proposed RT-qPCR

primers and probe sets were evaluated for their ability to

detect human and bovine rotavirus strains. Systems B

and C target nucleotide sequences within the NSP3 gene,

while system A and system D target the VP6 and VP7

proteins, respectively. These four RT-qPCR assays were

principally designed for the detection of human group A

rotaviruses; the two assays targeting the NSP3 gene have

been validated with clinically important rotaviruses (Zeng

et al. 2008; Jothikumar et al. 2009). In the present study,

these four systems were used to detect animal rotavirus

strains, primarily bovine strains, for the first time. Detec-

tion systems B and C showed the best performance for

the detection of rotavirus in positive human faecal sam-

ples and rotavirus strains representing five major VP7

genotypes, G1, G2, G3, G4 and G9. In this study, system

B was the only RT-qPCR assay able to detect rotavirus

RNA in all positive human and bovine faecal samples.

The primers and probe used in this RT-qPCR assay pub-

lished by Zeng et al. consisted of a modified version of

the primers and the TaqMan probe previously developed

by Pang et al. 2004. System A could be a good method

for the detection of human and bovine rotavirus; how-

ever, the positive amplification signal obtained for nega-

tive samples could produce false-positive results. System

Table 3 (Continued )

RNA Dilution

RT-qPCR assays

Rotavirus A

System A

Logan et al.

(2006) (Cq)

Rotavirus A

System B

Zeng et al. (2008) (Cq)

Rotavirus A

System C

Jothikumar et al.

(2009) (Cq)

Rotavirus A

System D

Plante et al.

(2011) (Cq)


10�1 28�73 28�3 35�22 34�5 26�2 26�33 No Cq No Cq

10�2 31�9 31�61 37�36 42�18 29�62 29�33 No Cq No Cq

10�3 35�29 35�81 No Ct No Ct 33�7 32�88 No Cq No Cq

10�4 No Cq No Cq No Cq No Cq 36�53 36�28 No Cq No Cq





10�1 29�52 28�89 30�75 30�25 24�96 24�91 No Cq No Cq

10�2 32�92 33�9 34�98 34�46 28�4 28�41 No Cq No Cq


10�4 No Cq No Cq No Cq No Cq 34�36 37�1 No Cq No Cq







D, targeting the VP7 protein and previously tested only

with the human rotavirus strain WA (ATCC CRL-2018)

(Plante et al. 2011), was the least effective system, detect-

ing only 81% of human rotavirus–positive samples, and

none of the bovine rotavirus RNA material (0/13)

included in this study. These results confirm that the

Figure 1 Phylogenic tree of the VP7 nucleotide sequences of rotavirus strains in the study, analysed using the neighbour-joining algorithm for

assignment of G genotype. Arrows indicate the strains identified in this study, and the bootstrap scores for branches are shown from 1000

replicates. The scale bar is proportional to 22% sequence divergence.




VP7 capsid gene may not be a good target for the

detection of a large diversity of rotavirus strains.

Serially diluted plasmid DNA standard was previously

used to validate the primers and probes for amplification

systems A, B and C and to estimate the limits of detection

(Logan et al. 2006; Zeng et al. 2008; Jothikumar et al.

2009). The resulting limits of detection, ranging from 3 to

10 genome equivalent copies, are consistent with the

results obtained in the present study. The sensitivity of

system C, developed by Jothikumar et al. 2009, was esti-

mated to be between 2 and 4 viral particles. In the present

study, system C showed Cq values that were consistently

lower than those for the other detection systems, for every

sample. In addition, the analysis of rotavirus RNA

Figure 2 Phylogenic tree of the partial VP4 nucleotide sequences of human rotavirus strains in the study, analysed using the neighbour-joining

algorithm for assignment of P genotype. Arrows indicate the strains identified in this study, and the bootstrap scores for branches are shown

from 1000 replicates. The scale bar is proportional to 25% sequence divergence.




dilution series revealed that the limit of detection (LOD)

obtained for this assay was generally 10- to 100-fold more

sensitive than that for the other assays. These results sug-

gest that system C was more sensitive than the other three

systems evaluated in this study for the detection of rotavi-

rus in human and bovine faecal samples. The nucleotide

composition of the targeted region, the RNA conforma-

tion or the availability of the targeted region for the

reverse transcription step can explain the differences in

efficiency and sensitivity among the RT-qPCR detection

systems tested. As the four molecular detection assays

were performed on the same RNA extracts, viral RNA

extraction recovery, RNA integrity and PCR inhibitors

from faecal samples can be excluded.

A new molecular typing system based on all 11 gene

segments was developed recently (Matthijnssens et al.

Figure 3 Phylogenic tree of the partial VP4 nucleotide sequences of bovine rotavirus strains in the study, analysed using the neighbour-joining

algorithm for assignment of P genotype. Arrows indicate the strains identified in this study, and the bootstrap scores for branches are shown

from 1000 replicates. The scale bar is proportional to 20% sequence divergence.




2008). This system is based on sequencing and phyloge-

netic analysis of all fragments and uses the notations

Gx-P[x]-Ix-Rx-Cx-Mx-Ax-Nx-Tx-Ex-Hx for the VP7-

VP4-VP6-VP1-VP2-VP3-NSP1-NSP2-NSP3-NSP4-NSP5/6

genes. The system offers good discriminatory power and

allows a very fine description of each strain’s genotype.

However, sequencing of the complete rotavirus genome is

a time-consuming process, and this may limit the applica-

tion of the new typing system. Rotavirus characterization

based on G and P genotypes is still widely used. Four G

and P genotypes were identified in this study in human

samples, including G1P[8], G1P[6], G4P[8] and G3P[9],

with G1P[8] being the most commonly detected strain.

The G1P[8] genotype is predominant in various countries

around the world (Gentsch et al. 2005; van der Heide

et al. 2005; Ahmed et al. 2006; Pietruchinski et al. 2006;

Lee et al. 2009) and is targeted by the two commercial

vaccines approved in Canada, RotaTeqR and RotarixTM

(Lamhoujeb et al. 2010). The emerging rotavirus G9 and

the rare G12 serotype were not detected in faecal samples

from Canadian children included in this study.

The human rotavirus strain CHR-120 with the G3P[9]

genotype was found to be similar to a feline rotavirus

strain isolated in the United States. In a study by Tsuga-

wa and Hoshino (2008), homology between human and

feline rotavirus strains was demonstrated in all genome

segments. Close contact between animals and humans in

the domestic environment is a factor that promotes inter-

species transmission and mixed infections. The G3 strain

has not only been identified in humans but also in

several other animal species, such as pigs, monkeys, dogs,

cats, horses, mice, lambs, birds and rabbits (Khamrin

et al. 2006; Martella et al. 2010).

Studies carried out in Argentina, the Netherlands,

Australia, Brazil and Canada showed that the G and P

genotypes commonly identified in bovine rotavirus

strains are G6, G10, P[11] and P[5] (Alfieri et al. 2004;

van der Heide et al. 2005; Lamhoujeb et al. 2010; Swiatek

et al. 2010; Badaracco et al. 2012). A similar pattern was

observed in the present study; the genotypes identified

were G6P[11], G6P[5], G10P[11] and G10P[5]. No simi-

larity has been observed between these bovine rotavirus

strains and human strains.

Results obtained in this study indicate that the

RT-qPCR assay developed by Jothikumar et al. 2009

(system C) performed very well for the detection of

human rotavirus; it was generally more sensitive than

the other RT-qPCR assays tested. However, system B is

the only assay evaluated in the study that was able to

detect rotavirus RNA in all positive human and bovine

faecal samples. Among the P and G genotypes identi-

fied in this study, G1P[8] and G6P[11] were predomi-

nant in the human and bovine rotavirus strains,

respectively. Sequence analysis of the VP4 and VP7

genes revealed that the human rotavirus strain CHR-

120 was similar to a feline rotavirus strain isolated in

the United States.

Acknowledgement

This research was supported by Agriculture and

Agri-Food Canada Research Branch Project RPBI # 1485.

References

Abid, I., Guix, S., Aouni, M., Pinto, R. and Bosch, A. (2007)

Detection and characterization of human group C

rotavirus in the pediatric population of Barcelona, Spain.

J Clin Virol 38, 78–82.

Ahmed, H.E., Coulter, J.B.S., Nakagomi, O., Hart, C.A., Zaki,

J.M., Al-Rabaty, A.A., Dove, W. and Cunliffe, N.A. (2006)

Molecular characterization of rotavirus gastroenteritis

strains, Iraqi Kurdistan. Emerg Infect Dis 12, 824–826.

Table 4 Rotavirus G and P genotypes identified in human and bovine

faecal samples

VP7 VP4

Human faecal samples positive for rotavirus

Sample 8081 - STHY-21 G1 P[8]

Sample S66825 (HSC Toronto) – STHY-119 ND * ND

Sample T54210 (HSC Toronto) – STHY-120 G3 ND

Sample W45010 (HSC Toronto) – STHY-121 G3 ND

Sample T57043 (HSC Toronto) – STHY-122 G1 P[8]

Sample M43529 (HSC Toronto) – STHY-123 G4 P[8]

Sample F76031 (HSC Toronto) – STHY-124 G1 P[6]

Sample W44279 (HSC Toronto) – STHY-125 G1 P[8]

Sample H71374 (HSC Toronto) – STHY-126 G1 P[6]

Sample H73726 (HSC Toronto) – STHY-127 ND ND

Sample M45804 (HSC Toronto) – STHY-128 ND P[8]

Sample CHR-7 G1 P[8]

Sample CHR-120 G3 P[9]

Bovine faecal samples positive for rotavirus

Sample FMV 1124422 G10 P[11]

Sample FMV 1122505 ND P[11]

Sample FMV 1094847 G10 ND

Sample FMV 1089933 G6 P[5]




Sample FMV 1081283 ND ND



Sample FMV 1075017 G10 ND


Sample FMV 1087766 ND P[11]

*ND: Not Determined.




Alfieri, A.F., Alfieri, A.A., Bacellar Barreiros, M.A., Gagliardi

Leite, J.P. and Richtzenhain, L.J. (2004) G and P

genotypes of group A rotavirus strains circulating in calves

in Brazil, 1996–1999. Vet Microbiol 99, 167–173.

Badaracco, A., Garaicoechea, L., Rodriguez, D., Uriarte, E.L.,

Odeon, A., Galarza, R., Abdala, A., Fernandez, F. et al. (2012)

Bovine rotavirus strains circulating in beef and dairy herds in

Argentina from 2004–2010. Vet Microbiol 158, 394–399.

Banyai, K., Esona, M.D., Mijatovic, S., Kerin, T.K., Pedreira,

C., Mercado, J., Balmaseda, A., Perz, M.C. et al. (2009)

Zoonotic bovine rotavirus strain in diarrheic child,

Nicaragua. J Clin Virol 46, 391–393.

Bishop, R.F., Davidson, G.P., Holmes, I.H. and Ruck, B.J.

(1973) Virus particles in epithelial cells of duodenal

mucosa from children with acute non-bacterial

gastroenteritis. Lancet 2, 1281–1283.

Brassard, J., Seyer, K., Houde, A., Simard, C. and Trottier, Y.-

L. (2005) Concentration and detection of hepatitis A and

rotavirus in spring water samples by reverse transcription-

PCR. J Virol Methods 123, 163–169.

Escobar-Herrera, J., Cancio, C., Guzman, G.I., Villegas-

Sepulveda, N., Estrada-Garcia, T., Garcia-Lozano, H.,

Gomez-Santiago, F. and Gutierrez-Escolano, A.L. (2006)

Construction of an internal RT-PCR standard control for

the detection of human caliciviruses in stool. J Virol

Methods 137, 334–338.

Freeman, M.M., Kerin, T., Hull, J., McCaustland, K. and

Gentsch, J. (2008) Enhancement of detection and

quantification of rotavirus in stool using a modified real-

time RT-PCR assay. J Med Virol 80, 1489–1496.

Gentsch, J.R., Glass, R.I., Woods, P., Gouvea, V., Gorziglia,

M., Flores, J., Das, B.K. and Bhan, M.K. (1992)

Identification of group A rotavirus gene 4 types by

polymerase chain reaction. J Clin Microbiol 30, 1365–1373.

Gentsch, J.R., Laird, A.R., Bielfelt, B., Griffin, D.D., Banyai, K.,

Ramachandran, M., Jain, V., Cunliffe, N.A. et al. (2005)

Serotype diversity and reassortment betweem human and

animal rotavirus strains: implication for rotavirus vaccine

programs. J Infect Dis 192, S146–S159.

Gouvea, V., Glass, R.I., Woods, P., Taniguchi, K., Clark, H.F.,

Forrester, B. and Fang, Z.-Y. (1990) Polymerase chain

reaction amplification and typing of rotavirus nucleic acid

from stool specimens. J Clin Microbiol 28, 276–282.

Guti�errez-Aguirre, I., Steyer, A., Boben, J., Gruden, K.,

Poljsak-Prijatelj, M. and Ravnikar, M. (2008) Sensitive

detection of multiple rotavirus genotypes with a single

reverse transcription-real-time quantitative PCR assay.

J Clin Microbiol 46, 2547–2554.

van der Heide, R., Koopmans, M.P.G., Shekary, N., Houwers,

D.J., van Duynhoven, T.T.H.P. and van der Poel, W.H.M.

(2005) Molecular characterizations of human and animal

group A rotaviruses in the Netherlands. J Clin Microbiol

43, 669–675.

Houde, A., Gu�evremont, E., Poitras, E., Leblanc, D., Ward, P.,

Simard, C. and Trottier, Y.-L. (2007) Comparative

evaluation of new TaqMan real-time assays for the

detection of hepatitis A virus. J Virol Methods 140, 80–89.

Houde, A., Mattison, K., Ward, P. and Plante, D. (2009)

Molecular detection and characterization of food and

waterborne viruses. In Bacterial DNA, DNA Polymerase

and DNA Helicases ed. Knudsen, W.D. and Bruns, S.S. pp.

137–185. New York, USA: Nova Publishers.

Isegawa, Y., Nakagomi, O., Nakagomi, T., Ishida, S., Uesugi, S.

and Ueda, S. (1993) Determination of bovine rotavirus G

and P serotypes by polymerase chain reaction. Mol Cell

Probes 7, 277–284.

Jones, T.H., Houde, A., Poitras, E., Ward, P. and Johns, M.W.

(2009) Development and evaluation of a multiplexed real-

time TaqMan RT-PCR assay with a sample process

control for detection of F-specific RNA coliphage

genogroup I and IV. Food Environ Virol 1, 57–65.

Jothikumar, N., Kang, G. and Hill, V.R. (2009) Broadly

reactive TaqMan assay for real-time RT-PCR detection of

rotavirus in clinical and environmental samples. J Virol

Methods 155, 126–131.

Kang, G., Iturriza-Gomara, M., Wheeler, J.G., Crystal, P.,

Monica, B., Ramani, S., Primrose, B., Moses, P.D. et al.

(2004) Quantitation of group A rotavirus by real-time

reverse-transcription-polymerase chain reaction:

correlation with clinical severity in children in South

India. J Med Virol 73, 118–122.

Khamrin, P., Maneekarn, N., Peerakome, S., Yagyu, F., Okitsu,

S. and Ushijima, H. (2006) Molecular characterization of

rare G3P[3] human rotavirus reassortant strain reveals

evidence for multiple human-animal interspecies

transmissions. J Med Virol 78, 986–994.

Koopmans, M. and Duizer, E. (2004) Foodborne viruses: an

emerging problem. Int J Food Microbiol 90, 23–41.

Kottaridi, C., Spathis, A.T., Ntova, C.K., Papaevangelou, V.

and Karakitsos, P. (2012) Evaluation of a multiplex real

time reverse transcription PCR assay for the detection and

quantification of the most common human rotavirus

genotypes. J Virol Methods 180, 49–53.

Lamhoujeb, S., Cook, A., Pollari, F., Bidawid, S., Farber, J. and

Mattison, K. (2010) Rotavirus from Canadian farms

samples. Arch Virol 155, 1127–1137.

Lee, S.Y., Hong, S.K., Lee., S.G., Suh, C.I., Park, S.W., Lee,

J.H., Kim, J.H., Kim, D.S. et al. (2009) Human rotavirus

genotypes in hospitalized children, South Korea, April

2005 to March 2007. Vaccine 27S, F97–F101.

Leung, A.K., Kellner, J.D. and Davis, H.D. (2005) Rotavirus

gastroenteritis. Adv Ther 22, 476–487.

Logan, C., O’Leary, J.J. and O’Sullivan, N. (2006) Real-time

reverse transcription-PCR for detection or rotavirus and

adenovirus as causative agents of acute viral gastroenteritis

in children. J Clin Microbiol 44, 3189–3195.

Loisy, F., Atmar, R.L., Guillon, P., Le Cann, P., Pommepuy,

M. and Le Guyader, F.S. (2005) Real-time RT-PCR

for norovirus screening in shellfish. J Virol Methods 123,

1–7.




Maes, R.K., Grooms, D.L., Wise, A.G., Han, C., Ciesicki, V.,

Hanson, L., Vickers, M.L., Kanitz, C. et al. (2003)

Evaluation of a human group A rotavirus assay for on-site

detection of bovine rotavirus. J Clin Microbiol 41, 290–

294.

Martella, V., Banyai, K., Matthijnssens, J., Buonavoglia, C. and

Ciarlet, M. (2010) Zoonotic aspects of rotaviruses. Vet

Microbiol 140, 246–255.

Matthijnssens, J., Ciarlet, M., Rahman, M., Attoui, H., Banyai,

K., Estes, M.K., Gentsch, J.R., Iturriza-Gomara, M. et al.

(2008) Recommendations for the classification of group A

rotaviruses using all 11 genomic RNA segments. Arch

Virol 153, 1621–1629.

Matthijnssens, J., Ciarlet, M., McDonald, S.H., Attoui, H.,

Banyai, K., Brister, J.R., Buesa, J., Esona, M.D. et al.

(2011) Uniformity of rotavirus strain nomenclature

proposed by the Rotavirus Classification Working Group

(RCWG). Arch Virol 156, 1397–1413.

Matthijnssens, J., Otto, P.H., Ciarlet, M., Desselberger, U., Van

Ranst, M. and Johne, R. (2012) VP6-sequence-based cutoff

values as a criterion for rotavirus species demarcation.

Arch Virol 157, 1177–1182.

Mattison, K., Brassard, J., Gagn�e, M.-J., Ward, P., Houde, A.,

Lessard, L., Simard, C., Shukla, A. et al. (2009) The feline

calicivirus as a sample process control for the detection of

food and waterborne RNA viruses. Int J Food Microbiol

132, 73–77.

Min, B.-S., Noh, Y.-J., Shin, J.-H., Baek, S.-Y., Min, K.-I., Ryu,

S.-R., Kim, B.-G., Park, M.-K. et al. (2006) Assessment of

the quantitative real-time polymerase chain reaction using

a cDNA standard for human group A rotavirus. J Virol

Methods 137, 280–286.

Pang, X.L., Lee, B., Boroumand, N., Leblanc, B. and

Preiksaitis, K. (2004) Increased detection of rotavirus

using a real time reverse transcription-polymerase chain

reaction (RT-PCR) assay in stool specimens from children

with diarrhea. J Med Virol 72, 496–501.

Pang, X., Cao, M., Zhang, M. and Lee, B. (2011) Increased

sensitivity for various rotavirus genotypes in stool

specimens by amending three mismatched nucleotides in

the forward primer of a real-time RT-PCR assay. J Virol

Methods 172, 85–87.

Pietruchinski, E., Benati, F., Lauretti, F., Kisielius, J., Ueda, M.,

Volotao, E.M., Soares, C.C., Hoshino, Y. et al. (2006)

Rotavirus Diarrhea in children and adults in a Southern

city of Brazil in 2003: distribution of G/P types and

finding of rare G12 strain. J Med Virol 78, 1241–1249.

Plante, D., B�elanger, G., Leblanc, D., Ward, P., Houde, A. and

Trottier, Y.-L. (2011) The use of bovine serum albumin to

improve the RT-qPCR detection of foodborne viruses

rinsed from vegetable surfaces. Lett Appl Microbiol 52,

239–244.

Rahman, M., Banik, S., Faruque, A.S.G., Taniguchi, K., Sack,

D.A., Van Ranst, M. and Azim, T. (2005) Detection and

characterization of human group C rotaviruses in

Bangladesh. J Clin Microbiol 43, 4460–4465.

Raming, F., Ciarlet, M., Mertens, P.P.C. and Dermody, T.S.

(2005) Rotavirus. In Virus Taxonomy; eight report of the

international committee on taxonomy of viruses ed. Fauquet,

C.M., Mayo, M.A., Maniloff, J., Desselberger, U. and Ball,

L.A. pp. 484–496. London: Elsevier Academic Press.

Rutjes, S.A., Lodder, W.J., Bouwknegt, M. and de Roda

Husman, A.M. (2007) Increased hepatitis E virus

prevalence on Dutch pig farms from 33 to 55% by using

appropriate internal quality controls for RT-PCR. J Virol

Methods 143, 112–116.

Schwarz, B.-A., Bange, R., Vahlenkamp, T.W., Johne, R. and

M€uller, H. (2002) Detection and quantitation of group A

rotaviruses by competitive and real-time reverse

transcription-polymerase chain reaction. J Virol Methods

105, 277–285.

Scipioni, A., Bourgot, I., Mauroy, A., Ziant, D., Saegerman, C.,

Daube, G. and Thiry, E. (2008) Detection and

quantification of human and bovine noroviruses by a

TaqMan RT-PCR assay with a control for inhibition. Mol

Cell Probes 22, 215–222.

Steyer, A., Bajzelj, M., Iturriza-Gomara, M., Mladenova, Z.,

Korsun, N. and Poljsak-Prijatelj, M. (2010) Molecular

analysis of human group A rotavirus G10P[14] genotype

in Slovenia. J Clin Virol 49, 121–125.

Swiatek, D.L., Palombo, E.A., Lee, A., Coventry, M.J., Britz,

M.L. and Kirkwood, C.D. (2010) Detection and analysis of

bovine rotavirus strains circulating in Australian calves

during 2004 and 2005. Vet Microbiol 140, 56–62.

Tate, J.E., Burton, A.H., Boschi-Pinto, C., Steele, A.D., Duque,

J. and Parashar, U.D. (2012) 2008 estimate of worldwide

rotavirus-associated mortality in children younger than

5 years before the introduction of universal rotavirus

vaccination programmes: a systematic review and meta-

analysis. Lancet Infect Dis 12, 137–141.

Tsugawa, T. and Hoshino, Y. (2008) Whole genome sequence

and phylogenetic analyses reveal human rotavirus G3P[3]

strains Ro1845 and HCR3A are examples of direct virion

transmission of canine/feline rotaviruses to humans.

Virology 380, 344–353.

Ward, P., Poitras, E., Leblanc, D., Letellier, A., Brassard, J., Plante,

D. and Houde, A. (2009) Comparative analysis of different

TaqMan real-time RT-PCR assays for the detection of swine

Hepatitis E virus and integration of Feline calicivirus as

internal control. J Appl Microbiol 106, 1360–1369.

Zeng, S.-Q., Halkosalo, A., Salminen, M., Szakal, E.D.,

Puustinen, L. and Vesikari, T. (2008) One-step

quantitative RT-PCR for the detection of rotavirus in

acute gastroenteritis. J Virol Methods 153, 238–240.


