Transcript
Page 1: CITYVIEW 21...2013/04/04  · Beautiful skin is essential, and with some expert tips, achieving it doesn’t have to be difficult. “On your wedding day, smooth, glowing skin is an

CITYVIEW APRIL 18 — 24, 2013 21

ADVERTISING SECTION

BRIDAL PLANNER

Tips and ideas on controlling costs, insurance, shoe selection and more!

INSIDE

It’s All About

You!

Page 2: CITYVIEW 21...2013/04/04  · Beautiful skin is essential, and with some expert tips, achieving it doesn’t have to be difficult. “On your wedding day, smooth, glowing skin is an

22 CITYVIEW APRIL 18 — 24, 2013

ADVERTISING SECTION

Providing full service catering at these locations and throughout Des Moines

Catering to you!

515-333-5057

AH BLANK GOLF COURSEYear Round Availability

Beautiful Views of the Golf Course

515-281-4658

515-281-3809

Page 3: CITYVIEW 21...2013/04/04  · Beautiful skin is essential, and with some expert tips, achieving it doesn’t have to be difficult. “On your wedding day, smooth, glowing skin is an
Page 4: CITYVIEW 21...2013/04/04  · Beautiful skin is essential, and with some expert tips, achieving it doesn’t have to be difficult. “On your wedding day, smooth, glowing skin is an

24 CITYVIEW APRIL 18 — 24, 2013

ADVERTISING SECTION

T he ideal dress, the perfect menu, the heartfelt vows — to these add another necessity of your dream wedding: gorgeous, glow-ing skin. Throughout your entire wedding — from the mo-

ment you start walking down the aisle to when you exchange vows to your first dance as husband and wife — the focus is on your face. Beautiful skin is essential, and with some expert tips, achieving it doesn’t have to be difficult. “On your wedding day, smooth, glowing skin is an absolute must. Good skin care is an internal and external process,” says Veronica Bar-ton-Schwartz, a leading expert in skin care with more than 30 years of experience. Barton-Schwartz founded the Skin and Body Care Center in Malibu, Calif., where she uses her extensive knowledge to help clients look and feel their best. Whether she’s prepping a celebrity for the red carpet or a bride before her big day, she helps clients get smooth, healthy skin that truly glows. Here are her top skin care tips for brides-to-be: 1. Start three months ahead of the big day. “Start prepping skin at least three months in advance. That will give you enough time to ensure that your skin is clear, smooth and glowing for your special day,” says Barton-Schwartz. Here are some general guidelines based on age: 20s: “When brides are in their 20s, they most likely are facing acne and some discoloration from sun damage. Deep-cleaning facials are a must to prep the skin at this age,” says Barton-Schwartz. 30s up: “In your 30s and 40s, the skin needs exfoliating regularly because it only exfoliates naturally every 35 days as opposed to every 14 days in your 20s. This is the time to start using retinoids to help improve the overall texture and tone of your skin,” she says.

40s and 50s: “In your 40s, your estrogen levels are tapering so your skin will be drier. You’ll have to add collagen-building peptides morn-ing and night to your skin care regimen. In your 50s, you’ll notice loss of elasticity and you will need stronger antioxidant treatments and moisturizers. The older you get, the more important it is to use a good serum under your moisturizer to help combat dry skin and loss of elasticity,” she explains. 2. Eat foods and beverages that nourish skin. When it comes to healthy skin, it’s not only how you treat it exter-nally, but internally as well. Barton-Schwartz says it’s wise to eliminate all sugar and white flour while increasing some skin care superstar foods. 3. Consider supplements that benefit the skin. Supplements can greatly benefit skin health from the inside out. In addition to a good multi-vitamin, Barton-Schwartz suggests con-sidering alpha lipoic acid that assists metabolism, DMAE to improve muscle tone under skin, Co-Q10 that increases metabolic efficiency and improves heart health and omega-3s (found in fish oil) for heart, eyes, brain, skin and overall body health. 4. Don’t forget last minute to-dos for the big day. When the big day comes, you’re likely to feel a mix of emotions: excitement, anxiety, etc. Some important day-of skin care tips can help you stay calm and look your best: “Eat some protein in the morn-ing and take a walk to boost circulation and lymphatic drainage. Use your Veronica Peptides to help with any puffiness and dark circles un-der your eyes,” suggests Barton-Schwartz. “For your complexion, use a sheer, satin-matte foundation, medium coverage concealer for trouble spots, a light dusting of pressed powder and a powder blush. Keep your makeup natural. Wear waterproof mascara, just in case.”

Expert skin care tips for glowing skin on your wedding day

DeDeDeDeDeDeDDeDeDeDDeDeDess MoMoMoMoMoMoMoMoMooininininininininninnnesesesesesesesesesess’ ’ ’ ’ ’ ’ ’ ’ ’’ mmommmomomomomomomomomomomom ststststststststststst cc c c c cc cccccomomomomommmmmmplplplplp etetetetetette ee e e memememememeeenununununununun

ininininininiinclclclclclclcc uuuu kkkkkkkk CCCCCCCCCChihihhihihihihiihhihhhh ckckckckckckckckkkckkkenenenenenenenenenennnn a a aa a aaa aaandndndndnddndnnnnn SS S S Seaeaeaeaeaeaafofofofofofffooff ododododododdododddododd

ThThThThThThThThThThThThhThThThhhee eeeeeee eee eee ee e OrOrOrOOrOrOOrOrOOrOrOrOrOOOrOOrOriigigigigigigigigigigigiggigininiinininininiininalalalalalalalalalall LLLLLL LLLLLLacacacacacacacacaccacacaconononononononononononononnnonoonnononaaaaa aaaaaa aa a FaFaFaFaFFaFaFaFaFaFaFamimimimimimmimimimimimiimimmimm lylylylylylylylylyllylyylyyly R RR R R RRRRRRRReseseseseseseseseeseeseestatatatatatatataatataurururururururu ananananananananananantt!t!t!t!t!t!!t!tt

MoMoMoMoMoMMMooooM ndndndndddndndddayayayayyayayyyayyyayayyyyyyyy–T–T–TT–T–T–T–T–TT–T–Thuhuhuhuhuhuhuhuhuhuhh rsrsrsrsrsssrsrrsdadadddddadadddddaddaaay y y y yy y 1111111111111 a a a aaaammmmmmmmm–––––111111111111111 p p p pp ppmmmmmmmmmmm

FFrFFrFrFrF idididdidayayayyayayay &&&& & && & S S SS S SSSSSSSSSatatatatatataturuuuuururururuururru dadadaddadadaadadd y y yyy y y 11111111111111 a a a aaammmmmm––––––MiMiMiMiMiMiMiMidndndndndndndnd igigigigigigigi hththththththhhtht

NeNeNeNeNeeNeNeeNN veveveveveveveveeev rr r rr rrr ononononon SS S SS SSSSununununununununuunu dadadadadadadadadaddadadaayyyyyyyyyyyy

EnjoyOld World

Italian Cuisine!

PPPPPPPPPPPPPPaaaaaaaaaaaassssssssssssstttttttttttttaaaaaaaaa,,,,,, PPPPPPPPPPiiiiiiiiiizzzzzzzzzzzzzzzzzzzzzzzzzzzaaaaaaaaaaa,,,,,, SSSSSSSSSSSaaaaaaaaaaalllllllllllllllllaaaaaaaaaadddddddddddddsssssssssssaaaaaaaaaaaaaaannnnnnnnnnnnnnnnndddddddddddddddddd aaaaaaaaaaaaaaaaaalllllllllllllllllllllllllllllll yyyyyyyyyyyyyyyyyyooooooooooooouuuuuuuuuuuuuuuurrrrrrrrrrrrrr ffffffffffffaaaaaaaaaaaavvvvvvvvvvvvvoooooooooooorrrrrrrrrrriiiiiiiiiittttttttttttteeeeeeeeeeeeeeeessssssssssssssss

222224444444000000000000 IIIIIIIIIIIIIIIInnnnnnnnnnnggggggggggggeeeeeeeeeeeeeeerrrrrrrrrrrssssssssoooooooollllllllllllllll DDDDDDDDDeeeeeeeeeesssss MMMMMMMMMooooooooooiiiiiiiiinnnnnnneeeeeeeessssssss

515.288.2246wwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwww.....nnnnnnnnoooooooooooooooaaaaaaaaaaaaaahhhhhhhhhhhhhhhssssssssssssddddddddddddddddddeeeeeeeeesssssssssssmmmmmmmmmmmmooooooooooooooiiiiiiiiiiiiiinnnnnnnnnnnnnnneeeeeeeeeessssssssss.....ccccccccccccccooooooooooooooooommmmmmmmmmmmmmmm

eeeess ss s s sss s MMMoMoMoMoMMoMMMMoininninin

llludududududuuu inininininnnnng g g g g g g g gggg StStStStStStStSttSttS eaeaeaeaaaeaeaaaeaeaeaeaeaeaak,k,k,k,kk,k,kkkkkkkkkk,k C C CC CCCCChhhhhhhhh

One owner. One name.Family run since 1946.

Contact the Sales Dept. | [email protected]

Page 5: CITYVIEW 21...2013/04/04  · Beautiful skin is essential, and with some expert tips, achieving it doesn’t have to be difficult. “On your wedding day, smooth, glowing skin is an

CITYVIEW APRIL 18 — 24, 2013 25

ADVERTISING SECTION

NOTHING COMPARES to a wedding at the Fairgrounds.

EAST 30TH & EAST UNIVERSITY AVENUE | DES MOINES, IA P 5 1 5 . 2 6 2 . 3 1 1 1 E X T 2 2 1 I O W A S TAT E FA I R G O U N D S . O R G

Celebrate your special day at the Iowa State Fairgrounds. Historic buildings, modern event center and picturesque

outdoor settings await you and your guests. Enjoy free, close parking for your guests, an accessible location and a

staff ready to assist you with every detail. To schedule your wedding at the incomparable Iowa State Fairgrounds,

visit iowastatefairgrounds.org or contact Off Season Events at 515.262.3111, ext 221.

FAIRGROUNDSIOWA STATE

Page 6: CITYVIEW 21...2013/04/04  · Beautiful skin is essential, and with some expert tips, achieving it doesn’t have to be difficult. “On your wedding day, smooth, glowing skin is an

26 CITYVIEW APRIL 18 — 24, 2013

ADVERTISING SECTION

“I ’m so lucky I’m marrying my best friend,” is a phrase you often hear in wedding toasts. Now that you’ve found the person you want to spend the rest of your life with, make sure you protect each other by considering the bigger financial picture.

According to Wedding Paper Divas, 47 percent of engaged couples spend between one and nine hours per week planning their weddings, but it’s unlikely that much of that time is spent planning for life after the big day.

“Getting married is the perfect time to take a fresh look at your entire financial picture, in-cluding your insurance needs,” says Doug Smith, senior vice president of the Personal Lines divi-sion at Erie Insurance. “It’s much better to plan before the wedding so there are no surprises later.”

Here are five key insurance questions to discuss with your spouse-to-be before taking a walk down the aisle:

Where’s my bling? Chances are you spent a lot of time and money picking out rings you’ll love and wear every day. But according to asecurelife.com, one in 36 homes in the United States will be broken into this year, so it’s important to make sure you have the right insurance to cover your rings if they’re lost or stolen.

Your strategy: Have your rings appraised to establish their value. Keep your store receipts and take a picture of the rings. Having pictures and documentation helps speed up the claims process if you have to file a claim. Also, keep your rings in a safe deposit box when you’re not wearing them.

Baby, can you drive my car? Once you’re married, your spouse generally will be covered on your auto insurance policy and vice versa. This could mean opportunities for savings.

Your strategy: Once you become a two-car home, you may be eligible for a multi-car dis-count. You should also consider bundling your car insurance with your homeowners and/or life insurance which can result in even more savings. Additionally, some insurance companies offer a lower rate for married couples, so talk to your insurance agent to find out if this applies to your policy.

Have you protected the things that make your house a home? Are you planning to move into a new home after the honeymoon? Whether or not your living situation changes, make sure

your home and belongings are protected. Your strategy: Consider what new pieces will be added to your abode. If you purchase new furniture, art pieces or any other new belongings, it’s a good idea to make sure those items are covered in case of theft, fire or natural disaster. You’ll also want to make sure your home insurance covers 100 percent of the cost to rebuild your home if needed. “Do your research,” says Smith. “Some insurance companies cap their cov-erage at a certain amount. That means you could find yourself substantially underinsured, even if you thought you were paying for so-called ‘replacement cost’ insurance.” What do you need to do before plunging into a remodeling project? Even if you’re not purchasing a new home, two people in a house means you need more space, so you may be adding on to your existing home. This can mean workers doing potentially dangerous jobs in the home. Your strategy: When you hire a contractor, request a certificate of insurance to confirm his or her liability and workers’ compensation coverages. Review the certificate and your homeowners policy. Have you thought about life after you say “I do?” When you get married, you may become part of a dual-income household. When this happens, you plan your future based on a new bud-get created by two incomes, which brings increased financial responsibility. Should something happen, surviving family members could struggle without the right level of protection. Your strategy: Make sure your spouse is protected if one income is lost. Universal life insur-ance provides insurance for your entire life and builds a cash value. Term life insurance provides affordable coverage for a set number of years. Some websites, including erieinsurance.com, offer online calculators to help you determine how much insurance you need. As you begin to build a nest egg, you have more assets to protect. A personal umbrella policy provides extra protection for you and your family against lawsuits arising from personal injury or property damage claims. While it’s important to plan for rain on your wedding day and to make sure everyone has a place card, it’s even more important to plan for what comes after the moment you say “I do.” Making the proper insurance and financial arrangements will be a load off your mind if some-thing should arise.

Five questions to ask before you tie the knot

YOU SAY, WITH A

THE REST!

HOLIDAY INN 1050 6th Ave Des Moines, IA 50314 515.283.0151 www.holidayinn.com/dsm-downtown

Why buy when you can rent?

2900 UNIVERSITY AVENUE Suite B6A ~ Clocktower Square ~ WDM ~ 515.224.3937 ~ www.cherylsborrowedoccasions.com

Rent Wedding Dresses and Tuxedos here

10% Discount Bring in this ad and save

on your next rental

Page 7: CITYVIEW 21...2013/04/04  · Beautiful skin is essential, and with some expert tips, achieving it doesn’t have to be difficult. “On your wedding day, smooth, glowing skin is an

CITYVIEW APRIL 18 — 24, 2013 27

ADVERTISING SECTION

Catering For All Your Needs

316 Court Ave. | Des Moines, IA 50309515-282-2995 | DosRiosRestaurant.com

400 Locust St. Suite 195 | Des Moines, IA 50309515-537-8433 | BigCityBurgersandGreens.com

1011 Locust St. | Des Moines, IA 50309TempleforPerformingArts.com

Catering DSM is the preferred caterer for the Capital Square Atrium and has partnerships with multiple venues including:

4444444400000000000 LLLLLLLLooooooooooocccccust Streeeeeeeeeetttt, SSuiitttttttteeeeeeeee 11111119993333333333333 ||||||||||||||| DDDDDDDDDDDDDDDDDeeeeeeeeeeeeeeessssssssssssss MMMMMMMMMMoooooooooiiiiiiiineeeeeeeeeeeeess, IIIIIIIIAAAAAAAAA 5003009 | Ph: 551155-555500000000000008888888888888--000000888888822222222999999 |||||| wwwwwwwwwwwwwww.CaterrrringDDDDDDSSSSSSSMMMMMM.ccccccccooooooommmmmm

FFFFFFFFFFFFFFrrrrrrrrrrrrrrrooooooooommmmmmmmmmmmmmmmm wwwwwwwwwwwwwwwwwweeeeeeeeeeeeeeddddddddddddddddddddddddddddddddddddddddddiiiiiiiiiinnnnnnnnngg rrrrrrrrrrrrreeeeeeeeeeeeeeeeccccccccccceeeeeeeeeeeepppppppppppppppttttttttttttttttiiiiiiiiiiiioooooooooooooonnnnnnnnnnnsssssssss aaaaaaaaaaaaannnnnnnnnnndddddddddddddd rrrrrrreehhhhhhhhheaaaaaaaaaarrrrrrrrrrrrrssssssssssaaaaaaaaaaaaalllllllllll dddddddddddddddddddiiiiiiiiiinnnnnnnnnnnnnnnnnnnnnneeeeeeeeeeerrrrrrrsssss ttttttttttooooooooooooooo bbbbbbbbbbbbrrrrrrrruuuuuuuuuuuuuuuuunnnnnnnnnncccccccccccchhhhhhhhhhhhhhheeeeeeeeeeesssss aaaanddd bbaaccccccccccckkkkkkkkkkkkkyyyyyyyyyyyyyaaaaaaaaaaaaaarrrrrrrrrrrrrrrrrrddddddddddddddddd bbbbbbbbbbbbbbbbbaaaaaaaaaaaaaaaarrrrrrrrrrrrrrbbbbbbbbbbbbbeeeeeeeeeeeeeeeeqqqqqqqqqqqqqqquuuuuuuuuuuuuuuuuueeeeeeeeeeeeeeeeesssssssssssssssssss,,,,,,,,,,,

llllet uuss cccccccaaaaaaaaaattttttttteeeeeeeeeeeeeeerrrrrrrrrrrrrrrrrr ttttttttttttoooooooooooo yyyyyyyyyyyyyyyooooooooooooooooouuuuuurrrrrrrrrrrrrr eeeeeeeeeeeeevvvvvvvvvveeeeeeeeeeeeerrrrrryyyyyyyyyyyyyyyyy nnnnnnnnnnnneeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeddddddddddddddd.

Page 8: CITYVIEW 21...2013/04/04  · Beautiful skin is essential, and with some expert tips, achieving it doesn’t have to be difficult. “On your wedding day, smooth, glowing skin is an

28 CITYVIEW APRIL 18 — 24, 2013

ADVERTISING SECTION

515-244-CLUB - Kristy/D -WEST - Nataliewww.embassyclub.com

(Virtual Tour: www.virtualrabbit.com , search Embassy Club and click on “scenes” to view our spaces.)

cuisineexquisitevenuesdistinctive

Whether it’s the panoramic view from atop the Ruan Center in the Heart of Downtown or our

Embassy West location located on the banks of Crescent Lake; we have the views, the food,

the service and the attention to detail to ensure your perfect day at a surprisingly affordable cost.

Or let our catering services travel to your location of choice, including (but not limited to)

Des Moines’ most premier wedding venues: Greater Des Moines Botanical Garden;

The Rollins Mansion; The World Food Prize Hall of Laureates; the Jordan Creek

Crossing Event Center opening in July; or even your own backyard.

When the meal and service must be exquisite in both its taste and presentation,

put our 101 years of experience to work for your guests.

Izaak Walton Wedding& Banquet Center

515.244.3773Ask for Carolyn Berndt

Best kept secret in town!

Weddings ~ ReceptionsMaximum seating 350

Full Bar that seats 50In-house Catering~ ~ ~ ~ ~ ~ ~ ~ ~ ~Check out our rates

Corporate EventsCorprprpporate EventstsHoliday PartiesHoliday P rtartrtrtieiessCharity EventsCharityharityty venEventsts

ReunionsReunionseuunionsConveniently located off Park Avenue atniently located otly locate

4343 George Flag Pkwy.4343 Georgrge Flag Pkg Pkwwykwy..Des Moines

AlsoAlssooavailable availabbleable

forfofor

[email protected]

IZAAKIZAAKKWALTONWAALTONWALTLTONLEAGUELEAGUE

We have one of the lowest prices in town!

Dates still available for 2013

Page 9: CITYVIEW 21...2013/04/04  · Beautiful skin is essential, and with some expert tips, achieving it doesn’t have to be difficult. “On your wedding day, smooth, glowing skin is an

CITYVIEW APRIL 18 — 24, 2013 29

ADVERTISING SECTION

250 person capacity Full Catering and

Bar Menu Professional Event Staff Bridal Suite Stunning Views

of Golf Course

Ankeny, IA 515-965-6466 www.ottercreekankeny.com

YOUR WEDDING,

Décor provided byThe Perfect Wedding

YOUR WAY!

Cityview Best Ofand DSM Top List Winners

http://tastetogo.net 277-ToGo

Emily Gross and Andres WilliamsThe Frommelt Sisters

A Unique Place for Your Special DayThe Scottish Rite Consistory is an impressive building ideally

suited for your wedding.

From the rehearsal dinner in the Council Room, to the ceremony in the Consistory

Auditorium and the reception in the Grand Banquet Room, the Scottish Rite has a variety of places to meet your needs.

We have many amenities, but to truly appreciate the beauty and elegance, one must take a personal tour. We would be

happy to meet with you at your convenience.

Page 10: CITYVIEW 21...2013/04/04  · Beautiful skin is essential, and with some expert tips, achieving it doesn’t have to be difficult. “On your wedding day, smooth, glowing skin is an

30 CITYVIEW APRIL 18 — 24, 2013

ADVERTISING SECTION

I t may come as a surprise to young engaged couples, but the excite-

ment of the wedding and honeymoon doesn’t end when it’s all

over. In fact, after the honeymoon, it’s time to roll up your sleeves

and plan the big move — the joining of two households.

It’s a herculean task finding the perfect location with great

schools, affordable taxes and good neighbors. But once you’ve signed

on the dotted line for the home where you will begin your life as a

couple — and maybe also raise your family when the time arrives —

you’re ready to plan your big move.

Many newlyweds face the chore of merging furniture, kitchen

equipment and closet space from two households. To start your

moving process off on the right foot, consider eliminating duplicate

items and having a garage sale or donating items before beginning the

packing process. It’s a great chance to upgrade household furnishings

— especially if you received something new as a wedding gift.

Then determine what size moving truck you’ll need. A good rule

is to plan for 150 cubic feet of space for every fully furnished room.

Many young couples moving from a small apartment or condo into a

larger first home will find a 12- or 16-foot Penske rental truck more

than adequate. Plan to reserve your truck at least two weeks in ad-

Honeymoon encore: The big move in

Creating positive and worry-free Vacations and Events

Meeting & Event Planning Incentive Trip Planning

Destination Weddings & Honeymoons

Vacations

travelandtransport.com Look for us on Facebook and Twitter

Do you dream of saying “I do” surrounded by your family

and friends on a pristine, sandy beach?

Simple Romance

Effortless BlissSimple Romance

Effortless Bliss

213 Duff Avenue | Ames, IA 515.232.66402955 100th Street | Urbandale, IA 515.224.7619

How about overlooking a majestic mountain range? Maybe you

want to enjoy your honeymoon relaxing on a luxurious island or

all-inclusive resort. For over 66 years, the vacation travel specialists

at Travel and Transport have turned these dreams into reality.

Call our travel specials today and start planning

the wedding of your dreams.

Page 11: CITYVIEW 21...2013/04/04  · Beautiful skin is essential, and with some expert tips, achieving it doesn’t have to be difficult. “On your wedding day, smooth, glowing skin is an

CITYVIEW APRIL 18 — 24, 2013 31

ADVERTISING SECTION

vance. Penske Truck Rental offers rental discounts for AAA members to help young couples

with savings.

For help in making moving day go smoothly, use these tips from Penske. They’ve been in the

do-it-yourself moving business for more than 40 years:

Still unpacking your wedding gifts? If space isn’t a concern, keep those wedding gifts in their

original boxes, because the store packaging will help protect the items. But if space is tight in

the rental truck, throw away the store packaging and carefully repack in your moving boxes

with plenty of paddsing to protect your new gifts.

Start early and group items together. Get good, sturdy boxes of various sizes, and then fill

them with items of similar use, size or design. Some traditional ways to group items are by

item type (i.e. photo frames) or by contents of a room. Label each box with the room name

and the contents. Make sure you have plenty of packing bubbles or towels and cloths on hand

to keep breakable items from being damaged in the move.

Save your muscles. Ask friends to help you with carrying boxes. If something is heavy, enlist

some help to prevent injury or strain on your muscles.

When loading the truck, load the largest items (i.e. bed, couch, dresser) into the truck first to

ensure they will fit, and then start loading the heaviest boxes on the bottom and lighter boxes

on top. Having each box labeled with contents will help prevent you and your friends from

packing heavy books on top of your new fine china wedding gifts. Penske features an online

Truck Wizard application to assist.

When you cross the threshold of your new home for the first time as a married couple, you’ll

be surrounded by the excitement and energy of so many adventures to come in your future.

Carefully unpack your moving truck and cherish the memories of your personal belongings as

you meld them to fit into your new home and life with your new spouse.

Page 12: CITYVIEW 21...2013/04/04  · Beautiful skin is essential, and with some expert tips, achieving it doesn’t have to be difficult. “On your wedding day, smooth, glowing skin is an

32 CITYVIEW APRIL 18 — 24, 2013

ADVERTISING SECTION

Y ou’ve picked the perfect ring. You’ve practiced the

words you’ll use when you propose. But you know

she would be livid if you asked her on the big screen

at a sporting event.

Making an engagement truly memorable will win you

points for a lifetime with each retelling of your engagement

story. Here are some great ways to make your engagement be

one of a kind.

Take it personally.

You are proposing to the woman or man of your dreams

— the one person you’ve chosen to spend the rest of your life

with, the person who is the perfectly unique match to your-

self. So make the proposal just as personalized and special as

that person. Yes, you may have chosen the perfect ring, but

presentation is equally important.

Choose something that will not only stun your betrothed, but also be something he or she

can keep for years. Ditch the typical velvet box and go for a personalized, engraved keepsake box

from Things Remembered. With dozens of box options, you can perfectly match the style of

your new fiance, from classic and elegant to contemporary chic.

Then take it one step further, and engrave something meaningful to commemorate this day.

Your names, the date you were engaged or a personal love saying (that maybe only the two of you

understand) are ideal inscriptions.

Make it a party.

Yes, the holiday season is filled with parties, but a personal engagement party is something

that you and your families will remember forever. Whether you choose a private, intimate lo-

cale to pop the question or a bustling public setting, convene

family and friends during or afterward to celebrate together.

Plan a special party to commemorate this momentous, life-

changing occasion.

Don’t forget, a great party doesn’t necessarily mean

great expense. Gathering at home with champagne, maybe a

cheese plate and a homemade music playlist can make for one

of the most memorable occasions of your life. Just be sure your

future spouse is the center of attention, and you’ll be set to

make the event unforgettable.

Capture the moment.

Nearly all couples choose to hire photographers and

videographers to capture the memories of their wedding day.

But isn’t the engagement just as momentous? As your heart

begins to race when your knee bends toward the ground, the

last thing on your mind will be your camera. But being able to actually look back at this moment

will be something you’ll treasure for years to come.

The holidays are busy for everyone, so if you plan on hiring a professional photographer,

make sure to call at least a few weeks in advance. Luckily, unlike your wedding day, you’ll prob-

ably only need the photographer for an hour or so. If you’re already on a shoestring budget, see

if a photography enthusiast friend will take photos for you. They may not end up in The Louvre,

but with a decent camera, you’ll be sure to have some great snapshots of the big moment.

When it’s all said and done, you and your new fiance may not remember every tiny detail.

But using these simple tips will ensure your engagement day is a truly unique, memorable experi-

ence for you both.

How to make your proposal perfect

VENTORY FIND OUR FULL INVFIND OUR FULL INVENTOVENTORRYY

FACEBOOK!ONN FONN FACEBFAFACEBOOKOOK!!

HIHINGNGE E p p yoyou u finfind d onone-e ofof-a-a-k-kinind d finfinalal ttououchcheses.wiwillll hhelelpp

oorr wwweedddddiinnggss +++ aannnniivvvveerrssaarriieessPPPeerrffeecctt ffoo

Your Wedding Rental Destination! Your Wedding Rental Destination!

special event holiday + sg + more!decorating

218 - 5th Street - WDM - Valley Junction - 5.777.2770 515

Page 13: CITYVIEW 21...2013/04/04  · Beautiful skin is essential, and with some expert tips, achieving it doesn’t have to be difficult. “On your wedding day, smooth, glowing skin is an

CITYVIEW APRIL 18 — 24, 2013 33

ADVERTISING SECTION

F ights over finances are a commonly known cause of stress and divorce, and a new survey

indicates that while the average couple fights over money five times a year, they discuss

finances reasonably fewer than two times a month. Every couple knows there are some top-

ics you just don’t bring up — his mother’s dreadful cooking, your uncle’s bad manners. Money,

however, should never be among those subjects you don’t discuss — especially if you’re planning

your wedding.

“In today’s economy, it’s rare that a couple enters matrimony debt-free,” notes Carrie Braxdale,

managing director of investor services for TD Ameritrade Inc. (“TD Ameritrade”), a broker-deal-

er subsidiary of TD Ameritrade Holding Corporation. “Yet many newly engaged couples may be

as hesitant — or even more so — to discuss finances as couples who have been together for years.

They can get a jump-start on a lifetime of wedded bliss, however, if they take time to talk frankly

about finances before they walk down the aisle.”

The survey conducted by TD Ameritrade Holding Corporation and LearnVest found that

couples today face three top concerns when it comes to their finances: not having enough money

to retire (27 percent), not having enough money to live as they wish (25 percent) and not having

enough money to even live comfortably (24 percent).

Trust over money also emerged as a big issue. Forty percent of respondents do not completely

trust their partner to manage their combined finances. Just over one in five (21 percent) admit

they sometimes hide their spending from their partner. Thirty-eight percent say they are either

unaware or only partially aware of their mate’s debts. Perhaps they feel that ignorance is bliss.

Braxdale offers some advice to couples looking to take control of their finances and learn to

talk effectively about money:

Be open about debt before you say “I do.” Keeping secrets about how much you each owe on

student loans, credit cards or auto loans is no way to start off a marriage. While talking about

money might not be the most romantic conversation you ever have with your intended, it’s one

of the most important.

Check your credit scores. You’ll both keep your own score after you’re married, but purchases

you make as a couple afterward — like a house or car — can be affected by both your scores.

Check your scores at least once a year; doing so can help you catch and correct errors or fraud

and help you better manage your credit and overall finances.

More people are marrying later in life, so one or both partners may enter the union with a

401(k), IRA or other investment accounts. It’s important to discuss long-term retirement sav-

ings goals and understand how you both plan to manage these accounts. Websites like TD

Ameritrade’s Life 2.0 and Retirement Planning can help by offering access to free resources like

retirement calculators and portfolio planners. You’ll also find information on making financial

decisions that can help you meet your financial goals, whether you’re just starting out in your

life together, growing your family or approaching your retirement years.

Get to know each other’s saving and spending habits. One partner may be frugal and the other

more of a spender, but arguments don’t have to be inevitable. You’ll need to discuss your habits

and work together to find spending and saving solutions that work best for both of you, and for

your shared financial goals.

Build a budget that incorporates savings goals, income and expenses. Discuss whether com-

bined or separate bank accounts make the most sense for you, and be sure your financial goals

are in sync.

“Open discussions about money, credit, retirement savings and financial health are an impor-

tant step toward a healthy relationship,” Braxdale says.

5525 MILLS CIVIC PARKWAY

WEST DES MOINES, IA 50266

515-288-0356

WWW.SCHAFFERS.COM

Page 14: CITYVIEW 21...2013/04/04  · Beautiful skin is essential, and with some expert tips, achieving it doesn’t have to be difficult. “On your wedding day, smooth, glowing skin is an

34 CITYVIEW APRIL 18 — 24, 2013

ADVERTISING SECTION

P lanning and organizing a large and complex special event can quickly overwhelm a

bride- and groom-to-be, especially if the couple has no previous experience or train-

ing in large event organization. In addition to all the details of the invite list, the

location for all activities for the big day and the special intimate details of wedding party

gifts, getting to the big day without breaking the bank might seem impossible.

With a few smart steps before, during and after the ceremony, you’ll ensure your bank

account will remain as strong as your love for each other.

Tip 1: Strive to come in under-budget.

Set a budget and stick to it — or better yet, come in below it. Start out the wedding-

planning process with a set budget for all major expenses such as food, music, wedding at-

tire, flowers and the cake. But don’t forget about all the little expenses that can add up, too.

For example, tips for services that the DJ, drivers, hairstylist and bartenders provide can

add up to hundreds or even thousands of dollars. Remembering all the details and giving

yourself a little financial wiggle room should something be overlooked is a wise decision.

Tip 2: Wedding insurance equals peace of mind.

Insurance for a wedding? It’s something many have not heard of until planning a wed-

ding, but it should be a priority, because it protects your investment should something

unexpected occur. According to WedSafe Wedding Insurance, a leading insurance program

dedicated exclusively to weddings, there are two types of wedding insurance to consider:

First, cancellation/postponement insurance can offer financial reimbursement for un-

expected events that force cancellation or postponement, such as an illness, military depor-

tation or sudden unemployment. It also brings peace of mind during economic uncertainty

when many vendors suddenly go out of business. For example, it’s unfortunate but far from

rare for a wedding venue or photographer to go out of business and not return the deposit

to the now unhappy couple. This can amount to thousands of dollars. With cancellation/

postponement insurance, the wedding host has financial protection against lost deposits

from no-show or bankrupt vendors. Real wedding mishaps can occur, and wedding insur-

ance offers protection.

Second, liability insurance can provide protection if an injury occurs or property is dam-

aged, and responsibility for the incident is placed on the host as legally liable. For example,

someone slips on a spill and breaks his or her hip, or perhaps someone has a few too many

cocktails and gets into a car accident. Many venues today require that the host purchase

Relax while planning your wedding with these

Page 15: CITYVIEW 21...2013/04/04  · Beautiful skin is essential, and with some expert tips, achieving it doesn’t have to be difficult. “On your wedding day, smooth, glowing skin is an
Page 16: CITYVIEW 21...2013/04/04  · Beautiful skin is essential, and with some expert tips, achieving it doesn’t have to be difficult. “On your wedding day, smooth, glowing skin is an

36 CITYVIEW APRIL 18 — 24, 2013

ADVERTISING SECTION

S parkles, spangles and color, new or vintage, whatever your pref-

erence in wedding shoe styles, there’s one trend that every bride

should get behind: comfort.

“Pretty flats and even tennis shoes have been gaining popularity

among brides for several years, and while those styles may not be to

everyone’s taste, the concept of comfortable wedding shoes is good

for everyone,” says Dr. Crystal Holmes, a doctor of podiatric medicine

(DPM) and spokesperson for the American Podiatric Medical Associa-

tion (APMA).

While an APMA survey indicates that most women do emphasize

comfort over looks when choosing dress shoes, brides may consider

comfort less important than style on their big day. “Brides may think

that since they’re only wearing their wedding shoes for a day, it doesn’t

matter if the shoes make their feet hurt,” Holmes says. “But shoes that

hurt your feet can cause long-term problems, and make existing ones

even worse. Sore feet can put a damper on your wedding, reception and

even honeymoon.”

The APMA offers some advice for choosing the most comfortable

options in some popular wedding styles:

Pumps - A classic wedding shoe, bridal pumps come in a wide variety of styles, colors and

heights. When choosing a pump, be aware that pointy shoes place pressure on the toes and can

aggravate problems like hammertoes and bunions. Choose pumps with deep, wide toe boxes

that give you plenty of room to wiggle your toes. Keep in mind, lower heels are better, especially

if you’ll be in your wedding shoes for several hours.

Ballet flats - Flirty, feminine and fun, ballet flats can feel more comfortable than heels. But

very flat shoes can actually be harmful to your arch and heel. Opt for a

flat that has a bit of a heel, a thicker sole and plenty of cushioning and

support. Avoid flats that bend in half or easily twist.

Kitten heels - When it comes to good looks and foot-friendly

design, kitten heels are the cat’s meow. Typically lower than one inch,

kitten heels add a touch of height without placing undue pressure on

the ball of the foot that higher heels can cause. They also tend to be a bit

wider than the average heel, making them more stable and comfortable.

Platforms and wedges - Towering platforms and wedges pro-

vide height, style and endless options. But wearing these higher styles

requires brides to take extra caution. Platforms and wedges may com-

promise your balance and stability, and very high shoes can lead to ankle

rolls and falls. Look for lower platforms and wedges that feature secure

ankle straps. Cork bottoms provide some shock absorption and traction.

Peep toes - Popular among brides who want to show off their

pretty pedicures, peep toes range from towering heels to functional flats.

Regardless of heel height, peep toes may cause your toes to slip forward

or overlap, or may even push nail edges into the skin to form an ingrown

toenail. Avoid peep toes that are too tight, and be sure they are free of seams near the toe area, as

seams place further pressure on toes.

Sling backs - Showing a flirty flash of heel, sling backs are dynamic and sexy — perfect for

walking down the aisle and kicking up your heels during the reception. Look for a sling back

with a lower heel that will be more comfortable for extended wearing. Straps should be snug but

not too tight to avoid chafing on the back of the heel. Too loose straps may cause the shoe to slip

off your foot, so a proper strap fit is important.

The wedding shoe trend for everyone: pain-free and pretty

A wedding is such a special event and should be celebrated in a place asunique as your relationship.Celebrate your marriage at Honey Creek Resortfeaturing beautiful ceremony and reception sites. From rehearsal dinnersto the grand affair, and even a day-after brunch, the wedding you havealways envisioned is possible at Honey Creek Resort.

12633 Resort Drive, Moravia, Iowawww.honeycreekresort.com

Reservations call 877.677.3344

HONEY CREEK RESORT OFFERS:• 6,500 sq ft of beautiful ceremony and reception space• Extensive outdoor area for weddings or receptions• 105-room lakeside lodge• 28 luxury cottages• Rathbun Lakeshore Grille• 18-hole golf course

For group reservations and services for weddings, parties and receptions, please contact:

Marsha Whisler, Catering Manager641-724-1406 direct [email protected]

Page 17: CITYVIEW 21...2013/04/04  · Beautiful skin is essential, and with some expert tips, achieving it doesn’t have to be difficult. “On your wedding day, smooth, glowing skin is an

CITYVIEW APRIL 18 — 24, 2013 37

ADVERTISING SECTIONADVERTISING SECTION

Country Club Atmosphere

Clubhouse Seats up to 200

Outdoor Covered Patio Seats up to 150

Located on the Golf Course with Beautiful Views

Flexible Catering Options

State-of-the-Art Audio/Visual Equipment

Wedding Ceremonies & Receptions | Rehearsal DinnersBachelor/Bachelorette Golf Outings

Ken Norland | Sales and Events Manager515.263.1600 | [email protected]

4825 Copper Creek Drive | Pleasant Hill, IA 50327golfcoppercreek.com

the perfect setting for your perfect day

Wedding Daycharmunique

t r o l l e y c o .

Page 18: CITYVIEW 21...2013/04/04  · Beautiful skin is essential, and with some expert tips, achieving it doesn’t have to be difficult. “On your wedding day, smooth, glowing skin is an

38 CITYVIEW APRIL 18 — 24, 2013

ADVERTISING SECTION

2900 University AvenueClocktower Square ~ West Des Moinesletterperfectdm.com 515.223.6205

Letter Perfect

Letter Perfect

ttttoooo vvvviiiiisssiiittt uuusss aaaaannnnnddddd ssssseeeeeee ooouuuurrrr ooooooouuuuuttttttsssssssttttaaaannnnnnddddddddiiiiiiinnnnnnnnggggggggg aaaassssssssssooorrrrrrrrtttttttttmmmmmmmmmeeeeennnnttt ooofffff iiiiinnnnvvvviiiittttaaattttiiiiiiiooooooonnnnnssssssss

You’re Invited

EEEEEnnnnnnjjjjjjoooyyyy ppppprrrooofffffffeeeeessssssssiiioooonnnnnaaaaaaaallll aaaaaaaassssssiiisssstttttaaaaannncceeeeee iiiiiinnnnn mmmmmaaaaakkkiiiinnnnnggg aaaaaaaaaallllllllll yyyyyyoooooooouuurrrrrr dddddddddddeeeeeeecccciiiisssssiiiiiiooooooonnnnnnnsVVVVoootttteeeddddd ####1111 pppppllllaaaaaccceee ttttttoooo bbbbuuuuyyy iiinnnvvvviiiitttttaaaaattttttiiiiiiiiiioooooooonnnnssss iiiiiiiiinnnnnn DDDDeeeessssss MMMMMMMMMoooooooiiiiiinnnnnneeesssss bbbbbyyyyyyy

Des Moines Magazine

See our bridal invitation special on Facebook

OFFICIAL HOTEL OF ADVENTURELAND PARK

Begin yourAdventure

with us...

WWW.ADVENTURELAND-INN.COM

515-265-7321


Recommended