CHAPTER-4
IDENTIFICATION OF CHPV INTRAVIRAL INTERACTIONS
BY YEAST TWO-HYBRID SYSTEM
57
4.1 Introduction
The aim of the present study was to generate an unbiased data of interactions among
N, P, M and G proteins of CHPV. Studying protein-protein interactions of virus can facilitate
the understanding of the vital biological functions performed by the virus. The functional
analysis of VSV protein interactions has generated details about its life cycle and the various
steps in viral pathogenesis. The knowledge of CHPV life cycle and the functions of its
proteins have been contemplated from VSV. Although, VSV and CHPV are phylogenetically
related but they are markedly different in their host range (VSV is zoonotic virus, CHPV
infects humans) and pathogenesis which necessitates the need to generate precise and detailed
interaction information of the virus.
The functional significance of the interplay of viral proteins in CHPV life cycle
speculated from comparative studies are detailed as: The Nucleocapsid protein enwraps the
genomic RNA and protects it from degradation by RNases. It is maintained in soluble and
active form by its association with P protein which prevents the formation of N protein
aggregates. This association also confers specificity to N protein for its RNA-binding activity.
N protein also interacts with M protein and this association is important for encapsulating
ribonucleoprotein (RNP) cores. D’agostino and co-workers have proved that disrupting this
interaction can impair the viral assembly [82]. P protein is another important regulatory
protein that plays an indispensable role in viral transcription and replication and it does so by
interacting with other viral proteins. It also facilitates the binding of L protein with the N-
RNA template to form a tripartite complex required for genome transcription.
The M protein is a major structural protein of the virus and is known to connect the
viral envelope and the RNP core [83, 148] playing an important role in assembly [13, 14] and
budding of the virions. Self associations of viral proteins also hold importance in viral life
cycle like P protein self association is shown to be essential for transcriptional activity [86]. M
protein dimerisation plays role in the long range organization of M molecules which is
important for viral budding [85] and G protein self associates to form trimer molecules which
acts as viral spikes [87].
The protein interaction studies have been conducted for various viruses and these
studies have contributed in understanding the functions of uncharacterized proteins and their
role in viral infection [91, 93]. For CHPV, the only reported interactions include self-
association of N as well as P protein and N interaction with P protein [17, 18, 19, 20]. The
lack of information about the interactions of other proteins and as such lesser known biology
58
of the virus create the requirement for interaction analysis. In the present study, work has been
carried out to identify all the possible interactions among CHPV N, P, M and G proteins by
using yeast two-hybrid assay. The four proteins accounting for ten unique interaction pairs
were analyzed in sixteen combinations involving both BD and AD fusions for the prey. Y2H
analysis of these interacting pairs identified several interactions for Chandipura virus. Some of
the interactions have been identified for the first time for CHPV in this study.
59
4.2 Materials and methods
4.2.1 Host strains
MATCHMAKER GAL4 Two-Hybrid System 3 includes the yeast strains, AH109 and
Y187. Strain AH109 (MATa, trp1-901, leu2-3, 112, ura3-52, his3-200, gal4∆, gal80∆,
LYS2::GAL1UAS-GAL1TATA-HIS3, MEL1, GAL2UAS-GAL2TATA-ADE2, URA3::MEL1UAS-
MEL1TATA-lacZ) consists of three reporter genes (ADE2,HIS3 and MEL1) under the control
of three distinct GAL4 upstream activating sequences (UASs) and TATA boxes. Strain
Y187 (MATα, ura3-52, his3-200, ade2-101, trp1-901, leu2-3, 112, gal4∆, met–, gal80∆,
URA3::GAL1UAS-GAL1TATA-lacZ, MEL 1) contains the LacZ reporter gene under the
control of GAL1 UAS.
4.2.2 Yeast Two-Hybrid Vectors
The yeast expression vectors, pGBKT7 (BD vector, 7300 bps; Clontech) and
pGADT7 (AD vector, 7988 bps; Clontech) were used for cloning bait and prey templates,
respectively, for yeast two-hybrid analysis. The pGBKT7 plasmid expresses proteins fused to
GAL4 DNA binding domain (BD) with a c-myc epitope and the pGADT7 plasmid expresses
proteins fused to a GAL4 activation domain (AD) with a HA (hemagglutinin) epitope (Table
4.1). Following transformation and expression of bait-BD and prey-AD carrying plasmids in
yeast cells, both fusion proteins translocate to the nucleus of the yeast cells. The physical
interaction among bait and prey proteins brings BD and AD in close proximity to reconstitute
a functionally active transcription factor that binds specific activation sequences (UAS). In
the present system (which contains a GAL upstream activator sequence in yeast hosts), the
DNA-BD and AD when brought into close proximity, bind to UAS and activate the
transcription of ADE2 and HIS3 reporter genes that permit the growth of yeast on selective
media and MEL1 and LacZ reporter genes which allow blue/white selection.
60
Figure 4.1: Plasmid maps of pGBKT7 and pGADT7 vectors of Y2H system
Table 4.1: Characteristic features of BD and AD vectors
Features pGBKT7 (BD) vector pGADT7 (AD) vector
Size 7.3 kb 7.9 kb
Origin of replication pUC (for E. coli) and 2μ
ori (for S. cerevisiae)
pUC (for E. coli) and 2μ
ori (for S. cerevisiae)
Promoter ADH1 promoter (PADH1) ADH1 promoter (PADH1)
Antibiotic resistance Ampicillin (Ampr) Kanamycin (Kan
r)
Nutritional marker TRP1 LEU2
Tag c-myc HA
4.2.3 Control Vectors
Control vectors used for the Y2H analysis included the BD vectors pGBKT7-53 and
pGBKT7-Lam; and AD vector pGADT7-T (Clontech). The plasmids pGBKT7-53 and
pGBKT7-Lam encodes GAL DNA-BD fusions of murine p53 and human lamin C proteins,
respectively, while pGADT7-T encodes the large T-antigen of SV40 fused with GAL4 AD.
The known interactors p53 and large T-antigen [103, 149] were taken as positive interaction
control and the non interactors lamin C and large T-antigen [150, 151] were taken as negative
interaction control.
61
4.2.4 PCR amplification of viral genes
The open reading frames (ORFs) encoding CHPV N, P, M and G genes cloned in
CHPV N-pET33b, P-pET3a, M-pUC19 and G-pUC19 vectors, respectively, were amplified
using gene specific primers (Table 4.2). The details of these templates have been listed in
Chapter 3 (Section 3.2.2). All PCR reactions were performed in a final volume of 100 µl
using 0.5 pmol of each primer, 0.25 mM dNTPs (Sigma Aldrich), 6 U of Taq DNA
polymerase (Sigma Aldrich), 1 U of Pfu DNA polymerase (Promega) and 1 ng of template
DNA. The PCR products were purified using Qiagen PCR purification kit (Qiagen) as
described in Section 3.2.4.
Table 4.2: Primers for amplification of CHPV genes for cloning in BD and AD vectors
Gene specific primers used for PCR amplification of Chandipura Virus N, P, M and G genes (F- Forward primer
and R- Reverse primer). The names of the restriction enzymes are in italics and their recognition sequences in
bold.
S. No. Construct Oligo name Primer Sequence
1 BD-N N F Nde I (BD) 5′ GGAAGTGACATATGAGTTCTCAAGTATTCTGC 3′
N R BamH I (BD) 5′ GCTAACAGGATCCTCATGCAAAGAGTTTCCTGG 3′
2 BD-P P F Nde I (BD) 5′ GGAAGTGACATATGGAAGACTCGCAACTGTAT 3′
P R Sal I (BD) 5′ GGCACAAGTCGACTCAATTGAACTGGGGCTCAAG 3′
3 BD-M M F Nde I (BD) 5′ GGAAGTGACATATGCAAAGACTGAAGAAGTTTATAG 3′
M R Sal I (BD) 5′ GCACTATGTCGACTCAATGACTCTTAGAAATCAG 3′
4 BD-G G F Nde I (BD) 5′ GGAAGTGACATATGTATTTGAGTATAGCATTTCCAG 3′
G R Sal I (BD) 5′ GCACACTGTCGACTCATACTCTGGCTCTCATGTT 3′
5 AD-N N F Nde I (AD) 5′ GGAAGTGACATATGAGTTCTCAAGTATTCTGCATTT 3′
N R Xho I (AD) 5′ GGTGCATCTCGAGTCATGCAAAGAGTTTCCTGG 3′
6 AD-P P F Nde I (AD) 5′ GGAAGTGACATATGGAAGACTCGCAACTGTATCA 3′
P R Xho I (AD) 5′ GGTGCATCTCGAGTCAATTGAACTGGGGCTCAAG 3′
7 AD-M M F Nde I (AD) 5′ GGAAGTGACATATGCAACGTCTGAAGAAGTTTATAG 3′
M R EcoR I (AD) 5′GGTGCATGAATTCTCAATGACTCTTAGAAATCAGC 3′
8 AD-G G F Nde I (AD) 5′ GGAAGTGACATATGTATTTGAGTATAGCATTTCCAG 3′
G R EcoR I (AD) 5′ GCTAACAGAATTCTCATACTCTGGCTCTCATGTT 3′
62
4.2.5 Cloning of N, P, M and G genes in pGBKT7 and pGADT7 vectors
Purified PCR products of N, P, M and G genes (inserts) and their respective vectors
were digested with corresponding restriction enzymes (mentioned in Table 4.2) required for
cloning. Ligation was carried out at 1:5 (vector:insert) molar ratio with 100 ng of digested and
purified vector and the ligation mixture was transformed in E.coli DH5α cells. Recombinant
plasmid DNA was isolated from the transformed bacterial colonies and was screened by
restriction enzyme digestion. The genes were cloned in-frame downstream of BD-c-myc tag
of the pGBKT7 vector and AD-HA tag of pGADT7 vector, so as to generate BD-c-myc-bait
(BD-N, BD-P, BD-M and BD-G) and AD-HA-prey fusion proteins (AD-N, AD-P, AD-M and
AD-G), respectively. The detailed steps of cloning procedure have been discussed in Section
3.2.6.
4.2.6 Yeast two-hybrid analysis
Yeast two-hybrid analysis was performed according to the manufacturer’s instructions
for MATCHMAKER GAL4 Two-Hybrid System 3 (Clontech).
4.2.6.1 Yeast strain maintenance, recovery from frozen stocks, and routine culturing
Glycerol stocks of yeast cultures were prepared by resuspending a loopful of inoculum
in 500 µl of YPD (1% yeast extract, 2% peptone and 2% dextrose; for untransformed S.
cerevisiae strains AH109 and Y187) or SD (Selectively Deficient or Synthetically Defined)
medium (2.6% minimal SD base and 1X appropriate dropout supplement; for transformed
AH109 and Y187 cells) taken in a 1 ml cryovial. Sterile 50% glycerol was then added to
obtain a final concentration of 25% and the vial was vortexed vigorously to thoroughly
disperse the cells before freezing at -80 °C. The cultures were revived by streaking a loopful
of their glycerol stock on YPD or SD agar plates and incubating them at 30 °C until the
colonies grew 2-3 mm in diameter (~3-5 days). The revived cultures were maintained by
routinely culturing them on appropriate media.
4.2.6.2 Preparation of yeast competent cells
Frozen stocks of Y187/ AH109 S. cerevisiae yeast cells were streaked on YPDA agar
plates (2% peptone, 1% yeast extract, 2% dextrose, 0.2% adenine hemisulphate and 2% agar)
and incubated at 30 °C for 3-5 days until yeast colonies had reached ~2 mm in diameter.
Competent cells were prepared by inoculating several Y187/AH109 colonies (2-3 mm in
63
diameter) into 5 ml of YPDA medium. The culture was then vortexed for 5 minutes to
disperse any clumps and incubated at 30 °C and 230 rpm for 16-20 hours until absorbance at
OD600 was >1.5. Following overnight incubation the cultures were diluted into fresh 50 ml
YPDA medium to obtain an OD600 value of 0.2-0.3 and were further incubated at 30 °C and
230 rpm for ~3 hours until the OD600 reached 0.4-0.6. The cultures were then centrifuged at
6000 rpm for 5 minutes at room temperature and the cell pellet was resuspended in 25 ml (half
the culture volume) of autoclaved distilled water. Following centrifugation at 6000 rpm for 5
minutes at room temperature, the supernatant was discarded and the yeast pellet was
resuspended in 225 µl of freshly prepared 1X TE/LiAc (10 mM Tris, 0.1 mM EDTA, 0.1 M
LiAc, pH 7.5; for 50 ml culture) to attain competency. These cells were used immediately for
transformation.
4.2.6.3 PEG/LiAc yeast transformation
Competent Y187 (for BD vector fusion constructs)/AH109 (for AD vector fusion
constructs) yeast cells (100 µl) were mixed with ~0.1 µg of plasmid DNA to be transformed,
10 μl of 10 mg/ml denatured Herring testes carrier DNA (denatured by heating at 100 °C for
10 minutes) and 600 μl of PEG/LiAc (1X TE/LiAc and 40% PEG 3350) in 1.5 ml
microcentrifuge tube. Tubes were gently vortexed and then incubated in a slanting position at
30 °C and 230 rpm for 30 minutes. Following incubation, 70 μl DMSO was added and gently
mixed by inversion. The cells were then given a heat shock at 42 °C for 15 minutes and
chilled on ice for 2-3 minutes. The mixture was centrifuged at 13,000 rpm for 15 seconds at
room temperature. The supernatant was discarded and the pellet was resuspended in 500 μl of
1X TE. The transformation mixture (200 μl) was finally plated on either SD/-Trp (for
pGBKT7 transformants) or SD/-Leu (for pGADT7 transformants) agar plates. The plates were
incubated at 30 °C for 3-4 days until colonies appeared.
4.2.6.4 Preparation of yeast cultures for protein extraction
Transformed yeast cells were inoculated in 5 ml of appropriate SD selection medium
and incubated at 30 °C and 220 rpm overnight (primary culture). Corresponding volume of
overnight culture was added to 50 ml of YPDA medium such that the initial OD600 value was
0.2-0.3 (secondary culture). The secondary culture was further incubated at 30 °C and 220
rpm until the OD600 reached 0.4-0.6. The culture was then chilled by pouring into a prechilled
falcon and was centrifuged at 4 °C and 6000 rpm for 5 minutes. The supernatant was
64
discarded and the cell pellet was resuspended in 50 ml of ice-cold autoclaved distilled water.
The pellet was recovered by centrifugation at 4 °C and 6000 rpm for 5 minutes and
immediately chilled and finally stored at -80 ºC. Each and every step during the preparation of
the yeast cultures for protein expression was performed at 4 °C to avoid proteolysis.
4.2.6.5 Yeast protein extraction (Urea/SDS method)
The yeast cells were quickly thawed by adding complete cracking buffer [8 M Urea,
5% w/v SDS, 40 mM Tris-HCl pH 6.8, 0.1 mM EDTA, 0.4 mg/ml Bromophenol blue, 0.88%
β-mercaptoethanol, protease inhibitor solution (Sigma Aldrich), 5X PMSF] prewarmed at 60
°C. The total number of OD600 units for a given culture was calculated by multiplying the
OD600 value of 1 ml sample with the culture volume. Since 100 μl of complete cracking buffer
is to be added per 7.5 OD600 units of cells, the total number of OD600 units were divided by 7.5
and the quotient multiplied with 100 to determine the quantity (in μl) of prewarmed complete
cracking buffer to be added to the pellet. Each cell pellet was thawed in the prewarmed
cracking buffer at 60 °C for not more than 2 minutes to avoid proteolysis. Additional aliquots
of PMSF (1X) were added every 7 minutes until the samples were ready to be analysed by
SDS-PAGE or stored at -80 °C, since the initial excess PMSF (5X) in the cracking buffer
degrades quickly because of short half life. Each cell suspension was transferred to a 1.5 ml
microcentrifuge tube containing 80 μl of glass beads (Sigma Aldrich) per 7.5 OD600
units of cells. The samples were then heated at 70 °C for 10 minutes to free the membrane
associated proteins and mixed vigorously by vortexing for 1 minute. Debris and unbroken
cells were pelleted by centrifugation at 4 °C and 14,000 rpm for 5 minutes and the
supernatants were transferred to clean 1.5 ml microcentrifuge tubes placed on ice (first
supernatants). These first supernatants were boiled at 100 °C in a water bath for 3-5 minutes,
vortexed vigorously for 1 minute and subsequently centrifugation at 4 °C and 14,000 rpm for
5 minutes. The supernatants obtained for the second time (second supernatants) were
combined with the first supernatants. The samples were boiled at 100 °C for 10 minutes and
loaded on 10% SDS-PAGE or stored at -80 °C.
65
4.2.6.6 SDS-PAGE and Western Blot Analysis
SDS-PAGE and Western blotting were performed as explained in Section 3.2.9. The
expression of proteins extracted from the yeast cells were detected with mouse monoclonal
anti c-myc (for BD fusion proteins; 1: 2000 dilution, Sigma Aldrich) or mouse monoclonal
anti HA (for AD fusion proteins; 1:1000 dilution, Santa Cruz, USA) antibodies.
4.2.6.7 Autoactivation Analysis
Autoactivation is the independent activation of the HIS3 reporter by either the DNA-
BD or AD fusion construct in the absence of the other partner. Autoactivation by BD and AD
constructs of CHPV N, P, M and G proteins was tested by independently transforming them
into Y187/ AH109 yeast cells and plating on SD/-Trp/-His and SD/-Leu/-His media,
respectively. Empty BD and AD vectors were taken as negative controls.
4.2.6.8 Screening of protein-protein interactions
BD and AD fusion constructs were transformed in yeast cells by two methods i.e.,
sequential transformation and yeast mating.
4.2.6.8.1 Sequential transformation
The DNA-BD/bait plasmid was transformed in competent AH109 yeast cells
following the transformation protocol explained in Section 4.2.6.3. The AH109 cells
transformed with BD plasmid were then made competent (Section 4.2.6.2) and the DNA-
AD/prey plasmid was transformed into them. The transformants were plated at first on SD/-
Trp/-Leu media and incubated at 30 ºC for 3-5 days to check for successful transformation.
The interaction among the bait and prey proteins was identified by screening the
transformants on SD/-Trp/-Leu/-His media.
4.2.6.8.2 Yeast Mating
A loopful of Y187 and AH109 cells transformed with BD/bait and AD/prey plasmids,
respectively, were inoculated in 500 µl of YPDA media taken in a 1.5 ml microcentrifuge
tube. The cells were resuspended by vortexing and then incubated at 30 °C overnight
(16–20 hours) with shaking at 220 rpm. Aliquots of 100 µl of the mated clones were
plated on SD/-Trp/-Leu media to ensure successful mating. Finally, the interacting partners
were screened on SD/-Trp/-Leu/-His media. The plasmids, pGBKT7-53 and pGADT7-T
66
encoding the known interacting tumor suppressor protein p53 and Simian Virus 40 (SV40)
large T-antigen fused with BD and AD domains, respectively were used as positive control,
whereas pGBKT7-Lam and pGADT7-T which encode the non-interacting proteins Lamin and
SV40 large T-antigen, served as negative control for interaction studies.
4.2.6.9 Alpha-galactosidase assay
The interaction among bait and prey proteins results in the activation of GAL4
promoter. Y187 and AH109 cells secrete α-galactosidase enzyme in response to GAL4
activation, which can be detected on medium containing X-α-gal (Clontech). The mated
clones were screened for α-galactosidase activity by plating them on X-α-gal indicator plates
which were prepared by adding 20 µg/ml of X-α-gal in dimethylformamide (Appendix A) to
sterile SD triple dropout media (SD/-Trp/-Leu/-His). The plates were incubated at 30 °C and
the appearance of blue coloured colonies indicated the secretion of α-galactosidase. BD-p53
and AD-T interacting pair was taken as positive interaction control while BD-Lam and AD-T
was taken as non-interaction control. Plasmid pCL 1 which encodes the full length GAL4
protein, transformed in AH109 was taken as positive experimental control for α-galactosidase
assay.
67
4.3 Results
4.3.1 Generation of CHPV fusion constructs
Potential interactions among CHPV proteins were identified by cloning N, P, M and G
genes in yeast two-hybrid vectors; pGBKT7 (bait) having GAL4 DNA binding domain (BD)
and pGADT7 (prey) having GAL4 DNA activation domain (AD). Each ORF encoding CHPV
protein was PCR amplified using gene specific primers incorporating appropriate restriction
enzyme sites which enabled cloning in pGBKT7 and pGADT7 vectors. Following
amplification the products were analyzed on 1.2% agarose gel and were observed at their
expected sizes (Figure 4.2) [N (1200 bp), P (800 bp), M (690 bp) and G (1500 bp)]. The PCR
products were purified using Qiagen PCR purification kit and digested with corresponding
restriction enzymes. Subsequently, the digested amplicons were once again purified and
finally cloned in respective vectors (BD or AD) using T4 DNA ligase as discussed in Section
4.2.5. The recombinant clones were then transformed in competent E. coli DH5α cells and
screened on LB agar plates containing appropriate antibiotics (50 µg/ml kanamycin for BD
transformants and 100 µg/ml ampicillin for AD transformants).
Cloning was confirmed by isolating the recombinant plasmid DNA from E. coli cells
and subjecting them to restriction enzyme digestion. Insert release at 1200 bp on digestion
with Nde I and BamH I enzymes confirmed the cloning of construct BD-N (Figure 4.3).
Likewise, insert release at 800 bp, 690 bp and 1500 bp on digestion with Nde I and Sal I
enzymes confirmed the cloning of P, M and G genes in BD vector, respectively (Figure 4.4
and 4.5). Similarly, the cloning of N and P genes and M and G genes in AD vector was
validated by digestion with Nde I/ Xho I and Nde I/ EcoR I enzyme combinations,
respectively. The insert release at 1200 bp, 800 bp, 690 bp and 1500 bp corresponded to N, P,
M and G genes (Figure 4.6, 4.7 and 4.8). Only BD and AD vectors were also digested with the
same enzyme combinations and used as controls. Constructs generated by cloning N, P, M
and G genes in BD vector were named as BD-N, BD-P, BD-M and BD-G, respectively and
AD- prey fusion constructs were named as AD-N, AD-P, AD-M and AD-G, respectively.
68
(a) (b)
Figure 4.2: PCR amplification of N, P, M and G genes of CHPV
CHPV genes were PCR amplified with gene specific primers for cloning in BD and AD vectors. Panel (a)
represents amplification of genes with primers for BD vector. Lane 2, 3, 4 and 5 shows the amplified G, P, M
and N genes, respectively. Panel (b) represents the amplification of CHPV genes with primers for AD vector.
Lane 1, 2, 3 and 4 shows the amplified G, M, P and N genes, respectively. All the genes were observed at their
expected sizes. N gene (1200 bp), P gene (800 bp), M gene (690 bp) and G gene (1500 bp). L1 and L2 is 1 kb
DNA ladder (a; L2, Sigma Aldrich, b; L1, Fermentas, Molecular sizes are indicated).
Figure 4.3: Restriction digestion of BD-N using Nde I and BamH I
Recombinant plasmid DNA isolated from E. coli DH5α cells were digested with Nde I and BamH I enzymes to
confirm cloning of N gene in BD vector. Lane 1, 2, 3 represent the positive clones for BD-N showing the
released fragment at the size of N gene i.e., 1.2 kb. C (control) is the empty BD vector digested with the same
enzyme combination, L1 is 1 kb DNA ladder (Fermentas; Molecular sizes are indicated).
69
Figure 4.4: Restriction digestion of BD-P using Nde I and Sal I
Cloning of P gene in BD vector was validated by digesting the recombinant plasmid DNA with Nde I and Sal I
enzymes. Lane 2-6 represents the different minipreps of BD-P. Released fragment at the size of P gene (0.8 kb)
is seen in lanes 2-5. Mini P5 (lane 6) is negative. Lane 7 is the control BD vector. L is 100 bp DNA ladder; L2 is
1 kb DNA ladder (Sigma Aldrich; Molecular sizes are indicated).
Figure 4.5: Restriction digestion of BD-M and BD-G using Nde I and Sal I
Restriction enzyme digestion was performed for the screening of BD-M and BD-G recombinants using Nde I
and Sal I. Lanes 3-7 represent the minipreps tested for BD-G while lanes 8-11 show the minis tested for BD-M.
The fragment is released at the size of the genes i.e., 1.5 kb for G gene and 0.7 kb for M gene. L1 is 1 kb DNA
ladder (Fermentas; Molecular sizes are indicated). C is the control BD vector
70
Figure 4.6: Restriction digestion of AD-N recombinants using Nde I and Xho I
The plasmid DNAs were digested with Nde I and Xho I enzymes to screen for positive recombinant clones of
AD-N. Lanes 3-7 represent the digested minipreps showing the released fragment at 1.2 kb for N gene. L1 is 1
kb DNA ladder (Fermentas; Molecular sizes are indicated). C is the control AD vector digested with the same
enzyme combination.
Figure 4.7: Restriction digestion of AD-P using Nde I and Xho I
AD-P recombinants were validated by restriction enzyme digestion of plasmid DNAs using Nde I and Xho I
enzymes. Lanes 1-10 are the digested minis, the released fragment (0.8 kb) is observed in lanes 4 and 8. Lane 11
is the control AD vector. L1 is 1 kb DNA ladder (Fermentas; Molecular sizes are indicated).
71
.
Figure 4.8: Restriction digestion of AD-M and AD-G using Nde I and EcoR I
Screening for recombinants of AD-M and AD-G fusions was carried out by restriction enzyme digestion using
Nde I and EcoR I. lanes 1-8 represent the digested minipreps for AD-M showing released fragment at the size of
M gene i.e., 0.7 kb while lanes 9-11 show the digested minipreps for AD-G with released fragment at the size of
G gene i.e., 1.5 kb. Lane 12 is the empty AD vector digested with the same enzymes. L1 is 1 kb DNA ladder
(Fermentas; Molecular sizes are indicated).
4.3.2 Interaction analysis using yeast two-hybrid system
The Y2H bait (pGBKT7) and prey (pGADT7) vectors encoding the CHPV ORF’s (N,
P, M and G) were transformed in competent Y187 and AH109 cells and selected on SD/-Trp
(Figure 4.9) and SD/-Leu (Figure 4.10) medium, respectively. Plasmids pGBKT7 and
pGADT7 without inserts (only vectors) and pGBKT7-53, pGBKT7-Lam and pGADT7-T
control vectors were also transformed in competent Y187 and AH109 cells.
Figure 4.9: Selection of BD fusion transformants on SD/-Trp agar plates
CHPV N, P, M and G genes as BD fusions were transformed in Y187 strain of yeast cells by PEG/LiAc method
and selected on SD/-Trp agar plates (clockwise from top left; BD-N, BD-P, BD-M and BD-G).
72
Figure 4.10: Selection of AD fusion transformants on SD/-Leu agar plates
Recombinant AD vectors carrying CHPV N, P, M and G genes were transformed in AH109 strain of yeast cells
and selected on SD/-Leu agar plates (clockwise from top left; AD-N, AD-P, AD-M and AD-G).
The expression of BD-N, BD-P, BD-M and BD-G proteins in yeast Y187 cells and
AD fusion proteins in yeast AH109 cells was confirmed prior to proceeding with interaction
studies. Yeast cells harbouring recombinant vectors were lysed and the extracted cellular
proteins were analyzed by 10% SDS-PAGE and Western blotting. Western blotting was
performed using anti c-myc (BD) and anti HA (AD) mAbs and all the proteins were detected
at their expected sizes [protein size with additional ~25 kDa for BD + c-myc tag and AD +
HA tag; N protein: 72 kDa, P protein: 58 kDa (observed at higher size), M protein: 51 kDa, G
protein: 94 kDa, Figure 4.11 and 4.12 for BD and AD fusions, respectively]. BD-P (Figure
4.11 lane 2) and AD-P (Figure 4.12 lane 3) were observed at a higher size due to the aberrant
mobility of P protein as explained previously in Section 3.3.2.
Figure 4.11: Expression of viral genes with BD fusion in Y187 yeast strain
The expression of BD fusion proteins in Y187 yeast cells was checked by Western blotting using anti c-myc
mAbs. Lane 1: BD-N; ~72 kDa, Lane 2: BD-P; ~58 kDa, Lane 3: BD-M; ~51 kDa, Lane 4: BD-G; ~94 kDa. M
is prestained protein ladder (Fermentas; molecular sizes are indicated in kDa).
73
Figure 4.12: Expression of viral genes with AD fusion in AH109 yeast strain
The expression of AD fusion proteins in AH109 yeast cells was checked by Western blotting using anti-HA
mAbs. Lane 2: AD-G; ~94 kDa, Lane 3: AD-M; ~51 kDa, Lane 4: AD-P; ~58 kDa, Lane 5: AD-N; ~72 kDa. M
is prestained protein ladder (Fermentas; molecular sizes are indicated in kDa).
Following expression, all fusion constructs (both BD and AD) were checked for
autoactivation of the HIS3 reporter gene. The interaction of either the BD construct or the AD
construct (in the absence of the other) with transcriptional factors bound to TATA boxes leads
to basal transcriptional activity which activates the HIS3 reporter gene, a process termed as
autoactivation. In order to rule out this possibility, which otherwise might lead to false
positive results, all BD fusion constructs transformed in Y187 cells were plated on SD/-Trp/-
His media and all AD fusion constructs transformed in AH109 cells were plated on SD/-Leu/-
His media. Except for BD-P, none of the other constructs were found to activate the reporter
gene alone as indicated by the absence of growth on corresponding SD plates. Only BD-P was
found to directly activate the reporter gene (Figure 4.13) in the absence of any AD fusion
partner. However AD-P did not exhibit such property and hence studies involving P protein
were completed using AD-P.
74
Figure 4.13: Autoactivation exhibited by BD-P fusion protein
Y187 yeast cells expressing BD-P fusion protein was observed to grow on SD/-Trp/-His media indicating the
activation of the reporter gene HIS3, in the absence of any AD partner.
Subsequently, two different Y2H strategies were employed for transformation of BD
and AD vectors in yeast cells; sequential transformation and mating. Both these methods were
standardized with positive (pGBKT7-53 + pGADT7-T) and negative (pGBKT7-Lam +
pGADT7-T) interaction controls to assess the reproducibility of the results. However, due to
simplicity, yeast mating method was chosen over sequential transformation.
A total of 16 combinations of protein pairs were generated by mating Y187
(transformed with BD constructs of N, P, M and G) and AH109 (transformed with AD
constructs of N, P, M and G) [Figure 4.14] yeast cells. In addition to the above 16
combinations, the Y187 (transformed with BD constructs of N, P, M and G) and AH109
(transformed with AD constructs of N, P, M and G) yeast cells were mated with cells
harbouring only AD (AH109) and BD (Y187) vectors, respectively (Figure 4.15 (a) and (b),
respectively). Besides the test and control matings, the matchmaker system interaction
controls [pGBKT7-53 with pGADT7-T and pGBKT7-Lam with pGADT7-T; Figure 4.15 (c)]
were also considered for interaction analysis. Transformed haploid yeast strains (Y187 &
AH109) selected on SD/-Trp and SD/-Leu plates were mated together and the resulting
diploids were selected on SD media deficient in tryptophan and leucine (SD/-Trp/-Leu).
Growth on this medium indicated the presence of both the plasmids irrespective of any protein
interaction.
75
(a) (b)
(c) (d)
Figure 4.14: Mating among Y187 and AH109 cells expressing CHPV N, P, M and G proteins as BD and AD
fusions, respectively.
CHPV N, P, M and G genes as BD and AD fusions transformed in S. cerevisiae strains Y187 and AH109,
respectively, were mated together in all possible combinations and spread on SD/-Trp/-Leu agar plates to screen
for the presence of both the plasmids. (a): AD-N with BD-N, BD-P, BD-M and BD-G. (b): AD-P with BD-N,
BD-P, BD-M and BD-G. (c): AD-M with BD-N, BD-P, BD-M and BD-G. (d): AD-G with BD-N, BD-P, BD-M
and BD-G.
76
(a) (b)
(c)
Figure 4.15: Mating of yeast cells expressing CHPV N, P, M and G proteins with the cells harbouring control
vectors
CHPV N, P, M and G genes as BD and AD fusions transformed in S. cerevisiae strains Y187 and AH109,
respectively, were mated with yeast cells transformed with only AD and BD vectors and spread on SD/-Trp/-Leu
plates to screen for the presence of both the plasmids. (a): BD-N, P, M and G with only AD. (b): AD-N, P, M
and G with only BD. (c): pGADT7-T with pGBKT7-Lam and pGBKT7-53.
The diploid clones were screened for interacting proteins by plating on SD/-Trp/-Leu/-
His media. Growth was monitored for 2 weeks and the protein pair expressed in the diploid
clone growing on histidine deficient plates was considered as a positive interacting pair.
Isolated colonies of mated diploids were further amplified on histidine deficient media. Each
interaction was considered from both directions (as both bait and prey fusion), accounting for
10 unique protein pairs. Diploid clones carrying protein pairs which included BD-P grew on
triple dropout medium because of the autoactivation shown by BD-P (Figure 4.16 sectors 1,
17, 18, 19 and 20). The studies involving P protein interaction with N, M and G proteins were
thus considered wherein the interacting partner was AD-P. In order to attain further stringency
and also to eliminate potential false positives, two reporter genes under the control of different
promoters were employed i.e., HIS3 and MEL1. While HIS3 provided nutritional selection on
77
histidine deficient medium (Figure 4.16), MEL1 was used for blue/white screening by α -
galactosidase assay (Figure 4.17). All possible combinations among four viral proteins with
controls were streaked in patches on SD/-Trp/-Leu/-His/α-gal plate and the plate was
incubated at 30 °C. Interaction among pGBKT7-53 and pGADT7-T was taken as positive
control while pGBKT7- Lamin and pGADT7-T served as negative interaction control (Figure
4.17; sectors 25 and 26). A total of 6 interactions were observed to be positive by yeast two-
hybrid system (Table 4.3 and 4.4). These constitute NN, NP, NM, NG, MM and GG
interactions, four of these interactions (NM, NG, MM and GG) were novel for CHPV.
Although PP interaction was observed in Y2H, due to the autoactivation shown by the BD-P
protein this interaction was not conclusively positive. The results of intraviral protein
interaction analysis for CHPV have been summarized in Table 4.3 for all possible 16 pairs
and in Table 4.4 for 10 unique interacting pairs. The interactions identified by Y2H were
further confirmed by other assays which are detailed in Chapter-5.
78
Sector Bait Prey Sector Bait Prey Sector Bait Prey
1 P Empty vector 9 N P 17 P P
2 N Empty vector 10 N N 18 P N
3 M Empty vector 11 N M 19 P M
4 G Empty vector 12 N G 20 P G
5 Empty vector P 13 M N 21 G P
6 Empty vector N 14 M M 22 G N
7 Empty vector M 15 M P 23 G M
8 Empty vector G 16 M G 24 G G
Figure 4.16: Interaction screening results for CHPV N, P, M and G proteins
The yeast strains Y187 and AH109 harbouring recombinant bait and prey vectors encoding CHPV N, P, M and
G genes were systematically mated with each other, and the diploid cells were screened for the activation of
reporter gene HIS3 on SD/-Trp/-Leu/-His plates. Each protein was tested as both bait and prey fusion for a test
interaction. Presence of growth on medium lacking histidine indicated interaction between the proteins while
absence indicates no interaction. Sectors with P gene in bait vector (1, 17, 18, 19 and 20) are showing growth due
to autoactivation of reporter gene by BD-P.
79
Sector Bait Prey Sector Bait Prey Sector Bait Prey
1 N N 10 M P 19 M Empty vector
2 N P 11 M M 20 G Empty vector
3 N M 12 M G 21 Empty vector N
4 N G 13 G N 22 Empty vector P
5 P N 14 G P 23 Empty vector M
6 P P 15 G M 24 Empty vector G
7 P M 16 G G 25 p53 T antigen
8 P G 17 N Empty vector 26 Lamin T antigen
9 M N 18 P Empty vector
Figure 4.17: X-alpha galactosidase assay for interaction confirmation
All possible interacting pairs among CHPV viral proteins along with controls were plated on X-α gal (SD/-Trp/-
Leu/-His/α gal) medium. Formation of blue coloured colonies further confirmed the putative positive interactions
observed in Y2H analysis while absence of colour was an indication for non-interacting protein pair. Sectors 17-
26 represent the controls taken for the assay. Sectors with P gene in bait vector (5, 6, 7, 8 and 18) are showing
blue colouration due to autoactivation of reporter gene by BD-P.
80
Table 4.3: Results of viral-viral protein interaction analysis of CHPV
+: represents positive interaction
- : represents negative interaction
? : represents growth due to autoactivation of BD-P
N, P, M and G proteins were taken both as bait and prey fusions in the Y2H analysis. The first protein partner in
the pair was bait (BD fusion protein) and the second was prey i.e., AD fusion protein. Y2H assay was performed
using two independent reporter genes i.e., HIS3 and MEL1.
81
Table 4.4: Summarized results of viral-viral protein interaction analysis of CHPV
+: represents positive interaction
-: represents negative interaction
?: inconclusive
82
4.4 Discussion
The outcome of most of the biological processes is determined by protein-protein
interactions, which occur when two proteins bind to each other in a highly specific manner.
Although viruses are very simple entities, it is the systematic orchestration of the interactions
among their encoded proteins that they gain access to highly complex eukaryotic cells such as
those of humans, replicate within them and cause diseases whilst evading the cellular immune
surveillance. The revelation of these protein interactions can thus help in gaining insight into
viral architecture and pathogenesis. Different experimental techniques have been developed to
unravel the global picture of protein interactions in the cell. Some of them characterize
individual protein interactions while others are advanced for screening interactions on a
genome-wide scale.
Among different interaction analysis methodologies, yeast two-hybrid (Y2H)
screening remains the most practical and efficient tool to identify interacting partners because
it allows high-throughput screening in addition to being very sensitive for the identification of
transient interactions [99, 152, 153]. Comprehensive Y2H studies for the identification of
intraviral protein interactions have been carried out for many viruses which include Vaccinia
virus [154], SARS Coronavirus [93], Epstein barr virus [92] and Kaposi’s sarcoma associated
herpesvirus [91] and provided a framework to study potential interactions among viral
proteins and their functional roles.
In this chapter, Y2H analysis was performed in an unbiased manner, considering all
possible combinations of CHPV N, P, M and G proteins in order to identify the interactions
among them. A total of six interactions (NN, NP, NM, NG, MM and GG) have been identified
among the four viral proteins which included the previously documented interactions among
N and P proteins [17, 18, 19, 20]. The reproducibility of the reported associations in the
present study validated the approach of interaction analysis by Y2H. Among the four novel
interactions identified (NM, NG, MM and GG), NG interaction is being reported for the first
time for the family Rhabdoviridae. Although there had been some indirect evidences earlier
regarding the possible contact of N and G proteins such as the cross linking experiments
performed by Mudd and Swanson in 1978 which suggested the possible association of N and
G proteins in VSV [155] and virus structure assembly studies by Barge and co-workers in
1993, which also suggested a possible contact between the ribonucleoprotein complex and
cytoplasmic tail of G protein via N protein [156]. Since, the system employed in the present
study for PPI analysis dealt with pairwise binary interactions among two proteins, the
83
interaction between the core nucleocapsid protein (N) and membrane glycoprotein (G) could
be considered relevant in the absence of M protein as observed among the viruses of the
family Bunyaviridae (which include matrix protein deficient viruses) [157]. On the basis of
the available literature and the outcome of the present study, it was thus hypothesized that the
cytoplasmic tail of CHPV G protein could associate with the N protein through the lateral
spaces between the subunits of M helix.
As NG interaction, the self associations of viral membrane proteins M and G, also
identified in this study, could have an important role in virion assembly and/or virion
membrane biogenesis since matrix protein dimerisation is required for membrane integrity
[85] and the functionally active trimeric form of G protein is required for receptor
identification and membrane fusion [91]. Previous studies suggested that the interaction
among N and M proteins provides stability and rigidity to the nucleocapsid core and outer
matrix of the virion [158]. Together the functional relevance of the six interactions (NN, NP,
NM, NG, MM and GG) identified by Y2H have been justified.