Transcript
Page 1: CELL LINE AUTHENTICATION REPORT...CELL LINE AUTHENTICATION REPORT Genomics Unit of Technology Centre, Institute for Molecular Medicine Finland (FIMM), has authenticated the cell lines

CELL LINE AUTHENTICATION REPORT

Genomics Unit of Technology Centre, Institute for Molecular Medicine Finland (FIMM), has

authenticated the cell lines / samples HEL24.3, HEL24.3-SOX2-ntdT and HEL24.3-OCT4-nEmGFP with the

Promega GenePrint10 System.

The Promega GenePrint10 system allows co-amplification and detection of ten human loci (9 STR loci

and Amelogenin for gender identification). These loci collectively provide a genetic profile with a

random match probability of 1 in 2.92 x 109.

The results obtained were compared to results found in ATCC STR database of Human Cell Lines, JCRB

STR database of Human Cell Lines, ICLC STR database of Human Cell Lines (CLIMA 2.1 search available at

hhtp://bioinformatics.hsanmartino.it/clima2/ ) and the DSMZ Online STR database

(http://www.dsmz.de/services/services-human-and-animal-cell-lines/online-str-analysis.html . The

identity estimates are calculated according to the allele information found in these sources.

HEL24.3

SAMPLE COMPARING

TO ASSAY

OBSERVED GENOTYPE

EXPECTED GENOTYPE

HEL24.3 CCD-1112Sk

/ HEL24.3 AMEL X/Y X/Y

HEL24.3 CCD-1112Sk

/ HEL24.3 CSF1PO 10/10 10/10

HEL24.3 CCD-1112Sk / HEL24.3

D13S317 12/12 12/12

HEL24.3 CCD-1112Sk

/ HEL24.3 D16S539 11/12 11/12

HEL24.3 CCD-1112Sk

/ HEL24.3 D21S11 29/29

HEL24.3 CCD-1112Sk

/ HEL24.3 D5S818 11/12 11/12

HEL24.3 CCD-1112Sk

/ HEL24.3 D7S820 8/10 8/10

HEL24.3 CCD-1112Sk

/ HEL24.3 TH01 7/9.3 7/9.3

HEL24.3 CCD-1112Sk

/ HEL24.3 TPOX 11/11 11/11

HEL24.3 CCD-1112Sk

/ HEL24.3 VWA 16/18 16/18

Page 2: CELL LINE AUTHENTICATION REPORT...CELL LINE AUTHENTICATION REPORT Genomics Unit of Technology Centre, Institute for Molecular Medicine Finland (FIMM), has authenticated the cell lines

18/18 expected and detected alleles were identical, giving an overall identity estimate of 100 %.

Therefore the HEL24.3 cell line can be confirmed to be identical to CCD-1112Sk (ATCC®CRL-2429™)

reported to be its origin in Trokovic et al. Stem Cell Research (2015)15:266-268 (>80% allelic identity

needed for confirmation according to the International Cell Line Authentication Committee (ICLAC)

guidelines. Information for marker D21S11 for this cell line was not found in the above mentioned

databases.

HEL24.3-SOX2-ntdT

SAMPLE COMPARING

TO ASSAY

OBSERVED

GENOTYPE

EXPECTED

GENOTYPE

HEL24.3-SOX2-ntdT CCD-1112Sk

/ HEL24.3 AMEL X/Y X/Y

HEL24.3-SOX2-ntdT CCD-1112Sk

/ HEL24.3 CSF1PO 10/10 10/10

HEL24.3-SOX2-ntdT CCD-1112Sk

/ HEL24.3 D13S317 12/12 12/12

HEL24.3-SOX2-ntdT CCD-1112Sk

/ HEL24.3 D16S539 11/12 11/12

HEL24.3-SOX2-ntdT CCD-1112Sk / HEL24.3

D21S11 29/29

HEL24.3-SOX2-ntdT CCD-1112Sk

/ HEL24.3 D5S818 11/12 11/12

HEL24.3-SOX2-ntdT CCD-1112Sk

/ HEL24.3 D7S820 8/10 8/10

HEL24.3-SOX2-ntdT CCD-1112Sk / HEL24.3

TH01 7/9.3 7/9.3

HEL24.3-SOX2-ntdT CCD-1112Sk

/ HEL24.3 TPOX 11/11 11/11

HEL24.3-SOX2-ntdT CCD-1112Sk

/ HEL24.3 VWA 16/18 16/18

18/18 expected and detected alleles were identical, giving an overall identity estimate of 100 %.

Therefore the HEL24.3-SOX2-ntdT cell line can be confirmed to be identical to HEL24.3 and CCD-1112Sk

(ATCC®CRL-2429™) reported to be its origin in Trokovic et al. Stem Cell Research (2015)15:266-268

(>80% allelic identity needed for confirmation according to the International Cell Line Authentication

Committee (ICLAC) guidelines. (>80% allelic identity needed for confirmation according to the

International Cell Line Authentication Committee (ICLAC) guidelines. Information for marker D21S11 for

this cell line was not found in the above mentioned databases.

Page 3: CELL LINE AUTHENTICATION REPORT...CELL LINE AUTHENTICATION REPORT Genomics Unit of Technology Centre, Institute for Molecular Medicine Finland (FIMM), has authenticated the cell lines

HEL24.3-OCT4-nEmGFP

SAMPLE COMPARING

TO ASSAY

OBSERVED

GENOTYPE

EXPECTED

GENOTYPE

HEL24.3-OCT4-nEmGFP CCD-1112Sk /

HEL24.3 AMEL X/Y X/Y

HEL24.3-OCT4-nEmGFP CCD-1112Sk /

HEL24.3 CSF1PO 10/10 10/10

HEL24.3-OCT4-nEmGFP CCD-1112Sk /

HEL24.3 D13S317 12/12 12/12

HEL24.3-OCT4-nEmGFP CCD-1112Sk /

HEL24.3 D16S539 11/12 11/12

HEL24.3-OCT4-nEmGFP CCD-1112Sk /

HEL24.3 D21S11 29/29

HEL24.3-OCT4-nEmGFP CCD-1112Sk /

HEL24.3 D5S818 11/12 11/12

HEL24.3-OCT4-nEmGFP CCD-1112Sk /

HEL24.3 D7S820 8/10 8/10

HEL24.3-OCT4-nEmGFP CCD-1112Sk /

HEL24.3 TH01 7/9.3 7/9.3

HEL24.3-OCT4-nEmGFP CCD-1112Sk /

HEL24.3 TPOX 11/11 11/11

HEL24.3-OCT4-nEmGFP CCD-1112Sk /

HEL24.3 VWA 16/18 16/18

18/18 expected and detected alleles were identical, giving an overall identity estimate of 100 %.

Therefore the HEL24.3-OCT4-nEmGFP cell line can be confirmed to be identical to HEL24.3 and CCD-

1112Sk (ATCC®CRL-2429™) reported to be its origin in Trokovic et al. Stem Cell Research (2015)15:266-

268 (>80% allelic identity needed for confirmation according to the International Cell Line

Authentication Committee (ICLAC) guidelines. Information for marker D21S11 for this cell line was not

found in the above mentioned databases.

The analyses were performed on cell line DNA samples delivered to FIMM Technology Center by Timo

Otonkoski group on April 19th 2017, and therefore represent the status of the cell lines at that time.

Päivi Lahermo Päivi Lahermo, Senior researcher, PhD, Docent

Genotyping Unit, Technology Centre

Institute for Molecular Medicine Finland FIMM

PO Box 20, FI-00014 University of Helsinki

[email protected], Tel. +358-50-4151182

Page 4: CELL LINE AUTHENTICATION REPORT...CELL LINE AUTHENTICATION REPORT Genomics Unit of Technology Centre, Institute for Molecular Medicine Finland (FIMM), has authenticated the cell lines
Page 5: CELL LINE AUTHENTICATION REPORT...CELL LINE AUTHENTICATION REPORT Genomics Unit of Technology Centre, Institute for Molecular Medicine Finland (FIMM), has authenticated the cell lines
Page 6: CELL LINE AUTHENTICATION REPORT...CELL LINE AUTHENTICATION REPORT Genomics Unit of Technology Centre, Institute for Molecular Medicine Finland (FIMM), has authenticated the cell lines
Page 7: CELL LINE AUTHENTICATION REPORT...CELL LINE AUTHENTICATION REPORT Genomics Unit of Technology Centre, Institute for Molecular Medicine Finland (FIMM), has authenticated the cell lines
Page 8: CELL LINE AUTHENTICATION REPORT...CELL LINE AUTHENTICATION REPORT Genomics Unit of Technology Centre, Institute for Molecular Medicine Finland (FIMM), has authenticated the cell lines

Target Sequence PAM Score Gene Chromosome Strand Position Mismatches ResultsSOX2 end GAAATGGGAGGGGTGCAAAAGAG GAGAG 100 ENSG00000181449 chr3 1 181713385 0 Insertion

1 GAAATGGGAGGGGTGCAAAAGAG GAGAG 100 chr8 1 124301880 0 Intact2 TGGATGGGAAGGTTGCAAAAGAG AAGGG 3.59 chr7 1 141252241 5 Intact3 GTTAAGTGAGGGGAGCAAAAGAG GAGAA 1.65 chr1 1 81977335 5 Intact4 TTGATTGTAGGAGTGCAAAAGAG ATGAA 1.60 chr8 -1 49767662 6 Intact5 CTGCTGGTAGGGGTGCAAATGAG TTGGG 1.55 chr17 1 73904586 6 Intact6 GGGAAGAGTGGGGTGCAAAAGAG GGGAG 1.51 chr20 1 11523181 5 Intact

Supplemental Table 1: Predicted SOX2 end SaCas9 gRNA off-target sites assessed for mutations by Sanger sequencing

Potential off target sites were evaluated using the GuideScan web tool at http://www.guidescan.com/. The top 6 off-target sites predicted by the tool were Sanger sequenced by in a HEL24.3-SOX2-ntdT-C9-H5 cells.


Recommended