Transcript
Page 1: Advances in Genomics Since  the Publication of the Human Genome

Advances in Genomics Since the Publication of

the Human GenomeGreg Feero, M.D., Ph.D.

Faculty, Maine-Dartmouth FamilyPractice Residency Program, Fairfield, ME

Contributing editor, Journal of the American Medical Association

Page 2: Advances in Genomics Since  the Publication of the Human Genome

Disclosures• No financial or intellectual conflicts of

interest.

• I am a primary care doctor.

• For better or worse, my opinions are my own!!

Page 3: Advances in Genomics Since  the Publication of the Human Genome

Outline• Still waiting for the revolution?

• Discovery apace.

• An unsatisfying answer?

• The final word – education!

Page 4: Advances in Genomics Since  the Publication of the Human Genome

Science 4 Feb 2011

Page 5: Advances in Genomics Since  the Publication of the Human Genome

Degree of specialization

Impa

ct o

f gen

omic

s

Page 6: Advances in Genomics Since  the Publication of the Human Genome

February 2011NHGRI Published New Vision for Genomics

Page 7: Advances in Genomics Since  the Publication of the Human Genome

Understandingthe Structure of

Genomes

Understandingthe Biology of

Genomes

Understandingthe Biology of

Disease

Advancingthe Science of

Medicine

Improving theEffectivenessof Healthcare

1990-2003Human Genome Project

2004-2010

2011-2020

Beyond 2020

Genomic Accomplishments: Base Pairs to Bedside

Page 8: Advances in Genomics Since  the Publication of the Human Genome

Sequence from chromosome 7

GAAATAATTAATGTTTTCCTTCCTTCTCCTATTTTGTCCTTTACTTCAATTTATTTATTTATTATTAATATTATTATTTTTTGAGACGGAGTTTCACTCTTGTTGCCAACCTGGAGTGCAGTGGCGTGATCTCAGCTCACTGCACACTCCGCTTTCTGGTTTCAAGCGATTCTCCTGCCTCAGCCTCCTGAGTAGCTGGGACTACAGTCACACACCACCACGCCCGGCTAATTTTTGTATTTTTAGTAGAGTTGGGGTTTCACCATGTTGGCCAGACTGGTCTCGAACTCCTGACCTTGTGATCCGCCAGCCTCTGCCTCCCAAAGAGCTGGGATTACAGGCGTGAGCCACCGCGCTCGGCCCTTTGCATCAATTTCTACAGCTTGTTTTCTTTGCCTGGACTTTACAAGTCTTACCTTGTTCTGCCTTCAGATATTTGTGTGGTCTCATTCTGGTGTGCCAGTAGCTAAAAATCCATGATTTGCTCTCATCCCACTCCTGTTGTTCATCTCCTCTTATCTGGGGTCACATATCTCTTCGTGATTGCATTCTGATCCCCAGTACTTAGCATGTGCGTAACAACTCTGCCTCTGCTTTCCCAGGCTGTTGATGGGGTGCTGTTCATGCCTCAGAAAAATGCATTGTAAGTTAAATTATTAAAGATTTTAAATATAGGAAAAAAGTAAGCAAACATAAGGAACAAAAAGGAAAGAACATGTATTCTAATCCATTATTTATTATACAATTAAGAAATTTGGAAACTTTAGATTACACTGCTTTTAGAGATGGAGATGTAGTAAGTCTTTTACTCTTTACAAAATACATGTGTTAGCAATTTTGGGAAGAATAGTAACTCACCCGAACAGTGTAATGTGAATATGTCACTTACTAGAGGAAAGAAGGCACTTGAAAAACATCTCTAAACCGTATAAAAACAATTACATCATAATGATGAAAACCCAAGGAATTTTTTTAGAAAACATTACCAGGGCTAATAACAAAGTAGAGCCACATGTCATTTATCTTCCCTTTGTGTCTGTGTGAGAATTCTAGAGTTATATTTGTACATAGCATGGAAAAATGAGAGGCTAGTTTATCAACTAGTTCATTTTTAAAAGTCTAACACATCCTAGGTATAGGTGAACTGTCCTCCTGCCAATGTATTGCACATTTGTGCCCAGATCCAGCATAGGGTATGTTTGCCATTTACAAACGTTTATGTCTTAAGAGAGGAAATATGAAGAGCAAAACAGTGCATGCTGGAGAGAGAAAGCTGATACAAATATAAATGAAACAATAATTGGAAAAATTGAGAAACTACTCATTTTCTAAATTACTCATGTATTTTCCTAGAATTTAAGTCTTTTAATTTTTGATAAATCCCAATGTGAGACAAGATAAGTATTAGTGATGGTATGAGTAATTAATATCTGTTATATAATATTCATTTTCATAGTGGAAGAAATAAAATAAAGGTTGTGATGATTGTTGATTATTTTTTCTAGAGGGGTTGTCAGGGAAAGAAATTGCTTTTTTTCATTCTCTCTTTCCACTAAGAAAGTTCAACTATTAATTTAGGCACATACAATAATTACTCCATTCTAAAATGCCAAAAAGGTAATTTAAGAGACTTAAAACTGAAAAGTTTAAGATAGTCACACTGAACTATATTAAAAAATCCACAGGGTGGTTGGAACTAGGCCTTATATTAAAGAGGCTAAAAATTGCAATAAGACCACAGGCTTTAAATATGGCTTTAAACTGTGAAAGGTGAAACTAGAATGAATAAAATCCTATAAATTTAAATCAAAAGAAAGAAACAAACTGAAATTAAAGTTAATATACAAGAATATGGTGGCCTGGATCTAGTGAACATATAGTAAAGATAAAACAGAATATTTCTGAAAAATCCTGGAAAATCTTTTGGGCTAACCTGAAAACAGTATATTTGAAACTATTTTTAAA

About 2000 bases

Page 9: Advances in Genomics Since  the Publication of the Human Genome

Only about 3,000,000 more slides to go.

Page 10: Advances in Genomics Since  the Publication of the Human Genome

At one slide per second, this lecture will be done in about 35 days!

Page 11: Advances in Genomics Since  the Publication of the Human Genome

The human genome is pretty darn big.

Page 12: Advances in Genomics Since  the Publication of the Human Genome

“The race was to sequence the human genome, all 3 billion genetic letters of it… a race not to the finish but to the starting line. Moreover, … the new race marked by that starting line was a marathon.”

Page 13: Advances in Genomics Since  the Publication of the Human Genome

Circa 2000

Page 14: Advances in Genomics Since  the Publication of the Human Genome
Page 15: Advances in Genomics Since  the Publication of the Human Genome

Circa 2012

Page 16: Advances in Genomics Since  the Publication of the Human Genome

Understandingthe Structure of

Genomes

Understandingthe Biology of

Genomes

Understandingthe Biology of

Disease

Advancingthe Science of

Medicine

Improving theEffectivenessof Healthcare

1990-2003Human Genome Project

2004-2010

2011-2020

Beyond 2020

Genomic Accomplishments: Base Pairs to Bedside

Page 17: Advances in Genomics Since  the Publication of the Human Genome

Progress in Mendelian disease gene discovery

KnownUnknown, suspected Mendelian

1990 2011

Sources: Lander, E. Nature , Feb. 2011www.genetests.org, Feb 2011

Page 18: Advances in Genomics Since  the Publication of the Human Genome
Page 19: Advances in Genomics Since  the Publication of the Human Genome
Page 20: Advances in Genomics Since  the Publication of the Human Genome

Cystic fibrosis Adult onset diabetes AIDS

Page 21: Advances in Genomics Since  the Publication of the Human Genome
Page 22: Advances in Genomics Since  the Publication of the Human Genome

Diabetes Diabetes

Unaffected Unaffected

SNP A SNP B

Page 23: Advances in Genomics Since  the Publication of the Human Genome

0

300

600

900

1200

1500

1800

Jul-05 Oct-05 Jan-06 Apr-06 Jul-06 Oct-06

Affymetrix 500K

Illumina 317K

Illumina 550K Illumina

650Y

Continued Progress in Genotyping Technology

Courtesy S. Gabriel, Broad/MITJuly 2005 Oct 2006

Cost

per

per

son

(USD

)

Page 24: Advances in Genomics Since  the Publication of the Human Genome

NHGRI Catalog of Published Genome-Wide Association Studies (GWAS)

> 5619 SNPs!!

Page 25: Advances in Genomics Since  the Publication of the Human Genome

Equation of a Variant’s Predictive Potential

Effect size

X =AssociationStrength

PredictivePotential

Page 26: Advances in Genomics Since  the Publication of the Human Genome

Classical genetic study“mutation”

Effect size

X =AssociationStrength

PredictivePotential

Association => Causality

Page 27: Advances in Genomics Since  the Publication of the Human Genome

Genome Wide Association Study“SNP”

Effect size

X =AssociationStrength

PredictivePotential

Page 28: Advances in Genomics Since  the Publication of the Human Genome

Genome Wide Association Study“SNPs”

Effect size

?X =AssociationStrength

PredictivePotential

Page 29: Advances in Genomics Since  the Publication of the Human Genome

Nature, April 2003

Quantum Leaps in Technology:

.….Genome sequencing at $1000 or less for a

mammalian genome…..

Page 30: Advances in Genomics Since  the Publication of the Human Genome

Advances in Genome Biology and Technology Conference

February 2012

Page 31: Advances in Genomics Since  the Publication of the Human Genome

genome.gov/sequencingcosts

Page 32: Advances in Genomics Since  the Publication of the Human Genome
Page 33: Advances in Genomics Since  the Publication of the Human Genome
Page 34: Advances in Genomics Since  the Publication of the Human Genome

Sequencing

???

Effect size

X =AssociationStrength

PredictivePotential

Page 35: Advances in Genomics Since  the Publication of the Human Genome
Page 36: Advances in Genomics Since  the Publication of the Human Genome

Frequency vs. Effect

Frequency in population

Effe

ct s

ize Classical

mutation

SNP-like variation

?

Page 37: Advances in Genomics Since  the Publication of the Human Genome

Published online April 2, 2012

Page 38: Advances in Genomics Since  the Publication of the Human Genome
Page 39: Advances in Genomics Since  the Publication of the Human Genome

Nature 9/23/12

Page 40: Advances in Genomics Since  the Publication of the Human Genome

30 JUNE 2011

Page 41: Advances in Genomics Since  the Publication of the Human Genome

16 June 2011

Page 42: Advances in Genomics Since  the Publication of the Human Genome

You are not alone in there….

Page 43: Advances in Genomics Since  the Publication of the Human Genome
Page 44: Advances in Genomics Since  the Publication of the Human Genome

Genomics

Personalized Medicine

Quality Health Care

Page 45: Advances in Genomics Since  the Publication of the Human Genome
Page 46: Advances in Genomics Since  the Publication of the Human Genome

JAMA, March 14,2012

Page 47: Advances in Genomics Since  the Publication of the Human Genome

Solutions – primary care style…

• 33% of diabetics are undiagnosed --- blood glucose. (Almanac, 2008)

• 24% of hypertensives undiagnosed --- blood pressure measurements. (Almanac, 2008)

• 37% of high cholesterol undiagnosed --- fasting lipid panel. (Almanac, 2008)

• Universal health care, better screening programs, smoking cessation, exercise programs, improved nutrition etc…

Page 48: Advances in Genomics Since  the Publication of the Human Genome

WSJ, Nov. 2, 2013

$1,600,000!!!!!!

Page 49: Advances in Genomics Since  the Publication of the Human Genome

Are the expenses of targeted treatments sustainable?

For:Patients?Insurers?

State budgets?National economies?

Page 50: Advances in Genomics Since  the Publication of the Human Genome
Page 51: Advances in Genomics Since  the Publication of the Human Genome

Understandingthe Structure of

Genomes

Understandingthe Biology of

Genomes

Understandingthe Biology of

Disease

Advancingthe Science of

Medicine

Improving theEffectivenessof Healthcare

1990-2003Human Genome Project

2004-2010

2011-2020

Beyond 2020

Genomic Accomplishments: Base Pairs to Bedside

Page 52: Advances in Genomics Since  the Publication of the Human Genome

2011Medical Education Issue9/7/2011

Page 53: Advances in Genomics Since  the Publication of the Human Genome

Genomics theme issues:JAMAArchives of:DermatologyFacial Plastic SurgeryGeneral PsychiatryInternal MedicineNeurologyOphthalmologyOtolaryngology—Head & Neck SurgeryPediatrics & Adolescent MedicineSurgery

Coming April 2013!

Page 54: Advances in Genomics Since  the Publication of the Human Genome

2012 – The rising tide of genomics….2000 – The genomic tsunami

Page 55: Advances in Genomics Since  the Publication of the Human Genome

Conclusions• The revolution is here, and happening all about

you.

• The front lines are in specialty care, but not for long.

• Considerably more basic, clinical, and translational research will be need to answer the “cost curve” question.

Page 56: Advances in Genomics Since  the Publication of the Human Genome

Some slides courtesy of:

Eric Green, NHGRI

Jean Jenkins, NHGRI

Teri Manolio, NHGRI

THANKS!


Recommended