7/22/2019 24-0514
1/93
um am oto U niversity R epository S ystem
Title Studies on COD removal using poly (vinyl alcohol)-
gel beads as biomass carrier in UASB reactor
A uthor(s) Do Phuong Khanh
C itation
Issue date 2012-03-23
Type Thesis or Dissertation
U R L http://hdl.handle.net/2298/24903
R ight
7/22/2019 24-0514
2/93
STUDIES ON COD REMOVAL USING POLY(VINYL ALCOHOL)-GEL
BEADS AS BIOMASS CARRIER IN UASB REACTOR
A Dissertation Submitted in Partial Requirement for the Graduation in Engineering
February, 2012
DO PHUONG KHANH
Graduate School of Science and Technology
KUMAMOTO UNIVERSITY
7/22/2019 24-0514
3/93
STUDIES ON COD REMOVAL USING POLY(VINYL ALCOHOL)-GEL
BEADS AS BIOMASS CARRIER IN UASB REACTOR
(PVA UASB COD)
A Dissertation Submitted in Partial Requirement for the Graduation in Engineering
Doctoral Dissertation
February, 2012
By
DO PHUONG KHANH
Supervisor
Prof. KENJI FURUKAWA
Department of New Frontier Sciences
Graduate School of Science and Technology
KUMAMOTO UNIVERSITY
7/22/2019 24-0514
4/93
i
Acknowledgement
I am appreciated to many people whose support, advice and encouragement allowed
me to complete this work.
Firstly, I would like to express my sincere and honest thanks to my supervisor, Prof.
Kenji Furukawa. His academic guidance, technical advice and incisive considerations
during my study deserve all my gratitude. Without his patient instruction, the completion
of this thesis and the publications would not have been possible.
Secondly, I am very thankful to Prof. Susumu Takio, Prof. Yoshito Kitazono and
Assoc. Prof. Takeshi Kitano for their help to check my dissertation.
I am extremely thankful to Dr. Lai Minh Quan, Dr. Zhang Wenjie, Dr. Daisuke Hira,
Dr. Qiao Sen, Dr. Xu Xiaochen, Dr. Ma Yongguang, Dr. Li Zhigang, Mr. Kazuya
Kamishima and Mr. Takahiro Sato for the direct support during my experiments. I have
learned from all of you. My thanks are also due to Ms. Murashima Kimiyo, who never
failed to give me great encouragement and suggestions. I express my appreciation to
Kuraray Corporation for providing me the polymer gel beads.
Im indebted to the Japanese students, Vietnamese students and Chinese students in
Prof. Furukawas lab. Specially, I deeply appreciate my tutors, Dr. Taichi Yamamoto and
Mr. Takehiko Shinohara; my elder brother and elder sister, Dr. Yang Jiachun and Dr.
Zhang Li; my young colleagues, Mr. Masashi Takekawa, Mr. Satoshi Ohta, Mr. Ryouta
Esaki, Mr. Yuuki Nakayama, Mr. Daisuke Yoshida; Dr. Liu Chengliang, Dr. Gao Yanning,
Dr. Sou Tyou Syun, Dr. Masako Sakai, Mr. Tran Thanh Liem, Ms. Phan Thi Hong Ngan,
Mr. Chen Cheng, Ms. Jiang Jing, Ms. Xu Shan, Ms. Wei Qiaoyan, Mr. Yuki Tomoshige
7/22/2019 24-0514
5/93
ii
and Dr. Keita Takagi for their kindness and friendships. Im very grateful to Ms. Seiko
Saito for giving me so much administration guidance and sharing the unforgettable
moments in Hanoi.
Im thankful to IJEP and GelK programs for giving me not only fundamental
academic knowledge and financial support, but also good friends. I have highly
appreciated all members of Meidensha Corporation (Stationed staff in Nagoya), who
have taught and helped me so much during my internship.
My gratitude also extends to Mr. & Mrs. Sakimoto, Mr. & Mrs. Harada, Ms. Midori
Noguchi, Mr. & Mrs. Akimoto, Ms. Mieko Ikeda, Ms. Megumi Yoshii and my closest
friends in Kumavina, who give me the second family. I would like to appreciate my
doctoral friends, Ms. Meshkatul Jannat, Ms. Nguyen Thi Ngoc, Ms. Liany Hendratta, Mr.
Lei Lu, Mr. Bingwei Tian, Mr. Tohirin Sukarno and Ms. Mahsa Saeidi, who always cheer
me up.
Special thanks to my all family members: Mom, Dad, Phuong Hanh and Duc Anh
for lots of spiritual support.
I wish to acknowledge all people, whom I might have not mentioned here and who
have either directly or indirectly give me their thoughtfulness and encouragement.
7/22/2019 24-0514
6/93
iii
List of contents
Abstract .. v
List of acronyms and abbreviations ....... vii
Lists of tables .. viii
List of figures .... ix
Chapter 1 Literature review ... 01
1.1Introduction . 01
1.1.1 Treatment of low-strength wastewater by UASB reactors 01
1.1.2 Application of PVA-gel carrier for wastewater treatment . 09
1.2Objectives of this study ... 12Chapter 2 Effect of temperature on UASB treatment of low-strength wastewater
using poly(vinyl alcohol)-gel carrier .. 17
2.1 Introduction . 17
2.2 Materials and methods . 18
2.2.1 Experimental setup ... 18
2.2.2 Synthetic medium . 19
2.2.3 Biomass carrier . 20
2.2.4 Analytical methods ... 20
2.3 Results . 21
2.3.1 UASB reactor performance .. 22
2.3.2 Effects of temperature decrease and extremely short HRTs . 25
2.3.3 Characteristics of attached growth ... 26
2.3.4 Archaeal community analysis ... 28
2.3.5 Post-treatment of UASB reactor effluent . 30
2.4 Discussion 31
2.5 Conclusions . 32
Chapter 3 Response of poly(vinyl alcohol)-gel and poly(ethylene glycol)-gel
biogranular sludges in two identical UASB reactors 37
3.1 Introduction . 37
3.2 Materials and methods . 38
3.2.1 Reactor setup 38
3.2.2 Substrates .. 39
7/22/2019 24-0514
7/93
iv
3.2.3 Biomass carrier . 39
3.2.4 Analytical methods ... 40
3.3 Results and discussion . 40
3.3.1 Reactor performance . 40
3.3.2 Characteristics of attached growth ... 42
3.4 Conclusions . 57
Chapter 4 Substrate removal kinetics in a UASB reactor using poly(vinyl
alcohol)-gel carrier operated at 15oC ................................................................. 50
4.1 Introduction . 50
4.2 Materials and methods . 51
4.2.1 Experimental setup ... 52
4.2.2 Synthetic influent .. 52
4.2.3 Seed sludge ... 52
4.2.4 Analytical methods ... 52
4.3 Results and discussion . 52
4.3.1 Reactor performance . 53
4.3.2 Characteristics of attached growth ... 54
4.3.3 Substrate removal kinetics in UASB reactor 56
4.4 Conclusions . 62
Chapter 5 Post-treatment of UASB effluents by a swim-bed reactor . 66
5.1 Introduction . 66
5.2 Materials and methods . 66
5.2.1 Experimental setup ... 66
5.2.2 Seed sludge ... 68
5.2.3 Biomass carrier . 685.2.4 Analytical methods ... 68
5.3 Results and discussion . 69
5.3.1 Reactor startup .. 69
5.3.2 COD removal performance .. 70
5.4 Conclusions . 73
Chapter 6 Conclusions 75
Publications... 78
7/22/2019 24-0514
8/93
v
Abstract
Low-strength wastewater is identified with COD concentrations below 1000 mg/L.
Its main sources are cesspit leakage, septic tank, sewage treatment plant, industrial
process water, rainfall runoffs, agricultural drainage, etc. In many developing countries,
such wastewaters are large in quantity and discharged into water bodies without a
treatment process.
Over the past forty years, UASB reactor was introduced by Dr. Lettinga and his
coworkers in Netherlands. It has become one of the most popular anaerobic wastewater
treatment processes because of low energy demand, simple construction and high
removal efficiency. The application of UASB reactor for industrial wastewater treatment
indicated a number of reports on the treatment of high-strength wastewater and
medium-strength wastewater. A small fraction of published papers have discussed on the
treatment of low-strength wastewater, because such wastewater is poor in recoverable
materials, therefore treating them brings insignificant returns. It becomes crucial to treat
low-strength wastewater with less input of energy and other resources.
Sludge granulation is considered as the key success of UASB process. In our
experiments, PVA-gel beads were employed as a biomass carrier. This functional resin
has a reticulate structure that can trap and carry microorganisms. PVA-gel beads have
been employed as biomass carrier in hundreds of projects on industrial water treatment
systems in Japan. Recently, PVA gels have been applied for lab-scale anaerobic
bioreactors, including packed-bed, anammox and UASB. Zhang et al. (2009) carried out
his experiments with UASB reactor using PVA gels treating high-strength wastewater. In
my study, the treatment of low-strength wastewater by UASB reactor using PVA gel
beads has been discussed. This dissertation covered six following chapters:
Chapter 1 An overview of the studies on low-strength wastewater treatment by
UASB bioreactors and the application of poly(vinyl alcohol)-gel beads as biomass carrier
for anaerobic wastewater treatment.
Chapter 2 The performance of a UASB reactor treating low-strength wastewater
under mesophilic (35
o
C) to psychrophilic (15
o
C) conditions. The effect of temperature
7/22/2019 24-0514
9/93
vi
decrease on COD removal was evaluated. The operational strategy was keeping the stable
influent COD concentrations and accelerating HRT to below 1 hr. A stepwise increase of
organic loading rates was achieved, excluding the requirements for time and space of
experiments. The acceptable organic loading rates for treatment of low-strength
wastewater by UASB reactor were discussed.
Chapter 3 The role of the porous macrostructure of PVA granules in UASB reactor
was investigated. COD removal and the dominant microbial species in two identical
UASB reactors using PVA-gel carrier and poly(ethylene glycol) (PEG)-gel carrier for
treating low-strength wastewater were studied.
Chapter 4 The operation of a cylinder-shaped UASB reactor using PVA-gel carrier
at 15oC and under short HRTs. It was compared with the performance of a cuboid-shaped
UASB reactor as described in Chapter 2. The microbial population and substrate removal
kinetics for the cylinder-shaped UASB reactor was presented.
Chapter 5 The feasibility of applying a swim-bed reactor as post-treatment of
UASB effluents was investigated.
Chapter 6 Conclusion remarks and recommendation for future work.
7/22/2019 24-0514
10/93
vii
List of acronyms and abbreviations
AHR Anaerobic Hybrid Reactor
BF Biofringe
BOD5 5-day Biological Oxygen Demand
COD Chemical Oxygen Demand
GSS Gas Solid Separator
HRT Hydraulic Retention Time
OLR Organic Loading Rate
OTU Operational Taxonomic Unit
PCR Polymerase Chain Reaction
PVA Poly(vinyl alcohol)
PEG Poly(ethylene glycol)
SEM Scanning Electron Micrograph
SS Suspended Solids
TN Total Nitrogen
UASB Upflow Anaerobic Sludge Blanket
VFA Volatile Fatty Acids
VSS Volatile Suspended Solids
7/22/2019 24-0514
11/93
viii
List of Tables
Table Title
1-1 Classification of methanogenic bacteria (Whitman et al., 2001)
1-2 Five-year reports on COD removal using PVA bio-carriers (2005-2011)
2-1 Operational parameters
2-2 Performance of UASB reactor during Period I-III
2-3 Comparison of temperature coefficient ()for anaerobic treatments
2-4 Performance of lab-scale UASB reactors using PVA gel carrier
2-5 Archaeal communities of UASB sludge
2-6 BOD5, COD and TN concentrations in UASB effluents
3-1 Operational parameters of the two identical UASB reactors
3-2 Properties of the original PVA/PEG beads
3-3 Treatment performance of UASB reactors using PVA/PEG-gel carriers
3-4 Archaeal communities in UASBPVAand UASBPEGsludges
4-1 Operational parameters of 2.5 L-cylinder-shaped UASB reactor
4-2 Treatment performance of 2.5 L-cylinder-shaped UASB reactor
4-3 Treatment performance of UASB reactors using PVA-gel at 15oC
4-4 Archaeal communities in the granular sludge obtained from 2.5 L-UASB
4-5 Data for Grau second-order kinetic model for 2.5 L-UASB reactor
4-6 Comparison of kinetic parameters in the Grau second-order model
4-7 Data for modified Stover-Kincannon model for 2.5 L-UASB reactor
4-8 Comparison of kinetic parameters in the Stover-Kincannon model
5-1 Treatment performance of the swim-bed reactor
7/22/2019 24-0514
12/93
ix
List of Figures
Figure Title
1-1 Five-year reports (1999-2004) on the treatment of industrial wastewaters by
UASB reactors
1-2 Schematic diagram of a basic UASB reactor
1-3 Anaerobic conversion of organic substrates to methane
1-4 Schematic of the multi-layer model for anaerobic granulation
1-5 Kurarays wastewater treatment technology using PVA gel beads
2-1 Schematic diagram of UASB reactor (A); blank PVA beads (B); macrostructure of
blank PVA bead, scale bar 20 m (C); cultivated PVA beads (D)
2-2 Time courses of COD removal
2-3 COD concentrations at different sampling ports under loading rate of 17 kg-COD
m-3d-1(HRT 0.6 h)
2-4 Temperature dependence of COD removal rate
2-5 Scanning electron microscopic images of a matured PVA-gel beads
2-6 BOD5, COD and TN concentrations in UASB effluents under COD loading rates
of 5 to 40 kg-COD m-3d-1
3-1 Schematic of two identical 1L-cylinder-shaped UASB reactors
3-2 Time courses of COD removal by UASBPVAand UASBPEGreactors
3-3 SEM of the anaerobic sludge attached to a matured PVA bead
3-4 SEM of the macrostructure of an original PEG bead
3-5 SEM of the anaerobic sludge attached to a matured PEG bead
4-1 Schematic diagram of 2.5 L-cylinder-shaped UASB reactor
4-2 Time courses of COD removal by 2.5 L-cylinder-shaped UASB reactor
7/22/2019 24-0514
13/93
x
4-3 Grau second-order model application for 2.5 L-UASB reactor
4-4 Modified Stover-Kincannon model application for 2.5 L-UASB reactor
4-5 Comparison of the predicted and the actual COD concentrations from 2.5
L-cylinder-shaped UASB reactor operated at 15oC
5-1 Schematic diagram of 7.7 L-swim-bed reactor as the post treatment of UASB
effluents from 3.9 L-cuboid-shaped UASB reactor (A) and 2.5 L-cylinder-shaped
UASB reactor (B)
5-2 Cross-sectional schematic diagram of swim-bed reactor
5-3 Time course of total sludge attachment to the BF carrier
5-4 Time courses of COD removal by swim-bed reactor
5-5 Linear relation between COD removal rate and COD loading rate
5-6 The BF carrier with attached growth (day 50 and day 320)
5-7 Time courses of reactor SS concentration and linear upflow velocity
7/22/2019 24-0514
14/93
1
Chapter 1 Literature Review
1.1Introduction
Anaerobic biological wastewater treatment has been majorly collected much
attention by the researchers due to its sustainability. Many anaerobic bioreactor systems,
such as anaerobic filters (AF), anaerobic sequencing batch reactors (SBR), anaerobic
expanded bed reactors (EGSB) and anaerobic fluidized bed reactors (AFB) have been
introduced for the treatment of biodegradable wastewaters. Of these, upflow anaerobic
sludge blanket (UASB) technology was recently considered as the most popular method
in which organic materials can be removed under high loading rate (Habeeb et al., 2010).
Sludge granules are at the core of UASB technology (Lettinga et al., 1980; Van Haandel
et al., 1994). A sludge granule is an aggregate of microorganisms forming under a
constant upflow hydraulic regime. The sludge granules are multi-microbial
communities and none of the individual species is capable of degrading complex
organic matters (Lens et al., 1995; Yu et al., 2000). The operation of UASB reactor was
previously limited to the treatment of high-strength industrial wastewater (Alphenaar et
al., 1993; Arching et al., 1993; Hwang et al., 1991; Imai et al., 1997; Ke et al., 1996).
Recent studies have been practically indicated the feasibility of UASB reactors to treat
low-strength industrial and domestic wastewaters (Sankar Ganesh et al., 2007; Show et
al., 2004). This chapter attempts to review the application of UASB reactor in the
treatment of such wastewaters; besides, the development of granule-based UASB
reactors using poly(vinyl alcohol)-gel is briefly introduced.
1.1.1Low-strength wastewater treatment by UASB reactors
The UASB process has been developed by Dr. Gatze Lettinga in the late 1970's at
the WageningenUniversity, The Netherlands (Lettinga et al., 1980). The UASB reactor
is mainly classified as bioreactors, due toits biological treatment of wastewater. UASB
reactor is characterized by its low energy demand, simple construction and high removal
efficiency(Show et al., 2004).Sankar Ganesh et al. (2007), cited by Habeeb et al.
(2010) reported a survey to investigate the application of UASB reactor during
7/22/2019 24-0514
15/93
2
1999-2004. With numerous advances (sludge development, microbial manipulation,
reactor hydrology, upstream controls, combination with other reactors, etc.),
biodegradable wastewaters varying in strength have been treated efficiently with UASB
reactors as illustrated inFig. 1-1.
Fig. 1-1 Five-year reports (1999-2004) on the treatment of industrial wastewaters by
UASB reactors (Sankar Ganesh, 2007)
It indicates that a small fraction of reports focused on low-strength industrial
wastewaters. UASB process was regarded to suite for the treatment of high-strength
wastewaters, followed by medium-strength ones, but low-strength wastewaters pose
special challenge. Such wastewaters generally ensue from washing operations:
households generate such wastewaters as sewages, and industries do so as streams
resulting from washing of the machinery and the rest of the shop floor. Such wastewaters
are of low-strength but are large in quantity. It therefore becomes crucial that techniquesbe developed to treat such wastewaters with less input of energy.
The UASB system is mainly consisted of a tank, pump, and biogas collector system
as illustrated in Fig. 1-2A. Untreated wastewater is distributed at the bottom and fluid up
through the sludge blanket, where organic matters are digested, absorbed, and
metabolized into bacterial cell and produce biogas. The gas solid separator (GSS) was
designed at the top of the reactor (Fig. 1-2B).
7/22/2019 24-0514
16/93
3
Fig. 1-2 Schematic diagram of a basic UASB reactor:
UASB design (A), GSS design (B), GSS process (C), biodegradation in UASB
reactor (D) (Habeeb et al., 2010)
C D
BA
7/22/2019 24-0514
17/93
4
The main reason to provide UASB reactor with GSS was (i) to collect the discharged
biogas properly, (ii) to decrease the turbulence which is mainly resulted from gas arising
in bubbles, (iii) to reduce the solids content in effluent, and (iv) to reduce the sludge
particles washout by entrapping particles in sludge blanket or flocculating or settling the
particles. Fig. 1-2C shows how the separation device is working. The successful
treatment in UASB reactor is mainly attributed to the formation of anaerobic granular in
sludge bed where microbial communities plays the central role on digesting the substrates
to biogas. The biological digestion process is illustrated in Fig. 1-2D.
In the UASB granules, different groups of bacteria carry out sequential metabolic
processes. Various theories have been explained the activity and performance of
microbial communities inside UASB (Liu et al., 2003). An overall scheme for anaerobic
conversions of organic substrates to methane is indicated in Fig. 1-3. During anaerobic
degradation of particulate organic materials, particulate biopolymers (carbohydrates,
proteins and lipids) are firstly hydrolyzed to organic monomers, which can be utilized as
substrates by fermentative organisms (amino acids, sugars) or by anaerobic oxidizers
(fatty acids). The carbonic products from these reactions are either acetate (CH3COOH)
and hydrogen or intermediate compounds, such as propionate and butyrate, which may
later be converted to acetate or hydrogen (H2). Methane (CH4) is mostly produced from
acetate or hydrogen and carbon dioxide (CO2).
UASB microbial communities can be classified into two domains, Bacteria and
Archaea. Stable anaerobic digestion is accomplished by representatives of four major
metabolic groups: hydrolytic-fermentative bacteria, proton-reducing acetogenic bacteria,
acetotrophic methanogens and hydrogenotrophic methanogens. Acetotrophic and
hydrogenotrophic methanogens are essential for the last step of methanogenesis.
The acetotrophic methanogens are obligate Archaea anaerobes, which convert
acetate to methane and carbon dioxide (CH3COOHCH4 + CO2). The activity of the
acetotrophic methanogens are of paramount importance during anaerobic conversion of
acetate. In earlier work,MethanosarcinaandMethanosaetaspecies were found to be the
dominant methanogens in a variety of UASB reactors. In other methanogenic reactions,
hydrogen is used as an electron acceptor to form methane by hydrogennotrophic
methanogens (4H2 + CO2CH4 + 2H2O), while many H2-using methanogens can also
7/22/2019 24-0514
18/93
5
use formate as an electron donor for the reduction of CO2to CH4(4HCOOH CH4+
3CO2+ 2H2O).
Complex organic substrates
Particulate organic matter Carbohydrates Proteins Lipids
Monomers
Amino acids Fatty acids Sugars Alcohols
Intermediary products
Acetate Propionate Ethanol Lactate
Methanogenesis
Methane (CH4)+
Carbon dioxide (CO2)
Fig. 1-3 Anaerobic conversion of organic substrates to methane
The hydrogen partial pressure is an important parameter, which defines process
stability or upsets in an anaerobic digestion process. Hence, the occurrence of the
hydrogenotrophic methanogens is crucial for an efficient process performance (Demirel
et al., 2008). Table 1-1 shows the outline of methanogenic bacteria classification
Hydrolysis
Acidogenesis
Acetogenesis
Reductive homoacetogenesis
Acetate
(CH3COOH)H2, CO2
Homoacetogenic oxidation
Reductive homoacetogenesis
Hydrolytic bacteria
Fermentative acidogenic bacteria
Acetogenic bacteria
Acetotrophic methanogens Hydrogenotrophic methanogens
7/22/2019 24-0514
19/93
6
(Whitman et al., 2001). So far, 28 genera of methanogens have been described. The
majority of rod-shaped methanogens are affiliated to the order Methanobacteriales,
which consists of three mesophilic genera (Methanobacterium,Methanobrevibacterand
Methanosphaera) and two thermophilic or hyperthermophilic genera
(MethanothermobacterandMethanothermus).
Table 1-1 Classification of methanogenic bacteria (Whitman et al., 2001)
Class I. Methanobacteria (known to grow on H2/CO2and formate as carbon source)
Order I. Methanobacteriales
Family I. Methanobacteriaceae
Genus I. Methanobacterium
Genus II. Methanobrevibacter
Genus III. MethanosphaeraGenus IV. Methanothermobacter
Family II. Methanothermaceae
Genus I. Methanothermus
Class II. Methanococci (known to grow on H2/CO2and formate as carbon source)
Order I. Methanococcales
Family I. Methanococcaceae
Genus I. Methanococcus
Genus II. Methanothermococcus
Family II. Methanocaldococcaceae
Genus I. Methanocaldococcus
Genus II. Methanotorris
Class III. Methanomicrobia
Order I. Methanomicrobiales (known to be hydrogenotrophic)
Family I. Methanomicrobiaceae
Genus I. Methanomicrobium
Genus II. Methanoculleus
Genus III. Methanofollis
Genus IV. Methanogenium
Genus V. Methanolacinia
Genus VI. Methanoplanus
Family II. Methanocorpusculaceae
Genus I. Methanocorpusculum
Family III. Methanospirillaceae
Genus I. Methanospirillum
Order II. Methanosarcinales (known to be acetotrophic and methylotrophic)Family I. Methanosearcinaceae
Genus I. Methanosarcina
Genus II. Methanococcoides
Genus III. Methanohalobium
Genus IV. Methanohalophilus
Genus V. Methanolobus
Genus VI. Methanomethylovorans
Genus VII. Methanomicrococcus
Genus VIII. Methanosalsum
Family II. Methanosaetaceae
Genus I. Methanosaeta
(Genus: related to the laboratory-scale work in Chapter 2, 3, 4)
7/22/2019 24-0514
20/93
7
All methanogens grow on a H2/CO2gas mixture. Many of them utilize formate and
some grow on other simple alcohols. The anaerobic digester is a compatible surrounding
for the growth of mesophilic methanogens andMethanobacteriumstrains, which play an
important role in the anaerobic degradation of organic compounds as the terminal
metabolic groups (Hobson & Shaw, 1973).
Many mechanisms and models for anaerobic granulation are currently available in
the literature. Based on the microscopic observation, a layered structure of UASB
granules (Fig. 1-4) was initially proposed by MacLeod et al. (1990) and Guiot et al.
(1992), also supported by a numbers of works (Arcand et al., 1994; Lens et al., 1995; Liu
et al., 2003). Recent research by Sekiguchi et al. (1998) showed that UASB granules have
a center which might be formed as a result of the accumulation of metabolically inactive,
decaying biomass and inorganic materials. Tay et al. (2000) proposed a theory for the
molecular mechanism of sludge granulation. The overall granulation starts from
dehydration of bacterial surfaces, and followed by embryonic granule formation, granule
maturation and post maturation. This theory provides useful information for
understanding how anaerobic granules form in a molecular level, but it is most likely that
this theory does not account for those operational conditions associated metabolic
changes of microorganisms, which would highly contribute to the formation of UASB
granules.
Fig. 1-4 Schematic of the multi-layer model for anaerobic granulation
(Hulshoff Pol, 2004)
CH4, CO2
CH3COOH
VFA
7/22/2019 24-0514
21/93
8
The start-up and operation of UASB reactor is involved the adjustment of pH of
influent, initial sludge amount, hydraulic retention time (HRT), organic loading rate
(OLR), upflow velocity and temperature of treatment. The start-up period is continuing
until reaching steady-state operation, which is recognized by the changes in removal
efficiency below 10%.
Temperature is a significant variable where it enhances microorganisms to produce
methane from digestion organic matters. An investigation for the influence of the
temperature on the UASB performance included operation of two UASB reactors in the
same HRT of 7 days and OLRs of 10.74 kg COD m-3d-1but different temperatures of
treatment (mesophilic temperature of 37oC vs. thermophilic temperature at 55oC). Where
the temperature was increasing from 37 to 43oC, removal efficiency increment was
observed, consequently it had been concluded that the optimum range is the mesophilic
temperature up to 37oC and less than 43oC (Choorit et al., 2007). Furthermore,
temperature shock is of considerable phenomena. It usually occurs in seasonal countries
due to their temperatures varieties during the day. The influence of temperature shock has
been studied by Hwang et al. (1991) and Ke et al. (1996). The authors reported that as a
result of decreased the temperature by 15oC for 48h, a reduction in biogas production of
60% and was observed. The partial recovery of gas production took 5 days to reach 80%
of original level whereas the full recovery has been achieved after 30 days.
HRT is considered as the key operating parameter where its effectiveness is mainly
controlling the performance of UASB reactors. Many authors are in agreement by
considering HRTs of 8 hr is the optimum. The very long HRTs (over 10 hr) are affecting
adversely on the process of sludge granulation with a little removal efficiency increment
was obtained. The very short HRTs (under 1 hr) can be disadvantageous due to its
negative role of biomass washout (Alphenaar et al., 1993; Van Haandel et al., 1994; Yu et
al., 2000).
The pH value is also affected the UASB performance. The pH of influent has been
limited by Van Haandel & Lettinga (1994) between the ranges of 6.3 to 7.8. The change in
pH of treatment is an important factor for the UASB reactor stability. Some of
experiments have been conducted to illustrate the behavior of UASB system towards a
change in the substrate pH (Borja & Banks, 1995). Lowering the pH value from 6.8 to 6.6
7/22/2019 24-0514
22/93
9
by injecting HCl, gas production increased 40% as well as the concentration of CO2.
Where NaOH was added to raise the pH up to 7.4, an increment of biogas generation was
observed with decreasing in CO2production.
Recently, modifications of UASB have been conducted in order to expand the use of
system and to increase its purpose. Some of suggested ideas have been practically
implemented. Lettinga et al. (1980) has been recommended adding natural ionic acids to
treatment of a very strong wastewater in order to enhance the digestion process.
Subsequently, it has been implemented by Leal et al. (2006) using additive hydrolytic
enzyme to remove oil and grease in treating dairy effluents. Yu et al. (2000) and Tiwari et
al. (2005) reported the possibilities of adding natural or artificial materials to increase the
sludge granule size and enhance the digestion of UASB reactor. One major drawback of
the UASB reactor is its long start-up period, which generally requires 2-8 months for the
development of anaerobic granular sludge (Liu et al., 2003). In order to reduce the
space-time requirements of UASB bioreactors towards a cheaper treatment, strategies for
expediting granular formation are highly desirable.
1.1.2 Application of PVA-gel carrier for wastewater treatment
The inert nuclei model for anaerobic granulation was initially proposed by Lettinga
et al. (1980). In the presence of inert micro-particles in an UASB reactor, anaerobic
bacteria could attach to the particle surfaces to form the initial biofilms, namely
embryonic granules. The mature granules can be further developed through the growth of
these attached bacteria under given operational conditions. The inert nuclei model was
supported by experimental evidences that addition of water absorbing polymer particles
were used to promote the formation of anaerobic granules (Imai et al., 1997).
Biomass entrapment within various hydrogels is among the progressive approaches
for the creation of enhanced granulation. Many gel matrices have been proposed as
possible carriers. Either natural biopolymers (polysaccharides such as alginate, agar,
carrageenan, etc. or proteins such as gelatin, collagen and others) or synthetic polymers
(polyvinyl alcohol, polyethers, polyacrylates, polyurethanes) can be used. These
polymeric materials were first described at the beginning of 1970s. In recent years,
poly(vinyl alcohol) (PVA)-gel which is an inexpensive and non-toxic synthetic polymer
7/22/2019 24-0514
23/93
10
has been widely used for immobilization of bioactive materials (Cao et al., 2002, Chen et
al., 1998; Lozinsky et al., 1998; Quan et al., 2009; Zhang et al., 2007). Because PVA-gel
possesses many attractive properties (i.e. hydrophilicity, reactivity, film formation,
resistance to oxidation), it is a potential biomass carrier that can be applied in the
fermentation industry, medicine, food, chemistry and the ecological engineering (Bai et
al., 2010). Table 1-2 shows the recent laboratory-scale work on removal of COD from
wastewaters using PVA-based biomass carriers.
Table 1-2 Five-year reports on COD removal using PVA-gel carriers (2005-2011)
Carrier Reactor Operationaltime (days)
Substrate,Temperature (
oC)
HRT(h)
Reference
PVA entrapment Cinder filtration4 days per
batch
Oil-field
wastewater, 3096 Li (2005)
PVA beadsAnaerobic fluidized
bed (AFB)
120 Corn steep liquor,
3510
Zhang
(2009)
PVA-calcium
alginate pellets
Membrane
bioreactor (MBR)
330 Reactive Black 5
dye, 20 24
You
(2010)
PVA beads UASB90 Ethylene glycol,
358
Zhang
(2011)
In the present work, PVA-gel beads were supplied by Kuraray Corporation, from
which it was first industrialized in the world. This is a small white spherical
bacteria-fixed carrier made from PVA resin. With an extremely fine net-like structure,
each sphere with diameter of 4 mm and specific gravity of 1.025 can sustain one billion
microorganisms. PVA gel is design to treat industrial and domestic wastewater through
bacterial activities. Fig. 1-5 shows the biological wastewater treatment system using
PVA-gel beads. Because it enables the use of smaller facilities and more efficient
processing than the conventional activated sludge method, this process is being adopted
in household septic tanks, factory wastewater facilities and sewage processing plants.
Removal efficiencies of biological oxygen demand (BOD5), chemical oxygen demand
(COD) and total nitrogen (TN) obtained from treatment of industrial wastewater
7/22/2019 24-0514
24/93
11
containing 600 mg BOD L-1, 200 mg COD L-1and 600 mg TN L-1is 99, 90 and 98%,
respectively. PVA-gel carrier has been selected for hundreds of industrial-scale water
treatment systems (Kuraray Corporation). It has also been applied for lab-scale anaerobic
bioreactors, including packed-bed reactor (Rouse et al., 2005), anammox reactor (Tran et
al., 2006; Quan et al., 2010; Li et al., 2011) and UASB reactor (Zhang et al., 2008; Khanh
et al., 2011). Quan et al. (2010) conducted an anammox reactor using modified PVA-gel
carrier with immobilization technique. Other authors used the original Kurarays PVA-gel
beads. Zhang et al. (2008-2011) carried out his experiments with UASB reactor using
PVA carrier treating high-strength wastewaters. The treatment of low-strength
wastewater is crucial in many developing countries, such as Vietnam, etc., thus, my study
focus on the UASB reactor using PVA-gel carrier treating low-strength wastewater.
Fig. 1-5 Kurarays wastewater treatment technology using PVA gel beads.
(Kuraray Annual Report, 2007)
7/22/2019 24-0514
25/93
12
1.2 Objectives of this study
COD reduction is one of the most common factors for validation of any wastewater
treatment facility. The aim of this study was to investigate COD removal fromlow-strength wastewater with application of UASB reactors using PVA-gel beads. The
more specific objectives of the research included:
1. Establishing a UASB reactor treating low-strength wastewater under mesophilic
to psychrophilic conditions. The effect of temperature decrease on COD
reduction will be studied; besides, the acceptable organic loadings for
low-strength wastewater treatment by UASB reactor will also be investigated
under the decrease of hydraulic retention time. (Chapter 2);
2. Realizing the role of porous structure of PVA granules in UASB reactors. COD
removal performance and the dominant microbial species in two identical
bioreactors using PVA and poly(ethylene glycol)-gel carriers will be studied
(Chapter 3);
3. Studying the diversity and dynamics of microbial communities in two lab-scale
UASB bioreactors treating low-strength wastewater (Chapter 4);
4. Investigating the feasibility of applying a swim-bed reactor as post-treatment of
UASB effluents (Chapter 5).
References
Alphenaar, P.A., Visser, A., Lettinga, G. (1993): The effect of liquid upward velocity and
hydraulic retention time on granulation in UASB reactors treating wastewater with a
high sulphate content, Bioresource Technology, 3, 960968.
Arcand, Y., Guiot, S.R., Desrochers, M., Chavarie, C. (1994): Impact of the reactor
hydrodynamics and organic loading on the size and activity of anaerobic granules,
Chemical Engineering Journal and Biochemical Engineering Journal, 56, 2335.
Arching, B.K., Schmidt, J.E., Winther-Nielsen, M., Macario, A.J.L., de Macario, E.C.
(1993): Effect of medium composition and sludge removal on the production,
composition and architecture of thermophilic (55o
C) acetate-utilizing granules from
7/22/2019 24-0514
26/93
13
an upflow anaerobic sludge blanket reactor, Applied and Environmental
Microbiology, 59, 25382545.
Bai, X., Ye, Z.F., Li, Y.F., Zhou, L.C., Yang, L.Q. (2010): Preparation of crosslinkedmacroporous PVA foam carrier for immobilization of microorganisms, Process
Biochemistry, 45, 6065.
Borja, R., Banks, C.J. (1995): Response of an anaerobic fluidized bed reactor treating
ice-cream wastewater to organic, hydraulic, temperature and pH shocks, Journal of
Biotechnology, 39(3), 251259.
Cao, G.M., Zhao, Q.X., Sun, X.B., Zhang, T. (2002): Characterization of nitrifying and
denitrifying bacteria coimmobilized in PVA and kinetics model of biological
nitrogen removal by coimmobilized cells, Enzyme and Microbial Technology, 30,
4955.
Chen, K.C., Lee, S.C., Chin, S.C., Houng, J.Y. (1998): Simultaneous carbon-nitrogen
removal in wastewater using phosphorylated PVA-immobilized microorganisms,
Enzyme and Microbial Technology, 23, 311320.
Choorit, W., Wisarnwan, P. (2007): Effect of temperature on the anaerobic digestion of
palm oil mill effluent, Journal of Biotechnology Research, 10 (3), 376385.
Demirel, B., Scherer, P. (2008): The roles of acetotrophic and hydrogenotrophic
methanogens during anaerobic conversion of biomass to methane: a review,
Reviews in Environmental Science and Biotechnology, 7, 173190.
Guiot, S.R., Pauss, A., Costerton, J.W. (1992): A structured model of the anaerobic
granules consortium, Water Science and Technology, 25, 110.
Habeeb, S.A., Aziz Bin Abdul Latiff, A.B., Zulkifli B.A. (2010): A review on Properties
of the digestion process in the upflow anaerobic sludge blanket (UASB) reactor.
Canadian Journal on Environmental, Construction and Civil Engineering, 1 (3),
5870.
Hobson, P.N., Shaw, B.G. (1973): The bacterial population of piggery-waste anaerobic
digesters, Water Research, 8, 507516.
7/22/2019 24-0514
27/93
14
Hulshoff Pol, L.W., de Castro Lopes, S.I., Lettinga, G., Lens, P.N.L. (2004): Anaerobic
sludge granulation, Water Research, 38, 13761389.
Hwang, P.C., Cheng, S.S. (1991): Treatment of p-cresol with a recirculating UASBreactor using the concept of kinetic control, Water Science and Technology, 24,
133140.
Imai, T. (1997): Advanced start-up of UASB reactors by adding of water absorbing
polymer, Water Science and Technology, 36, 399406.
Ke, S.Z., Shi, Z., Zhang, T., Fang, H.H. (1996): Degradation of phenol in wastewater in
an upflow anaerobic sludge blanket reactor, Water Research, 30(6), 13531360.
Khanh, D.P., Quan, L.M., Zhang, W., Hira D., Furukawa, K. (2011): Effect of
temperature on low-strength wastewater treatment by UASB reactor using
poly(vinyl alcohol)-gel carrier, Bioresource Technology, 102,1114711154.
Kuraray Annual Report (FY2007) www.kuraray.co.jp/ir/library/pdf/annual/ar2007.pdf
Leal, M.C.M.R., Freire, D.M.G., Cammarota, M.C., Sant Anna Jr. G.L. (2006): Effect of
enzymatic hydrolysis on anaerobic treatment of dairy wastewater, Process
Biochemistry, 41(5), 11731178.
Lens, P., de Beer D., Cronenberg, C., Ottengraf, S., Verstraete, W. (1995): The use of
microsensors to determine distributions in UASB aggregates, Water Science and
Technology, 31, 273280.
Lettinga, G., Velsen, A.F.M., Hobma, S.W., Zeeuw, W., Klapwijk, A. (1980): Use of the
upflow sludge blanket reactor concept for biological wastewater treatment,
Biotechnology and Bioengineering, 22(4), 699734.
Li, Q., Kang, C., Zhang, C. (2005): Wastewater produced from an oilfield and
continuous treatment with an oil-degrading bacterium, Process Biochemistry, 40,
873877.
Li, Z.G., Hira, D., Fujii, T., Furukawa, K. (2011): Treatment capability and microbial
community of anammox process using PVA gel beads as biomass carriers,
Japanese Journal of Water Treatment Biology, 47(4), 137145.
7/22/2019 24-0514
28/93
15
Liu, Y., Xu, H.L., Yang, S.F., Tay, J.H. (2003): Mechanisms and models for anaerobic
granulation in UASB reactor, Water Research, 37 (3), 661673.
Lozinsky, V.I., Plieva, F.M. (1998): Poly(vinyl alcohol) cryogels employed as matricesfor cell immobilization: 3. Overview of recent research and developments, Enzyme
and Microbial Technology, 23, 227242.
MacLeod, F.A., Guiot, S.R., Costerton, J.W. (1990): Layered structure of bacterial
aggregates produced in an upflow anaerobic sludge bed and filter reactor, Applied
and Environmental Microbiology, 56, 15981607.
Quan, L.M., Khanh, D.P., Hira, D., Fujii, T., Furukawa, K. (2011): Reject water
treatment by improvement of whole cell anammox entrapment using polyvinyl
alcohol/alginate gel, Biodegradation, 22, 11551167.
Sankar Ganesh, P., Ramasamy, E.V., Gajalakshmi, S., Sanjeevi, R., Abbasi, S.A. (2007):
Studies on treatment of low-strength effluents by UASB reactor and its application
to dairy industry wash waters, Indian Journal of Biotechnology, 6, 234238.
Sekiguchi, Y., Kamagata, Y., Syutsubo, K., Ohashi, A., Harada, H., Nakamura, K.
(1998): Diversity of mesophilic and thermophilic granular sludge determined by
16S rRNA gene analysis, Microbiology, 22, 26552665.
Show, K.Y., Wang, Y., Foong, S.F., Tay, J.H. (2004): Accelerated start-up and enhanced
granulation in upflow anaerobic sludge blanket reactors, Water Research, 38,
22932304.
Rouse, J.D., Fujii, T., Sugino, H., Tran, H., Furukawa, K. (2005): PVA-gel beads as a
biomass carrier for anaerobic oxidation of anmmonium in a packed-bed reactor, In:Proceedings of 5th International Exhibition and Conference on Environmental
Technology, Heleco05, Athens, Greece, 19.
Tay, J.H., Xu, H.L., Teo, K.C. (2000): Molecular mechanism of granulation. I: H+
translocation-dehydration theory, Environmental Engineering, 126, 403410.
Tiwari, M.K., Guha, S., Harendranath, C.S., Tripathi, S. (2005): Enhanced granulation
by natural ionic polymer additives in UASB reactor treating low-strength
7/22/2019 24-0514
29/93
16
wastewater, Water Research, 40(7), 38013810.
Tran, T.T.H., Luong, N.K., Liu, Z.J., Fujii, T., Rouse, J.D., Furukawa, K. (2006):
Nitrogen removal by immobilized anammox sludge using PVA gel as biocarrier,Japanese Journal of Water Treatment Biology, 42(3), 139149.
Van Haandel, A., Kato, M.T., Cavalcanti, P.F.F., Florencio, L. (2006): Anaerobic reactor
design concepts for the treatment of domestic wastewater, Environmental Science
and Bioechnology, 5, 2138.
Van Haandel, A.C., Lettinga, G. (1994): Anaerobic sewage treatment: A practical guide
for regions with a hot climate, John Wiley & Sons, New York.
Whitman, W.B., Boone, D.R., Koga, Y., Keswani, J. (2001): Taxonomy of methanogenic
Archaea, In: Boone DR, Castenholz RW, Garrity GM (eds), Bergeys manual of
systematic bacteriology, vol 1. Springer, 211294.
Yu, J.H., Chen, M.J., Yue, P.L. (2000): Distribution and change of microbial activity in
combined UASB and AFB reactors for wastewater treatment, Bioprocess and
Biosystems Engineering, 22(4), 315322.
Zhang, L.S., Wu, W.Z., Wang, J.L. (2007): Immobilization of activated sludge using
improved polyvinyl alcohol (PVA) gel, Journal of Environmental Sciences, 19,
12931297.
Zhang, W., Wang, D., Koga, Y., Yamamoto, T., Zhang, L., Furukawa, K. (2008): PVA
gel beads enhance granule formation in a UASB reactor, Bioresource Technology,
99, 84008405.
Zhang, W., Xie, Q., Rouse, J.D., Qiao, S., Furukawa, K. (2009): Treatment of
high-strength corn steep liquor using cultivated polyvinyl alcohol gel beads in
anaerobic fluidized-bed reactor, Bioscience and Bioengineering, 107(1), 4953.
Zhang, W., Zhang, X., Wang, D., Koga, Y., Rouse, J.D., Furukawa, K. (2011): Trace
elements enhance biofilm formation in UASB reactor for solo simple molecule
wastewater treatment, Bioresource and Technology, 102, 92969299.
7/22/2019 24-0514
30/93
17
Chapter 2 Effect of temperature on UASB treatment of
low-strength wastewater using poly(vinyl alcohol)-gel carrier
2.1Introduction
COD reduction is one of the most common factors for validation of any facility that
has to comply with wastewater treatment regulations. Failure to deal appropriately with
COD reduction can result in non-compliance fines. UASB reactor is among the most
popular anaerobic treatment process in which organic matter is digested, absorbed, and
metabolized into bacterial cell mass and biogas, thus COD reduction can be successfully
achieved (Seghezzo et al., 1998; Tchobanoglous et al., 2003). PVA, which is a readily
available low-cost polymeric gel, has previously been shown to be an effective biomass
carrier in UASB reactors treating high-COD-containing wastewater (Zhang et al., 2008a
and 2008b). Further experiments were therefore conducted to evaluate the feasibility of
using UASB reactors for low-COD-containing wastewater treatment. It is widely known
that low-COD-containing wastewater [
7/22/2019 24-0514
31/93
18
2.2Materials and methods
2.2.1 Experimental setup
Fig. 2-1 Schematic diagram of 3.9L-cuboid-shaped UASB reactor (A),
blank PVA-gel beads (B), macrostructure of a PVA-gel bead, scale bar 20 m (C),
cultivated PVA-gel beads (D)
The laboratory-scale UASB reactor constructed in cuboid shape was made of
Plexiglas with a total volume of 3.9 L (60x60x110 mm).The reactor had six sampling
ports and a peristaltic pump was used to maintain the fluidity of the sludge bed (Fig.
2-1A). The influent was injected at the bottom-end of the reactor with a stepwise increase
in flow rates. Table 2-1 shows the strategy for operating UASB reactor under short
hydraulic retention times. HRTs less than 2h and 1h were applied, involving with high
A
Recycle port
PVA gelcarrier
P
Gas-solidseparator
Influent
Gascoll
ection
NaCl
solution
SP-1
SP-2
SP-3
SP-4
SP-5
Effluent port
P
Water bath
7/22/2019 24-0514
32/93
19
organic loading rates. In comparison with HRTs of 6h and more in conventional UASB,
these HRTs was short, allows savings in time for treatment process. The treatment
temperature was decreased allows to save input of energy supplied for the reactor. The
treatment of low-strength wastewater is preferably carried out at ambient temperature.
The reactor temperature was referred to the mean annual temperatures in
moderate-climate and tropical-climate countries. Depending on the geographical location,
mean annual temperatures of wastewater have been reported in the range 327C in the
United States and from 30 to 35C for countries in Africa and the Middle East
(Tchobanoglous et al., 2003).
Table 2-1 Operational parameters
HRT
(h)
Flow rate
(L h-1)
Upflow velocity
(m h-1)
Loading rate
(kg-COD m-3 d-1)
Time (days)
Period I
(35oC)
Period II
(25oC)
Period III
(15oC)
2.00 2.0 0.9 5.05.3 017
1.56 2.5 1.1 6.46.6 1727 7095 190205
0.87 4.5 1.7 11.512.0 2733 95110 205224
0.60 6.5 2.2 17.017.5 3339 110130 224240
0.49 8.0 2.6 21.022.0 3945 130150 240265
0.39 10 3.2 26.027.5 4553 150180 265270
0.33 12 3.8 27.531.5 5356 180185 270275
0.28 14 4.3 36.437.1 5661 185190 275278
0.25 16 4.9 39.139.7 6567
0.23 17 5.1 42.544.5 6769
0.22 18 5.4 46.047.5 6970
2.2.2 Synthetic medium
The influent containing COD concentrations of 430 20 mg L1was prepared by
diluting concentrated synthetic wastewater composed of bonito extract (40 g L1),
peptone (60 g L
1
), NaHCO3(80 g L
1
), NaCl (10 g L
1
), KCl (2.8 g L
1
), CaCl22H2O
7/22/2019 24-0514
33/93
20
(2.8 g L1), and MgSO47H2O (2.0 g L
1). Influent pH was approximately 7.1-7.3. The
5-day soluble biochemical oxygen demand (BOD5) was about 65% of the soluble COD.
2.2.3 Biomass carrier
The original PVA-gel beads (4-mm diameter) were supplied by the Kuraray Co., Ltd
(Osaka, Japan) (Figs. 2-1B, 1C). The cultivated PVA-gel beads originated from a
previously studied anaerobic fluidizing reactor. The volume of bio-carrier was 0.8 L.
These beads were black when transferred to the UASB reactor (Fig. 2-1D) and had an
average settling velocity of 177 m h1. The settling velocities of the PVA gel were
determined in quiescent water in a 2-L graduated cylinder (height 42 cm).
2.2.4 Analytical methods
Effluent filtered through a 1.0-m membrane filter was used for analysis of soluble
components. Soluble COD concentrations were measured by the closed reflux
colorimetric method (APHA, 1995). The evolved gas was collected through a gassolid
separator and the volume was measured using an inverted cylinder containing tap water
with the pH lowered to 3.0 using 1N H2SO4. Methane analyses were performed using a
GC-14B gas chromatograph (Shimadzu, Kyoto, Japan). Determination of BOD5 was
carried out using the dilution method and total nitrogen (TN) concentration was measured
using the persulfate digestion-UV spectrophotometric method and Standard Methods
(APHA, 1995).
Scanning electron microscopic observations of the PVA-gel structure were
conducted as follows: a PVA-gel bead was cut into two pieces and washed twice, for 5
min each time, with 0.1 M phosphate buffer (pH 7.4). The PVA-gel pieces were hardened
for 90 min in a 2.5% glutaraldehyde solution prepared with 0.1 M phosphate buffer (pH
7.4). Next, the samples were washed in the buffer solution three times, for 10 min each
time, and then fixed for 90 min in a 1.0% OsO4solution prepared with 0.1 M phosphate
buffer. After washing the samples three times, for 10 min each time, in the buffer solution,
they were dehydrated in serially graded solutions of ethanol at concentrations of 10%,
30%, 50%, 70%, 90%, and 95% for 10 min each, and then twice at a concentration of
99.5% for 30 min each time. The samples were frozen and dried using a freeze-drier
(JEOL JFD-300, JEOL, Tokyo, Japan), and then sputter-coated with gold for 100 s with
7/22/2019 24-0514
34/93
21
an ion-sputtering device (JEOL JFC-1100E). Finally, the samples were observed with a
scanning electron microscope (JEOL JSM 6390LV).
A sludge sampleattached to PVA gel was taken from at sampling port 1 (day 270).The sludge samples used for DNA extraction were stored at 20C prior to analyses. The
sludge sample was first ground with a pestle under liquid nitrogen. Meta-genomic DNA
was extracted using an ISOIL kit (Nippon Gene, Tokyo, Japan) according to the
manufacturers instructions. The archaeal 16S rRNA genes in the DNA were amplified by
PCR with Phusion High-Fidelity DNA polymerase (Finnzymes, Espoo, Finland) and the
primers of Parch519f (forward primer: 5-CAGCCGCCGCGGTAA-3) and ARC915r
(reverse primer: 5- GTGCTCCCCCGCCAATTCCT -3) (Coolen et al., 2004). PCR was
carried out according to the following thermocycling parameters: 30 s initial denaturation
at 98C, 25 cycles of 10 s at 98C, 20 s at 65C, 20 s at 72C, and 5 min final elongation
at 72C. The amplified products were electrophoresed on a 1% agarose gel. A band (~0.4
kb) on the agarose gel was excised, and the DNAs in that band were extracted and
purified using a Wizard SV Gel and PCR Clean-Up System (Promega, Madison, WI,
USA).
The purified DNA fragments were ligated into the EcoRV site of pBluescript II KS +(Stratagene, La Jolla, CA, USA). Escherichia coli DH5 was transformed using the
constructed plasmids. The plasmids were extracted from the clones carrying them by the
alkaline method. The DNA fragments were sequenced using a 3130xl genetic analyzer
and BigDye terminator v3.1 cycle sequencing kit (Applied Biosystems, Foster City, CA,
USA). Operational taxonomic units (OTUs) were defined by a 1% distance level in the
nucleotide sequences. The sequences were compared with those in the nr database by the
basic local alignment search tool (BLAST) program available on the NCBI website
(http://blast.ncbi.nlm.nih.gov/Blast.cgi).
2.3 Results
2.3.1 UASB reactor performance
The reactor was operated at temperatures varying from 35C (Period I) to 25C
(Period II), and 15C (Period III) as shown in Table 2-2. The experiments were carried
7/22/2019 24-0514
35/93
22
out with stable influent COD concentrations (43020 mg L1) and a stepwise decrease in
HRT, which reduces the treatment space and time.
Table 2-2 Performance of UASB reactor during Period I-III
Parameters 35oC (I) 25oC(II) 15oC (III)
Influent COD (mg L-1
) 42515 42916 4258
Effluent COD (mg L-1
) 9680 17530 32540
COD loading rate (kg m-3
d-1
) 2217 1710 147
COD removal rate (kg m-3
d-1
) 1411 10.56.5 42
COD removal efficiency (%) 7610 6010 313
Specific COD removal rate (kg m3-PVA-gel
1d
1) 6046 5031 199
CH4 yield (m3kg
1-CODremoved) 0.250.04 0.150.06 0.020.01
Fig. 2-2 shows the time courses of COD removal. Influent COD concentration was
kept stable and HRT was shortened, leading to an increase in loading rates and specific
COD removal rate. Due to the decrease of temperature, the methane yield reduced and
effluent COD concentrations increased stepwise. The effluent COD concentrations were
below 200 mg L-1 during Period I-II. At extremely short HRTs, COD removal rates
dropped to low values that indicated the COD overloads.
The reactor was started up at 35 C and an HRT of 2.0 h. From day 20, the HRT was
decreased stepwise. As the HRT was shortened to 0.26 h, the COD loading rate reached
40 kg-COD m3d1. A COD removal rate of 28 kg-COD m3d1, correlated with a high
specific COD removal rate of 137 kg-COD m3-PVA-gel1 d1, was achieved. The
methane yield reached 0.25 m3kg1-CODremoved. At the extremely short HRT of 0.22 h,
the COD removal rate dropped to 26 kg-COD m3d1with a decrease in methane yield to
0.21 m3kg1-CODremoved.
Period II at 25C was started from day 70. The COD removal rate reached 17
kg-CODremovedm3d1at an HRT of 0.39 h. The maximum loading rate was 27 kg-COD
m
3
d
1
. A specific COD removal rate of 80 kg-COD m
3
-PVA-gel
1
d
1
and a methane
7/22/2019 24-0514
36/93
23
yield of 0.21 m3kg1-CODremoved were obtained. The HRT was then shortened to 0.28 h,
and thereafter it was increased to 1.56 h for the third period of operation, at 15 C, from
day 190.
Period I
(35oC)
Period II
(25oC)
Period III
(15oC)
Fig. 2-2 Time courses of COD removal
During Period III, a maximum loading rate of 21 kg-COD m3 d1was obtained
using stepwise decreases in HRT. The COD removal rate reached 6 kg-COD m3d1
under HRT 0.49 h. A specific COD removal rate of 28 kg-COD m3-PVA-gel1d1was
obtained, and the methane yield was reduced to 0.19 m3kg1-CODremoved. Overall, COD
removal rate decreased by 50% with each temperature decrease of 10C.
0.0
0.2
0.4
0.6
0.8
1.0
1.2
1.4
1.6
0
5
10
15
20
25
30
35
HRT(h)
Temperature(oC) Temperature
HRT
0
5
10
15
20
25
30
35
40
45
50
0
50
100
150
200
250
300
350
400
450
500
CODloadingrate,
COD
removalrate
(kg-CODm-3d-1)
C
ODconcentration(mgL-1)
Influent COD Effluent COD COD loading rate COD removal rate
0.00
0.05
0.10
0.15
0.20
0.25
0.30
0
20
40
60
80
100
120
0 50 100 150 200 250 300
Methaneyield
(m3kg-1-CODremoved
)
SpecificCODremovalrate
(kg-CODm3-PVA-gel-1d-1)
Time (day)
Specific COD removal rate
Methane yield
7/22/2019 24-0514
37/93
24
In each period of operation, a steady-state phase was reached before COD overload
conditions occurred; overload conditions occurred during days 6569, days 180189, and
days 265278. The HRTs for each COD overload condition were 0.26 h, 0.39 h, and 0.49
h at 35C, 25C, and 15C, respectively. The changes in COD concentrations inside the
UASB reactor during the steady-state phases were measured (Fig. 2-3). The samples were
taken from the three sampling ports (lower port SP-3; middle port SP-4; higher port SP-5)
located at heights of 35, 50, and 65 cm above the reactor bottom.
The steady-state COD concentrations were compared with the influent and effluent
COD concentrations. At the same HRT (0.6 h) and an up-flow linear velocity of 2.2 m h1,
only 715% of the influent COD concentration (30 to 60 mg-COD L1, depending on the
reactor temperatures) was removed from the upper part of UASB reactor where the
sampling ports are located. Thus, it could be concluded that organic matter was mostly
degraded by the PVA-gel layer in the lower part of reactor. High COD consumption in the
sludge bed at 35C and 25C periods demonstrated that the PVA-gel beads played an
important role as support materials in retaining a sufficient amount of anaerobic sludge in
the UASB reactor. Under short HRTs, temperatures as low as 15C may lead to limited
biodegradation, thus high concentrations of residual COD in the upper part of UASB
reactor were observed.
Fig. 2-3 COD concentrations at different sampling ports
under loading rate of 17 kg-COD m3
d1
(HRT 0.6 h)
0
50
100
150
200
250
300
350
400
450
COD
concentration(mgL-1)
Influent port Lower port Middle port Higher port Effluent port
35oC 25
oC 15
oC
7/22/2019 24-0514
38/93
25
2.3.2Effects of temperature decrease and extremely short HRTsA decrease in biochemical reaction rate is often related to a decrease in treatment
temperature. The effect of reactor temperature (T) on COD removal rate (k) is given by
the following empirical equation (Tchobanoglous et al., 2003):
(1)
where kT is the COD removal rate at temperature TC, k20 is the COD removal rate at
20C, and is the temperature coefficient 1.056 (20-30oC) and 1.135 (4-20oC). The
values for cold temperatures (below 20C) were larger than those for medium
temperatures, implying that psychrophilic conditions had more influence on the COD
removal rate than mesophilic conditions did. This trend is illustrated in Fig. 2-4 that
shows the temperature dependence of COD removal rates under HRTs ranging from 1.56
h to 0.49 h.
Fig. 2-4 Temperature dependence of COD removal rate
The Eq. (1) permits the calculation of the temperature coefficient () based on
experimental COD removal rates. The value was determined to be 1.05 to 1.09
(average: 1.07) at temperatures ranging from 35C to 15C. The values in the present
study were consistent with previously reported results (Table 2-3).
0
5
10
15
20
15 25 35
CODremovalrate(kg-CODm-3d-1)
Temperature (oC)
HRT 1.56 hHRT 0.87 h
HRT 0.60 h
HRT 0.49 h
7/22/2019 24-0514
39/93
26
Table 2-3 Comparison of temperature coefficients ()for anaerobic treatments
Temperature coefficient () Temperature References
1.047 20oC Phelps (1944)
1.135
1.056
420oC
2030oCSchroepfer et al., (1964)
1.09 (PVA beads)
1.05 (PVA beads)
1525oC
2535oCThis study
1.07-1.11 (star channel)
1.06-1.11 (pall rings)
1.04-1.05 (gravel)
1525oC El-Monayeri et al., (2007)
All values of were larger than 1, showing that the COD removal rate decreased as
the temperature decreased. El-Monayeri et al. (2007) discussed that the structure of
biomass carrier influences the values. Thereported values of varied from 1.05 to 1.11
for three types of support media (gravel, pall rings and star channel). The highly porous
carriers, such as star channel and pall rings have the higher values of than non-porous
carriers. The average value of in case of PVA-gel carrier was 1.07 consistent with the
range of values for the highly porous carriers.
2.3.3 Characteristics of attached growth
Fig. 2-5 Scanning electron microscopic images of a matured PVA-gel bead:
cross-section (A), surface (B) and interior (C)
A B C
7/22/2019 24-0514
40/93
27
The PVA beads on days 70, 170, and 270 had average settling velocities of 194, 199,
and 201 m h1, respectively, greater than the value of 177 m h1in the start-up process. In
comparison, reported typical values for anaerobic biomass granules are in the range
18100 m h1 (Quan et al., al., 2011). Because of biomass attachment, the color of
PVA-gel beads turned to black. The outer surface of matured PVA-gel was covered with a
dense sludge layer (Fig. 2-5). Cracks appeared as a result of gas release. The porous
structure of PVA-gel provided a matrix for biomass development to the inner core of bead.
The use of PVA-gels in lab-scale UASB reactors treating different types of wastewater
under temperature variation is summarized in Table 2-4. Zhang et al. (2008a) conducted
his experiments using PVA beads as seed nuclei in a UASB reactor treating high-strength
synthetic wastewater made of corn steep liquor. The PVA-gel beads had a similar density
to natural granules, 1.031.08 g cm3, which has been shown to be beneficial for
microbial attachment (Schmidt and Ahring, 1996).
Table 2-4 Performance of lab-scale UASB reactors using PVA-gel carrier
Operational condition
UASB I
(Zhang et al., 2008a; 2008b)
UASB II
(this study)
Reactor temperature 35 C 35 C 35 C 25 C 15 C
Reactor volume (L) 7.5 7.5 3.9 3.9 3.9
HRT (h) 4810 14.48.0 2.000.22 1.560.28 1.560.28
Synthetic medium Corn steep liquor Ethylene glycol Peptone-bonito extract
Influent COD concentration (mg L1) 770-11000 600-3800 43020
COD loading rate (kg-COD m3d1) 0.422.5 1.011 5.247 6.337 6.435.5
COD removal rate (kg-COD m3d1) 20.5 10.7 25 16 12
Operation period (day) 280 137 70 118 98
PVA-gel size (mm diameter) 23 34 4 4 4
Packing ratio (%) 8 12 20 20 20
Specific COD removal rate(kg-COD m3-PVA-gel1d1)
154 78 119 81 60
Settling velocity (m h1) 200 322 194 199 201
7/22/2019 24-0514
41/93
28
During the experimental periods, the PVA-gel beads always settled at the bottom of
the reactor. The smaller PVA-gel beads (2~3-mm diameter) promoted biomass
attachment, but the bigger ones (4-mm diameter) were helpful for retaining the beads in
the reactor (Zhang et al., 2008a and 2008b). Hence, the bigger-size PVA-gel beads were
selected for the experiments in our study. As the reactor temperature decreased from
35 C to 15 C, the specific COD removal rate decreased by nearly 50%, from 119 to 60
kg-COD m3-PVA-gel1d1; however, the settling velocity increased. The mechanism of
anaerobic sludge granulation in UASB reactors is poorly understood, but the increase in
settling velocity could be explained by the development of attached biomass layers on the
surface of PVA-gel.
2.3.4 Archaeal community analysis
In the UASB reactor, sequential metabolic processes are carried out by different
groups of bacteria such as hydrolytic bacteria, fermentative acidogenic bacteria,
acetogenic bacteria, and methanogens. The archaeal communities for UASB sludge on
the surface of the PVA-gel carrier treating low-strength organic wastewater in the present
study is shown in Table 2-5.
Eight different OTUs were identified in the archaeal clone library of the sludge
sample (day 270). OTU 1 and OTU 2 had 100% and 98% sequence identity with
Methanobacterium beijingensestrain 4-1 (AY552778), respectively.Methanobacterium
beijingense strain 4-1 was isolated from an anaerobic digester in Beijing, China. The
strain has been shown to use H2/CO2 and formate for growth and methane production.
OTU 3 and OTU 4 had 100% sequence identity withMethanobacterium formicicum
strain FCam (AF028689) and Methanobacterium formicicum strain S1 (DQ649309),respectively.Methanobacterium formicicumstrain FCam was isolated from rice-field soil
in France. The strain has also been shown to use H2/CO2 and formate for growth and
methane production. Thus, 36% (12 clones/33 clones) of archaeal members in the UASB
sludge community were thought to belong to the genus ofMethanobacteriumwhich grow
on H2/CO2 and formate.
OTU 5 and OTU 6 had 99% sequence identity with UnculturedMethanosarcinales
archaeon clone QEEC1CH041 (CU917466) and 97% sequence identity withUncultured
7/22/2019 24-0514
42/93
29
Methanosaeta sp. clone DI_C03 (AY454761), respectively.
Table 2-5 Archaeal communities of UASB sludge
OTU TaxonGenBankAccession
Identity(%)
Numberof clones
1 UnculturedMethanobacteriumsp. clone WA1
Methanobacterium beijingense strain 4-1
EU88817
AY552778
100
100
6/33
2 Uncultured Methanogenic archaeon isolate SSCP band As11
Methanobacterium beijingensestrain 4-1
DQ682559
AY552778
99
98
1/33
3 UnculturedMethanobacterium sp. clone SWA3
Methanobacterium formicicum strain FCam
EU888014
AF028689
100
100
4/33
4 UnculturedMethanobacteriumsp. clone SWA4
Methanobacterium formicicum strain S1
EU888013
DQ649309
100
100
1/33
5 UnculturedMethanosarcinalesarchaeon clone QEEC1CH041
UnculturedMethanosarcinales archaeon clone QEEC1AB061
CU917466
CU917434
99
99
1/33
6 Uncultured archaeon isolate ARC7_G07
UnculturedMethanosaetasp. clone DI_C03
FM162215
AY454761
99
97
1/33
7 Archaeon enrichment culture clone C4-15C-A
Uncultured archaeon 44A-1
GU196162
AF424765
100
100
12/33
8 Uncultured crenarchaeote clone F31
Uncultured crenarchaeote clone GoM_GC232_4463_Arch73
EU910616
AM745241
99
94
7/33
It is widely known thatMethanosarcina andMethanosaeta are important aceticlastic
methanogenic species.Methanosarcinaare the most versatile methanogens. They can use
various sources of carbon, including methylamines and acetate. Methanosaetaalso can
use acetate as a substrate, although their growth rate is slower than that of
Methanosarcina. Methanosaeta was found to be dominant at very low acetate
concentrations and has a high affinity for acetate (Kongjan et al., 2011). On the other hand,
the genus Methanosarcina was able to tolerate high acetate concentrations and has a
7/22/2019 24-0514
43/93
30
much lower substrate affinity, but higher maximum specific use rate (Karakashev et al.,
2005; Tatara et al., 2005). Thus, the presence of Methanosarcina and Methanosaeta
species would support the proposition that methanogens with slow growth rates like
Methanosaetacan easily bind to PVA-gel, allowing longer sludge retention times in the
UASB reactor.
OTU 7 and OTU 8 had 100% sequence identity with Archaeon enrichment culture
clone C4-15C-A (GU196162) and Uncultured archaeon 44A-1 (AF424765), 94-99%
sequence identity with Crenarchaeote-relatives (EU910616 and AM745241). The
presence of these sequences can be explained by the distinctive operating conditions of
the UASB reactor under low temperatures and extremely short hydraulic retention time.
2.3.5 Post-treatment of UASB reactor effluent
The benefits of anaerobic wastewater treatment in UASB reactors are fully realized
if a post-treatment system is available. This process should be easy to operate, stable
under shock loads, and have low energy-requirements because the UASB reactor is
operated under various temperatures and HRTs. Fig. 2-6 shows the effluent BOD and
COD concentrations. The BOD5/COD ratio was 0.6, so the effluents from our UASB
reactor contain easily biodegradable organic carbon.
Fig. 2-6 BOD5, COD and TN concentrations in UASB effluents
under loading rates of 5 to 40 kg-COD m3
d1
Nitrogen removal is also often required before discharging treated effluents. The
influent total nitrogen (TN) concentrations were from 35 to 40 mg L1, of which 30% was
removed from the influent by the UASB reactor. As shown in Fig. 2-6, the UASB
effluents contained low TN concentrations. The economical post-treatment of such
0
50
100
150
200
250
300
350
BOD5 COD TN
Concentration(mgL-1) 35oC 25oC 15oC
35oC 25oC 15oC
BOD5
7/22/2019 24-0514
44/93
31
UASB effluents has been documented using a down-flow hanging-sponge system
(Takahashi et al., 2011); a sequencing batch reactor system (Moawad et al., 2009); an
electrocoagulation system (Yetilmezsoy et al., 2009); slow sand filters (Tyagi et al.,
2009); and polishing ponds (Sato et al., 2006), etc. Other studies of the development of
swim-bed technology demonstrated that swim-bed-attached growth bioreactors showed
excellent performance in organic wastewater post-treatment (Cheng et al., 2006). With
respect to the use of PVA-based biomass carriers, recently developed anammox reactors
have been reported as providing a promising nitrogen removal process (Ge et al., 2009;
Quan et al., 2011). These results show that further study is needed to evaluate
cost-effective systems for the post-treatment of UASB reactor effluents.
2.4 Discussion
It is widely known that temperature is an important factor in anaerobic treatment of
domestic wastewater. In addition, temperature shifts may cause higher suspended solids
levels in effluents and a decrease in the removal efficiencies of soluble COD (Morgan
and Allen, 2003; Ndon et al., 1997); the accumulation of suspended solids present in
domestic wastewater may decrease the methanogenic activity of the sludge, and also
causes formation of scum layers. Sudden washout of sludge may occur if these scum
layers are not stabilized within the reactor. In this situation, long HRTs and relatively
low organic loading rates are needed, thus the scope for high-rate wastewater treatment
is limited.
The UASB reactor showed the ability to sustain shock loads; however, it should be
prevented from overloading. In the present study, the recognition of COD overload
during each period of operation based on the drops of COD removal rate as showed in Fig.
2-2. Our findings must be viewed in the light of some limitations. One potential limitation
is that temperature control of the UASB reactor was needed, even though operation at
ambient temperatures is preferred. This was because of large variations in the ambient
temperature; these variations may cause unexpected effects in the reactor performance
under extremely short HRTs. This study also did not cover temperatures below 10 C,
which has been a challenge for many biological treatment processes. However, the results
from this study demonstrated the treatment feasibility of UASB reactors at low
temperatures.
7/22/2019 24-0514
45/93
32
The use of PVA-gel as the biomass carrier in UASB reactors has not been widely
documented. UASB reactors are required to operate under various temperatures,
depending on seasonal conditions. The present study addressed the effects of temperature
change on the treatment performance of a UASB reactor. It was found that the COD
removal rate of UASB reactor decreased by 50% for a temperature decrease of 10 C.
Extremely short HRTs could not be used at low temperatures because COD overload
occurred. Also, the characteristics of matured PVA-gel beads were found to be affected
by the wastewater constituents.
This study presented trends for COD removal rate against COD loading rate in
agreement with those reported by El-Monayeri et al. (2007). The key feature of UASB
process that allows higher volumetric COD loadings than as in other anaerobic processes
is the development of a dense granulated sludge (Ghangrekar et al., 2005; Tchobanoglous
et al., 2003). Several months may be required to develop this granulated sludge. A seed is
often supplied from other facilities to accelerate the reactor start-up. The UASB reactor in
our study was seeded with cultivated PVA-gel obtained from a previous anaerobic
fluidizing bed reactor, resulting in a short start-up phase.
Recently, there has been increasing interest in the mechanisms of granuledevelopment inside UASB reactors (Bhunia and Ghangrekar, 2007; Liu et al., 2003;
Vlyssides et al., 2008). Habeeb et al. (2011) assessed five key factors affecting UASB
granulation, namely (1) temperature, (2) organic loading rate, (3) pH and alkalinity, (4)
nutrients, and (5) cations and minerals. The present study covered the effects of
temperature and organic loading rate on PVA-gel carrier. Further work should assess the
development of granules in terms of the other factors. In addition, it has been
demonstrated experimentally that a high COD removal rate can be achieved by preparing
active microorganisms inside gel biomass carriers (Isaka et al., 2011; Quan et al., 2011).
These methods can be applied to the attached immobilization of useful microorganisms.
2.5 Conclusions
Two important findings were obtained from this study:
1) The effect of temperature on the treatment of low-strength wastewater in a UASB
reactor using PVA-gel carrier was investigated. The COD removal rate was reduced by
7/22/2019 24-0514
46/93
33
50% when the temperature was decreased by 10 C;
2) The relationship between COD removal rate and treatment temperature was
experimentally evaluated. The average temperature coefficient () was determined to be
1.07.
References
APHA, AWWA, WPCF (1995): Standard Methods for the Examination of Water and
Wastewater, 19th ed., American Public Health Association, Washington, DC.
Angenent, L.T., Banik, G.C., Sung, S. (2001): Anaerobic migrating blanket reactor
treatment of low-strength wastewater at low temperatures, Water Environment
Research, 73(5), 567574.
Bhunia, P., Ghangrekar, M.M. (2007): Statistical modeling and optimization of biomass
granulation and COD removal in UASB reactors treating low strength wastewater,
Bioresource Technology, 99, 42294238.
Cheng, Y.J., Watanabe, Y., Qiao, S., Koyama, T., Furukawa, K. (2006): Comparison of
treatment capacity of swim-bed technology and conventional activated sludgeprocess for domestic wastewater treatment, Japanese Journal of Water Treatment
Biology, 42(3), 129157.
Coolen, M.J.L., Hopmans, E.C., Rijpstra, W.I.C., Muyzer, G., Schouten, S., Volkman,
J.K., Sinninghe, D.J.S. (2004): Evolution of the methane cycle in Ace Lake
(Antarctica) during the Holocene: response of methanogens and methanotrophs to
environmental change, Organic Geochemistry, 35, 11511167.
El-Monayeri, D.S., Atta, N.N., El-Mokadem, S., Aboul-Fotoh, A.M. (2007): Effect of
organic loading rate and temperature on the performance of horizontal biofilters, In:
Proceedings of Eleventh International Water Technology Conference, IWTC11 2007,
Sharm El-Sheikh, Egypt, 671682.
Ge, Y.S., Yamaguchi, A., Sakuma, H. (2009): Study on the performance of anaerobic
ammonium oxidation treatment using PVA gel as a carrier, Water Science and
Technology, 59(5), 10371041.
7/22/2019 24-0514
47/93
34
Ghangrekar, M.M., Asolekar, S.R., Joshi, S.G. (2005): Characteristics of sludge
developed under different loading conditions during UASB reactor start-up and
granulation, Water Research, 39, 11231133.
Habeeb, S.A., Aziz Bin Abdul L.A.B., Zawawi, B.D., Zulkifli, B.A. (2011): A review
on granules initiation and development inside UASB reactor and the main factors
affecting granules formation process, International Journal of Energy and
Environment (IJEE), 2(2), 311320.
Isaka, K., Itokawa, H., Kimura, Y., Noto, K., Murakami, T. (2011): Novel autotrophic
nitrogen removal system using gel entrapment technology, Bioresource
Technology, 102(17), 77207726.
Karakashev, D., Batstone, D., Angelidaki, I. (2005): Influence of environmental
conditions on methanogenic compositions in anaerobic biogas reactors, Applied and
Environmental Microbiology, 71(1), 331338.
Kongjan, P., O-Thong, S., Angelidaki, I. (2011): Performance and microbial community
analysis of two-stage process with extreme thermophilic hydrogen and
thermophilic methane production from hydrolysate in UASB reactors, Bioresource
Technology, 102, 40284035.
Kumar, A., Yadav, A.K., Sreekrishnan, T.R., Satya, S., Kaushik, C.P. (2007): Treatment
of low strength industrial cluster wastewater by anaerobic hybrid reactor,
Bioresource Technology, 99, 31233129.
Liu, Y., Xu, H.L., Yang, S.F., Tay, J.H. (2003): Mechanisms and models for anaerobic
granulation in upflow anaerobic sludge blanket reactor, Water Research, 37 (3),
661673.
Moawad, A., Mahmoud, U.F., El-Khateeb, M.A., El-Molla, E. (2009): Coupling of
sequencing batch reactor and UASB reactor for domestic wastewater treatment,
Desalination, 242, 325335.
Morgan, S.F., Allen, D.G. (2003): Effects of temperature transient conditions on aerobic
biological treatment of wastewater, Water Research, 37(15), 35903601.
7/22/2019 24-0514
48/93
35
Ndon, U.J., Dague, R.R. (1997): Effects of temperature and hydraulic retention time on
anaerobic sequencing batch reactor treatment of low-strength wastewater, Water
Research, 31(10), 24552466.
Phelps, E.B. (1944): Stream Sanitation, John Wiley & Sons, New York.
Quan, L.M., Khanh, D.P., Hira, D., Furukawa, K. (2011): Reject water treatment by
improvement of whole cell anammox entrapment using polyvinyl alcohol/alginate
gel, Biodegradation, 22, 11551167.
Sato, N., Okubo, T., Onodera, T., Ohashi, A., Harada, H. (2006): Prospects for a
self-sustainable sewage treatment system: A case study on full-scale UASB system
in Indias Yamuna River Basin, Journal of Environmental Manage, 80, 198207.
Schmidt, J.E. and Ahring, B.K. (1996): Granular sludge formation in upflow anaerobic
sludge blanket (UASB) reactors, Biotechnology and Bioengineering, 49 (3),
229246.
Schroepfer, G.J., Robins, M.L., Susag, R.H. (1964): The research program on the
Mississippi River in the Vicinity of Minneapolis and St.Paul, Advances in Water
Pollution Research, Vol. 1, Pergamon, London.
Seghezzo, L., Zeeman, G., van Lier, J.B., Hamelers, H.V.M., Lettinga, G. (1998): A
review: The anaerobic treatment of sewage in UASB and EGSB reactors,
Bioresource Technology, 65, 175190.
Sekiguchi, Y., Kamagata, Y., Nakamura, K., Ohashi, A., Harada, H. (1999): Fluorescence
in situ hybridization using 16S rRNA-targeted oligonucleotides reveals localization
of methanogenes and selected uncultured bacteria in mesophilic and thermophilicsludge granules, Applied and Environmental Microbiology, 65, 12801288.
Singh, K.S., Harada, H., Viraraghavan, T. (1995): Low-strength wastewater treatment by
a UASB reactor, Bioresource Technology, 55, 187194.
Takahashi, M., Yamaguchi, T., Kuramoto, Y., Nagano, A., Shimozaki, S., Sumino, H.,
Araki, N., Yamazaki, S., Kawakami, S., Harada, H. (2011): Performance of a
pilot-scale sewage treatment: An up-flow anaerobic sludge blanket (UASB) and a
7/22/2019 24-0514
49/93
36
down-flow hanging sponge (DHS) reactors combined system by sulfur-redox
reaction process under low-temperature conditions, Bioresource Technology, 102,
753757.
Tatara, M., Yamazawa, A., Ueno, Y., Fukui, H., Goto, M., Sode, K. (2005): High-rate
thermophilic methane fermentation on short-chain fatty acids in a down-flow
anaerobic packed-bed reactor, Bioprocess and Biosystems Engineering, 27 (2),
10513.
Tchobanoglous, L., Burton, F.L., Stensel, D.H. (2003): Wastewater Engineering:
Treatment and Reuse, 4th ed., Mc Graw-Hill, New York, ISBN 0-07-041878-0.
Tyagi, V.K., Khan, A.A., Kazmi, A.A., Mehrotra, I., Chopra, A.K. (2009): Slow sand
filtration of UASB reactor effluent: A promising post treatment technique,
Desalination, 249(2), 571576.
Uemura, S., Harada, H. (2000): Treatment of sewage by a UASB reactor under moderate
to low temperature conditions, Bioresource Technology, 72, 275282.
Vlyssides, A., Barampouti, E.M., Mai, S. (2008): Granulation mechanism of a UASB
reactor supplemented with iron, Anaerobe, 14(5), 275279.
Yetilmezsoy, K., Iihan, F., Sapci-Zengin, Z., Sakar, S., Gonullu, M.T. (2009):
Decolorization and COD reduction of UASB pretreated poultry manure wastewater
by electrocoagulation process: A post-treatment study, Journal of Hazardous
Materials, 162, 120132.
Zhang, W., Wang, D., Koga, Y., Yamamoto, T., Zhang, L., Furukawa, K. (2008a):
PVA-gel beads enhance granule formation in a UASB reactor, BioresourceTechnology, 99, 84008405.
Zhang, W. (2008b): Applications of PVA-gel beads as biomass carrier for anaerobic
wastewater treatment, Ph.D. thesis, Kumamoto University, Kumamoto, Japan.
http://reposit.lib.kumamoto-u.ac.jp/handle/2298/11953
7/22/2019 24-0514
50/93
37
Chapter 3 Response of poly(vinyl alcohol)-gel and
poly(ethylene glycol)-gel biogranular sludges in two identical
UASB reactors
3.1 Introduction
UASB reactor has been employed in industrial and municipal wastewater treatment
for decades. It exhibits positive features such as high organic loadings, low energy
demand, short hydraulic retention time and easy reactor construction (Alphenaar et al.,
1993; Bhunia et al., 2007; El-Kamah et al., 2011; Fang et al., 1994; Ghangrekar et al.,2005; Lettinga et al., 1980; Mahoney et al., 1987; Schmidt et al, 1996; Zhang et al., 2008).
Important parameters affecting the treatment efficiency of UASB reactors include the
granulation process in the reactor, the characteristics of the wastewater to be treated, the
selection of inoculum material, the influent of nutrients and several other environmental
factors. Among these parameters, the granulation process is believed to be the most
critical one (Fang et al., 1994; Show et al., 2004). Different mechanisms and models for
anaerobic granulation in UASB reactors were reviewed by Liu et al. (2004). Of those,
some authors have been in agreements that one of the contributing factors to the
development of granules is the presence of nuclei (or bio-carriers) for microbial
attachment. The attachment of cells to these particles has been proposed as the initiation
step for granulation. Since the second step is the formation of a dense and thick biofilm on
the cluster of the inert carriers, this step could be considered as biofilm formation. One
the initial aggregates are formed, subsequent granulation could be regarded as an
increment of biofilm thickness. Several investigators have studied the effect of inert
particles in the granulation. Hulshoff Pol et al. (1989, 2004) demonstrated the importance
of inert support particles in the granulation process. When the inert particles with a
diameter of 40-100 m were removed from the inoculated sewage sludge, granulation
was not observed within the period of time required for granulation in the seed sludge. Yu
et al. (1999) proposed the guidelines for the selection of inert materials to be used in order
to enhance sludge granulation as (i) high specific surface area, (ii) specific gravity similar
to anaerobic sludge, (iii) good hydrophobicity, and (iv) spherical shape.
7/22/2019 24-0514
51/93
38
In chapter 1, PVA-gel beads supplied by Kuraray Corporation (Japan) were applied
for treatment of low-strength wastewater. PVA-gel performed itself as a potential biomass
carrier in UASB reactor (Khanh et al., 2011; Zhang et al., 2008; Zhang et al., 2011). Of
polymer gel particles, poly(ethylene glycol) (PEG), which is very similar to PVA beads,
has been considered as a possible biomass carrier (Hashimoto et al., 1998; Isaka et al.,
2007; Isaka et al., 2011; Xiangli et al., 2008). In the
Recommended