Transcript
Page 1: 1 - CPRE 583 (Reconfigurable Computing): Evolvable Hardware Iowa State University (Ames) CPRE 583 Reconfigurable Computing Lecture 24: Fri 11/18/2011 (Evolvable

1 - CPRE 583 (Reconfigurable Computing): Evolvable Hardware Iowa State University (Ames)

CPRE 583Reconfigurable ComputingLecture 24: Fri 11/18/2011

(Evolvable Hardware)

Instructor: Dr. Phillip Jones([email protected])

Reconfigurable Computing LaboratoryIowa State University

Ames, Iowa, USA

http://class.ee.iastate.edu/cpre583/

Page 2: 1 - CPRE 583 (Reconfigurable Computing): Evolvable Hardware Iowa State University (Ames) CPRE 583 Reconfigurable Computing Lecture 24: Fri 11/18/2011 (Evolvable

2 - CPRE 583 (Reconfigurable Computing): Evolvable Hardware Iowa State University (Ames)

•HW3: will be assigned as extra credit

•Exam 2– Reminder push back to Friday after Thanksgiving week– Note: I will have a substitute administrating the exam since I will be

attending a conference.

•Weekly Project Updates due: Friday’s (midnight)

Announcements/Reminders

Page 3: 1 - CPRE 583 (Reconfigurable Computing): Evolvable Hardware Iowa State University (Ames) CPRE 583 Reconfigurable Computing Lecture 24: Fri 11/18/2011 (Evolvable

3 - CPRE 583 (Reconfigurable Computing): Evolvable Hardware Iowa State University (Ames)

Project Grading Breakdown

• 50% Final Project Demo• 30% Final Project Report

– 20% of your project report grade will come from your 5-6 project updates. Friday’s midnight

• 20% Final Project Presentation

Page 4: 1 - CPRE 583 (Reconfigurable Computing): Evolvable Hardware Iowa State University (Ames) CPRE 583 Reconfigurable Computing Lecture 24: Fri 11/18/2011 (Evolvable

4 - CPRE 583 (Reconfigurable Computing): Evolvable Hardware Iowa State University (Ames)

• FPL• FPT• FCCM• FPGA• DAC• ICCAD• Reconfig• RTSS• RTAS• ISCA

Projects Ideas: Relevant conferences• Micro• Super Computing• HPCA• IPDPS

Page 5: 1 - CPRE 583 (Reconfigurable Computing): Evolvable Hardware Iowa State University (Ames) CPRE 583 Reconfigurable Computing Lecture 24: Fri 11/18/2011 (Evolvable

5 - CPRE 583 (Reconfigurable Computing): Evolvable Hardware Iowa State University (Ames)

• Teams Formed and Topic: Mon 10/10– Project idea in Power Point 3-5 slides

• Motivation (why is this interesting, useful)• What will be the end result• High-level picture of final product

– Project team list: Name, Responsibility• High-level Plan/Proposal: Fri 10/14

– Power Point 5-10 slides (presentation to class Wed 10/19)• System block diagrams• High-level algorithms (if any)• Concerns

– Implementation– Conceptual

• Related research papers (if any)

Projects: Target Timeline

Page 6: 1 - CPRE 583 (Reconfigurable Computing): Evolvable Hardware Iowa State University (Ames) CPRE 583 Reconfigurable Computing Lecture 24: Fri 11/18/2011 (Evolvable

6 - CPRE 583 (Reconfigurable Computing): Evolvable Hardware Iowa State University (Ames)

• Work on projects: 10/19 - 12/9– Weekly update reports

• More information on updates will be given• Presentations: Finals week

– Present / Demo what is done at this point– 15-20 minutes (depends on number of projects)

• Final write up and Software/Hardware turned in: Day of final (TBD)

Projects: Target Timeline

Page 7: 1 - CPRE 583 (Reconfigurable Computing): Evolvable Hardware Iowa State University (Ames) CPRE 583 Reconfigurable Computing Lecture 24: Fri 11/18/2011 (Evolvable

7 - CPRE 583 (Reconfigurable Computing): Evolvable Hardware Iowa State University (Ames)

Initial Project Proposal Slides (5-10 slides)• Project team list: Name, Responsibility (who is project leader)

– Team size: 3-4 (5 case-by-case)• Project idea

• Motivation (why is this interesting, useful)• What will be the end result• High-level picture of final product

• High-level Plan– Break project into mile stones

• Provide initial schedule: I would initially schedule aggressively to have project complete by Thanksgiving. Issues will pop up to cause the schedule to slip.

– System block diagrams– High-level algorithms (if any)– Concerns

• Implementation• Conceptual

• Research papers related to you project idea

Page 8: 1 - CPRE 583 (Reconfigurable Computing): Evolvable Hardware Iowa State University (Ames) CPRE 583 Reconfigurable Computing Lecture 24: Fri 11/18/2011 (Evolvable

8 - CPRE 583 (Reconfigurable Computing): Evolvable Hardware Iowa State University (Ames)

Weekly Project Updates

• The current state of your project write up– Even in the early stages of the project you

should be able to write a rough draft of the Introduction and Motivation section

• The current state of your Final Presentation– Your Initial Project proposal presentation

(Due Wed 10/19). Should make for a starting point for you Final presentation

• What things are work & not working• What roadblocks are you running into

Page 9: 1 - CPRE 583 (Reconfigurable Computing): Evolvable Hardware Iowa State University (Ames) CPRE 583 Reconfigurable Computing Lecture 24: Fri 11/18/2011 (Evolvable

9 - CPRE 583 (Reconfigurable Computing): Evolvable Hardware Iowa State University (Ames)

Common Questions

Page 10: 1 - CPRE 583 (Reconfigurable Computing): Evolvable Hardware Iowa State University (Ames) CPRE 583 Reconfigurable Computing Lecture 24: Fri 11/18/2011 (Evolvable

10 - CPRE 583 (Reconfigurable Computing): Evolvable Hardware Iowa State University (Ames)

• Text: Chapter 33• Readings:

– #8: A new species of hardware (2000) – #9: Real-world applications of analog and digital

evolvable hardware (1999) – #10: Generalized Disjunction Decomposition for

Evolvable Hardware (2006)

Resources on Evolvable Hardware

Page 11: 1 - CPRE 583 (Reconfigurable Computing): Evolvable Hardware Iowa State University (Ames) CPRE 583 Reconfigurable Computing Lecture 24: Fri 11/18/2011 (Evolvable

11 - CPRE 583 (Reconfigurable Computing): Evolvable Hardware Iowa State University (Ames)

• Understand Evolvable Hardware basics?• Benefits and Drawbacks• Key types/categories

What you should learn

Page 12: 1 - CPRE 583 (Reconfigurable Computing): Evolvable Hardware Iowa State University (Ames) CPRE 583 Reconfigurable Computing Lecture 24: Fri 11/18/2011 (Evolvable

12 - CPRE 583 (Reconfigurable Computing): Evolvable Hardware Iowa State University (Ames)

• One of the first papers to compare reconfigurable HW with biological organisms (1993) – “Evolvable Hardware with Genetic Learning: A first step

towards building a Darwin Machine”, Higuchi– Biological organism => DNA

• GATACAAAGATACACCAGATA– Reconfigurable Hardware => Configuration bitstream

• 000100111011011011011010101

Evolvable Hardware

Page 13: 1 - CPRE 583 (Reconfigurable Computing): Evolvable Hardware Iowa State University (Ames) CPRE 583 Reconfigurable Computing Lecture 24: Fri 11/18/2011 (Evolvable

13 - CPRE 583 (Reconfigurable Computing): Evolvable Hardware Iowa State University (Ames)

• One of the first papers to compare reconfigurable HW with biological organisms (1993) – “Evolvable Hardware with Genetic Learning: A first step

towards building a Darwin Machine”, Higuchi– Biological organism => DNA

• GATACAAAGATACACCAGATA– Reconfigurable Hardware => Configuration bitstream

• 000100111011011011011010101

Evolvable Hardware

GATACA

GenotypePhenotype

Page 14: 1 - CPRE 583 (Reconfigurable Computing): Evolvable Hardware Iowa State University (Ames) CPRE 583 Reconfigurable Computing Lecture 24: Fri 11/18/2011 (Evolvable

14 - CPRE 583 (Reconfigurable Computing): Evolvable Hardware Iowa State University (Ames)

• One of the first papers to compare reconfigurable HW with biological organisms (1993) – “Evolvable Hardware with Genetic Learning: A first step

towards building a Darwin Machine”, Higuchi– Biological organism => DNA

• GATACAAAGATACACCAGATA– Reconfigurable Hardware => Configuration bitstream

• 000100111011011011011010101

Evolvable Hardware

GATACA

GATAGA

GenotypePhenotype

Page 15: 1 - CPRE 583 (Reconfigurable Computing): Evolvable Hardware Iowa State University (Ames) CPRE 583 Reconfigurable Computing Lecture 24: Fri 11/18/2011 (Evolvable

15 - CPRE 583 (Reconfigurable Computing): Evolvable Hardware Iowa State University (Ames)

• One of the first papers to compare reconfigurable HW with biological organisms (1993) – “Evolvable Hardware with Genetic Learning: A first step

towards building a Darwin Machine”, Higuchi– Biological organism => DNA

• GATACAAAGATACACCAGATA– Reconfigurable Hardware => Configuration bitstream

• 000100111011011011011010101

Evolvable Hardware

GATACA

GATAGA

GenotypePhenotype

Page 16: 1 - CPRE 583 (Reconfigurable Computing): Evolvable Hardware Iowa State University (Ames) CPRE 583 Reconfigurable Computing Lecture 24: Fri 11/18/2011 (Evolvable

16 - CPRE 583 (Reconfigurable Computing): Evolvable Hardware Iowa State University (Ames)

• One of the first papers to compare reconfigurable HW with biological organisms (1993) – “Evolvable Hardware with Genetic Learning: A first step

towards building a Darwin Machine”, Higuchi– Biological organism => DNA

• GATACAAAGATACACCAGATA– Reconfigurable Hardware => Configuration bitstream

• 000100111011011011011010101

Evolvable Hardware

0001 1100

GenotypePhenotype

Page 17: 1 - CPRE 583 (Reconfigurable Computing): Evolvable Hardware Iowa State University (Ames) CPRE 583 Reconfigurable Computing Lecture 24: Fri 11/18/2011 (Evolvable

17 - CPRE 583 (Reconfigurable Computing): Evolvable Hardware Iowa State University (Ames)

• One of the first papers to compare reconfigurable HW with biological organisms (1993) – “Evolvable Hardware with Genetic Learning: A first step

towards building a Darwin Machine”, Higuchi– Biological organism => DNA

• GATACAAAGATACACCAGATA– Reconfigurable Hardware => Configuration bitstream

• 000100111011011011011010101

Evolvable Hardware

0001 1100

0001 0000

GenotypePhenotype

Page 18: 1 - CPRE 583 (Reconfigurable Computing): Evolvable Hardware Iowa State University (Ames) CPRE 583 Reconfigurable Computing Lecture 24: Fri 11/18/2011 (Evolvable

18 - CPRE 583 (Reconfigurable Computing): Evolvable Hardware Iowa State University (Ames)

• One of the first papers to compare reconfigurable HW with biological organisms (1993) – “Evolvable Hardware with Genetic Learning: A first step

towards building a Darwin Machine”, Higuchi– Biological organism => DNA

• GATACAAAGATACACCAGATA– Reconfigurable Hardware => Configuration bitstream

• 000100111011011011011010101

Evolvable Hardware

0001 1100

0001 0000

DFF

DFF

GenotypePhenotype

Page 19: 1 - CPRE 583 (Reconfigurable Computing): Evolvable Hardware Iowa State University (Ames) CPRE 583 Reconfigurable Computing Lecture 24: Fri 11/18/2011 (Evolvable

19 - CPRE 583 (Reconfigurable Computing): Evolvable Hardware Iowa State University (Ames)

• Phylogeny Ontogeny Epigenesis (POE) – Phylogeny: Evolution through recombination and mutations

• Biological reproduction : Genetic Algorithms– Ontogeny: Self replication

• Multicellular organism's cell division : Cellular Automata– Epigenesis: adaptation trigger by external environment

• Immune system development : Artificial Neural Networks

Classifying Adaption/Evolution

Page 20: 1 - CPRE 583 (Reconfigurable Computing): Evolvable Hardware Iowa State University (Ames) CPRE 583 Reconfigurable Computing Lecture 24: Fri 11/18/2011 (Evolvable

20 - CPRE 583 (Reconfigurable Computing): Evolvable Hardware Iowa State University (Ames)

• Phylogeny Ontogeny Epigenesis (POE) – Phylogeny: Evolution through recombination and mutations

• Biological reproduction : Genetic Algorithms– Ontogeny: Self replication

• Multicellular organism's cell division : Cellular Automata– Epigenesis: adaptation trigger by external environment

• Immune system development : Artificial Neural Networks

Classifying Adaption/Evolution

Ontogeny

Epigenesis

Phylogeny

Page 21: 1 - CPRE 583 (Reconfigurable Computing): Evolvable Hardware Iowa State University (Ames) CPRE 583 Reconfigurable Computing Lecture 24: Fri 11/18/2011 (Evolvable

21 - CPRE 583 (Reconfigurable Computing): Evolvable Hardware Iowa State University (Ames)

• 30/40 year old concept. But applying to reconfigurable hardware is newish (1990’s)

• Evolutionary Algorithms (EAs)– Genetic Algorithms– Genetic Programming– Evolution Strategies– Evolutionary programming

Artificial Evolution

Page 22: 1 - CPRE 583 (Reconfigurable Computing): Evolvable Hardware Iowa State University (Ames) CPRE 583 Reconfigurable Computing Lecture 24: Fri 11/18/2011 (Evolvable

22 - CPRE 583 (Reconfigurable Computing): Evolvable Hardware Iowa State University (Ames)

• 30/40 year old concept. But applying to reconfigurable hardware is newish (1990’s)

• Evolutionary Algorithms (EAs)– Genetic Algorithms– Genetic Programming– Evolution Strategies– Evolutionary programming

Artificial Evolution

Page 23: 1 - CPRE 583 (Reconfigurable Computing): Evolvable Hardware Iowa State University (Ames) CPRE 583 Reconfigurable Computing Lecture 24: Fri 11/18/2011 (Evolvable

23 - CPRE 583 (Reconfigurable Computing): Evolvable Hardware Iowa State University (Ames)

• Genome: a finite string of symbols encoding an individual

• Phenotype: The decoding of the genome to realize the individual

• Constant Size population

• Generic steps– Initial population– Decode– Evaluate (must define a fitness function)– Selection– Mutation– Cross over

Genetic Algorithms

Page 24: 1 - CPRE 583 (Reconfigurable Computing): Evolvable Hardware Iowa State University (Ames) CPRE 583 Reconfigurable Computing Lecture 24: Fri 11/18/2011 (Evolvable

24 - CPRE 583 (Reconfigurable Computing): Evolvable Hardware Iowa State University (Ames)

Genetic AlgorithmsInitialize Population

0000 10001010 11111100 00001111 00000000 00001111 1111

Decode Evaluate

Selection

Mutation

Next Generation

CrossOver

Page 25: 1 - CPRE 583 (Reconfigurable Computing): Evolvable Hardware Iowa State University (Ames) CPRE 583 Reconfigurable Computing Lecture 24: Fri 11/18/2011 (Evolvable

25 - CPRE 583 (Reconfigurable Computing): Evolvable Hardware Iowa State University (Ames)

Genetic AlgorithmsInitialize Population

0000 10001010 11111100 00001111 00000000 00001111 1111

Decode Evaluate

1010 00111010 01001100 00001111 00000000 00001111 0100

Selection

Mutation

Next Generation

CrossOver

0000 = Black1111 = White

Left 4 bits: color

0000 = 01111 = 15

Right 4 bits: # sides

Page 26: 1 - CPRE 583 (Reconfigurable Computing): Evolvable Hardware Iowa State University (Ames) CPRE 583 Reconfigurable Computing Lecture 24: Fri 11/18/2011 (Evolvable

26 - CPRE 583 (Reconfigurable Computing): Evolvable Hardware Iowa State University (Ames)

Genetic AlgorithmsInitialize Population

0000 10001010 11111100 00001111 00000000 00001111 1111

Decode Evaluate

1010 00111010 01001100 00001111 00000000 00001111 0100

Selection

Mutation

Next Generation

CrossOver

(0110 1000)

0000 = Black1111 = White

Left 4 bits: color

0000 = 01111 = 15Right 4 bits: # sides

Page 27: 1 - CPRE 583 (Reconfigurable Computing): Evolvable Hardware Iowa State University (Ames) CPRE 583 Reconfigurable Computing Lecture 24: Fri 11/18/2011 (Evolvable

27 - CPRE 583 (Reconfigurable Computing): Evolvable Hardware Iowa State University (Ames)

Genetic AlgorithmsInitialize Population

0000 10001010 11111100 00001111 00000000 00001111 1111

Decode Evaluate

1010 00111010 01001100 00001111 00000000 00001111 0100

1010 0011 (.40)1010 0100 (.70)1100 0000 (.20)1111 0000 (.10)0000 0000 (.10)1111 0100 (.60) (0110 1000)

Selection

Mutation

Next Generation

CrossOver

Page 28: 1 - CPRE 583 (Reconfigurable Computing): Evolvable Hardware Iowa State University (Ames) CPRE 583 Reconfigurable Computing Lecture 24: Fri 11/18/2011 (Evolvable

28 - CPRE 583 (Reconfigurable Computing): Evolvable Hardware Iowa State University (Ames)

Genetic AlgorithmsInitialize Population

0000 10001010 11111100 00001111 00000000 00001111 1111

Decode Evaluate

1010 00111010 01001100 00001111 00000000 00001111 0100

1010 0011 (.40)1010 0100 (.70)1100 0000 (.20)1111 0000 (.10)0000 0000 (.10)1111 0100 (.60) (0110 1000)

Selection

1010 0011 (.40)1010 0100 (.70)1111 0100 (.60)

Mutation

Next Generation

CrossOver

Page 29: 1 - CPRE 583 (Reconfigurable Computing): Evolvable Hardware Iowa State University (Ames) CPRE 583 Reconfigurable Computing Lecture 24: Fri 11/18/2011 (Evolvable

29 - CPRE 583 (Reconfigurable Computing): Evolvable Hardware Iowa State University (Ames)

Genetic AlgorithmsInitialize Population

Decode Evaluate

1010 00111010 01001100 00001111 00000000 00001111 0100

1010 0011 (.40)1010 0100 (.70)1100 0000 (.20)1111 0000 (.10)0000 0000 (.10)1111 0100 (.60) (0110 1000)

Selection

1010 0011 (.40)1010 0100 (.70)1111 0100 (.60)

Mutation

1110 0011 1010 1100 1110 0100

1010 0111 0010 0110 1111 0100

Next Generation

CrossOver

0000 10001010 11111100 00001111 00000000 00001111 1111

Page 30: 1 - CPRE 583 (Reconfigurable Computing): Evolvable Hardware Iowa State University (Ames) CPRE 583 Reconfigurable Computing Lecture 24: Fri 11/18/2011 (Evolvable

30 - CPRE 583 (Reconfigurable Computing): Evolvable Hardware Iowa State University (Ames)

Genetic AlgorithmsInitialize Population

Decode Evaluate

1010 00111010 01001100 00001111 00000000 00001111 0100

1010 0011 (.40)1010 0100 (.70)1100 0000 (.20)1111 0000 (.10)0000 0000 (.10)1111 0100 (.60) (0110 1000)

Selection

1010 0011 (.40)1010 0100 (.70)1111 0100 (.60)

Mutation

1110 0011 1010 1100 1110 0100

1010 0111 0010 0110 1111 0100

1110 1100 1010 0011 1110 0100

1010 0110 0010 0111 1111 0100

Next Generation

CrossOver

0000 10001010 11111100 00001111 00000000 00001111 1111

Page 31: 1 - CPRE 583 (Reconfigurable Computing): Evolvable Hardware Iowa State University (Ames) CPRE 583 Reconfigurable Computing Lecture 24: Fri 11/18/2011 (Evolvable

31 - CPRE 583 (Reconfigurable Computing): Evolvable Hardware Iowa State University (Ames)

Genetic AlgorithmsInitialize Population

Decode Evaluate

1010 00111010 01001100 00001111 00000000 00001111 0100 (0110 1000)

Selection

1010 0011 (.40)1010 0100 (.70)1111 0100 (.60)

Mutation

1110 0011 1010 1100 1110 0100

1010 0111 0010 0110 1111 0100

1110 1100 1010 0011 1110 0100

1010 0110 0010 0111 1111 0100

Next Generation

CrossOver

1110 1100 1010 0011 1110 01001010 0110 0010 0111 1111 0100

1010 0011 (.40)1010 0100 (.70)1100 0000 (.20)1111 0000 (.10)0000 0000 (.10)1111 0100 (.60)

Page 32: 1 - CPRE 583 (Reconfigurable Computing): Evolvable Hardware Iowa State University (Ames) CPRE 583 Reconfigurable Computing Lecture 24: Fri 11/18/2011 (Evolvable

32 - CPRE 583 (Reconfigurable Computing): Evolvable Hardware Iowa State University (Ames)

Genetic AlgorithmsInitialize Population

Decode Evaluate

1110 11001010 00111110 01001010 01100010 01111111 0100

1010 0011 (.40)1010 0100 (.70)1100 0000 (.20)1111 0000 (.10)0000 0000 (.10)1111 0100 (.60) (0110 1000)

Selection

1010 0011 (.40)1010 0100 (.70)1111 0100 (.60)

Mutation

1110 0011 1010 1100 1110 0100

1010 0111 0010 0110 1111 0100

1110 1100 1010 0011 1110 0100

1010 0110 0010 0111 1111 0100

Next Generation

CrossOver

1110 1100 1010 0011 1110 01001010 0110 0010 0111 1111 0100

Page 33: 1 - CPRE 583 (Reconfigurable Computing): Evolvable Hardware Iowa State University (Ames) CPRE 583 Reconfigurable Computing Lecture 24: Fri 11/18/2011 (Evolvable

33 - CPRE 583 (Reconfigurable Computing): Evolvable Hardware Iowa State University (Ames)

Genetic AlgorithmsInitialize Population

Decode Evaluate

1110 11001010 00111110 01001010 01100010 01111111 0100 (0110 1000)

Selection

1010 0011 (.40)1010 0100 (.70)1111 0100 (.60)

Mutation

1110 0011 1010 1100 1110 0100

1010 0111 0010 0110 1111 0100

1110 1100 1010 0011 1110 0100

1010 0110 0010 0111 1111 0100

Next Generation

CrossOver

1110 1100 1010 0011 1110 01001010 0110 0010 0111 1111 0100

1110 1100 (.70) 1010 0011 (.40) 1110 0100 (.65) 1010 0110 (.85) 0010 0111(.80) 1111 0100 (.60)

Page 34: 1 - CPRE 583 (Reconfigurable Computing): Evolvable Hardware Iowa State University (Ames) CPRE 583 Reconfigurable Computing Lecture 24: Fri 11/18/2011 (Evolvable

34 - CPRE 583 (Reconfigurable Computing): Evolvable Hardware Iowa State University (Ames)

Genetic AlgorithmsInitialize Population

Decode Evaluate

1110 11001010 00111110 01001010 01100010 01111111 0100 (0110 1000)

Selection

1110 1100 (.70)1010 0110 (.85)0010 0111 (.80)

Mutation

1110 0011 1010 1100 1110 0100

1010 0111 0010 0110 1111 0100

1110 1100 1010 0011 1110 0100

1010 0110 0010 0111 1111 0100

Next Generation

CrossOver

1110 1100 1010 0011 1110 01001010 0110 0010 0111 1111 0100

1110 1100 (.70) 1010 0011 (.40) 1110 0100 (.65) 1010 0110 (.85) 0010 0111(.80) 1111 0100 (.60)

Page 35: 1 - CPRE 583 (Reconfigurable Computing): Evolvable Hardware Iowa State University (Ames) CPRE 583 Reconfigurable Computing Lecture 24: Fri 11/18/2011 (Evolvable

35 - CPRE 583 (Reconfigurable Computing): Evolvable Hardware Iowa State University (Ames)

Evolvable Hardware Platform

Page 36: 1 - CPRE 583 (Reconfigurable Computing): Evolvable Hardware Iowa State University (Ames) CPRE 583 Reconfigurable Computing Lecture 24: Fri 11/18/2011 (Evolvable

36 - CPRE 583 (Reconfigurable Computing): Evolvable Hardware Iowa State University (Ames)

• GA are a type of guided search

• Why use a guide search? Why not just do an exhaustive search?

Genetic Algorithms

Page 37: 1 - CPRE 583 (Reconfigurable Computing): Evolvable Hardware Iowa State University (Ames) CPRE 583 Reconfigurable Computing Lecture 24: Fri 11/18/2011 (Evolvable

37 - CPRE 583 (Reconfigurable Computing): Evolvable Hardware Iowa State University (Ames)

• GA are a type of guided search

• Why use a guide search? Why not just do an exhaustive search?

• Assume – 1 billion individuals can be evaluated a second– The genome of a individual is 32-bits in size– How long to do an exhaustive search?

Genetic Algorithms

Page 38: 1 - CPRE 583 (Reconfigurable Computing): Evolvable Hardware Iowa State University (Ames) CPRE 583 Reconfigurable Computing Lecture 24: Fri 11/18/2011 (Evolvable

38 - CPRE 583 (Reconfigurable Computing): Evolvable Hardware Iowa State University (Ames)

• GA are a type of guided search

• Why use a guide search? Why not just do an exhaustive search?

• Assume – 1 billion individuals can be evaluated a second– Now genome of a individual is a FPGA

• 1,000,000 bits in size– How long to do an exhaustive search?

Genetic Algorithms

Page 39: 1 - CPRE 583 (Reconfigurable Computing): Evolvable Hardware Iowa State University (Ames) CPRE 583 Reconfigurable Computing Lecture 24: Fri 11/18/2011 (Evolvable

39 - CPRE 583 (Reconfigurable Computing): Evolvable Hardware Iowa State University (Ames)

• Extrinsic Evolution (furthest from biology)– Evolution done in SW, then result realized in HW

• Intrinsic Evolution– HW is used to deploy individuals– Results are sent back to SW for fitness calculation

• Complete Evolution– Evolution is completely done on target HW device

• Open-ended Evolution (closest to biology)– Evaluation criteria changes dynamically

Evolvable Hardware Taxonomy

OntogenyEpigenesis

Phylogeny

Page 40: 1 - CPRE 583 (Reconfigurable Computing): Evolvable Hardware Iowa State University (Ames) CPRE 583 Reconfigurable Computing Lecture 24: Fri 11/18/2011 (Evolvable

40 - CPRE 583 (Reconfigurable Computing): Evolvable Hardware Iowa State University (Ames)

Evolvable Hardware Applications• Prosthetic Hand controller chip

– Kajitani “An Evolvable Hardware Chip for Prostatic Hand Controller”, 1999

Page 41: 1 - CPRE 583 (Reconfigurable Computing): Evolvable Hardware Iowa State University (Ames) CPRE 583 Reconfigurable Computing Lecture 24: Fri 11/18/2011 (Evolvable

41 - CPRE 583 (Reconfigurable Computing): Evolvable Hardware Iowa State University (Ames)

Evolvable Hardware Applications• Tone Discrimination and Frequency generation

– Adrian Thompson “Silicon Evolution”, 1996

Xilinx XC6200

Page 42: 1 - CPRE 583 (Reconfigurable Computing): Evolvable Hardware Iowa State University (Ames) CPRE 583 Reconfigurable Computing Lecture 24: Fri 11/18/2011 (Evolvable

42 - CPRE 583 (Reconfigurable Computing): Evolvable Hardware Iowa State University (Ames)

Evolvable Hardware Applications• Tone Discrimination and Frequency generation

Node Functions Node Genotype

Page 43: 1 - CPRE 583 (Reconfigurable Computing): Evolvable Hardware Iowa State University (Ames) CPRE 583 Reconfigurable Computing Lecture 24: Fri 11/18/2011 (Evolvable

43 - CPRE 583 (Reconfigurable Computing): Evolvable Hardware Iowa State University (Ames)

Evolvable Hardware Applications• Tone Discrimination and Frequency generation

Evolved 4KHz oscillator

Page 44: 1 - CPRE 583 (Reconfigurable Computing): Evolvable Hardware Iowa State University (Ames) CPRE 583 Reconfigurable Computing Lecture 24: Fri 11/18/2011 (Evolvable

44 - CPRE 583 (Reconfigurable Computing): Evolvable Hardware Iowa State University (Ames)

Benefits of Evolvable Hardware?

Page 45: 1 - CPRE 583 (Reconfigurable Computing): Evolvable Hardware Iowa State University (Ames) CPRE 583 Reconfigurable Computing Lecture 24: Fri 11/18/2011 (Evolvable

45 - CPRE 583 (Reconfigurable Computing): Evolvable Hardware Iowa State University (Ames)

Evolvable Hardware Issues?

Page 46: 1 - CPRE 583 (Reconfigurable Computing): Evolvable Hardware Iowa State University (Ames) CPRE 583 Reconfigurable Computing Lecture 24: Fri 11/18/2011 (Evolvable

46 - CPRE 583 (Reconfigurable Computing): Evolvable Hardware Iowa State University (Ames)

Evolvable Hardware Issues?

Page 47: 1 - CPRE 583 (Reconfigurable Computing): Evolvable Hardware Iowa State University (Ames) CPRE 583 Reconfigurable Computing Lecture 24: Fri 11/18/2011 (Evolvable

47 - CPRE 583 (Reconfigurable Computing): Evolvable Hardware Iowa State University (Ames)

Evolvable Hardware Platforms• Commercial Platforms

– Xilinx XC6200• Completely multiplex base, thus could program

random bitstreams dynamically without damaging chip

– Xilinx Virtex FPGA• Custom Platforms

– POEtic cell– Evolvable LSI chip (Higuchi)

Page 48: 1 - CPRE 583 (Reconfigurable Computing): Evolvable Hardware Iowa State University (Ames) CPRE 583 Reconfigurable Computing Lecture 24: Fri 11/18/2011 (Evolvable

48 - CPRE 583 (Reconfigurable Computing): Evolvable Hardware Iowa State University (Ames)

Next Lecture

• Exam 2 Overview

Page 49: 1 - CPRE 583 (Reconfigurable Computing): Evolvable Hardware Iowa State University (Ames) CPRE 583 Reconfigurable Computing Lecture 24: Fri 11/18/2011 (Evolvable

49 - CPRE 583 (Reconfigurable Computing): Evolvable Hardware Iowa State University (Ames)

Notes• Notes


Recommended