Zika Virus - Cell-stem -Cell

7/25/2019 Zika Virus - Cell-stem -Cell

1/12

Brief Report

Zika Virus Infects Human Cortical Neural Progenitorsand Attenuates Their Growth

Graphical Abstract

Highlights

d Zika virus (ZIKV) infects human embryonic cortical neural

progenitor cells (hNPCs)

d ZIKV-infected hNPCs produce infectious ZIKV particles

d ZIKV infection leads to increased cell death of hNPCs

d ZIKV infection dysregulates cell cycle and transcription in

hNPCs

Authors

Hengli Tang, Christy Hammack,

Sarah C. Ogden, ..., Peng Jin,

Hongjun Song, Guo-li Ming

Correspondence

[email protected](H.T.),

[email protected](H.S.),

[email protected](G.-l.M.)

In BriefThe suspected link between ZIKV

infection and microcephaly is an urgent

global health concern. Tang et al. report

that ZIKV virus directly infects human

cortical neural progenitor cells with high

efficiency, resulting in stunted growth of

this cell population and transcriptional

dysregulation.

Accession Numbers

GSE78711

Tang et al., 2016, Cell Stem Cell 18, 14June 2, 2016 2016 Elsevier Inc.

http://dx.doi.org/10.1016/j.stem.2016.02.016
mailto:[email protected]:[email protected]:[email protected]://dx.doi.org/10.1016/j.stem.2016.02.016http://dx.doi.org/10.1016/j.stem.2016.02.016mailto:[email protected]:[email protected]:[email protected]


2/12

Cell Stem Cell

Brief Report

Zika Virus Infects Human Cortical NeuralProgenitors and Attenuates Their Growth

Hengli Tang,1,11,*Christy Hammack,1,11 Sarah C. Ogden,1,11 Zhexing Wen,2,3,11 Xuyu Qian,2,4,11 Yujing Li,9 Bing Yao,9

Jaehoon Shin,2,5 Feiran Zhang,9 Emily M. Lee,1 Kimberly M. Christian,2,3 Ruth A. Didier,10 Peng Jin,9

Hongjun Song,2,3,5,6,7,*and Guo-li Ming2,3,5,6,7,8,*1Department of Biological Science, Florida State University, Tallahassee, FL 32306, USA2Institute for Cell Engineering3Department of Neurology4Biomedical Engineering Graduate Program5Cellular and Molecular Medicine Graduate Program6Solomon Snyder Department of Neuroscience7Kavli Neuroscience Discovery Institute8Department of Psychiatry and Behavioral Sciences

Johns Hopkins University School of Medicine, Baltimore, MD 21025, USA9Department of Human Genetics, Emory University School of Medicine, Atlanta, GA 30322, USA10College of Medicine, Florida State University, Tallahassee, FL 32306, USA11

Co-first author*Correspondence: [email protected](H.T.),[email protected](H.S.), [email protected](G.-l.M.)


SUMMARY

The suspected link between infection by Zika virus

(ZIKV), a re-emerging flavivirus, and microcephaly

is an urgent global health concern. The direct target

cells of ZIKV in the developing human fetus are not

clear. Here we show that a strain of the ZIKV,

MR766, serially passaged in monkey and mosquito

cells efficiently infects human neural progenitor cells(hNPCs) derived from induced pluripotent stem cells.

Infected hNPCs further release infectious ZIKV parti-

cles. Importantly, ZIKV infection increases cell death

and dysregulates cell-cycle progression, resulting in

attenuated hNPC growth. Global gene expression

analysis of infected hNPCs reveals transcriptional

dysregulation, notably of cell-cycle-related path-

ways. Our results identify hNPCs as a direct ZIKV

target. In addition, we establish a tractable experi-

mental model system to investigate the impact and

mechanism of ZIKV on human brain development

and provide a platform to screen therapeutic com-

pounds.

Zika virus (ZIKV), a mosquito-borne flavivirus, is now reported to

be circulating in 26 countries and territories in Latin America and

the Caribbean (Petersen et al., 2016). While infected individuals

can often be asymptomatic or have only mild symptoms, of

mounting concern are reports linking ZIKV infection to fetal

and newborn microcephaly and serious neurological complica-

tions, such as Guillain-Barresyndrome (Petersen et al., 2016).

The World Health Organization declared a Public Health Emer-

gency of International Concern on February 1 of 2016 (Heymann

et al., 2016). ZIKV infects human skin cells, consistent with its

major transmission route (Hamel et al., 2015). ZIKV was detected

in the amniotic fluid of two pregnant women whose fetuses had

been diagnosed with microcephaly (Calvetet al., 2016), suggest-

ing that ZIKV can cross the placental barrier. ZIKV was also

found in microcephalic fetal brain tissue (Mlakar et al., 2016).

Because so little is known about direct cell targets and mecha-

nisms of ZIKV, and because access to fetal human brain tissue

is limited, there is an urgent need to develop a new strategy to

determine whether there is a causal relationship between ZIKV

infection and microcephaly. Here we used human induced

pluripotent stem cells (hiPSCs) as an in vitro model to investigate

whether ZIKV directly infects human neural cells and the nature

of its impact.

We obtained a ZIKV stock from the infected rhesus Macaca

cell line LLC-MK2. We passaged the virus in the mosquito C6/

C36 cell line and titered collected ZIKV on Vero cells, an inter-

feron-deficient monkey cell line commonly used to titer viruses.

Sequences of multiple RT-PCR fragments generated from

this stock (Figure S1A) matched the sequence of MR766, the

original ZIKV strain that likely passed from an infected rhesus

monkey to mosquitos (Dick et al., 1952). We first tested several

human cell lines and found varying levels of susceptibility to

ZIKV infection (Table S1). Notably, the human embryonic kidneycell line HEK293T showed low permissiveness for ZIKV infection

(Figure S1C).

To identify direct target cells of ZIKV in the human neural line-

age, we used a highly efficient protocol to differentiate hiPSCs

into forebrain-specific human neural progenitor cells (hNPCs),

which can be further differentiated into cortical neurons (Wen

et al., 2014). The titer of ZIKV in the infected humans is currently

unknown. We performed infections at a low multiplicity of infec-

tion (MOI < 0.1) and the medium containing virus inoculum was

removed after a 2 hr incubation period. Infection rates were

then quantified 56 hr later with RT-PCR using MR766-specific

primers (Figure S1A) and with immunocytochemistry using an

anti-ZIKV envelope antibody (Figures 1A and 1B). The hNPCs

Cell Stem Cell 18, 14, June 2, 2016 2016 Elsevier Inc. 1

Please cite this article in press as: Tang et al., Zika Virus Infects Human Cortical Neural Progenitors and Attenuates Their Growth, Cell Stem Cell (2016),

http://-/?-http://-/?-mailto:[email protected]:[email protected]:[email protected]://dx.doi.org/10.1016/j.stem.2016.02.016http://-/?-http://-/?-http://-/?-http://-/?-http://-/?-http://-/?-http://-/?-http://-/?-http://dx.doi.org/10.1016/j.stem.2016.02.016mailto:[email protected]:[email protected]:[email protected]://-/?-http://-/?-


3/12

were readily infected by ZIKV in vitro, with the infection

spreading to 65%90% of the cells within 3 days of inoculation

(Figures 1A and 1C). Quantitative analysis showed similar results

for hNPCs derived from hiPSC lines of two different subjects

(Figure 1C). As a control, we also exposed human embryonic

stem cells (hESCs), hiPSCs, and immature cortical neurons toZIKV under the same conditions. hESCs and hiPSCs could

also be infected by ZIKV, but the infection was limited to a few

cells at the colony edge with reduced expression of the pluripo-

tent marker NANOG (Figures 1C andS1D;Table S1). Immature

neurons differentiated from hNPCs also exhibited lower levels

of infection under our conditions (Figures 1B and 1C). Together,

these results establish that hNPCs, a constitutive population of

the developing embryonic brain, are a direct cell target of ZIKV.

ZIKV envelope immunostaining exhibited the characteristic

intracellular virus factory pattern of flaviviruses (Romero-

Brey and Bartenschlager, 2014)(Figure 1A). We therefore tested

infectivity using supernatant from infected hNPCs and observed

robust infection of Vero cells (Figure 1D), indicating that produc-

tive infection of hNPCs leads to efficient secretion of infectious

ZIKV particles.

We next determined the potential impact of ZIKV infection on

hNPCs. We found a 29.9% 6.6% reduction in the total number

of viable cells 6672 hr after ZIKV infection, as compared to the

mock infection (n = 3). Interestingly, ZIKV infection led to signif-icantly higher caspase-3 activation in hNPCs 3 days after infec-

tion, as compared to the mock infection, suggesting increased

cell death (Figures 2A and 2B). Furthermore, analysis of DNA

content by flow cytometry suggested cell-cycle perturbation of

infected hNPCs (Figures 2C andS2A). Therefore, ZIKV infection

of hNPCs leads to attenuated growth of this cell population that

is due, at least partly, to both increased cell death and cell-cycle

dysregulation.

To investigate the impact of ZIKV infection on hNPCs at the

molecular level, we employed global transcriptome analyses

(RNA-seq). Our genome-wide analyses identified a large number

of differentially expressed genes upon viral infection (Figure S2B

and Table S2). Gene Ontology analyses revealed a particular

A BZIKVEDAPI

+ZIKV

Mock

+ZIKV

Mock

ZIKVEDAPI

C D

hNPC neuron

Vero

ZIKVEDAPI

hESC hiPSC hNPC

C line

hNPC

D line

Neuron

Day 1

Neuron

Day 9

0

20

40

60

80

100

Infectionrate(%)

* *

5 5 5 566

*

Figure 1. ZIKV Infects hiPSC-Derived Neural Progenitor Cells with High Efficiency

(A and B) Sample confocal images of forebrain-specific hNPCs (A) and immature neurons (B) 56 hr after infection withZIKV supernatant,immunostained for ZIKVenvelop protein (ZIKVE; green) and DAPI (gray). Cells were differentiated from the C1-2 hiPSC line. Scale bars, 20mm.

(C) Quantification of infection efficiency for different cell types, including hESCs, hiPSCs, hNPCS derived from two different hiPSCs, and immature neurons 1 or

9 days after differentiation from hNPCs. Both hESCs and hiPSCs were analyzed 72 hr after infection, whereas all other cells were analyzed 56 hr after infection.

Numbers associated with bar graphs indicate numbers of independent experiments. Values represent mean SD (*p < 0.01; Students t test).

(D)Production of infectious ZIKVparticlesby infected hNPCs. Supernatant fromhNPC cultures72 hr after ZIKVinfection wascollected and added to Verocellsfor

2 hr. The Vero cells were further cultured for 48 hr. Shown are sample images of ZIKVE immunostaining (green) and DAPI (gray). Scale bars, 20 mm.

See alsoFigure S1andTable S1.

2 Cell Stem Cell 18, 14, June 2, 2016 2016 Elsevier Inc.


http://-/?-http://-/?-http://-/?-http://-/?-http://-/?-http://-/?-http://-/?-http://-/?-http://-/?-http://-/?-http://-/?-http://-/?-http://-/?-http://-/?-


4/12

enrichment of downregulated genes in cell-cycle-related path-

ways (Figure 2D), which is consistent with our flow cytometry

findings (Figure 2C). Upregulated genes were primarily enriched

in transcription, protein transport, and catabolic processes

(Figure 2E). Consistent with increased caspase-3 activation

observed by immunocytochemistry (Figures 2A and 2B), RNA-

seq analysis revealed upregulation of genes, including cas-

pase-3, involved in the regulation of the apoptotic pathway(Figure 2E). These global transcriptome datasets not only sup-

port ourcell biology findings butalso provide a valuable resource

for the field.

It is not known whether specific strains of ZIKV circulating in

geographically diverse parts of the world differ in their ability to

impact neural development, and the stain we used had been

discovered prior to the current reports of a potential epidemio-

logic link between ZIKV and microcephaly. Nevertheless, our re-

sults clearly demonstrate that ZIKV can directly infect hNPCs

in vitro with high efficiency and that infection of hNPCs leads

to attenuated population growth through virally induced

caspase-3-mediated apoptosis and cell-cycle dysregulation.

Infected hNPCs also release infectious viral particles, which pre-

sents a significant clinical challenge for developing effective

therapeutics to arrest or block the impact of infection. Future

studies using the hiPSC/hNPC model can determine whether

various ZIKV strains impact hNPCs differently and, conversely,

whether a single ZIKV strain differentially affects hNPCs from

hiPSCs of various human populations.

Flaviviruses tend to have broad cellular tropisms and multiple

factors contribute to pathogenic outcomes, including specificcellular response and tissue accessibility. Dengue virus infects

cells of several lineages and hematopoietic cells play an essen-

tial role in the associated pathogenesis (Pham et al., 2012). West

Nile virus infects epithelial cells of multiple tissues and can be

neuroinvasive (Suthar et al., 2013). We note that ZIKV also infects

other human cell types, including skin cells and fibroblasts

(Hamel et al., 2015), and it remains unknown how ZIKV may

gain access to the fetal brain (Mlakar et al., 2016). The capacity

of ZIKV to infect hNPCs and attenuate their growth underscores

the urgent need for more research into the role of these cells in

putative ZIKV-related neuropathology. The finding that ZIKV

also infects immature neurons raises critical questions about

pathological effects on neurons and other neural cell types in

+ ZIKV Mock0

5

10

15

20

Cas3+c

ells(%)

A CZIKVECas3DAPI

+ZIK

V

Mock

Mock

Infected

Mixture

0

2000

4000

0

500

1000

0

300

600

25000 50000 75000 100000

25000 50000 75000 100000

25000 50000 75000 100000

D ECell cycle

Cell cycle phase

M phase

Nuclear division

Mitosis

M phase of mitotic cell cycle

Cell cycle process

Organelle fission

DNA metabolic process

Mitotic cell cycle

Transcription

Regulation of transcription

Protein localization

Protein transport

Establishment of protein localization

Intracellular transport

Regulation of transcription, DNA-dependent

Modification-dependent macromolecule catabolic process

Modification-dependent protein catabolic process

Regulation of cell death

0 10 20 300 10 20 30

-log10 Pvalue

B 2N 4N

*

-log10 Pvalue

Figure 2. ZIKV-Infected hNPCs Exhibit Increased Cell Death and Dysregulated Cell-Cycle Progression and Gene Expression

(A and B) Increased cell death of ZIKV-infected hNPCs. Shown in (A) are sample images of immunostaining of hNPCs for ZIKVE (green) and cleaved-caspase-3

(Cas3; red) and DAPI (gray) 72 hr after ZIKV infection. Scale bars, 20 mm. Shown in (B) is the quantification. Values represent mean SEM (n = 6; *p < 0.01;

Students t test).

(C) Cell-cycle perturbation of hNPCs infected by ZIKV. Shown are sample flow cytometry analyses of distributions of hNPCs (from the C1-2 line) at different

phases of the cell cycle 72 hr after ZIKV or mock infection. For the mixture sample, mock and infected hNPCs were mixed at a ratio of 1:1 following propidiumiodide staining of each sample.

(D and E) RNA-seq analysis of hNPCs (C1-2 line) 56 hr after ZIKV or mock infection. Genes with significant differences in expression between infected and

uninfected hNPCs were subjected to GO analyses. The top 10 most significant terms are shown for downregulated (D) and upregulated (E) genes, respectively.

The log10 p values are indicated by bar plots. An additional term of regulation of programmed cell death is also shown for upregulated genes (E).

See alsoFigure S2andTable S2.

Cell Stem Cell 18, 14, June 2, 2016 2016 Elsevier Inc. 3


http://-/?-http://-/?-http://-/?-http://-/?-


5/12

the brain, as well as potential long-term consequences. Intrigu-

ingly, an early animal study showed ZIKV infection of neurons

and astrocytes in mice and observed enlarged astrocytes (Bell

et al., 1971). Our study also raises the question of whether

ZIKV infects neuralstem cells in adult humans(Bond et al., 2015).In summary, our results fill a major gap in our knowledgeabout

ZIKV biology and serve as an entry point to establish a mecha-

nistic link between ZIKV and microcephaly. Our study also pro-

vides a tractable experimental system for modeling the impact

of ZIKV on neural development and for investigating underlying

cellular and molecular mechanisms. Of equal importance, our

hNPC model and robust cellular phenotype comprise a readily

scalable platform for high-throughput screens to prevent ZIKV

infection of hNPCs and to ameliorate its pathological effects dur-

ing neural development.

ACCESSION NUMBERS

The accession number for RNA-seq data reported in this paper is GEO:GSE78711.

SUPPLEMENTAL INFORMATION

Supplemental Information for this article includes two figures, two tables, and

Supplemental Experimental Procedures and can be found with this article on-

line at http://dx.doi.org/10.1016/j.stem.2016.02.016.

AUTHOR CONTRIBUTIONS

H.T., H.S., and G.-l.M. conceived of the research, designed the study, and

wrote the manuscript. C.H., S.C.O., Z.W., and X.Q. performed experiments,

analyzed data, and contributed equally to this study. Y.L., B.Y., J.S., F.Z.,

and P.J.performed RNA-seq analysis, and E.M.L.,K.M.C.,and R.A.D. contrib-

uted to additional data collection. All authors commented on the manuscript.

ACKNOWLEDGMENTS

We thank Yichen Cheng, Taylor Lee, and Jianshe Lang of the Tang laboratory,

Lihong Liu and Yuan Cai of the Ming and Song laboratories, Luoxiu Huang of

the Jin laboratory for technical assistance, Zhiheng Xu and additional labora-

tory members for suggestions, and Timothy Megraw for assistance with

confocal imaging. H.T. thanks the College of Arts and Sciences and the

Department of Biological Science at Florida State University for seed funding.

This work was partially supported by NIH (AI119530/AI111250 to H.T.,

NS047344 to H.S., NS048271/NS095348 to G-l.M., and NS051630/

NS079625/MH102690 to P.J.), MSCRF (toH.S.), and start-up funding (to H.S.).

Received: February 24, 2016

Revised: February 28, 2016

Accepted: February 29, 2016

Published: March 4, 2016

REFERENCES

Bell, T.M., Field, E.J., and Narang, H.K. (1971). Zika virus infection of the cen-

tral nervous system of mice. Arch. Gesamte Virusforsch. 35, 183193.

Bond, A.M., Ming, G.L., and Song, H. (2015). Adult mammalian neural stem

cells and neurogenesis: Five decades later. Cell Stem Cell 17, 385395.

Calvet, G., Aguiar, R.S., Melo, A.S., Sampaio, S.A., de Filippis, I., Fabri, A.,

Araujo, E.S., de Sequeira, P.C., de Mendonca, M.C., de Oliveira, L., et al.

(2016). Detection and sequencing of Zika virus from amniotic fluid of fetuses

with microcephaly in Brazil: a case study. Lancet Infect. Dis. S1473-3099(16)

00095-5.http://dx.doi.org/10.1016/S1473-3099(16)00095-5.

Dick, G.W., Kitchen, S.F.,and Haddow, A.J.(1952). Zika virus. I. Isolations and

serological specificity. Trans. R. Soc. Trop. Med. Hyg. 46, 509520.

Hamel, R.,Dejarnac, O., Wichit, S.,Ekchariyawat, P., Neyret,A., Luplertlop, N.,

Perera-Lecoin, M., Surasombatpattana, P., Talignani, L., Thomas, F., et al.(2015). Biology of Zika virus infection in human skin cells. J. Virol. 89, 8880

8896.

Heymann, D.L., Hodgson, A., Sall, A.A., Freedman, D.O., Staples, J.E.,

Althabe, F., Baruah, K., Mahmud, G., Kandun, N., Vasconcelos, P.F., et al.

(2016). Zika virus and microcephaly: why is this situation a PHEIC? Lancet

387, 719721.

Mlakar, J., Korva, M., Tul, N., Popovic, M., Poljsak-Prijatelj, M., Mraz, J.,

Kolenc, M., Resman Rus, K., Vesnaver Vipotnik, T., Fabjan Vodusek, V.,

et al. (2016). Zika virus associated with microcephaly. N. Engl. J. Med.

http://dx.doi.org/10.1056/NEJMoa1600651.

Petersen, E., Wilson, M.E., Touch, S., McCloskey, B., Mwaba, P., Bates, M.,

Dar, O., Mattes, F., Kidd, M., Ippolito, G., et al. (2016). Rapid spread of Zika

virus in the Americas - Implications for public health preparedness for

mass gatherings at the 2016 Brazil Olympic Games. Int. J. Infect. Dis. 44,

1115.Pham, A.M., Langlois, R.A., and TenOever, B.R. (2012). Replication in cells of

hematopoietic origin is necessary for Dengue virus dissemination. PLoS

Pathog.8, e1002465.

Romero-Brey, I., and Bartenschlager, R. (2014). Membranous replication fac-

tories induced by plus-strand RNA viruses. Viruses6, 28262857.

Suthar, M.S., Diamond, M.S., and Gale, M., Jr. (2013). WestNile virus infection

and immunity. Nat. Rev. Microbiol.11, 115128.

Wen, Z., Nguyen, H.N., Guo, Z., Lalli, M.A., Wang, X., Su, Y., Kim, N.S., Yoon,

K.J., Shin, J., Zhang, C., et al. (2014). Synaptic dysregulation in a human iPS

cell model of mental disorders. Nature 515, 414418.

4 Cell Stem Cell 18, 14, June 2, 2016 2016 Elsevier Inc.


http://dx.doi.org/10.1016/j.stem.2016.02.016http://refhub.elsevier.com/S1934-5909(16)00106-5/sref1http://refhub.elsevier.com/S1934-5909(16)00106-5/sref1http://refhub.elsevier.com/S1934-5909(16)00106-5/sref1http://refhub.elsevier.com/S1934-5909(16)00106-5/sref1http://refhub.elsevier.com/S1934-5909(16)00106-5/sref2http://refhub.elsevier.com/S1934-5909(16)00106-5/sref2http://refhub.elsevier.com/S1934-5909(16)00106-5/sref2http://refhub.elsevier.com/S1934-5909(16)00106-5/sref2http://dx.doi.org/10.1016/S1473-3099(16)00095-5http://refhub.elsevier.com/S1934-5909(16)00106-5/sref4http://refhub.elsevier.com/S1934-5909(16)00106-5/sref4http://refhub.elsevier.com/S1934-5909(16)00106-5/sref4http://refhub.elsevier.com/S1934-5909(16)00106-5/sref4http://refhub.elsevier.com/S1934-5909(16)00106-5/sref5http://refhub.elsevier.com/S1934-5909(16)00106-5/sref5http://refhub.elsevier.com/S1934-5909(16)00106-5/sref5http://refhub.elsevier.com/S1934-5909(16)00106-5/sref5http://refhub.elsevier.com/S1934-5909(16)00106-5/sref5http://refhub.elsevier.com/S1934-5909(16)00106-5/sref5http://refhub.elsevier.com/S1934-5909(16)00106-5/sref6http://refhub.elsevier.com/S1934-5909(16)00106-5/sref6http://refhub.elsevier.com/S1934-5909(16)00106-5/sref6http://refhub.elsevier.com/S1934-5909(16)00106-5/sref6http://refhub.elsevier.com/S1934-5909(16)00106-5/sref6http://dx.doi.org/10.1056/NEJMoa1600651http://refhub.elsevier.com/S1934-5909(16)00106-5/sref8http://refhub.elsevier.com/S1934-5909(16)00106-5/sref8http://refhub.elsevier.com/S1934-5909(16)00106-5/sref8http://refhub.elsevier.com/S1934-5909(16)00106-5/sref8http://refhub.elsevier.com/S1934-5909(16)00106-5/sref8http://refhub.elsevier.com/S1934-5909(16)00106-5/sref8http://refhub.elsevier.com/S1934-5909(16)00106-5/sref8http://refhub.elsevier.com/S1934-5909(16)00106-5/sref9http://refhub.elsevier.com/S1934-5909(16)00106-5/sref9http://refhub.elsevier.com/S1934-5909(16)00106-5/sref9http://refhub.elsevier.com/S1934-5909(16)00106-5/sref9http://refhub.elsevier.com/S1934-5909(16)00106-5/sref9http://refhub.elsevier.com/S1934-5909(16)00106-5/sref10http://refhub.elsevier.com/S1934-5909(16)00106-5/sref10http://refhub.elsevier.com/S1934-5909(16)00106-5/sref10http://refhub.elsevier.com/S1934-5909(16)00106-5/sref10http://refhub.elsevier.com/S1934-5909(16)00106-5/sref11http://refhub.elsevier.com/S1934-5909(16)00106-5/sref11http://refhub.elsevier.com/S1934-5909(16)00106-5/sref11http://refhub.elsevier.com/S1934-5909(16)00106-5/sref11http://refhub.elsevier.com/S1934-5909(16)00106-5/sref12http://refhub.elsevier.com/S1934-5909(16)00106-5/sref12http://refhub.elsevier.com/S1934-5909(16)00106-5/sref12http://refhub.elsevier.com/S1934-5909(16)00106-5/sref12http://refhub.elsevier.com/S1934-5909(16)00106-5/sref12http://refhub.elsevier.com/S1934-5909(16)00106-5/sref12http://refhub.elsevier.com/S1934-5909(16)00106-5/sref12http://refhub.elsevier.com/S1934-5909(16)00106-5/sref12http://refhub.elsevier.com/S1934-5909(16)00106-5/sref12http://refhub.elsevier.com/S1934-5909(16)00106-5/sref11http://refhub.elsevier.com/S1934-5909(16)00106-5/sref11http://refhub.elsevier.com/S1934-5909(16)00106-5/sref10http://refhub.elsevier.com/S1934-5909(16)00106-5/sref10http://refhub.elsevier.com/S1934-5909(16)00106-5/sref9http://refhub.elsevier.com/S1934-5909(16)00106-5/sref9http://refhub.elsevier.com/S1934-5909(16)00106-5/sref9http://refhub.elsevier.com/S1934-5909(16)00106-5/sref8http://refhub.elsevier.com/S1934-5909(16)00106-5/sref8http://refhub.elsevier.com/S1934-5909(16)00106-5/sref8http://refhub.elsevier.com/S1934-5909(16)00106-5/sref8http://refhub.elsevier.com/S1934-5909(16)00106-5/sref8http://dx.doi.org/10.1056/NEJMoa1600651http://refhub.elsevier.com/S1934-5909(16)00106-5/sref6http://refhub.elsevier.com/S1934-5909(16)00106-5/sref6http://refhub.elsevier.com/S1934-5909(16)00106-5/sref6http://refhub.elsevier.com/S1934-5909(16)00106-5/sref6http://refhub.elsevier.com/S1934-5909(16)00106-5/sref5http://refhub.elsevier.com/S1934-5909(16)00106-5/sref5http://refhub.elsevier.com/S1934-5909(16)00106-5/sref5http://refhub.elsevier.com/S1934-5909(16)00106-5/sref5http://refhub.elsevier.com/S1934-5909(16)00106-5/sref4http://refhub.elsevier.com/S1934-5909(16)00106-5/sref4http://dx.doi.org/10.1016/S1473-3099(16)00095-5http://refhub.elsevier.com/S1934-5909(16)00106-5/sref2http://refhub.elsevier.com/S1934-5909(16)00106-5/sref2http://refhub.elsevier.com/S1934-5909(16)00106-5/sref1http://refhub.elsevier.com/S1934-5909(16)00106-5/sref1http://dx.doi.org/10.1016/j.stem.2016.02.016


6/12


7/12

SUPPLEMENTARY FIGURES AND LEGENDS

Figure S1, related to Figure 1.(A) RT-PCR amplification of ZIKV genome from infected Vero cells. Primers were designed using

the ZIKV MR766 sequence: #1: 89-279; #2: 4082-4281; #3: 1763-1952; #4: 1763-1850.(B) Sample images of immunostaining of Vero cells with a pan-flavivirus anti-E antibody (ZIKVE) at

56 hours after infection or mock infection. Scale bar: 20 m.(C-D) Sample images of immunostaining of HEK293 cells (C) and hESCs (WA09) and hiPSCs(DF19-9-11T.H.; D) with ZIKVE 72 hours after ZIKV or mock infection. hESCs and hiPSCs werealso stained with antibody against pluripotency marker NANOG. Note that ZIKVE+cells were

located at the edge of the colonies and exhibited reduced levels of NANOG. Scale bars: 20 m.


8/12

Figure S2, related to Figure 2.(A) Sample flow cytometry plots of the distribution of hNPCs at different phases of cell cycle 72hours after ZIKV or mock infection. An independent experiment using the same protocol as inFigure 2C.(B) Scatter plot of global transcriptome changes between mock and ZIKV infected cells. Log2FPKM (Fragments Per Kilobase of transcript per Million mapped reads) from RNA-seq data areplotted, and genes with significant differential expression values are highlighted. Upregulated genesare shown in red and downregulated genes are shown in blue.


9/12

SUPPLEMENTARY TABLES

Table S1. Summary of ZIKV infection of different cell types, related to Figure 1.

Name Type ZIKV permissiveness*

WA09 hESCs +/-

DF19-9-11T.H. hiPSCs +/-C1-2-NPC hNPCs +++

D3-2-NPC hNPCs +++

C1-2-N differentiated immature neurons fromhNPCs

+

293T human embryonic kidney cell line +/-

SNB-19 human CNS cell line (Glioblastoma) +++

SF268 human CNS cell line (astrocytoma) +++

Vero monkey IFN-kidney cell line +++

C6/C36 mosquito (Aedes albopictus) cell line +++

* +++: 65-100% cells infection after 3 days; +: 10-20% of the cells infected after 3 days; +/-: < 10%

of cells infected after 3 days.

Table S2. Differential gene expression between ZIKV infected and mock infected hNPCs,related to Figure 2.(A) Sequencing information(B) List of downregulated genes(C) List of upregulated genes


10/12

SUPPLEMENTAL EXPERIMENTAL PROCEDURES

Culture of Human iPSCs and Differentiation into Cortical Neural Progenitor Cells andImmature NeuronsHuman iPSC lines were previously generated from skin biopsy samples of a male newborn (C1-2line) and a male adult (D3-2 line) and had been fully characterized and passaged on MEF feederlayers (Wen et al., 2014). H9 hESCs (WA09 from WiCell) and hiPSCs (DF19-9-11T.H. from WiCell)were cultured under feeder-free conditions as described previously (Wu et al., 2012). All studiesfollowed institutional IRB and ISCRO protocols approved by Johns Hopkins University School ofMedicine and Florida State University. Human iPSCs (C1-2 and D3-2) were differentiated intoforebrain-specific hNPCs and immature neurons following a previously established protocol (Wen etal., 2014). Briefly, hiPSCs colonies were detached from the feeder layer with 1 mg/ml collagenasetreatment for 1 hour and suspended in embryonic body (EB) medium, consisting of FGF-2-freeiPSC medium supplemented with 2 M Dorsomorphin and 2 M A-83, in non-treated polystyreneplates for 4 days with a daily medium change. After 4 days, EB medium was replaced by neuralinduction medium (NPC medium) consisting of DMEM/F12, N2 supplement, NEAA, 2 g/ml heparinand 2 M cyclopamine. The floating EBs were then transferred to matrigel-coated 6-well plates atday 7 to form neural tube-like rosettes. The attached rosettes were kept for 15 days with NPCmedium change every other day. On day 22, the rosettes were picked mechanically and transferredto low attachment plates (Corning) to form neurospheres in NPC medium containing B27. The

neurospheres were then dissociated with Accutase at 37C for 10 minutes and placed onto

matrigel-coated 6-well plates at day 24 to form monolayer hNPCs in NPC medium containing B27.These hNPCs expressed forebrain-specific progenitor markers, including NESTIN, PAX6, EMX-1,FOXG1 and OTX2 (Wen et al., 2014). For neuronal differentiation, monolayer hNPCs were

dissociated with Accutase at 37C for 5 minutes and placed onto Poly-D-Lysine/laminin-coated

coverslips in the neuronal culture medium, consisting of Neurobasal medium supplemented with 2

mM L-glutamine, B27, cAMP (1 M), LAscorbic Acid (200 ng/ml), BDNF (10 ng/ml) and GDNF (10ng/ml) (Wen et al., 2014).

Preparation of ZIKV and Cell InfectionA ZIKV stock with the titer of 1x105Tissue Culture Infective Dose (TCID)/ml in the form of culturefluid from an infected rhesus Macaca cell line, LLC-MK2, was originally obtained from ZeptoMetrix(Buffalo, NY). This virus stock was then used to infect theAedesC3/C36 cells at a MOI of 0.02.Supernatant from the infected mosquito cells was collected 4-6 days post-infection and frozen inaliquots for both titering and infection of human cells. An equal volume of culture medium fromuninfected C3/C36 cells was used for mock infection. For all infections, 0.5-1 million cells wereseeded into 12-well plates with or without coverlips one day before virus addition. hiPSCs (DF19-9-11T.H.) were cultured under feeder-free conditions in mTeSR medium before infection. All viralinfection were performed under the same condition and the virus inoculum was removed after a 2-hour incubation and fresh medium for the appropriate cell type was added. To determine whetherinfected hNPCs produced more infectious ZIKV particles, supernatant from hNPC cultures 72 hoursafter infection was collected, filtered and then added to Vero cells for 48 hours.

RNA Extraction, RT-PCR and DNA sequencingTotal cellular RNA was purified from nave or ZIKV-infected Vero cells using the Qiagen RNeasyPlus kit according to manufacturers instructions. cDNA was produced from 1,000 ng total RNA,using random hexamers and an Invitrogen Superscript III first-strand kit according to themanufacturer's instructions. PCR was performed using GoTaq green PCR master mix (Promega)and Zika MR766 -genome specific primers (genome position 80-279: forward,TGGGAGGTTTGAAGAGGCTG; reverse, TCTCAACATGGCAGCAAGATCT; 1763-1850, forward,CATATTCCTTGTGCACCGCG, reverse, GCATACTGCACCTCCACTGT; 1763-1952, forward,CATATTCCTTGTGCACCGCG, reverse, TCAGTAATCACGGGGTTGGC; 4082-5456, forward,


11/12

CAAGGAGTGGGAAGCGGAG, reverse, CCATGTGATGTCACCTGCTCT; 5456-5620, forward,GCGATGCGTTTCCAGATTCC, reverse, TTGTCAGACAGGCTGCGATT). PCR products werepurified and directly sequenced without cloning.

ImmunocytochemistryCells were fixed with 4% paraformaldehyde (Sigma) for 15 min at room temperature. Samples werepermeabilized and blocked with 0.25% Triton X-100 (Sigma) and 10% donkey serum in PBS for 20min as previously described (Chiang et al., 2011; Wen et al., 2014; Yoon et al., 2014). Sampleswere then incubated with primary antibodies at 4 C overnight, followed by incubation withsecondary antibodies for 1 hr at room temperature. The following antibodies were used: anti-Flavivirus Group Antigen Antibody (clone D1-4G2-4-15; mouse; 1:500; Millipore), anti-Cleavedcaspase-3 (Asp15; Rabbit; 1:500; Cell Signaling Technology), anti-NANOG (goat; 1:500; R & DSystems). Antibodies were prepared in PBS containing 0.25% Triton X-100 and 10% donkeyserum. Images were taken by Zeiss LSM 880 confocal microscope, or Zeiss Axiovert 200Mmicroscope.

Flow Cytometry AnalysisZIKV-infected hNPCs at 72 hours post-infection and mock-infected parallel cultures were fixed forDNA content analysis. Staining with a Propidium Iodide Flow Cytometry Kit for Cell Cycle Analysis(Abcam) was performed according to manufacturer's instructions. Cell cycle progression data wereobtained using BD FACS Canto Ruo Special Order System flow cytometer (Becton Dickinson) andanalyzed using FACS Diva software.

Transcriptome AnalysesZIKV-infected hNPCs 56 hours after ZIKA and mock infection in parallel cultures were used forglobal transcriptome analysis. RNA-seq libraries were generated from duplicated samples percondition using the Illumina TruSeq RNA Sample Preparation Kit v2 following manufacturersprotocol. An Agilent 2100 BioAnalyzer and DNA1000 kit (Agilent) were used to quantify amplifiedcDNA, and a qPCR-based KAPA library quantification kit (KAPA Biosystems) was used toaccurately quantify library concentration. 12 pM diluted libraries were used for sequencing. 75-cyclepaired-end sequencings were performed using Illumina MiSeq and single-end sequencings wereperformed as technical replicates using Illumina NextSeq (Table S2A). Image processing andsequence extraction were performed using the standard Illumina Pipeline (BaseSpace). RNA-seqreads were aligned using tophat v2.0.13 (Trapnell et al., 2012). Significantly differentially expressedgenes were identified using cuffdiff by comparing FPKMs between all pairs of samples with P value< 0.05 (Trapnell et al., 2012) (Figure S2B and Table S2B-C). Gene Ontology analyses on biologicalprocess were performed by The Database for Annotation, Visualization and Integrated Discovery(DAVID) v6.7 (Huang da et al., 2009).


12/12

SUPPLEMENTARY REFERENCES

Chiang, C.H., Su, Y., Wen, Z., Yoritomo, N., Ross, C.A., Margolis, R.L., Song, H., and Ming, G.L.(2011). Integration-free induced pluripotent stem cells derived from schizophrenia patients with aDISC1 mutation. Mol Psychiatry16, 358-360.

Huang da, W., Sherman, B.T., and Lempicki, R.A. (2009). Systematic and integrative analysis oflarge gene lists using DAVID bioinformatics resources. Nature protocols4, 44-57.

Trapnell, C., Roberts, A., Goff, L., Pertea, G., Kim, D., Kelley, D.R., Pimentel, H., Salzberg, S.L.,Rinn, J.L., and Pachter, L. (2012). Differential gene and transcript expression analysis of RNA-seqexperiments with TopHat and Cufflinks. Nature protocols7, 562-578.

Wen, Z., Nguyen, H.N., Guo, Z., Lalli, M.A., Wang, X., Su, Y., Kim, N.S., Yoon, K.J., Shin, J.,Zhang, C., et al. (2014). Synaptic dysregulation in a human iPS cell model of mental disorders.Nature515, 414-418.

Wu, X., Robotham, J.M., Lee, E., Dalton, S., Kneteman, N.M., Gilbert, D.M., and Tang, H. (2012).Productive hepatitis C virus infection of stem cell-derived hepatocytes reveals a critical transition toviral permissiveness during differentiation. PLoS pathogens8, e1002617.

Yoon, K.J., Nguyen, H.N., Ursini, G., Zhang, F., Kim, N.S., Wen, Z., Makri, G., Nauen, D., Shin,J.H., Park, Y., et al. (2014). Modeling a genetic risk for schizophrenia in iPSCs and mice revealsneural stem cell deficits associated with adherens junctions and polarity. Cell Stem Cell 15, 79-91.

Documents

Zika Virus - Cell-stem -Cell