Upload
others
View
21
Download
0
Embed Size (px)
Citation preview
Page 1 of 27
IL-35 producing B cells promote the development of pancreatic neoplasia
Yuliya Pylayeva-Gupta1,3, Shipra Das1, Jesse S. Handler1, Cristina H. Hajdu2,
Maryaline Coffre2, Sergei Koralov2, Dafna Bar-Sagi1
1Department of Biochemistry and Molecular Pharmacology; 2Department of
Pathology, New York University School of Medicine, New York, NY, 10016, USA
3Present address: Department of Genetics, Lineberger Comprehensive Cancer
Center, University of North Carolina School of Medicine, Chapel Hill, NC, 27514,
USA.
Correspondence: Dafna Bar-Sagi, Ph.D., Department of Biochemistry and
Molecular Pharmacology, NYU School of Medicine, 550 First Avenue, Smilow 201,
New York, NY 10016; FAX 646-501-6721; email: [email protected]
Keywords: KRas; pancreas; cancer; B cells; Interleukin-10; Interleukin-35
Running title: B cells play a pro-tumorigenic role in pancreatic neoplasia
Conflict of interest: The authors have no conflict of interest to disclose.
Research. on October 15, 2020. © 2015 American Association for Cancercancerdiscovery.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on December 29, 2015; DOI: 10.1158/2159-8290.CD-15-0843
2
ABSTRACT
A salient feature of pancreatic ductal adenocarcinoma (PDA) is an abundant
fibroinflammatory response characterized by the recruitment of immune and
mesenchymal cells and the consequent establishment of a pro-tumorigenic
microenvironment. Here we report the prominent presence of B cells in human
pancreatic intraepithelial neoplasia (PanIN) and PDA lesions as well as in
oncogenic K-Ras-driven pancreatic neoplasms in the mouse. The growth of
orthotopic pancreatic neoplasms harboring oncogenic K-Ras was significantly
compromised in B cell-deficient mice (μMT), and this growth deficiency could be
rescued by the reconstitution of a CD1dhighCD5+ B cell subset. The pro-
tumorigenic effect of B cells was mediated by their expression of IL-35 through a
mechanism involving IL-35-mediated stimulation of tumor cell proliferation. Our
results identify a previously unrecognized role for IL-35-producing CD1dhighCD5+
B cells in the pathogenesis of pancreatic cancer and underscore the potential
significance of a B cell/IL-35 axis as a therapeutic target.
SIGNIFICANCE
This study identifies a B cell subpopulation that accumulates in the pancreatic
parenchyma during early neoplasia and is required to support tumor cell
growth. Our findings provide a rationale for exploring B cell-based targeting
approaches for the treatment of pancreatic cancer.
Research. on October 15, 2020. © 2015 American Association for Cancercancerdiscovery.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on December 29, 2015; DOI: 10.1158/2159-8290.CD-15-0843
3
INTRODUCTION
Pancreatic ductal adenocarcinoma (PDA) is a highly aggressive disease with a
dismal 5- year survival rate of 6% and a poor response to all existing therapies.
The development of PDA is initiated by mutations in the KRas oncogene followed
by inactivating mutations and deletion of tumor suppressor genes including
TRP53, CDKN2A, and SMAD4 (1). The role of these alterations in the initiation
and progression of PDA has been attributed to cell-intrinsic processes that are
critical for malignant transformation, including the bypass of proliferative barriers,
metabolic adaptation and metastatic dissemination.
In addition to these genetically-driven cell intrinsic changes, a key
pathophysiological aspect of PDA is the recruitment of host immune cells into the
tumor microenvironment. Investigations into the functional relevance of discrete
tumor infiltrating immune cell subtypes have uncovered a multitude of
immunomodulatory mechanisms mediated by recruited cells. For example, tumor
associated macrophages and myeloid-derived suppressor cells have been
shown to promote pancreatic tumorigenesis through the suppression of anti-
tumor immunity via expression of heme oxygenase-1 and arginase, respectively
(2-4). CD4+ T cells repress the anti-tumor activity of CD8+ cytotoxic T cells from
the onset of pancreatic neoplasia (5). Likewise, regulatory subset of CD4+ T cells
promotes progression of pancreatic neoplasia by suppressing anti-tumor T cell
immunity in mice immunized with Listeria monocytogenes (6). Furthermore, PDA
associated inflammation potentiates differentiation of immune cell subsets, such
as Th17 T cells and plasmacytoid dendritic cells, that can enhance tumor cell
Research. on October 15, 2020. © 2015 American Association for Cancercancerdiscovery.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on December 29, 2015; DOI: 10.1158/2159-8290.CD-15-0843
4
growth (7, 8). Significantly, these mechanisms are engaged at very early stages
of disease development and represent attractive targets for therapeutic
intervention.
We have previously shown that the formation of preinvasive lesions known as
pancreatic intraepithelial neoplasia (PanIN) is accompanied by the recruitment of
B cells into the pancreatic parenchyma (3). In the present study we sought to
determine whether this immune cell population plays a role in neoplastic
progression. Our findings identify a B cell subset that contributes to pancreatic
cancer pathogenesis through a paracrine mechanism that promotes the
proliferation of the transformed epithelium.
RESULTS
To investigate the role of B cells in pancreatic tumorigenesis, we first assessed
whether their presence is linked to pancreatic neoplasia in human and mouse.
Prominent B cell infiltrates were detected in proximity to human PanIN lesions as
well as in pancreata of LSL-KrasG12D;p48Cre (KC) mice (Fig. 1A). Furthermore the
implantation of pancreatic ductal epithelial cells expressing oncogenic KRas
(KRasG12D-PDEC) into wild-type (WT) pancreata led to the accumulation of B
cells in regions adjacent to the newly established neoplastic lesions (Fig. 1A)
suggesting an instructive role for the transformed epithelium in B cell recruitment.
We reasoned that the infiltration of neoplastic lesions by B cells would be
mediated by chemotactic cues with the most relevant being the main B cell
chemoattractant CXCL13. Consistent with this postulate, CXCL13 was detected
Research. on October 15, 2020. © 2015 American Association for Cancercancerdiscovery.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on December 29, 2015; DOI: 10.1158/2159-8290.CD-15-0843
5
in the fibroinflammatory stroma surrounding human and mouse PanIN lesions
(Fig. 1B and C; and Supplementary Fig. S1A and B), and treatment of mice
with anti-CXCL13 blocking antibody resulted in decreased accumulation of B
cells in pancreata of KC mice and mice orthotopically implanted with GFP-
KRasG12D-PDEC (Supplementary Fig. S1C-F). To further characterize the
CXCL13-expressing cell population, qPCR analysis was performed on FACS-
sorted cells from pancreata of KC mice. Using the immune marker CD45 and the
fibroblast marker CD140 (PDGFR), we found that the expression of CXCL13 was
restricted to the fibroblast fraction (CD45-CD140+) of the isolated cells (Fig. 1D).
In agreement with this finding, double immunofluorescent staining revealed that
CXCL13 expressing cells were positive for the mesenchymal marker vimentin
(Fig. 1B and C, insets). Another cell population that could potentially contribute
to CXCL13 production is dendritic cells (9). However, we did not detect CXCL13
mRNA in intra-pancreatic dendritic cells (CD45+CD11c+) (Fig. 1D). Together,
these results indicate that in the context of evolving pancreatic neoplasia, stromal
fibroblasts are induced to secrete CXCL13, thereby promoting the infiltration of B
cells into the pancreatic tumor microenvironment. These observations are
consistent with recent findings documenting that fibroblast-mediated production
of CXCL13 potentiates recruitment of B cells in a prostate cancer model (10).
The physiological relevance of this recruitment event is suggested by the fact
that anti-CXCL13 treatment of mice orthotopically implanted with GFP-KRasG12D-
PDEC resulted in the reduced growth of the orthotopic lesions (Supplementary
Fig. S1G and H).
Research. on October 15, 2020. © 2015 American Association for Cancercancerdiscovery.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on December 29, 2015; DOI: 10.1158/2159-8290.CD-15-0843
6
To directly analyze the functional significance of B cells in pancreatic
tumorigenesis, GFP-KRasG12D-PDEC were implanted into pancreata of μMT mice
which lack functional B cells or syngeneic WT control animals. Analysis of
pancreata at 2 weeks post-implantation revealed a significant reduction in the
abundance of GFP-KRasG12D-PDEC-derived lesions in μMT mice in comparison
to WT mice (Fig. 1E and F). A similar difference was observed at four weeks
post-implantation (Supplementary Fig. S2A and B). To determine whether the
compromised growth of the neoplastic cells in μMT mice is a direct consequence
of B cell loss, WT B cells were adoptively transferred into μMT animals. Two
days post adoptive transfer, the mice were orthotopically implanted with GFP-
KRasG12D-PDEC and pancreata and spleens were harvested 2 weeks thereafter
(Supplementary Figure S2C). The defect in growth of GFP-KRasG12D-PDEC in
μMT mice was rescued to a significant extent by the adoptive transfer of WT B
cells, and was accompanied by de novo infiltration of transferred B cells (Fig. 1E
and F and Supplementary Fig. S2D), consistent with an essential role for B
cells in establishing a pro-tumorigenic environment. As B lymphocytes were also
observed in the vicinity of neoplastic lesions formed as a consequence of the
concordant pancreatic expression of oncogenic KrasG12D and mutant p53R172H
(Supplementary Fig. S2E), we examined their functional significance in this
setting using cells derived from pdx-1Cre;LSL-KrasG12D;LSL-p53R172H/+ (KPC) mice
(11). Tumors formed by KPC cells that were orthotopically implanted into
pancreata of μMT mice were of significantly reduced size compared to orthotopic
tumors formed in WT pancreata (Supplementary Fig. S2F). These findings
Research. on October 15, 2020. © 2015 American Association for Cancercancerdiscovery.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on December 29, 2015; DOI: 10.1158/2159-8290.CD-15-0843
7
along with those reported by the accompanying papers (12, 13) suggest that the
presence of B cells might be required to support both early and more advanced
stages of pancreatic tumorigenesis.
Studies conducted in mouse models of squamous carcinomas have
demonstrated that humoral immunity, which is associated with the production of
immunoglobulins by mature B cells, can facilitate tumorigenesis predominantly
through a mechanism involving Fcγ receptor-dependent activation of myeloid
cells (14). To evaluate the role of B cells in myeloid cell activation in the context
of pancreatic tumorigenesis, we analyzed CD45+CD11b+F4/80+ macrophages for
expression of markers specific for either M1 or M2 (tumor-associated
macrophage, TAM) phenotype. We found that, in μMT mice with orthotopic
implants of GFP-KRasG12D-PDEC or GFP-KPC-PDEC, there was a decrease in
the prevalence of TAM-like CD206-expressing intra-pancreatic macrophages and
a corresponding increase in M1-like CD86 positive macrophages
(Supplementary Fig. S3A-D). These observations are consistent with earlier
findings demonstrating that B cell depletion leads to the repolarization of tumor
associated macrophages. To investigate the potential relevance of Fcγ receptor-
dependent activation of macrophages to the observed B cell dependence of
neoplastic growth, we examined the prevalence of antibody-producing plasma
cells in control p48Cre and KC mice. We observed a significant increase in
CD19low/-B220low/-CD138+ plasma cells in the spleens of KC animals (Fig. 2A and
Supplementary Fig. S4A). Concordantly, a significant increase in the proportion
of mature marginal zone B cells (plasma cell precursors) was detected in spleens
Research. on October 15, 2020. © 2015 American Association for Cancercancerdiscovery.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on December 29, 2015; DOI: 10.1158/2159-8290.CD-15-0843
8
of KC mice as compared to controls (Supplementary Fig. S4B and C),
consistent with an increase in systemic inflammation in mice with pancreatic
cancer (15). However, there was no increase in the abundance of plasma cells in
the pancreatic microenvironment of KC animals (Fig. 2A), suggesting that tumor
infiltrating B cells might modulate pancreatic neoplasia by means other than
immunoglobulin production.
Recent studies addressing the function of B cells in autoimmune disorders
have demonstrated that B cell-mediated cytokine release can alter disease
progression (16). In particular, a subset of cytokine-producing
CD19+CD1dhighCD5+ B cells has been shown to impart immunological tolerance
in autoimmune disease and to promote progression of breast and squamous
carcinomas (17, 18). We found that CD1dhighCD5+ B cells are expanded in
pancreata of KC and orthotopically implanted mice as compared to p48Cre
animals (Fig. 2B and Supplementary Fig. 4SD). To investigate if this B cell
subset contributes to growth of GFP-KRasG12D-PDEC in vivo,
CD19+CD1dhighCD5+ or CD19+CD1dlowCD5- cells were adoptively transferred into
μMT mice (Supplementary Fig. S5A and B). Pancreata were then orthotopically
injected with GFP-KRasG12D-PDEC and harvested for analysis at 2 weeks post-
implantation. While the efficiency of the adoptive transfer was the same for both
B cell subsets, only CD19+CD1dhighCD5+ cells could effectively rescue the
defective growth of GFP-KRasG12D-PDEC in μMT mice (Fig. 2C and D and
Supplementary Fig. S5C). Based on these observations we conclude that
Research. on October 15, 2020. © 2015 American Association for Cancercancerdiscovery.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on December 29, 2015; DOI: 10.1158/2159-8290.CD-15-0843
9
CD1dhighCD5+ B cells play an essential role in the development of pancreatic
neoplasia.
A critical functional output of CD1dhighCD5+ subtype has been reported to be
the expression of immunosuppressive cytokine IL-10 (19, 20). Consistent with
this attribute, B cell-specific IL-10 expression was detected in both mouse and
human pancreatic cancer (Supplementary Fig. S6A-D). To test whether the
observed B cell-mediated growth promoting effect is IL-10 dependent, WT or
IL10-/- B cells (derived from spleens of WT or IL10-/- mice, respectively) were
adoptively transferred into μMT mice. Two days after B cell transfer, mice were
injected with GFP-KRasG12D-PDEC and cells were allowed to grow for 2 weeks.
The successful transfer of B cells was confirmed using flow cytometry
(Supplementary Fig. S6E). We found that IL10-/- B cells were capable of
rescuing the growth of GFP-KRasG12D-PDEC in vivo to the same extent as WT B
cells (Fig. 2E and F). Thus Il-10 expression is dispensable for the growth
promoting effect of B cells on neoplastic lesions.
It has been recently shown that, in the context of autoimmune and infectious
diseases, CD1dhighCD5+ B cells can confer their immune modulatory effects via
expression of the cytokine IL-35 (a heterodimer, consisting of protein subunits
p35 and EBI3, encoded by genes IL12a and Ebi3, respectively) (21, 22).
Significantly, IL-35 has been found to be upregulated in sera of pancreatic cancer
patients (23). Analysis of KC pancreata revealed that IL12a expression is
primarily confined to B cells and, in particular, to the CD1dhighCD5+ B cell
subpopulation (Fig. 3A and B). A similar pattern of expression was observed for
Research. on October 15, 2020. © 2015 American Association for Cancercancerdiscovery.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on December 29, 2015; DOI: 10.1158/2159-8290.CD-15-0843
10
Ebi3 transcript (Fig 3C and D). Furthermore, B cell-specific expression of p35
was detected by immunofluorescence in samples of mouse as well as in human
PanIN lesions (Fig. 3E and F and Supplementary Fig. S7A and B). Since the
p35 subunit of IL-35 can combine with p40 (IL12b) and EBI3 can combine with
p28 (IL27) to form IL-12 and IL-27 respectively, we tested the expression of
these subunits in intra-pancreatic B cells. Neither total B cells nor CD1dhighCD5+
subpopulation of B cells isolated from pancreata of KC mice expressed IL12b or
IL27 to an appreciable degree (Supplementary Fig. S7C and D). To directly test
the functional significance of IL-35, WT or IL12a -/- B cells (derived from spleens
of WT or IL12a-/- mice, respectively) were adoptively transferred into μMT mice
(Supplementary Fig. S8), followed by orthotopic implantation of GFP-KRasG12D-
PDEC. As shown in Fig. 3G and H, IL12a -/- B cells failed to rescue the growth
of GFP-KRasG12D-PDEC in vivo suggesting that the B cell-dependent neoplastic
expansion requires IL-35 production. IL-35 has been previously reported to
stimulate the proliferation of pancreatic cancer cell lines (24). We therefore tested
the impact of B cell-mediated IL-35 production on the proliferation of GFP-
KRasG12D-PDEC. As shown in Fig. 3I and J, the absence of B cells was
accompanied by a reduction in epithelial cell proliferation, which was rescued by
WT but not IL12a-/- B cells. No changes in apoptosis were observed under these
conditions as judged by cleaved caspase staining (data not shown). Based on
these observations, we propose that expression of IL-35 by CD1dhighCD5+ is
required for the proliferative expansion of KRasG12D-harboring neoplastic lesions
in vivo.
Research. on October 15, 2020. © 2015 American Association for Cancercancerdiscovery.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on December 29, 2015; DOI: 10.1158/2159-8290.CD-15-0843
11
DISCUSSION
Understanding the cellular and molecular underpinnings of PDA-associated
immune modulation is a prerequisite for the development of immunotherapy-
based targeting approaches for this deadly malignancy. Our current work
identifies a B cell subset as an important driver of pancreatic tumorigenesis.
Specifically, we demonstrate that, in the context of pancreatic neoplasia, B cells
of CD19+CD1dhighCD5+ cell surface phenotype play a pro-tumorigenic role
through the production of IL-35. In a model of experimental autoimmune
encephalomyelitis (EAE), activation of TLR4 and CD40 has been shown to
induce the upregulation of mRNAs encoding subunits of IL-35 (IL12a and Ebi3)
by B cells(25). By analogy, it is plausible that activation of TLR4 and CD40 could
modulate IL-35 production in B cells in pancreatic cancer, as both TLR4 and
CD40 are upregulated on stromal cells in the pancreatic cancer milieu and
inhibition of TLR4 protects against pancreatic cancer(8). While we have shown
that IL-35 can stimulate the proliferation of tumor cells, one of the IL-35
receptors, gp130(22), is expressed on the surface on multiple immune cell
types(26). Thus, the effects of IL-35 are likely to be exerted through a network of
interactions involving tumor and stromal cells.
To date, the evidence for B cell function in PDA has been scarce and seemingly
contradictory. Whereas, infiltration of CD20+ tumor-associated pan-B cell
population has been shown to correlate with better survival prognosis (27),
elevated levels of B cell activating factor (BAFF) have been reported to correlate
with metastatic propensity (28). These findings are in line with the increasing
Research. on October 15, 2020. © 2015 American Association for Cancercancerdiscovery.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on December 29, 2015; DOI: 10.1158/2159-8290.CD-15-0843
12
appreciation of the multifaceted role that B cells play in tumorigenesis. As part of
the adaptive immune system, B cells harbor the potential to mediate antitumor
responses by facilitating antigen presentation, effective priming of T cells and
anti-tumor antibody production (29, 30). On the other hand, B cells have been
shown to contribute to tumorigenesis by promoting alternative macrophage
activation (via deposition of immune complexes) and dampening T cell-mediated
anti-tumor response (B regulatory function) (14, 31). The findings described in
this study, along with those reported by Lee et al. and Gunderson et al. (12, 13),
illustrate that, depending on biological context, the pro-tumorigenic effects of B
cells could be mediated by distinct B cell populations. Thus, we have shown that
IL-35 producing B cells are required to support growth of early pancreatic
neoplasia. Gunderson et al. (12) have demonstrated that, in the setting of
advanced disease, the pro-tumorigenic role of B cells can be mediated by the
engagement of FcRϒ on tumor-associated macrophages resulting in their TH2
reprogramming. Lastly, Lee et al. (13) have reported an increase in B1b cells in
mouse neoplastic lesions that is further amplified upon loss of Hif1-alpha,
indicating that expansion of this B cell subset might be uniquely controlled by
oxygen sensing mechanisms. Functional dissection of how these various B cell-
dependent effector mechanisms are orchestrated would enable the full
delineation of the role of B cells in the development and maintenance of
pancreatic tumors.
MATERIALS AND METHODS
Research. on October 15, 2020. © 2015 American Association for Cancercancerdiscovery.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on December 29, 2015; DOI: 10.1158/2159-8290.CD-15-0843
13
Animal models
The LSL-KrasG12D, Pdx1-Cre and p48-Cre strains have been described
previously(3). C57BL/6 mice used for orthotopic injections and isolation of B cells
for adoptive transfers were obtained from The Charles River Laboratories. Both
female and male mice were used in studies. Randomization methods or
inclusion/exclusion criteria were not used to allocate animals to experimental
groups. Researchers were not blinded to the experimental groups while
conducting surgeries, as well as during data collection for orthotopic
transplantation into WT and μMT mice (due to very apparent spleen size
differences upon organ harvest and B cell differences in flow cytometry
experiments). Data collection for orthotopic transplantation into μMT mice
supplemented with B cells of various genotypes was conducted blindly.
Orthotopic implantation of PDEC was performed as described previously(3). In
the setting of orthotopic injection, GFP-KrasG12D-PDEC were injected at 1 x 106
cells/mouse pancreas and KPC cells were injected at 7.5 x 104 cells/mouse
pancreas. B cell-deficient μMT mice, IL10-/- and Il12a-/- animals were obtained
from Jackson Laboratories (strains #002288, 002251 and 002692 respectively).
All animal care and procedures were approved by the Institutional Animal Care
and Use Committee at NYU School of Medicine.
Isolation, Culture, and Infection of PDEC
Isolation, culture and adenoviral infection of PDEC were carried out as previously
described(32). KPC cell line (line 4662) was a kind gift from Dr. R. H. Vonderheide.
Research. on October 15, 2020. © 2015 American Association for Cancercancerdiscovery.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on December 29, 2015; DOI: 10.1158/2159-8290.CD-15-0843
14
Primary cell lines were not authenticated, and were tested for Mycoplasma
contamination every 4 months. To generate GFP-labeled PDEC lines, the cells
were infected with pLVTHM-GFP virus as described in(3). Briefly, lentivirus was
generated by transfecting HEK-293T cells with the vector, the packaging construct
(psPAX2), and the envelope plasmid (pMD2G). Supernatants containing viral
particles were collected over a period of 48 hours. Following final collection,
supernatants were filtered through a 0.45μm syringe filter and concentrated using
100MWCO Amicon Ultra centrifugal filters (Millipore).
Adoptive transfer of B cells
Spleens of WT C57Bl6 mice (2-3 month of age, Charles River Laboratories) were
mechanically dissociated, a single cell suspension was made in 1%FBS/PBS,
passed through a 70μm strainer (BD Falcon) and treated with RBC lysis buffer
(eBioscience). B cells were purified using CD45R-linked MACS beads (Miltenyi)
using LS columns according to manufacturer’s instructions. Enrichment of B cells
was confirmed by flow cytometry using FITC-CD19 (6D5, #115505, Biolegend).
Viability and numbers of purified B cells were assessed using Nexcelom
Cellometer Auto 2000 viability counter. Purified cells were then washed in cold
PBS and injected retro-orbitally into recipient mice (7x106 cells/mouse in 100μl
volume (WT, IL10-/- and IL12a-/- B cells) or 1.5x106 cells/mouse in 100μl volume
(CD19+CD1dhighCD5+ and CD19+CD1dlowCD5-).
Quantitative RT-PCR
Research. on October 15, 2020. © 2015 American Association for Cancercancerdiscovery.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on December 29, 2015; DOI: 10.1158/2159-8290.CD-15-0843
15
For RNA isolation, cells were enriched into B cell and non-B cell populations, as
well as immune and non-immune cells using CD45R-linked or CD45-linked
MACS beads (Miltenyi). Flow through fractions yielded non-B cells and non-
immune cells, respectively. Cells were then further processed by FACS:
CD19+CD1dhiCD5+ and CD19+CD1dlowCD5- B cells; CD45-CD140a+ fibroblasts
and CD45-CD140a- non-fibroblasts as well as CD45+CD11c+ dendritic cells were
FACS sorted using a 100μm nozzle from 3-6 month old KC mice pancreata (or
spleens for dendritic cells) into the lysing reagent Trizol (Invitrogen) and total
RNA was extracted as per manufacturer instructions (RNeasy mini kit, QIAGEN).
1μg of total RNA was reverse-transcribed using the Quantitect Reverse
Transcription kit (Qiagen). Subsequently specific transcripts were amplified by
SYBR Green PCR Master Mix (USB) using a Stratagene Mx 3005P
thermocycler. Where fold expression is specified, comparative CT method was
used to quantify gene expression. Where relative expression is specified,
standard curve method was used to quantify gene expression. Expression was
normalized to GAPDH.
Primers used for QPCR are as follows: GAPDH forward - CAC GGC AAA TTC
AAC GGC ACA GTC, reverse - ACC CGT TTG GCT CCA CCC TTC A; CXCL13
forward - GTA ACC ATT TGG CAC GAG GAT T, reverse - AAT GAG GCT CAG
CAC AGC AA; IL12a forward - CAT CGA TGA GCT GAT GCA GT, reverse -
CAG ATA GCC CAT CAC CCT GT; Ebi3 forward - TGC TCT TCC TGT CAC
TTG CC, reverse - CGG GAT ACC GAG AAG CAT GG; IL-10 forward - CAG
TAC AGC CGG GAA GAC AA, reverse - CCT GGG GCA TCA CTT CTA CC;
Research. on October 15, 2020. © 2015 American Association for Cancercancerdiscovery.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on December 29, 2015; DOI: 10.1158/2159-8290.CD-15-0843
16
IL12b forward - CAGCAAGTGGGCATGTGTTC, reverse -
TTGGGGGACTCTTCCATCCT; IL27 forward – TGTCCACAGCTTTGCTGAAT,
reverse – CCGAAGTGTGGTAGCGAGG.
Human Pancreas Specimens
For the purposes of analyzing B cell infiltration pattern and CXCL13 expression
pattern, we examined 10 samples containing PanIN lesions and 10 samples
containing PDAC lesions (20 samples total). Samples consisted of 5μm sections
that were cut from FFPE blocks provided by the Tissue Acquisition and
Biorepository Service (TABS) of the NYU School of Medicine. This study was
conducted in accordance with the Declaration of Helsinki; all samples were
anonymized prior to being transferred to the investigator’s laboratory and
therefore meet exempt human subject research criteria.
Histology and Immunohistochemistry
Mouse pancreata were fixed and processed for histology and
immunohistochemistry (IHC) as described previously(3). The IHC protocol was
modified to detect mouse and human CXCL13, where blocking was done in 1x
bovine free blocking solution (Vector) supplemented with 0.5% Tween-20, and
10% serum for 1 hour at room temperature, followed by incubation with the
primary antibody diluted in 1x bovine free blocking solution overnight at 40C.
Secondary biotinylated rabbit-anti-goat antibody (Vector) was diluted in 1x bovine
free blocking solution as well. The following primary antibodies were used: rabbit
anti-GFP (#2956S, Cell Signaling), rat anti-B220 (#BDB557390, Fisher), rabbit-
Research. on October 15, 2020. © 2015 American Association for Cancercancerdiscovery.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on December 29, 2015; DOI: 10.1158/2159-8290.CD-15-0843
17
anti-vimentin (#5741P, Cell Signaling), mouse-anti-CD20 (#555677, BD
Pharmingen), rabbit-anti-phospho Histone H3 (#06-570, Millipore), goat-anti-
mouse CXCL13 and goat-anti-human CXCL13 (#AF470 and # AF801, both from
R&D systems). At least 9 mice per experimental condition were analyzed for
GFP staining and 6 mice per condition were analyzed for pHH3 staining. Slides
were examined on a Nikon Eclipse 80i microscope.
Immunofluorescence
For paraffin sections: FFPE sections were deparaffinized and rehydrated,
permeabilized with TBS/0.1% Tween-20 and washed in PBS. Citrate buffer
antigen retrieval (10 mM sodium citrate/0.05% Tween-20 (pH 6.0)) was
performed in a microwave for 15 minutes. Blocking was performed in 10%
serum/1% BSA/0.5% Tween-20/PBS for 1 hour at room temperature. Primary
antibodies were diluted in 2% BSA/0.5% Tween-20/PBS and incubated on
sections overnight at 40C. Secondary antibodies (Alexa Fluor-labeled, Invitrogen)
were diluted in 2% BSA/PBS for 1 hr at room temperature. Sections were
washed with PBS and stained with DAPI. The following primary antibodies were
used: goat-anti-mouse CXCL13 (#AF470, R&D Systems), rabbit-anti-vimentin
(#5741P, Cell Signaling), mouse-anti-CD20 (#555677, BD Pharmingen), anti-
IL12a (#LS-B9481, LS Bio), anti-B220 (#BDB557390, Fisher), anti-IL-10 (#bs-
0698R, Bioss), anti-CD19 (#550284, BD Pharmingen). For frozen sections:
staining was performed as described in (3) using the following primary
antibodies: anti-IL12a ((#LS-B9481, LS Bio), anti-B220 ((#BDB557390, BD
Research. on October 15, 2020. © 2015 American Association for Cancercancerdiscovery.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on December 29, 2015; DOI: 10.1158/2159-8290.CD-15-0843
18
Pharmingen). Slides were examined using AxioVision v4.7 (Zeiss) software on a
Zeiss Axiovert 200M microscope.
Flow cytometry
Cellular suspensions from the tissues were prepared as described previously in 2.
The following antibodies were used: anti-CD19 (1D3, #45-0193-80, eBioscience),
anti-B220 (RA3-6B2, #RM2630, Life Technologies), anti-CD45 (104, #109825,
Biolegend), anti-CD1d (1B1, #123507, Biolegend), anti-CD140 (APA5, #135905,
Biolegend), anti-CD21 (7E9, #123419, Biolegend), anti-CD5 (53-7.3, #100607,
Biolegend), anti-AA4.1 (#17-5892, eBioscience), anti-CD138 (281-2, #142505,
Biolegend), anti-CD206 (C068C2, Biolegend), anti-CD86 (GL-1, Biolegend), anti-
F4-80 (BM8, Biolegend), anti-CD11b (M1-70, Biolegend). Dead cells were
excluded by staining with Propidium Iodine (Sigma-Aldrich) or Aqua Live/Dead
stain. Flow cytometry was performed on FACScalibur and LSRII II (BD
Biosciences) instruments at NYU School of Medicine Flow Cytometry Core
Facility and data was analyzed using FlowJo software.
Blockade of CXCL13
For CXCL13 neutralization experiments, anti-CXCL13 or a control IgG antibody
(both from R&D Systems), were injected at a concentration of 200 mg/mouse
(10). For experiments using KC animals, injections were performed twice per
week for one week. For experiments using orthotopically implanted animals, mice
were injected with the antibodies two days prior to implantation and then every 4
days post implantation for a total duration of two weeks.
Research. on October 15, 2020. © 2015 American Association for Cancercancerdiscovery.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on December 29, 2015; DOI: 10.1158/2159-8290.CD-15-0843
19
Statistical Analyses
Data are presented as means ± standard deviations (SD) or SEM, as indicated.
The experiments were repeated at a minimum of three times to demonstrate
reproducibility. In estimating orthotopic tumor size based on our previous data,
the standard deviation for our dependent variable is 2 units in wild type mice. We
would be interested in any differences between strains greater than 4 units.
Assuming equal variability and sample size in the two strains, a two-tailed alpha
of .05, and power of .80, we determined that we would need about 5-6 animals
per group to detect an effect as small as 0.5 SD units. Variance was similar
between the groups that were being statistically compared. Data were analyzed
by the Microsoft Excel built-in t test (unpaired, two-tailed) and results were
considered significant at p value < 0.05.
ACKNOWLEDGEMENTS
We thank L. J. Taylor for discussions and help with manuscript preparation, and
the members of Bar-Sagi lab for comments. Special thanks to Drs. George Miller,
David Tuveson, Ken Olive and Howard Crawford for their generous help with
mouse strains lost during hurricane Sandy.
GRANT SUPPORT
The FACS, Histopathology Cores, and Tissue Acquisition and Biorepository
Service of NYU School of Medicine are partially supported by the National
Research. on October 15, 2020. © 2015 American Association for Cancercancerdiscovery.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on December 29, 2015; DOI: 10.1158/2159-8290.CD-15-0843
20
Institutes of Health Grant 5 P30CA16087-31. This shared resource is partially
supported by the Cancer Center Support Grant, P30CA016087, at the Laura and
Isaac Perlmutter Cancer Center. This work was supported by the 2013
Pancreatic Cancer Action Network-AACR Inaugural Research Acceleration
Network Grant, supported by Tempur-Pedic in memory of Tim Miller, Grant
Number 13-90-25-VOND (D.B.-S. and Robert H. Vonderheide) and by the 2013
Pancreatic Cancer Action Network-AACR Pathway to Leadership Grant, Grant
Number 13-70-25-PYLA (Y.P.-G.).
COMPETING FINANCIAL INTERESTS
The authors declare no competing financial interests.
AUTHOR CONTRIBUTIONS
YPG conducted most experimental studies and data analysis; RNA expression
analysis from FACS sorted cells was performed by YPG and SD; evaluation of
tumor growth with IL12a-/- B cells was performed by YPG and SD; JSH and SD
contributed to immunohistochemical staining and analysis of samples; CHH
selected and provided human tissue samples; MC and SK designed and facilitated
analysis of B cells; DBS directed all studies. YPG and DBS conceived the studies
and co-wrote the manuscript.
REFERENCES
1. Rishi A, Goggins M, Wood LD, Hruban RH. Pathological and molecular evaluation of pancreatic neoplasms. Semin Oncol. 2015;42:28-39.
Research. on October 15, 2020. © 2015 American Association for Cancercancerdiscovery.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on December 29, 2015; DOI: 10.1158/2159-8290.CD-15-0843
21
2. Arnold JN, Magiera L, Kraman M, Fearon DT. Tumoral immune suppression by macrophages expressing fibroblast activation protein-alpha and heme oxygenase-1. Cancer Immunol Res. 2014;2:121-6. 3. Pylayeva-Gupta Y, Lee KE, Hajdu CH, Miller G, Bar-Sagi D. Oncogenic Kras-induced GM-CSF production promotes the development of pancreatic neoplasia. Cancer Cell. 2012;21:836-47. 4. Bayne LJ, Beatty GL, Jhala N, Clark CE, Rhim AD, Stanger BZ, et al. Tumor-derived granulocyte-macrophage colony-stimulating factor regulates myeloid inflammation and T cell immunity in pancreatic cancer. Cancer Cell. 2012;21:822-35. 5. Zhang Y, Yan W, Mathew E, Bednar F, Wan S, Collins MA, et al. CD4+ T lymphocyte ablation prevents pancreatic carcinogenesis in mice. Cancer Immunol Res. 2014;2:423-35. 6. Keenan BP, Saenger Y, Kafrouni MI, Leubner A, Lauer P, Maitra A, et al. A Listeria vaccine and depletion of T-regulatory cells activate immunity against early stage pancreatic intraepithelial neoplasms and prolong survival of mice. Gastroenterology. 2014;146:1784-94 e6. 7. McAllister F, Bailey JM, Alsina J, Nirschl CJ, Sharma R, Fan H, et al. Oncogenic Kras activates a hematopoietic-to-epithelial IL-17 signaling axis in preinvasive pancreatic neoplasia. Cancer Cell. 2014;25:621-37. 8. Ochi A, Nguyen AH, Bedrosian AS, Mushlin HM, Zarbakhsh S, Barilla R, et al. MyD88 inhibition amplifies dendritic cell capacity to promote pancreatic carcinogenesis via Th2 cells. J Exp Med. 2012;209:1671-87. 9. McDonald KG, McDonough JS, Dieckgraefe BK, Newberry RD. Dendritic cells produce CXCL13 and participate in the development of murine small intestine lymphoid tissues. Am J Pathol. 2010;176:2367-77. 10. Ammirante M, Luo JL, Grivennikov S, Nedospasov S, Karin M. B-cell-derived lymphotoxin promotes castration-resistant prostate cancer. Nature. 2010;464:302-5. 11. Hingorani SR, Wang L, Multani AS, Combs C, Deramaudt TB, Hruban RH, et al. Trp53R172H and KrasG12D cooperate to promote chromosomal instability and widely metastatic pancreatic ductal adenocarcinoma in mice. Cancer Cell. 2005;7:469-83. 12. Andrew J. Gunderson MMK, Takahiro Tsujikawa, Abraham V. Nguyen, Nesrine I. Affara, Brian, Ruffell SG, Shannon M. Liudahl, Morgan Truitt, Peter Olson, Grace Kim, Douglas Hanahan,, Margaret Tempero BS, Bryan Irving, Betty Y. Chang, Judith A. Varner, Lisa M. Coussens. BTK-dependent immune cell crosstalk drives pancreas cancer. Cancer Discovery. 2015. 13. Kyoung Eun Lee MS, Lauren J. Bayne, Elizabeth L. Buza, Amy C. Durham,, David Allman RHV, M. Celeste Simon. Hif1α deletion reveals pro-neoplastic function of B cells in pancreatic neoplasia. Cancer Discovery. 2015. 14. Andreu P, Johansson M, Affara NI, Pucci F, Tan T, Junankar S, et al. FcRgamma activation regulates inflammation-associated squamous carcinogenesis. Cancer Cell. 2010;17:121-34. 15. Martin HL, Ohara K, Kiberu A, Van Hagen T, Davidson A, Khattak MA. Prognostic value of systemic inflammation-based markers in advanced pancreatic cancer. Intern Med J. 2014;44:676-82.
Research. on October 15, 2020. © 2015 American Association for Cancercancerdiscovery.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on December 29, 2015; DOI: 10.1158/2159-8290.CD-15-0843
22
16. DiLillo DJ, Matsushita T, Tedder TF. B10 cells and regulatory B cells balance immune responses during inflammation, autoimmunity, and cancer. Ann N Y Acad Sci. 2010;1183:38-57. 17. Bodogai M, Lee Chang C, Wejksza K, Lai J, Merino M, Wersto RP, et al. Anti-CD20 antibody promotes cancer escape via enrichment of tumor-evoked regulatory B cells expressing low levels of CD20 and CD137L. Cancer Res. 2013;73:2127-38. 18. Schioppa T, Moore R, Thompson RG, Rosser EC, Kulbe H, Nedospasov S, et al. B regulatory cells and the tumor-promoting actions of TNF-alpha during squamous carcinogenesis. Proc Natl Acad Sci U S A. 2011;108:10662-7. 19. Scapini P, Lamagna C, Hu Y, Lee K, Tang Q, DeFranco AL, et al. B cell-derived IL-10 suppresses inflammatory disease in Lyn-deficient mice. Proc Natl Acad Sci U S A. 2011;108:E823-32. 20. Horikawa M, Minard-Colin V, Matsushita T, Tedder TF. Regulatory B cell production of IL-10 inhibits lymphoma depletion during CD20 immunotherapy in mice. J Clin Invest. 2011;121:4268-80. 21. Wang RX, Yu CR, Dambuza IM, Mahdi RM, Dolinska MB, Sergeev YV, et al. Interleukin-35 induces regulatory B cells that suppress autoimmune disease. Nat Med. 2014;20:633-41. 22. Collison LW, Delgoffe GM, Guy CS, Vignali KM, Chaturvedi V, Fairweather D, et al. The composition and signaling of the IL-35 receptor are unconventional. Nat Immunol. 2012;13:290-9. 23. Jin P, Ren H, Sun W, Xin W, Zhang H, Hao J. Circulating IL-35 in pancreatic ductal adenocarcinoma patients. Hum Immunol. 2014;75:29-33. 24. Nicholl MB, Ledgewood CL, Chen X, Bai Q, Qin C, Cook KM, et al. IL-35 promotes pancreas cancer growth through enhancement of proliferation and inhibition of apoptosis: evidence for a role as an autocrine growth factor. Cytokine. 2014;70:126-33. 25. Shen P, Roch T, Lampropoulou V, O'Connor RA, Stervbo U, Hilgenberg E, et al. IL-35-producing B cells are critical regulators of immunity during autoimmune and infectious diseases. Nature. 2014;507:366-70. 26. Lesina M, Kurkowski MU, Ludes K, Rose-John S, Treiber M, Kloppel G, et al. Stat3/Socs3 activation by IL-6 transsignaling promotes progression of pancreatic intraepithelial neoplasia and development of pancreatic cancer. Cancer Cell. 2011;19:456-69. 27. Tewari N, Zaitoun AM, Arora A, Madhusudan S, Ilyas M, Lobo DN. The presence of tumour-associated lymphocytes confers a good prognosis in pancreatic ductal adenocarcinoma: an immunohistochemical study of tissue microarrays. BMC Cancer. 2013;13:436. 28. Koizumi M, Hiasa Y, Kumagi T, Yamanishi H, Azemoto N, Kobata T, et al. Increased B cell-activating factor promotes tumor invasion and metastasis in human pancreatic cancer. PLoS One. 2013;8:e71367. 29. Donepudi M, Jovasevic VM, Raychaudhuri P, Mokyr MB. Melphalan-induced up-regulation of B7-1 surface expression on normal splenic B cells. Cancer Immunol Immunother. 2003;52:162-70.
Research. on October 15, 2020. © 2015 American Association for Cancercancerdiscovery.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on December 29, 2015; DOI: 10.1158/2159-8290.CD-15-0843
23
30. Schilbach K, Kreyenberg H, Geiselhart A, Niethammer D, Handgretinger R. Cloning of a human antibody directed against human neuroblastoma cells and specific for human translation elongation factor 1alpha. Tissue Antigens. 2004;63:122-31. 31. Shah S, Divekar AA, Hilchey SP, Cho HM, Newman CL, Shin SU, et al. Increased rejection of primary tumors in mice lacking B cells: inhibition of anti-tumor CTL and TH1 cytokine responses by B cells. Int J Cancer. 2005;117:574-86. 32. Lee KE, Bar-Sagi D. Oncogenic KRas suppresses inflammation-associated senescence of pancreatic ductal cells. Cancer Cell. 2010;18:448-58.
FIGURE LEGENDS
Figure 1. B cells infiltrate mouse and human pancreatic neoplasia and
promote growth of KrasG12D-PDEC in vivo.
(A) Immunohistochemical detection of B cells in human (CD20 staining) and mouse
(B220 staining) in pancreata from hPanIN (20 patient samples), p48Cre (control, 5
mice), KC (10 mice), or KRasG12D-PDEC (9 mice) orthotopic lesions, as indicated.
Inset, B cells in the parenchyma of an adjacent tissue section detected by
immunofluorescence using anti-CD19 (green) and DAPI (blue). Representative
images are shown. Scale bars, 100μm.
(B) Hematoxylin and eosin (H&E) staining and immunohistochemical staining for
CD20, CXCL13 and vimentin in a representative sample of human pancreatic
cancer containing PanIN lesions (n=20). Inset, sections of human PanIN lesions
were stained by immunofluorescence (CXCL13, red; vimentin, green; and DAPI,
blue). Scale bars, 100μm; inset 7.5μm.
(C) Serial sections of a KC mouse pancreas were stained by immunohistochemistry
with CXCL13 or immunofluorescence (n=10; CXCL13, red; vimentin, green; and
Research. on October 15, 2020. © 2015 American Association for Cancercancerdiscovery.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on December 29, 2015; DOI: 10.1158/2159-8290.CD-15-0843
24
DAPI, blue). A representative image is shown. Scale bars, 100μm and 12 μm
(inset).
(D) Expression of CXCL13 mRNA in cellular subsets isolated from pancreata of KC
mice. Error bars indicate SD. (n=6)
(E) Sections from orthotopic pancreatic grafts 2 weeks after GFP-KRasG12D-PDEC
implantation into WT or μMT mice were stained with H&E or anti-GFP antibody.
Where indicated, μMT mice were reconstituted with WT B cells 2 days prior to
orthotopic implantation. Representative images are shown. Scale bars, 100μm.
(F) Graph depicts quantification of the data in (E) and indicates the average fraction
of GFP+ signal per field of view (FOV; 10 FOV per animal; n=12 WT, n=14 μMT,
n=9 μMT+WT B cell animals).
Error bars indicate SD; P values were determined by Student’s t-test (unpaired,
two-tailed); p value: ***<0.001.
Figure 2. CD1dhighCD5+ B cells are expanded in pancreatic neoplasia and are
functionally important for sustaining growth of KrasG12D-PDEC in vivo.
(A) Quantification of flow cytometric analysis of plasma cells from spleens,
mesenteric lymph nodes (MLN), and pancreata of p48Cre (control) or KC mice. Cells
were analyzed for the presence of markers CD19, B220 and CD138 (n=5 p48Cre,
n=5 KC).
(B) Quantification of flow cytometric analysis of immune cells from pancreata of
p48Cre (control) mice, KC mice (2.5mo), or KRasG12D-PDEC orthotopic lesions (2
weeks), as indicated. After gating on CD19 and CD1d populations, cells were
Research. on October 15, 2020. © 2015 American Association for Cancercancerdiscovery.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on December 29, 2015; DOI: 10.1158/2159-8290.CD-15-0843
25
analyzed for the presence of CD5 marker (n=8 p48Cre, n=8 KrasG12D-PDEC, n=8
KC).
(C) Sections from orthotopic pancreatic grafts 2 weeks after GFP-KRasG12D-PDEC
implantation into WT or μMT mice were stained with anti-GFP antibody. Where
indicated, μMT mice were reconstituted with WT CD19+CD1dhighCD5+ or with
CD19+CD1dlowCD5- 2 days prior to orthotopic implantation. Representative images
are shown. Scale bars, 100μm.
(D) Graph depicts quantification of the data from (C) indicating the average fraction
of GFP+ area per FOV of the implant (10 FOV per animal; n=12 WT, n=11 μMT,
n=9 μMT+ CD1dlowCD5-, n=9 μMT+ CD1dhighCD5+, animals).
(E) Sections from orthotopic pancreatic grafts 2 weeks after GFP-KRasG12D-PDEC
implantation into WT or μMT mice were stained with H&E or anti-GFP antibody.
Where indicated, μMT mice were reconstituted with WT B cells or with IL10-/- B
cells 2 days prior to orthotopic implantation. Representative images are shown.
Scale bars, 100μm.
(F) Graph depicts quantification of the data from (E) indicating the average fraction
of GFP+ area per FOV of the implant (10 FOV per animal; n=14 WT, n=12 μMT,
n=12 μMT+WT B cell, n=12 μMT+IL10-/- B cell animals).
Error bars indicate SD; P values were determined by Student’s t-test (unpaired,
two-tailed); p value: *<0.05; **<0.01; ***<0.001; NS – not significant.
Figure 3. Expression of IL-35 by B cells is functionally important for
sustaining growth of KrasG12D-PDEC in vivo.
Research. on October 15, 2020. © 2015 American Association for Cancercancerdiscovery.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on December 29, 2015; DOI: 10.1158/2159-8290.CD-15-0843
26
(A) Levels of IL12a mRNA in immune cells from spleen or pancreata of p48Cre
(control) or KC mice were assessed by quantitative RT-PCR (n = 9 p48Cre, n=9 KC).
(B) Levels of IL12a mRNA in CD19+CD1dhighCD5+ and CD19+CD1dlowCD5- sub-
populations of B cells sorted from pancreata of KC mice were assessed by
quantitative RT-PCR (n=9 KC).
(C) Levels of Ebi3 mRNA in B cells and non-B cells from pancreata of KC mice
were assessed by quantitative RT-PCR (n=9 KC).
(D) Levels of Ebi3 mRNA in CD19+CD1dhighCD5+ and CD19+CD1dlowCD5- sub-
populations of B cells sorted from pancreata of KC mice were assessed by
quantitative RT-PCR (n=9 KC).
(E) Immunofluorescence staining for p35 and CD20 in samples of human
pancreatic cancer containing PanIN lesions. Scale bars, 10μm (top) and 20μm
(bottom). Two independent fields of view are shown.
(F) Immunofluorescence staining for p35 and B220 in samples of KC pancreata.
Scale bars, 20μm. Two independent fields of view are shown.
(G) Sections from orthotopic pancreatic grafts 2 weeks after GFP-KRasG12D-PDEC
implantation into WT or μMT mice were stained with H&E or anti-GFP antibody.
Where indicated, μMT mice were reconstituted with WT B cells or with IL12a-/- B
cells 2 days prior to orthotopic implantation. Representative images are shown.
Scale bars, 100μm.
(H) Graph depicts quantification of the data from (G) indicating the average fraction
of GFP+ area per FOV of the implant (10 FOV per animal; n = 9 WT, n=9 μMT, n= 9
μMT+WT B cell, n=9 μMT+IL12a-/- B cell animals).
Research. on October 15, 2020. © 2015 American Association for Cancercancerdiscovery.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on December 29, 2015; DOI: 10.1158/2159-8290.CD-15-0843
27
(I) Immunohistochemical staining for phospho-Histone H3 of GFP-KRasG12D-PDEC
implanted into mice as described in (G) above. Representative images are shown.
Scale bars, 50μm.
(J) Graph depicts quantification of the data in (I) and indicates the fraction of
phospho-Histone H3+ signal in epithelial cells (10 FOV per animal; n=6 WT, n=6
μMT, n=6 μMT+WT B cell, n=6 μMT+IL12a-/- B cell animals).
Error bars indicate SEM in A, SD in B-D, H, J; P values were determined by
Student’s t-test (unpaired, two-tailed); p value: *<0.05; **<0.01; ***<0.001.
Research. on October 15, 2020. © 2015 American Association for Cancercancerdiscovery.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on December 29, 2015; DOI: 10.1158/2159-8290.CD-15-0843
Figure 1
A control KRasG12D-PDEC KC hPanIN
Mouse Human
CD20 B220 B220 B220
D
CX
CL13 m
RN
A e
xpre
ssio
n
1.2
1
0.8
0.6
0.4
0.2
CD45+ CD11c+
B H&E CD20 CXCL13 vimentin
Human
C
F 35
30
25
20
15
10
5
***
μMT WT μMT
+WT B cells
***
GF
P +
sig
nal (p
erc
ent/
FO
V)
E WT μMT
μMT
+ WT B cells
H&
E
GF
P
DAPI
CXCL13
Vimentin
CXCL13
CXCL13
Vimentin
DAPI
Research. on October 15, 2020. © 2015 American Association for Cancercancerdiscovery.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on December 29, 2015; DOI: 10.1158/2159-8290.CD-15-0843
GF
P +
sig
nal (p
erc
ent/
FO
V)
NS
WT μMT CD1dlow
CD5-
CD1dhigh
CD5+
30
25
20
15
10
μMT
5
D
**
* **
*
B
Control KC KrasG12D
PDEC
10
5
15
20
%C
D19
hig
hC
D1
dh
igh c
ells
* ***
Figure 2
GF
P +
sig
nal (p
erc
ent/
FO
V)
F
25
20
15
10
5
μMT WT +WT
B cells
+IL10-/-
B cells
μMT
*** *** ***
E WT μMT
μMT
+ WT B cells
μMT
+ IL10-/- B cells
H&
E
GF
P
C WT μMT
μMT +
CD1dlowCD5-
μMT +
CD1dhighCD5+
A %
CD
19
low
/-B
22
0lo
wC
D1
38
+ c
ells
*
control KC
Spleen
control KC
MLN
control KC
Pancreas
0.5
1
1.5
2
2.5
3
Research. on October 15, 2020. © 2015 American Association for Cancercancerdiscovery.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on December 29, 2015; DOI: 10.1158/2159-8290.CD-15-0843
Figure 3
CD20
DAPI
E Human PanIN
p35
CD20
DAPI
p35
DAPI
A
non-B
cells
IL12
a e
xp
ressio
n f
old
ch
an
ge 10
8
6
4
2
B cells
C
B cells non-
B cells
Ebi3
expre
ssio
n f
old
ch
an
ge 3.5
3
2.5
2
1.5
1
0.5
F
B220
DAPI
Mouse PanIN
p35
B220
DAPI
p35
DAPI
D 25
20
15
10
5
Ebi3
expre
ssio
n f
old
ch
an
ge
**
B
IL12
a e
xp
ressio
n f
old
ch
an
ge 7
6
5
4
3
2
1
** ** ** spleen pancreas
Control Control KC KC CD1dlow
CD5-
CD1dhigh
CD5+
CD1dlow
CD5-
CD1dhigh
CD5+
WT μMT
μMT
+ WT B cells
μMT
+ IL12a-/- B cells
H&
E
GF
P
30
25
20
15
10
5
μMT WT +WT
B cells
+IL12a-/-
B cells
μMT
G H
J
% p
-HH
3+ e
pithelia
l cells
14
12
10
8
6
4
μMT WT +WT
B cells
+IL12a-/-
B cells
μMT
I
pH
H3
GF
P+ s
ignal (p
erc
ent/
FO
V)
*** ***
*** ***
2
* *
* *
Research. on October 15, 2020. © 2015 American Association for Cancercancerdiscovery.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on December 29, 2015; DOI: 10.1158/2159-8290.CD-15-0843
Published OnlineFirst December 29, 2015.Cancer Discov Yuliya Pylayeva-Gupta, Shipra Das, Jesse S. Handler, et al. neoplasiaIL-35 producing B cells promote the development of pancreatic
Updated version
10.1158/2159-8290.CD-15-0843doi:
Access the most recent version of this article at:
Material
Supplementary
http://cancerdiscovery.aacrjournals.org/content/suppl/2015/12/24/2159-8290.CD-15-0843.DC1
Access the most recent supplemental material at:
Manuscript
Authoredited. Author manuscripts have been peer reviewed and accepted for publication but have not yet been
E-mail alerts related to this article or journal.Sign up to receive free email-alerts
Subscriptions
Reprints and
To order reprints of this article or to subscribe to the journal, contact the AACR Publications
Permissions
Rightslink site. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC)
.http://cancerdiscovery.aacrjournals.org/content/early/2015/12/28/2159-8290.CD-15-0843To request permission to re-use all or part of this article, use this link
Research. on October 15, 2020. © 2015 American Association for Cancercancerdiscovery.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on December 29, 2015; DOI: 10.1158/2159-8290.CD-15-0843