Abstract Yeast whole-cell biocatalysts for lipase-cata-lyzed reactions were constructed by intracellularly over-producing Rhizopus oryzae lipase (ROL) in Saccharomy-ces cerevisiae MT81. The gene encoding lipase from R.oryzae IFO4697 was cloned, and intracellular overpro-duction systems of a recombinant ROL with a pro-se-quence (rProROL) were constructed. When rProROLfrom R. oryzae IFO4697 was produced under the controlof the 5-upstream region of the isocitrate lyase gene ofCandida tropicalis (UPR-ICL) at 30 C for 98 h by two-stage cultivation using SDC medium (SD medium with2% casamino acids) containing 2.0% and 0.5% glucose,intracellular lipase activity reached levels up to474.5 IU/l. These whole-cell biocatalysts were permea-bilized by air-drying and used for the synthesis of methylesters (MEs), a potential biodiesel fuel, from plant oiland methanol in a solvent-free and water-containingsystem. The ME content in the reaction mixturewas71 wt% after a 165-h reaction at 37 C with stepwiseaddition of methanol. These results indicate that an effi-cient whole-cell biocatalyst can be prepared by intracel-lular overproduction of lipase in yeast cells and theirpermeabilization.

Introduction

Lipases are enzymes that catalyze the hydrolysis of esterbonds of triglycerides. In nonaqueous systems, lipasescatalyze the reverse reaction, namely ester synthesis andtransesterification. They can also catalyze stereoselectiveand regioselective reactions. Lipases are therefore one ofthe most commonly used enzymes in industrial process-es. For the industrial bioconversion process, however,the utilization of intracellularly accumulated lipases inthe form of whole-cell biocatalysts is both more cost-ef-fective and more advantageous. This is because whole-cell biocatalysts are prepared simply by cultivation, andthe enzymes trapped inside the cells are regarded as im-mobilized and can be separated easily. Moreover, floccu-lent microbial cells containing lipase can be spontane-ously immobilized within porous support particles dur-ing cultivation (Liu et al. 1998).

In the present study, yeast expression systems for theintracellular production of active lipase were constructedand used for preparation of whole-cell biocatalysts.Yeast cells have a relatively rigid cell wall and they re-tain their structure in the presence of organic compoundsand solvents. Moreover, several methods to permeabilizeyeast cells which significantly improve their reactivityhave been developed (Gowda et al. 1991; Seip and Cosimo 1992; Inoue et al. 1994; Liu et al. 1999; Kondoet al. 2000). Yeasts are thus a useful tool in the develop-ment of whole-cell biocatalysts. Lipase from Rhizopusoryzae (ROL) was chosen because its secretory produc-tion has been accomplished in Saccharomyces cerevisiae(Takahashi et al. 1998, 1999). To construct whole-cellbiocatalysts for lipase-catalyzed reactions, recombinantlipase with a pro-sequence from R. oryzae IFO4697(rProROL) was intracellularly overexpressed under thecontrol of the glyceraldehyde-3-phosphate dehydroge-nase (GAPDH) promoter and the 5-upstream region ofthe isocitrate lyase gene of Candida tropicalis (UPR-ICL) (Umemura et al. 1995). UPR-ICL-mediated tran-scription is strongly induced by either glucose exhaus-tion or a non-fermentable carbon source such as ethanol

T. Matsumoto H. FukudaDivision of Molecular Science, Graduate School of Science and Technology, Kobe University,11 Rokkodaicho, Nada-ku, Kobe, 6578501, JapanS. Takahashi M. Ueda A. TanakaDepartment of Synthetic Chemistry and Biological Chemistry,Graduate School of Engineering, Kyoto University, Yoshida,Sakyo-ku, Kyoto, 6068501, JapanM. Kaieda A. Kondo ()Department of Chemical Science and Engineering, Faculty of Engineering, Kobe University, 11 Rokkodaicho, Nada-ku, Kobe, 6578501, Japane-mail: kondo@cx.kobe-u.ac.jpTel.: +81-78-8036196, Fax: +81-78-8036206

Appl Microbiol Biotechnol (2001) 57:515520DOI 10.1007/s002530100733

O R I G I N A L PA P E R

T. Matsumoto S. Takahashi M. Kaieda M. UedaA. Tanaka H. Fukuda A. Kondo

Yeast whole-cell biocatalyst constructed by intracellular overproduction of Rhizopus oryzae lipase is applicable to biodiesel fuel productionReceived: 11 April 2001 / Received revision: 11 May 2001 / Accepted: 18 May 2001 / Published online: 17 August 2001 Springer-Verlag 2001

or acetate (Kanai et al. 1996). The content of active li-pase in yeast cells was maximized by optimizing the cul-tivation procedure, and whole-cell biocatalysts were pre-pared by permeabilization of yeast cells.

To test the applicability of whole-cell biocatalystscontaining lipase to industrially significant reactions,they were used for biodiesel fuel production. Biodieselfuel refers to methylesters (MEs) synthesized from naturaltriglycerides and methanol (Cvengros and Cvengrosava1994; Masujuki and Sapuan 1995; Linco et al. 1998).Since biodiesel is a clean fuel (Varese and Varese 1996)and can be produced from waste oil, the development ofan efficient biodiesel fuel production process using li-pase (Nelson et al. 1996; Shimada et al. 1999) is consid-ered of great importance in helping to overcome environ-mental problems by utilizing non-petroleum and renew-able sources of fuel. Recently, Kaieda et al. (1999) foundthat ROL from R. oryzae IFO4697 efficiently catalyzesthe synthesis of MEs from natural triglycerides andmethanol (methanolysis reaction) in a solvent-free andwater-containing system. Based on this, the applicabilityof whole-cell biocatalysts to the methanolysis reaction ina solvent-free and water-containing system was studied.

Materials and methods

Strains, media and general methods

The S. cerevisiae strain used in this work was MT81 (MATaura31 trp11 ade21 leu23,112 his3) (Takahashi et al. 1998).The Escherichia coli strain used for genetic manipulation was No-vablue [endA1 hsdR17 (rK mK+) supE44 thi-1 gyrA96 relA1 lacrecA1/F {proAB+ lac Iq ZM15 Tn10 (tetr)}] (Novagen, Madison,Wis., USA). Rhizopus oryzae IFO4697 was used for cloning of thelipase gene.

Yeasts were grown in complete (YPD: 1% yeast extract, 2%peptone, 2% glucose) or selective (SD: 0.67% yeast nitrogen basesupplemented with appropriate amino acids and nucleotides, 2%glucose, unless otherwise noted) medium. To prepare plates, 2%agar was added to these media. E. coli was grown in LB medium(1% tryptone, 0.5% yeast extract, 1% sodium chloride) containing100 g/ml ampicillin.

Plasmids were transformed into S. cerevisiae cells using YeastMaker (Clontech Laboratories, Calif., USA), and the transform-ants were selected on SD-medium plates.

Construction of expression plasmids

For efficient intracellular overproduction of rProROL in yeastcells, plasmids pWGP3ProROL and pWI3ProROL were construct-ed for the constitutive and inducible expression, respectively, ofProROL (Fig. 1). R. oryzae IFO4697 chromosomal DNA was pre-pared by stirring the cells vigorously with glass beads followed byphenol-chloroform extraction. To amplify the gene encoding ROLtogether with the pro-sequence (ProROL) from chromosomalDNA, the following two oligonucleotides were used as primers:ICs (5 CTCCGGATCCATGGTTCCTGTTTCTGG TAAATCTG-GATCT 3) and ROLrvSalI (5 CGATGTCGACTTACAAACAG-CTTCC 3). PCR was carried out using pfu turbo polymerase(Strategene Cloning Systems, Calif., USA). The resulting frag-ment was ligated into the multicopy plasmid pWGP3 (Tajima etal. 1985) or pWI3 (Kanai et al. 1996) by the following procedures.pWGP3 was digested with BamHI and SalI. Subsequently, theDNA fragment containing ProROL gene was digested with the

same nucleases and inserted into the plasmid. The resulting plas-mid was named pWGP3ProROL. In the same way, plasmidpWI3ProROL was constructed from the DNA fragment containingProROL and the plasmid pWI3, which was digested with BglIIand SalI. In plasmid pWGP3ProROL, ProROL was expressed un-der the control of the GAPDH promoter, and in plasmidpWI3ProROL, the gene was expressed under the control of UPR-ICL.

Intracellular expression experiments

Transformants harboring the plasmid for intracellular overproduc-tion of rProROL were precultivated in SD medium at 30 C for30 h (OD600>1.5). These cultures were used to inoculate 150 ml ofSDC medium (SD medium containing 2% casamino acids) in 500-ml shaking flasks. The initial OD600 was 0.03 and the initialglucose concentration was 0.5%.

Measurement of lipase activity

The hydrolytic activities of lipase in culture broth and yeast cellswere measured with Lipase Kit S (Dainippon Pharmaceutical,Osaka, Japan) according to the protocol specified by the supplierand indicated by international units (IU). One IU of lipase activitywas defined as the amount of enzyme catalyzing the formation of1 mol of 2,3-dimercaptopropan-1-ol from 2,3-dimercaptopropan-1-ol tributyl ester per min. To measure the lipase activity in yeastcells, intracellular soluble fractions were extracted by the follow-ing procedure. Harvested yeast cells were washed twice with5 mM EDTA in 50 mM Tris-HCl buffer (pH 8.0) and resuspendedin the same buffer with 1 mM phenylmethylsulfonyl fluoride(PMSF), 3 mg leupeptin/l and 3 mg pepstatin A/l to inhibit the ac-tivity of certain proteases. This mixture was agitated with a halfvolume of glass beads for 30 s using a vortex mixer at maximumspeed and then cooled on ice. After ten cycles of agitation andcooling, the intracellular soluble fraction was obtained as the su-pernatant by centrifugation at 12,000 rpm at 4 C for 10 min.

Western blot analysis of rProROL

rProROL produced in yeast cells was analyzed by Western blot.Yeast cell homogenate was obtained as described above. Proteinsfrom culture supernatants and cell extracts were separated bySDS-PAGE using a 12.5% gel. The proteins separated on the gelwere electroblotted on polyvinylidene difluoride (PVDF) mem-

516

Fig. 1 Construction of expression plasmids pWGP3ProROL andpWI3ProROL for expression of ProROL from Rhizopus oryzaestrain IFO4697 under the control of the GAPDH promoter andUPR-ICL, respectively

brane (Millipore, Boston, Mass., USA) and reacted with primaryrabbit-anti-ROL IgG antibodies (Takahashi et al. 1998) and sec-ondary goat-anti-rabbit IgG alkaline phosphatase (AP)-conjugatedantibodies (Promega). Then the membrane was stained with nitro-blue tetrazolium chloride (NBT, Promega) and 5-bromo-4-chloro-3-indolylphosphate toluidine salt (BCIP, Promega).

Preparation of yeast whole-cell biocatalyst by permeabilization

Yeast whole-cell biocatalysts were prepared from cells intracellu-larly overproducing rProROL as follows. Yeast cells grown bytwo-stage cultivation were harvested by centrifugation at 3,000 gand washed with distilled water. Cell pellets were air-dried at42 C for 3 h or frozen at 50 C and thawed at room temperatureto improve the permeability of the cell membrane.

Methanolysis using whole-cell biocatalysts

Methanolysis was performed as follows. Yeast cells (0.4 g wetweight) intracellularly overproducing rProROL were suspended in2 ml of 0.1 M acetate buffer (pH 7.0) and used as a catalyst. Theyeast cell suspension was added into a mixture of soybean oil andmethanol (9.65/0.35 g/g=1/1, mol/mol). The reaction was carriedout in 30-ml screw-cap vials at 37 C at 150 oscillations per min.When the ME content reached approximately 33% and 67%,0.35 g of methanol was added.

The amount of MEs produced by methanolysis was measuredby capillary gas chromatography GC-18A (Shimadzu, Kyoto, Japan) connected to a DB-5 capillary column according to themethod previously reported (Kaieda et al. 1999), with minor mod-ifications. Aliquots of 150 l were taken from the reaction mixtureand centrifuged at 14,000 rpm to obtain the upper layer. Then,80 l of upper layer and 20 l of tricaprylin were mixed in a 10-mlbottle to which a specified amount of sodium sulfate, as dehydro-genizing agent, and 3.0 ml of hexane were added. A 1.0-l aliquotof the treated sample was subjected to gas chromatography toquantify ME content.

Results

Difference of deduced amino acid sequences of ProROL genes from R. oryzae IFO4697 and R. oryzae DSM853

Since ROL from R. oryzae IFO4697 was found to bevery effective for biodiesel production (Kaieda et al.1999), its gene was cloned and the DNA sequence deter-mined. Comparison of the deduced peptide sequences ofProROL genes from R. oryzae IFO4697 and R. oryzaeDSM853 (Beer et al. 1998) shows six amino-acid re-placements. Four were in the pro-region, namely, I30N,S39A, Y67N and G111S, and two were in the mature re-gion, namely, N250H and L369I. Two rProROL expres-sion systems under the control of either the GAPDH pro-moter or UPR-ICL, the 5-upstream region of the isoci-trate lyase gene of Candida tropicalis, were constructed(Fig. 1). Since preliminary overexpression experimentsshowed that the intracellular activity of R. oryzaeIFO4697 lipase was much higher than that of DSM853lipase (data not shown), the former was used in the ex-periments described below.

Constitutive and inducible intracellular production of rProROL from R. oryzae IFO4697

The effect of expression systems on intracellular rPro-ROL productivity was investigated using a constitutiveexpression system with the GAPDH promoter and induc-ible expression system with UPR-ICL. Figure 2 showsthe time courses of intracellular lipase activity in differ-ent expression systems in flask-cultivated yeast cells. Inall cases, lipase activity was not detected in the culturesupernatant. In the constitutive expression system withthe GAPDH promoter, the intracellular lipase activity of yeast strain MT81 harboring pWGP3ProROL(MT81/pWGP3ProROL) reached 99.3 IU/l at 225 h. Inthe inducible expression system with UPR-ICL, the in-tracellular lipase activity of MT81/pWI3ProROL in-creased rapidly as soon as glucose was exhausted andreached 350.6 IU/l at 175 h.

To more tightly regulate ProROL expression, the genewas intracellularly expressed during two-stage cultiva-tion of yeast cells, i.e. cell growth in SDC medium with2.0% glucose and induction in SDC medium with 0.5%glucose (Fig. 3). Using this method, rProROL was pro-duced rapidly after induction, and intracellular lipase ac-tivity reached 474.5 IU/l after 98 h of cultivation.

Western blot analysis of intracellular rProROL

Since a relatively large amount of active rProROL canaccumulate inside the yeast cells, the molecular statesand production levels of rProROL in each expressionsystem were analyzed. Figure 4 shows the Western blot

517

Fig. 2 Comparison of intracellular lipase activity of MT81/pWGP3ProROL and that of MT81/pWI3ProROL. Cell density(open symbols) and intracellular lipase activity (solid symbols) of MT81/pWGP3ProROL (, ) and MT81/pWI3ProROL (, ) are shown. Cultivation was carried out in SDC medium at30 C with an initial glucose concentration of 0.5%

analysis of proteins prepared from soluble cell homoge-nates. Intracellular rProROL was observed at a positionof approximately 46 kDa, which is the predicted molecu-lar weight of the 11.6-kDa pro-sequence and the 35-kDamature region of ROL in all soluble cell-homogenatefractions.

The amount of rProROL was measured with NIH im-age (version 1.62). The amounts of whole proteins cross-reacting with anti-ROL antibody correlated well with thelipase activity of the homogenate (data not shown). Theproduction level of rProROL in the inducible UPR-ICLsystem (lane 2) was higher than that of the constitutive

GAPDH promoter system (lane 1), although degradationbands of rProROL were observed. Furthermore, rPro-ROL production level was highest when two-stage culti-vation was carried out (lane 3).

Effect of cell permeabilization on methanolysis usingwhole-cell biocatalyst

In the methanolysis of plant oil, reaction substrates suchas methanol and triglyceride must permeate both the cellwall and the cell membrane. Therefore, whole-cell bio-catalysts were prepared by permeabilizing yeast cells.Yeast cells harboring plasmid pWI3ProROL were grownin two-stage cultivation and permeabilized by freeze-thawing and air-drying. Figure 5 shows the effect of cellpermeabilization on methanolysis using whole yeastcells as biocatalysts. The reaction profile using free en-zyme with the same activity as that inside the cells isalso shown. In the methanolysis reaction using free en-zyme, the ME content reached 80 wt% after a 72-h reac-tion; during this time methanol was added twice. In air-dried cells, ME content reached 71 wt% when methanolwas added twice during the 165-h reaction. Comparisonof these two reaction profiles indicated that the perme-ability of the cell membrane increased significantly byair-drying, and that air-dried cells possessed a sufficient-ly high reaction rate. The reaction rate of air-dried cellswas much higher than that of freeze-thawed cells. In thecase of non-treated cells, ME content was less than 1%even after a 232-h reaction.

518

Fig. 3 Two-stage cultivation for efficient intracellular expressionof rProROL in MT81/pWI3ProROL. Cell density () and intra-cellular lipase activity () are shown. The yeast cells were grownin SDC medium containing 2.0% glucose, harvested after 22 h ofcultivation (dashed line) and transferred to freshly prepared SDCmedium containing 0.5% glucose for induction of rProROL. Culti-vation was carried out at 30 C

Fig. 4 Comparison of intracellularly produced rProROL by im-munoblotting. In lanes 13, soluble cell homogenate containing20 g protein from Saccharomyces cerevisiae MT81 harboringeach plasmid was applied. Lane 1 MT81/pWGP3ProROL (175-hcultivation), lane 2 MT81/pWI3ProROL (175-h cultivation), lane3 two-stage cultivation of MT81/pWI3ProROL (98-h cultivation)

Fig. 5 Time course of methanolysis using yeast whole cells. Theweight percentages of methyl esters (MEs) in the reaction mixtureare plotted against the reaction time. Arrows show the time for theaddition of 0.35 g ethanol. Non-treated cells, freeze-thawedcells, air-dried cells. The reaction profile using free enzymewith the same activity as that inside the cells is also shown (opendiamonds)

Discussion

In the present study, an intracellular overproductionsystem of active lipase (Fig. 1) was developed in order toobtain whole-cell biocatalysts with high lipase activity.Since a previous study showed that rProROL has highhydrolysis activity and higher thermostability thanr28ROL, a lipase from R. oryzae that has 28 amino acidsof the prosequence (Takahashi et al. 1999), intracellularovereproduction of rProROL was investigated. Two dif-ferent promoter systems were tested to obtain high activ-ity whole-cell biocatalysts. The promoter system signifi-cantly affects the intracellular production of active rPro-ROL. From the results presented in Fig. 2, strong over-expression of ProROL using the constitutive GAPDHpromoter system reduced the productivity of intracellularrProROL. Furthermore, no remarkable intracellular rPro-ROL activity was observed in the inducible UPR-ICLsystem using sodium acetate or ethanol as sole carbonsource (data not shown), although these carbon sourcesare thought to strongly induce the protein production(Umemura et al. 1995; Kanai et al. 1996). Since rPro-ROL was not observed in the insoluble fraction in allcases (data not shown), overproduction during thegrowth phase probably caused its proteolytic degrada-tion. In addition, overproduction of rProROL duringgrowth inhibited the cell growth (data not shown), prob-ably because of the toxicity of ProROL, which has phos-pholipase activity (Beer et al. 1996). By contrast, a suffi-ciently large amount of active rProROL accumulatedduring cultivation of cells containing the inducible UPR-ICL system using glucose. Furthermore, higher intracel-lular lipase activity was obtained by two-stage cultiva-tion, which leads to the induction at the late-logarithmicgrowth phase and more strict regulation of rProROL pro-duction (Fig. 3). Therefore intracellular overproductionof rProROL in late-logarithmic phase may improve cellgrowth and suppress its proteolytic degradation. In thiscase, intercellular lipase activity reached 474.5 IU/l.

Yeast cells containing high lipase activity were usedas the whole-cell biocatalysts for methanolysis in a sol-vent-free system. Various methods of cell permeabilizat-ion to construct whole-cell biocatalysts have been report-ed (Felix 1982; Gowda et al. 1991; Seip and Cosimo1992; Inoue et al. 1994; Liu et al. 1999; Kondo et al.2000). In our previous study, permeabilization with 40%isopropyl alcohol was found to significantly improve theactivity of yeast whole-cell biocatalysts (Liu et al. 1999;Kondo et al. 2000). However, in the present study,freeze-thawing and air-drying were used to prepare yeastwhole-cell biocatalysts, since ROL is inactivated by al-cohol at such a high concentration (data not shown). Thepermeabilized cells that contained rProROL, and espe-cially those which had been air-dried, could interact withthe substrates and catalyze methanolysis. In addition, li-pase activity was not detected from the water phase cor-rected after the reaction, indicating that ROL was firmlytrapped inside the yeast cells. Comparison of the reactionrates of air-dried cells with that of free enzyme indicates

that the barrier for the diffusion of substrates and prod-ucts was reduced significantly by permeabilization.Since a large amount of whole-cell biocatalysts was easi-ly prepared by cultivation and are regarded as a kind ofself-immobilized enzyme, the permeabilized whole-cellbiocatalysts offer several advantages regarding their in-dustrial application. Further improvement of intracellularproduction levels of active lipase will increase the reac-tion rate of whole-cell biocatalysts.

The above results demonstrate that yeast whole-cellbiocatalysts, which intracellularly overproduced rPro-ROL, efficiently catalyzed methanolysis in a solvent-freereaction system. This is the first example of the accumu-lation of active lipase, which is secreted in the R. oryzaewild-type strain, in yeast cells, and its utilization inwhole-cell biocatalysts for an industrially important re-action. This whole-cell biocatalyst with high lipase ac-tivity may be applicable to many other reaction systemscatalyzed by lipases.

References

Beer HD, Wohlfahrt G, Shmid RD, McCarthy JEG (1996) The fold-ing and activity of the extracellular lipase of Rhizopus oryzaeare modulated by a prosequence. Biochem J 319:351359

Beer HD, McCarthy JEG, Bornscheuer UT, Schmid RD (1998)Cloning, expression, characterization and role of the leader se-quence of a lipase from Rhizopus oryzae. Biochem BiophysActa 1399:173180

Cvengros J, Cvengrosava Z (1994) Quality control of rapeseed oilmethyl esters by determination of acyl composition. JAOCS71:13491352

Felix H (1982) Permeabilized cells. Anal Biochem 120:211234Gowda LR, Bachhwat N, Bhat SG (1991) Permeabilization of

bakers' yeast by cetyltrimethylammonium bromide for intra-cellular enzyme catalysis. Enzyme Microb Technol 13:154157

Inoue Y, Tsuchiyama H, Kimura A. (1994) Continuous productionof S-lactoylglutathione by immobilized Hansenula mrakiicells. Process Biochem 29: 271275

Kaieda M, Samukawa T, Matsumoto T, Ban K, Kondo A, ShimadaY, Noda H, Nomoto F, Ohtuka K, Izumoto E, Fukuda H (1999)Biodiesel fuel production from plant oil catalyzed by Rhizopusoryzae lipase in a water-containing system without an organicsolvent. J Biosci Bioeng 88:627631

Kanai T, Atomi H, Umemura K, Ueno H, Teranishi Y, Ueda M,Tanaka A (1996) A novel heterologous gene expressionsystem in Saccharomyces cerevisiae using the isocitrate lyasegene promoter from Candida tropicalis. Appl Microbiol Bio-technol 44:759765

Kondo A, Liu Y, Furuta M, Fujita Y, Matsumoto T, Fukuda H(2000) Preparation of high activity whole cell biocatalyst bypermeabilization of recombinant flocculent yeast with alcohol.Enzyme Microb Technol 27:806811

Linco YY, Lamsa M, Wu X, Uosukainen E, Seppala J, Linko P(1998) Biodegradable products by lipase biocatalysis. J Bio-technol 66:4150

Liu Y, Kondo A, Ohkawa H, Shiota N, Fukuda H (1998) Biocon-version using immobilized recombinant flocculent yeast cellscarrying a fused enzyme gene in an intelligent bioreactor.Biochem Eng J 2:229235

Liu Y, Hama H, Fujita Y, Kondo A, Inoue Y, Kimura A, Fukuda H(1999) Production of S-lactoylglutathione by high activitywhole cell biocatalysts prepared by permeabilization of re-combinant Saccharomyces cerevisiae with alcohols. Bio-technol Bioeng 64:5460

519

Masujuki HH, Sapuan SM (1995) Palm oil methyl esters as lu-bricant additive in a small diesel engine. JAOCS 72:609612

Nelson LA, Foglia TA, Marmer WN (1996) Lipase-catalyzed pro-duction of biodiesel. JAOCS 73:11911195

Seip JE, Cosimo RD (1992) Optimization of accessible catalaseactivity in polyacrylamide gel-immobilized Saccharomycescerevisiae. Biotechnol Bioeng 40:638642

Shimada Y, Watanabe Y, Samukawa T, Sugihara A, Noda H, Fukuda H, Tominaga Y (1999) Conversion of plant oil to bio-diesel using immobilized Candida antarctica lipase. JAOCS76:789793

Tajima M, Nogi Y, Fukasawa T (1985) Primary structure of theSaccharomyces cerevisiae GAL7 gene. Yeast 1:6777

Takahashi S, Ueda M, Atomi H, Beer HD, Bornscheuer UT, Schmid RD, Tanaka A (1998) Extracellular production of ac-tive Rhizopus oryzae lipase by Saccharomyces cerevisiae. JFerment Bioeng 86:164168

Takahashi S, Ueda M, Tanaka A (1999) Independent production oftwo molecular forms of a recombinant Rhizopus oryzae lipaseby KEX2-engineered strains of Saccharomyces cerevisiae.Appl Microbiol Biotechnol 52:53440

Umemura K, Atomi H, Kanai T, Teranishi Y, Ueda M, Tanaka A(1995) A novel promoter, derived from the isocitrate lyasegene of Candida tropicalis, inducible with acetate in Saccha-romyces cerevisiae. Appl Microbiol Biotechnol 43:489492

Varese R, Varese M (1996) Methyl ester biodiesel: opportunity ornecessity? INFORM 7:816824

520