wssv

Q8

Q1Q2

Q4

Q3

at SciVerse ScienceDirect

Fish & Shellfish Immunology xxx (2012) 1e13

12345678910111213141516171819202122232425262728293031323334353637383940414243444546474849505152535455

YFSIM2172_proof ■ 23 March 2012 ■ 1/13

Contents lists available

Fish & Shellfish Immunology

journal homepage: www.elsevier .com/locate / fs i

5657585960616263646566

Immune response of four dual-CRD C-type lectins to microbial challenges in giantfreshwater prawn Macrobrachium rosenbergii

Qian Ren a,b,c,*, Meng Li c, Jie Du a,b, Chi-Yu Zhang c, Wen Wang a,b,**

a Jiangsu Key Laboratory for Biodiversity & Biotechnology, College of Life Sciences, Nanjing Normal University, 1 Wenyuan Road, Nanjing 210046, PR Chinab Jiangsu Key Laboratory for Aquatic Crustacean Diseases, College of Life Sciences, Nanjing Normal University, 1 Wenyuan Road, Nanjing 210046, PR Chinac Institute of Life Sciences, Jiangsu University, Zhenjiang, Jiangsu, PR China

6768697071727374757677787980

a r t i c l e i n f o

Article history:Received 3 August 2011Received in revised form5 March 2012Accepted 6 March 2012Available online xxx

Keywords:LectinVibrioWSSVPositive selectionInnate immunityMacrobrachium rosenbergii

* Corresponding author. Institute of Life Sciences, JJiangsu, PR China. Tel./fax: þ86 511 88791923.** Corresponding author. Jiangsu Key Laboratory forCollege of Life Sciences, Nanjing Normal University210046, PR China. Tel.: þ86 25 85891955; fax: þ86 2

E-mail addresses: [email protected] (Q. Ren), njn

1050-4648/$ e see front matter � 2012 Elsevier Ltd.doi:10.1016/j.fsi.2012.03.009

818283848586

Please cite this article in press as: Ren Q, etprawn Macrobrachium rosenbergii, Fish & Sh

a b s t r a c t

C-type lectins (CTLs) are believed to play important roles in the innate immunity of invertebrates andserve as pattern recognition receptors, opsonins, or effector molecules. In this study, the full-lengthscDNA of 4 CTL genes from giant freshwater prawn Macrobrachium rosenbergii were cloned and desig-nated as MrLec1, MrLec2, MrLec3, and MrLec4. All of these 4 lectin cDNAs encode proteins with 2carbohydrate recognition domains (CRDs). While MrLec1, MrLec3, and MrLec4 had signal peptides, nosignal peptide was detected in MrLec2. Two carbohydrate recognition motifs within two CRDs of eachlectin were predicted (QPE, EPG in MrLec1; EPT, EPA in MrLec2; QPT, NPR in MrLec3; KPN, EPD inMrLec4). Phylogenetic analysis showed that MrLec4 belongs to group A whereas MrLec1, MrLec2, andMrLec3 belong to group B. Positive selection in dual-CRD lectins suggested their probable roles in innateimmunity, and positively selected induced amino acid diversity of lectins may confer their ability torecognize a broad range of microbes. The qRT-PCR analysis in adult prawns showed thatMrLec1 is mainlyexpressed in the hepatopancreas, gills, and stomach, MrLec2 and MrLec4 are mainly distributed in thehepatopancreas, and MrLec3 is mainly expressed in the hepatopancreas and stomach. Time-courseanalysis using qRT-PCR showed that MrLec1 to MrLec4 are all upregulated by the Vibrio anguillarumchallenge. MrLec1 is upregulated after 2, 12, and 24 h of white spot syndrome virus (WSSV) challenge.The expression ofMrLec2 increases after 12 and 24 h of WSSV challenge, and the transcript ofMrLec3 andMrLec4 are downregulated after 2 h of WSSV challenge. The results suggest the potential roles of dual-CRD lectins in the innate immunity of M. rosenbergii.

� 2012 Elsevier Ltd. All rights reserved.

8788
89 90919293949596979899
100101

1. Introduction

Macrobrachium rosenbergii, are invertebrates that do not haveadaptive immune systems. When attacked by foreign microbes, thespecies relies only on its innate immune system for defense [1].When foreign microbes come into contact with a host, host patternrecognition receptors (PRRs) recognize and bind pathogen-associated molecular patterns (PAMPs) on the surface of invadingmicroorganisms [2]. Over the years, many PRRs, such as C-typelectins (CTLs), galactoside-binding lectins, peptidoglycan recogni-tion proteins, thioester-containing proteins, Gram-negative binding

iangsu University, Zhenjiang,

Biodiversity & Biotechnology,, 1 Wenyuan Road, Nanjing5 [email protected] (W. Wang).

All rights reserved.

102103104105106107108

al., Immune response of fourellfish Immunology (2012), d

proteins, scavenger receptors, fibrinogen-like domain immuno-lectins, and Down syndrome cell adhesion molecules, have beenidentified [3,4].

Since the first lectin was identified in the seeds of Leguminosaein 1888, lectins have been found in nearly all living organisms [5].Because of their ability to bind terminal sugars of glycoproteins orglycolipids, lectins are considered to be appropriate candidates forpattern recognition receptors in innate immunity. Lectins areclassified into C-, L-, P-, I-, R-, and S-type lectins according to theirstructures and functions [6]. Lectins could also be classified asmannose-, fructose-, rhamnose-, and galactose-binding lectins [7].CTLs have been very well studied, and common structural features,such as CRD sequences, disulfide-bond positions, and calcium-binding sites, have been observed in them [8]. CTLs, in contrast toother lectins, are Ca2þ-dependent [9]. Proteins containing domainswith sequences similar to CTL domains (CTLDs/CRDs) also belong tothis family [10]. The CTL superfamily includes the selectin andcollectin subgroups. Selectins are involved in cell adhesion and

109110

dual-CRD C-type lectins to microbial challenges in giant freshwateroi:10.1016/j.fsi.2012.03.009

Delta:1_given name

Delta:1_surname

Delta:1_given name

Delta:1_surname

Delta:1_given name

mailto:[email protected]

mailto:[email protected]

www.sciencedirect.com/science/journal/10504648

http://www.elsevier.com/locate/fsi

http://dx.doi.org/10.1016/j.fsi.2012.03.009



Table 1Primer sequences used in this study.

Primers name Sequence (50e30)

MrLec1-F CGCTTGCCTTCGAGTTCACGTMrLec1-R CAGTAAGCAATGGTCGCCTACGGGAMrLec2-F TGTGAAGCACCCTTCAGGGCMrLec2-R GCCCAGGTCGTTGGCATCTTGTATCMrLec3-F TGCACAGACATTTTCGAAGMrLec3-R CCTGGTGTTGTTGTTTCATACGGCGMrLec4-F TGCCCAGCCTTCTTTCAAAATGMrLec4-R AGGATGAAGCCCCTTGAATGCCACAMrLec1-RT-F CACATCTTTGTGGATTGGTGGMrLec1-RT-R CTTGTATTATTGCAGGGGTCAMrLec2-RT-F GCAATGTGTGTCTCCTGGTCGMrLec2-RT-R GGTCGTTGGCATCTTGTATCTMrLec3-RT-F TCAAATGAGCTGTCCATCCCCMrLec3-RT-R TGAGCCACACCTGACTGCGTCMrLec4-RT-F CTAACAACGACACTGAGGCAAMrLec4-RT-R ACCGACATCCACAAAGAAAACMr-Actin F CCCAGAGCAAGAGAGGTAMr-Actin R GCGTATCCTTCGTAGATGGG30 RACE Outer Primer TACCGTCGTTCCACTAGTGATTTUPMLong CTAATACGACTCACTATAGGGCAAGCAGTG

GTATCAACGCAGAGTShort CTAATACGACTCACTATAGGGC

50-CDS Primer A T25VNSMARTer ⅡA oligo AAGCAGTGGTATCAACGCAGAGTACXXXXX30-CDS primer A AAGCAGTGGTATCAACGCAGAGTAC(T)30VN

X ¼ undisclosed base in the proprietary SMARTer oligo sequence.N ¼ A, C, G, or T; V ¼ A, G, or C.

Q. Ren et al. / Fish & Shellfish Immunology xxx (2012) 1e132

111112113114115116117118119120121122123124125126127128129130131132133134135136137138139140141142143144145146147148149150151152153154155156157158159160161162163164165166167168169170171172173174175

176177178179180181182183184185186187188189190191192193194195196197198199200201202203204205206207208209210211212213214215216217218219220221222223224225226227228229230231232233234235236237238239240


migration while collectins take part in the first line of defenseagainst invading microorganisms [11,12].

CTLs from invertebrates are abundant in amount, and theirfunctions are versatile. Approximately 183 CTLDs have been foundin Caenorhabditis elegans [13]. Four CTLs found in Manduca sextawere designated as immulectins. Immulectin-1 and Immulectin-2stimulate prophenoloxidase activation, and Immulectin-2, Immu-lectin-3 and Immulectin-4 are involved in encapsulation andmelanization [14e18].

In recent years, a number of CTLs have been reported in penaeidshrimp. A hepatopancreas-specific CTL with one CRD from Fen-neropenaeus chinensis was reported to have antimicrobial activity[19]. FcLec3 could interact with VP28 of white spot syndrome virus(WSSV), and FcLec4 facilitates the clearance of Vibrio anguillarum;both are single CRD-containing lectins [20,21]. FcLec5 and FcLec2,both with two CRDs each, may act as PRRs via binding to bacteria[22,23]. Three novel MjLecs from Marsupenaeus japonicus may actwith PRRs by recognizing and binding to WSSV [24]. PmAV has oneCRD. While it does not appear to act with a PRR, it could act as anintermediate during antiviral immune defense [25].

Studies on shrimp lectins are extensive and their roles in anti-Vibrio or anti-WSSV immune response were reported. However, inthe giant freshwater prawn M. rosenbergii, the activity of lectinsagainst Vibrio or WSSV is not known. There is only one paper onlectin from M. rosenbergii, and it reported that purified lectin fromM. rosenbergii could regulate the production of oxidative radicalsand function as potential cytotoxins as well as microbiocides [26].WSSV induced white spot syndrome is thought to be one of themost serious viral diseases of shrimp. However, it was reported thatthe giant freshwater prawn M. rosenbergii had a high tolerance toWSSV [27]. The mechanism by which M. rosenbergii is resistant toWSSV infections is not clear. Vibriosis can result in high mortalityrates of larval of M. rosenbergii [28]. So, it is necessary to study theanti-Vibrio or anti-WSSV immune response in M. rosenbergii.

C-type lectins were reported to be involved in the invertebrateimmune responses. In the present study, four different cDNAsencoding for lectin genes (MrLec1 to MrLec4) from M. rosenbergiiwere cloned for the first time. Their tissue distributions andexpression patterns in the hepatopancreas upon V. anguillarum orWSSV challenge were also investigated. Our study providespreliminary results and indicates the probable roles of dual-CRDlectins in the innate immunity of M. rosenbergii. Positive selectionin the dual-CRD lectins also suggested their probable roles in innateimmunity.

2. Materials and methods

2.1. Immune challenge of M. rosenbergii, collection of hemocytesand other tissues

Adult M. rosenbergii (about 15 g each) were purchased from anaquaculture market in Zhenjiang, Jiangsu Province, China. Theprawns were acclimatized under laboratory condition in thefreshwater tanks at room temperature (25 �C) and were dividedinto a control group and two experimental groups, namely,V. anguillarum and WSSV-challenged groups. In the V. anguillarumgroup (20 prawns), about 3 � 107 cells were injected into theabdominal segment of M. rosenbergii using a 50 ml syringe. In theWSSV-challenged group (20 prawns), about 3.2 � 107 copies ofWSSV particles were injected into each prawn. The methods ofpreparation and quantification of the viral inoculums wereaccording to a previous paper [29]. Hemolymph was collected fromhealthy prawns (untreated) by mixing 1/10 volume anticoagulantbuffer (0.14 M NaCl, 0.1 M glucose, 30 mM trisodium citrate, 26 mMcitric acid, and 10 mM EDTA, pH 4.6). The hemolymph was

Please cite this article in press as: Ren Q, et al., Immune response of fourprawn Macrobrachium rosenbergii, Fish & Shellfish Immunology (2012), d

centrifuged at 800� g for 10 min (4 �C) to isolate the hemocytes.Other tissues (i.e., heart, hepatopancreas, gills, stomach, andintestine) were also collected from healthy prawns for RNAextraction. The hepatopancreas of prawns challenged withV. anguillarum or WSSV at 2, 6, 12, and 24 h (3 prawns in each time)were also collected for RNA extraction.

2.2. Total RNA isolation and cDNA synthesis

Total RNA was extracted from the above-mentioned tissuesusing an RNApure High-purity Total RNA Rapid Extraction Kit(Spin-column; Bioteke, Beijing, China) according to the manufac-turer’s protocol. First-strand cDNA was synthesized for qRT-PCRanalysis using an M-MLV First Strand Kit (Invitrogen, Shanghai,China) with the primer oligo (dT)20.

2.3. Cloning of full-length cDNA encoding 4 lectin genes

The 30 fragments with poly A of MrLec2eMrLec4 were clonedusing 30-Full RACE Core Set Ver. 2.0 (Takara, Dalian, China). The first-strand cDNA was synthesized according to the manufacturer’sprotocol using 30 RACE Adaptor. The 30 ends of MrLec2 to MrLec4were all cloned from the hepatopancreas using gene-specificprimers (MrLec2-F, MrLec3-F, and MrLec4-F) and 30 RACE OuterPrimer. The 50 fragment of MrLec1eMrLec4 and the 30 fragment ofMrLec1 were obtained using a Clontech SMARTer� RACE cDNAAmplification Kit from TAKARA (Dalian, China). The first-strandcDNA synthesis was performed following the manufacture’sinstruction using 50-CDS Primer A and SMARTer ⅡA oligo (50-RACE-Ready cDNA) and 30-CDS Primer A (30-RACE-Ready cDNA). The 50

ends of MrLec1 to MrLec4 and the 30 end of MrLec1 were amplifiedusing gene-specific primers (MrLec1-R to MrLec4-R and MrLec1-F)and a Universal Primer A Mix (UPM) according to the followingprocedures: 5 cycles at 94 �C for 30 s and 72 �C for 2min; 5 cycles at94 �C for 30 s, 70 �C for 30 s, and 72 �C for 2 min; and 20 cycles at94 �C for 30 s, 68 �C for 30 s, and 72 �C for 2 min (in the Biotekemachine, the reaction was prepared) using a Clontech Advantage 2


Fig. 1. Nucleotide and deduced amino acid sequences of four lectins cDNAs (A: MrLec1; B: MrLec2; C: MrLec3; D: MrLec4) with two CRDs from M. rosenbergii. Signal peptides andCRDs of MrLec1eMrLec4 are shaded and motifs related to ligand-binding specificity within the CRDs are boxed.

Q. Ren et al. / Fish & Shellfish Immunology xxx (2012) 1e13 3

241242243244245246247248249250251252253254255256257258259260261262263264265266267268269270271272273274275276277278279280281282283284285286287288289290291292293294295296297298299300301302303304305

306307308309310311312313314315316317318319320321322323324325326327328329330331332333334335336337338339340341342343344345346347348349350351352353354355356357358359360361362363364365366367368369370


PCR Kit from Takara (Dalian, China). The full length ofMrLec1eMrLec4 cDNAs were obtained by overlapping the 50 and 30

fragments. All gene-specific primerswere designed according to thesequences obtained via transcriptome sequencing using Solexamethods. The EST sequences of these 4 lectin genes were obtainedfrom the hepatopancreas fromM. rosenbergiiusing Illumina’s SolexaSequencing Technology performed by Chinese National HumanGenome Center at Shanghai. All primers are shown in Table 1.


2.4. Sequence and phylogenetic analyses

Nucleotide sequence homology and comparisons of the deducedamino acid sequence were accomplished using the online programBLAST (http://blast.ncbi.nlm.nih.gov/Blast.cgi). cDNA translationand deduced protein predictionwere achieved with ExPASy (http://www.au.expasy.org/), whereas signal sequence and domainprediction utilized SMART (http://www.smart.embl-heidelberg.


http://blast.ncbi.nlm.nih.gov/Blast.cgi

http://www.au.expasy.org/

http://www.au.expasy.org/

http://www.smart.embl-heidelberg.de/

Fig. 1. (continued).


371372373374375376377378379380381382383384385386387388389390391392393394395396397398399400401402403404405406407408409410411412413414415416417418419420421422423424425426427428429430431432433434435

436437438439440441442443444445446447448449450451452453454455456457458459460461462463464465466467468469470471472473474475476477478479480481482483484485486487488489490491


de/). MEGA 4.0 and GENDOC were used for multiple alignments ofdual-CRDs lectins from M. rosenbergii. MEGA 4.0 was also used toconstruct a phylogenetic tree [30].

492493494495496497498499500

2.5. Molecular evolutionary analyses

The CODEML program implemented in the PAML package [31]was used to test for variations in selective pressures measured asdN/dS per codon (u) across lineages of CTL genes with two CRDsand single CRD-containing lectin genes from shrimp. Likelihoodestimates under the assumption of a unique u ratio for all treebranches (Model 0) were compared to estimates from a free-ratio


model (variable u among branches): M0 versus M3, M1a versusM2a and M7 versus M8. A likelihood ratio test was performed bymultiplying the difference between log likelihood scores obtainedunder each model twice and comparing the result against a c2

distribution with degrees of freedom equal to the difference in thenumber of parameters estimated in each model [32,33].

2.6. Tissue distribution and expression pattern analysis ofMrLec1�MrLec4 upon Vibrio or WSSV challenge

The tissue distribution of MrLec1eMrLec4 at mRNA level in thehemocytes, heart, hepatopancreas, gills, stomach, and intestine was


http://www.smart.embl-heidelberg.de/



501502503504505506507508509510511512513514515516517518519520521522523524525526527528529530531532533534535536537538539540541542543544545546547548549550551552553554555556557558559560561562563564565

566567568569570571572573574575576577578579580581582583584585586587588589590591592593594595596597598599600601602603604605606607608609610611612613614615616617618619620621622623624625626627628629630


analyzed using qRT-PCR methods. The primers are listed in Table 1(MrLec1-RT-F,MrLec1-RT-R;MrLec2-RT-F,MrLec2-RT-R;MrLec3-RT-F, MrLec3-RT-R; MrLec4-RT-F, MrLec4-RT-R). Time-course analysisof MrLec1�MrLec4 in the hepatopancreas of M. rosenbergii


challenged with V. anguillarum or WSSV at 0, 2, 6, 12, and 24 h wasperformed using qRT-PCR methods with primers identical to thoseused during tissue distribution analysis. A 2 � SYBR real time PCRpremixture (Bioteke, Beijing, China) was used in the qRT-PCR




631632633634635636637638639640641642643644645646647648649650651652653654655656657658659660661662663664665666667668669670671672673674675676677678679680681682683684685686687688689690691692693694695

696697698699700701702703704705706707708709710711712713714715716717718719720721722723724725726727728729730731732733734735736737738739740741742743744745746747748749750751752753754755756757758759760


experiment according to the manufacturer’s instructions withStratagene MX300P. Details of the methods were in accordancewith a previously published paper [34]. b-actin was also amplifiedfor internal standardization with the primers Mr-Actin F and Mr-


Actin R. All samples were repeated in triplicate in the qRT-PCRanalysis. The data were calculated using 2�DDCt methods [35] andsubjected to statistical analysis. Unpaired sample t-test was con-ducted, and differences were considered significant if P < 0.05.


5


761762763764765766767768769770771772773774775776777778779780781782783784785786787788789790791792793794795796797798799800801802803804805806807808809810811812813814815816817818819820821822823824825

826827828829830831832833834835836837838839840841842843844845846847848849850851852853854855856857858859860


3. Results and discussion

3.1. Cloning of MrLec1eMrLec4 cDNA from M. rosenbergii

The full lengths of 4 different cDNAs of lectins (MrLec1eMrLec4)with 2 CRD domains from M. rosenbergii were obtained from thehepatopancreas (Fig. 1). The full length of MrLec1 is 1378 bp,including a 27 bp 50 untranslated region (UTR), a 969 bp openreading frame (ORF) encoding a protein of 322 amino acids, anda 382 bp 30 UTR (GenBank Accession No.: JQ349147). The fulllengths of MrLec2 (JQ349148), MrLec3 (JQ349149), and MrLec4(JQ349150) have 1217, 1419, and 1466 bp, respectively. MrLec2,MrLec3, and MrLec4 proteins have 317, 352, and 330 amino acids,respectively. All these four lectins have two CRDs (Fig. 1). Shrimplectins with two CRDs have been found in F. chinensis [22,23,36],Fenneropenaeus merguiensis [37], Penaeus monodon [38], and Lito-penaeus vannamei [39]. MrLec1 had a QPE and EPG motif, MrLec2had an EPT and EPA motif, MrLec3 had a QPT and NPR motif, andMrLec4 had a KPN and EPD motif. Most C-type lectins have eitheran EPN for mannose binding or a QPD motif for galactose binding[10]. The altered motif from EPN to EPQ of the CRD2 of FcLec5 doesnot show monosaccharide-binding activity [22]. Although themotif of Cf-Lec2 is altered from EPN to EPD, it could still bind tomannose [40]. Most sugar-binding motifs of MrLec1 to MrLec4 arenot EPN or QPD, which may indicate their different sugar-bindingactivities. MrLec1, MrLec3, and MrLec4 all have a signal peptide atthe C-terminal, but MrLec2 does not. No signal peptide could bepredicted in EsCTLDcp-1 from Eriocheir sinensis; thus, it wasbelieved to be a non-secretory protein. EsCTLDcp-2 was predictedto be a secretory protein with a signal peptide [41]. MrLec2 may bea non-secretory lectin, whereas MrLec1, MrLec3, and MrLec4 maybe secretory lectins. All CRDs of MrLec1eMrLec4 had six cysteines,and the cysteine pattern of the first CRD of MrLec1eMrLec4 wasfound to be as follows: MrLec1, C-X10-C-X17-C-X77-C-X15-C-X8-C;MrLec2 and MrLec3, C-X10-C-X17-C-X79-C-X15-C-X7-C; MrLec4, C-

Fig. 2. Multiple alignments of protein sequences of MrLec1eMrLec4


X10-C-X17-C-X76-C-X15-C-X7-C. The cysteine pattern of the secondCRD of MrLec1eMrLec3 was C-X10-C-X17-C-X77-C-X15-C-X7-C, andit was C-X10-C-X17-C-X82-C-X15-C-X7-C for MrLec4. Two CRDs-containing lectins from shrimp have similar cysteine patterns[22,23]. However, a single domain lectin from F. chinensiswas foundto have a different cysteine pattern: C-X11-C-X30-C-X61-C-X15-C-X7-C. An additional disulfide bridge could be found in a lectin fromL. vannamei [42]. The CRD1 and CRD2 of MrLec1 had 134 and 133amino acids, respectively, the CRD1 and CRD2 of MrLec2 had 135and 133 amino acids, respectively, the CRD1 and CRD2 of MrLec3had 135 and 133 amino acids, respectively, and the CRD1 and CRD2of MrLec4 had 132 and 138 amino acids, respectively. The lengths ofthe two CRDs in each lectin (MrLec1-MrLec3) from M. rosenbergiiwere nearly the same, except for MrLec4, which had CRD1 andCRD2 that differed in length. As well, the lengths of the two CRDs ineach dual-CRD-containing CTL from shrimp were nearly the same.In contrast, the lengths of the two CRDs in Bombyx mori lectinswere different. The N-terminal CRD was shorter in length, whereasthe C-terminal was longer. The short form had four cysteines whilethe long form had six [43]. The different lengths of CRDs ofM. rosenbergiimainly result from the different numbers of residuesbetween the third and fourth cysteines. Although the four lectinshad two CRDs, multiple alignments of MrLec1�MrLec4 showedthat their amino acid sequences were very diverse (Fig. 2). Thisfinding suggests their diverse roles in the innate immunity ofM. rosenbergii. Multiple-alignment findings showed that the Qresidue was generally located at the left side of the carbohydraterecognition motif and the G residue was generally located at theright side of the carbohydrate recognition motif (Fig. 2). The aminoacids located upstream and downstream of the carbohydraterecognition motif of CRD1 of MrLec4 were Y and N, which is anexception (Fig. 2). In FcLec5 and FcLec2 and FmLC, these two resi-dues are Q and N for CRD1 and Q and G for CRD2 [22,23,37]. Q

BLAST P analysis showed that MrLec1 shared 28% identity withCTLs from F. merguiensis and 27% identity with CTL 5 from

. The CRD1 and CRD2 domains are marked in different colors.

861862863864865866867868869870871872873874875876877878879880881882883884885886887888889890


Q6

Fig. 3. Multiple alignments of MrLec1eMrLec4 with other shrimp lectins having two CRDs. The GenBank accession numbers of these two CRD-containing lectins can be seen inFig. 4.

Table 2Lectins in other shrimps used in the evolutionary analysis.

Species Accessionnumber

CRD1/CRD2 length(aa residues)

CRD

Litopenaeus vannamei DQ871245.1 134/136 2Fenneropenaeus chinensis EU834290.1 134/134 2F. chinensis EU834289.1 134/134 2Fenneropenaeus merguiensis FJ751773.1 134/134 2F. chinensis AY871270.1 123/123 2P. monodon DQ871244.1 134/134 2Marsupenaeus japonicus GQ354209.1 131/0 1P. monodon AY302750.1 134/0 1F. chinensis EU834293.1 174/0 1F. chinensis EU834292.1 130/0 1F. chinensis EU834291.1 144/0 1F. chinensis DQ167572.1 131/0 1L. vannamei EF583939.1 131/0 1P. monodon DQ078266.1 123/0 1


891892893894895896897898899900901902903904905906907908909910911912913914915916917918919920921922923924925926927928929930931932933934935936937938939940941942943944945946947948949950951952953954955

956957958959960961962963964965966967968969970971972973974975976977978979980981982983984985986987988989990991992993994995996997998999

100010011002100310041005100610071008100910101011101210131014101510161017101810191020


F. Chinensis and CTL from L. vannamei. MrLec2 shared 32% identitywith CTL from L. vannamei, and 30% identity with Penaeus semi-sulcatus and F. merguiensis. MrLec3 shared 32% identity with CTLfrom F. merguiensis and 31% identity with CTL from P. monodon.MrLec4 shared 38% identity with CTL 5 from F. chinensis and 35%identity with CTL from L. vannamei. Multiple alignments showedthat the length of FcLec was the shortest, FcLec only had 287 aminoacids, and the lengths of LvLec andMrLec3 were the longest (Fig. 3).Multiple alignments also showed that a conserved motif of NDexisting in these shrimp lectins was important for Ca2þ binding(Fig. 3). However, only a D residue in MrLec1, MrLec3, and MrLec4could be found. The conserved motif or residue did not exist inMrLec2. It could be speculated that MrLec2 cannot bind Ca2þ.MrLec2 had a WIG motif in the CRD1 domain located at its N-terminal. It has been reported that many membrane-binding lec-tins contain WIG motifs [41]. Recombinant FcLec5 and FcLec2 havebeen reported to bind to microorganisms in a Ca2þ-independentmanner [22,23]. Hence, it could be speculated thatMrLec2 serves asa receptor, and could bind bacteria in a Ca2þ-independent manner.It was reported that the agglutination function of lectins was Ca2þ-dependent [22,23]. MrLec1, MrLec3, and MrLec4 had signalpeptides and a D residue for binding Ca2þ. Thus, it could be spec-ulated that these three lectins may agglutinate microorganisms inthe hemolymph (Table 2).


3.2. Evolutionary analysis of shrimp C-type lectin genes with one ortwo CRDs

Positive selection among the shrimp lectin genes was tested bythe site model implemented in PAML4. The lectin genes with twoCRDs were found to have undergone positive selection (Table 3).


Table 3Evolutionary analysis of C-type lectin genes with two CRD domains from shrimp and prawns. Q7

Model Model code lnL Estimates of parametersa 2Dl PSSb

Site-model M0 (one-ratio) �7636.535738 u ¼ 0.26031 395.61P < 0.01

N/AM3 (discrete) �7438.726909 p0 ¼ 0.21775, p1 ¼ 0.61179 (p2 ¼ 0.17047), u0 ¼ 0.3059,

u1 ¼ 0.27917, u2 ¼ 1.7377115E 16P** 29D 39A 52K 56A71L 79S 100P* 116S* 127S**130A 131I* 145S** 148V*159 M 173 A* 197 Q** 208 A*229 Y** 231 G 237 N** 244 T*256 S*

M1a (Nearly Neutral) �7493.070671 p0 ¼ 0.47955 (p1 ¼ 0.52045) 8.27P < 0.05

N/AM2a (Positive Selection) �7488.935932 p0 ¼ 0.45366, p1 ¼ 0.50388 (p2 ¼ 0.04247), u2 ¼ 5.68227 16P 145S 229YM7 (beta) �7443.944976 p ¼ 0.70979, q ¼ 1.26629 17.32

P < 0.01N/A

M8 (beta and w > 1) �7435.285592 p0 ¼ 0.91630 p ¼ 0. 81891, q ¼ 1.96352 (p1 ¼ 0. 08370)w ¼ 2.85929

16P 127S 145S* 229Y

Asterisks indicate significance: *P < 0.05; **P < 0.01. Predicted positively selected sites with posterior probabilities >85% are listed.a pi: proportion of sites. p, q: parameters of the distribution.b PSS Number of positively selected sites. Naïve empirical Bayes was used in M3 and Bayes empirical Bayes in M2a and M8.


10211022102310241025102610271028102910301031103210331034103510361037103810391040104110421043104410451046104710481049105010511052105310541055105610571058105910601061106210631064106510661067106810691070107110721073107410751076107710781079108010811082108310841085

108610871088108910901091109210931094109510961097109810991100110111021103110411051106110711081109111011111112111311141115111611171118111911201121112211231124


According to the LRT test, M2a, M3, and M8 fit the lectin genesbetter than M1a, M0, and M7. In the M3 model, 17% of the sites(w ¼ 1.74) was driven by positive selections. In the M2a and M8models, 4% (w¼ 5.68) and 8% (w¼ 2.86) of the sites were driven bypositive selections. Shrimp lectin genes with single CRDs do notundergo adaptive changes in their evolutionary histories (Table 4).Although the M3 model, which allows for the detection of evenslightly positive selections (w ¼ 3.0 for 2.6% of the sites, P < 0.01)was found to fit better, both the M2a and M8 models did not fit thedata in the LRT test. Positive selection is a distinctive character ofhost immune-related genes, and high variation in invertebrateimmunity genes was recently found [44]. Tachylectin-2, a 27-kDalectin from the Japanese horseshoe crab, is a protein with roles inthe recognition and agglutination of microbes [45]. Oculinatachylectin-2, which has a structure similar to crab tachylectin-2,has high amino acid diversity, and positive selection has beenobserved in it [43]. Taken together, positive selection in shrimpdual-CRD-containing lectins suggests their roles in shrimp innateimmunity and positive selection-induced amino acid diversity oflectins may confer their ability to recognize a broad range ofmicrobes (Table 3).

112511261127112811291130113111321133113411351136

3.3. Phylogenetic analysis of lectins from the crustaceans

Phylogenetic analysis showed that the lectins from the crusta-ceans could be divided into four groups (Fig. 4). Group A includedthe dual-CRD lectins FcLec5-1, PmLec, FmLec, LvLec, FcLec5, andMrLec4, as well as the single-CRD lectins MjLecE, FcLec1, andLvLect. In this group, the cysteine patterns of the three single-CRDlectins were different in that one extra cysteine (italicized) existedbetween the third and the fourth cysteines (C-X61-C-X15-C). GroupB included MrLec1 to MrLec3, as well as the two single-CRD lectins

Table 4Evolutionary analysis of single CRD-containing C-type lectin genes from shrimp and pra

Model Model code lnL Estimate

Site-model M0 (one-ratio) �3810.516627 u ¼ 0.13M3 (discrete) �3785.644181 p0 ¼ 0.1

u0 ¼ 0.0M1a (Nearly Neutral) �3805.579096 p0 ¼ 0.9M2a (Positive Selection) �3805.579096 p0 ¼ 0.9M7 (beta) �3789.629595 p ¼ 1.98M8 (beta and w > 1) �3787.900112 p0 ¼ 0.9

(p1 ¼ 0.0

Asterisks indicate significance: *P < 0.05; **P < 0.01. Predicted positively selected sites wa pi: proportion of sites. p, q: parameters of the distribution.b PSS Number of positively selected sites. Naïve empirical Bayes was used in M3 and


FcLec3 and PmAV, which had different cysteine patterns. Group Cincluded FcLec with two CRDs and PmLect with a single CRD. In thisgroup, the CRDs of FcLec and PmLect were only 123 amino acids inlength, which was relatively short. Group D included four single-CRD lectins. In this group, the region outside the CRDs of PcMBPand PlMBPwas rich in Gly, and the region outside the CRD of FcLec6was rich in Gln. These four single-CRD lectins also had differentcysteine patterns. The results of the phylogenetic analysis differedfrom those of a previous paper [22], wherein shrimp lectins con-taining two CRDs formed a subcluster. Shrimp single-CRD lectinswere also observed to form another group (Fig. 4).

3.4. Tissue distribution of MrLec1eMrLec4

Tissue distribution analysis using qRT-PCR methods showedthat MrLec1 were mainly expressed in hepatopancreas, gills andstomach. MrLec2 and MrLec4 could be detected mainly in thehepatopancreas, while the highest expression level ofMrLec3 couldbe detected in the hepatopancreas and it also could be detected inother tissue with relatively low expression level (Fig. 5). BothFcLec5 and FcLec2 are dual-CRD lectins from Chinese white shrimpand could be detected only in the hepatopancreas [22,23]. FmLcfrom banana shrimp, which has two CRDs, is expressed in thehepatopancreas [37]. The same is true for PmLT, which has twoCRDs [38]. Fclectin from Chinese white shrimp, which has twoCRDs, is expressed only in hemocytes [36]. In summary, mostshrimp dual-CRDs lectins are hepatopancreas-specific, althoughsome are hemocyte-specific. In the current work, MrLec2 andMrLec4 were mainly expressed in the hepatopancreas. MrLec1 hadnearly the same expression level in the hepatopancreas, gills, andstomach. AlthoughMrLec3was expressed at the highest level in thehepatopancreas, it could also be detected in other tissues. These

wns.

s of parametersa 2Dl PSSb

261 49.74P < 0.01

N/A7659, p1 ¼ 0.79756 (p2 ¼ 0.02585),3371, u1 ¼ 0.15169, u2 ¼ 3.04508

106A134T*

1453 (p1 ¼ 0.08547) 0P > 0.05

N/A1453, p1 ¼ 0.05512 (p2 ¼ 0.03034), u2 ¼ 1.00000 None711 q ¼ 10.84573 3.46

P > 0.05N/A

7609 p ¼ 2.13872 q ¼ 13.370832391) w ¼ 3.01799

None

ith posterior probabilities >85% are listed.

Bayes empirical Bayes in M2a and M8.

11371138113911401141114211431144114511461147114811491150


Fig. 4. Phylogenetic analysis of lectins fromM. rosenbergii with single-CRD lectins and lectins with two CRDs from shrimp. Lectins from M. rosenbergii are marked in red dots. LvLec(Litopenaeus vannamei, DQ871245.1), MjLecE (Marsupenaeus japonicus, GQ354209.1), PmAV (Penaeus monodon, AY302750.1), FcLec4, FcLec3, FcLec6, FcLec5, FcLec5-1, FcLec1, FcLec(Fenneropenaeus chinensis, EU834293.1; EU834292.1; EU834291.1; EU834290.1; EU834289.1; DQ167572.1; AY871270.1), FmLec (Fenneropenaeus merguiensis, FJ751773.1), LvLect(L. vannamei, EF583939.1), PmLec, PmLect (P. monodon, DQ871244.1; DQ078266.1), PcMBP (Procambarus clarkii, FJ410911.1), PlMBP (Pacifastacus leniusculus, AY861653.1). (Forinterpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)


11511152115311541155115611571158115911601161116211631164116511661167116811691170117111721173117411751176117711781179118011811182118311841185118611871188118911901191119211931194119511961197119811991200120112021203120412051206120712081209121012111212121312141215

12161217121812191220122112221223122412251226122712281229123012311232123312341235123612371238123912401241124212431244124512461247124812491250125112521253125412551256125712581259126012611262126312641265126612671268126912701271127212731274127512761277127812791280


four dual-CRD lectins from M. rosenbergii had very low expressionlevels in the hemocytes.

3.5. Response analysis of MrLec1eMrLec4 to pathogenic infection

Vibriosis can result in high mortality rates of larval ofM. rosenbergii and V. anguillarumwas also isolated from the larvae ofM. rosenbergii [28]. In order to investigate the probable roles ofMrLec1eMrLec4 in hepatopancreas under V. anguillarum challenge,the expressionpatternofMrLec1eMrLec4 in adultM. rosenbergiiwasstudied (Fig. 6). The qRT-PCR analysis showed that MrLec1 wasupregulated after 2 h of Vibrio challenge, reached the highest levelafter 6 h, and then decreased after 12 h. However, the expressionlevel of MrLec1 after 12 h was still higher than that of untreatedprawns.MrLec2was rapidlyupregulated to thehighest level after 2hof Vibrio challenge, and then decreased from 6 h to 24 h. However,the transcriptofMrLec2 after 6,12, and24hwas still higher than thatof the control. MrLec3 was initially upregulated after 2 h of Vibriochallenge, decreased after 6 h, increased again after 12 h, and finallydecreased after 24 h. The expression levels of MrLec3 after 2, 6, 12,and 24 h were higher than those of the control. MrLec4 had thehighest level after 2 h of Vibrio challenge, decreased after 6 h, andthen increased after 12 h (Fig. 6). The expression of dual-CRD lectinsfrom P. monodon remained unaffected 4 h after bacterial challenge[38]. A hepatopancreas-specific lectin from Chinese white shrimpwas also downregulated 2 h after the bacterial challenge, and thenupregulated from 6 h to 24 h post-challenge [19]. A CTL from Pro-cambarus clarkii was upregulated 48 h post-Vibrio challenge [46].Dual-CRD lectins from Chinese shrimp were also upregulated after2 h of Vibrio challenge [22,23]. A hemocyte-specific lectin with two


CRD domains from Chinese shrimp had the highest expression levelafter 72 h of bacterial challenge [36]. The protein sequences ofMrLec1 has VWGR motifs in the N-terminal CRD, similar to theNWGR motif of mammalian galectin-3, which is related to cellgrowth and apoptosis [47]. MrLec2 has an LWGVmotif similar to theNWGVmotif in immulectin-3 fromM. sexta. Immulectin-3 plays animportant role in hemocyte proliferation [48]. Thus, the upregula-tion of MrLec1 and MrLec2 expression by Vibrio challenge may berelated to hemocyte proliferation.

As we know, the giant freshwater prawn M. rosenbergii hada high tolerance to WSSV [27]. However, the mechanism by whichM. rosenbergii is resistant to WSSV infections is not clear up to date.In order to study the probable roles of MrLec1eMrLec4 in anti-WSSV immune response in M. rosenbergii, the expression patternof MrLec1eMrLec4 in hepatopancreas under WSSV challenge wasinvestigated (Fig. 7).MrLec1was upregulated after 2, 12, and 24 h ofWSSV challenge. The expression of MrLec2 also increased after 12and 24 h of WSSV challenge. The transcript of MrLec3 and MrLec4were downregulated after 2 h of WSSV challenge and turned up tonormal levels at 6 and 24 h. The PmAV gene encoding a lectin hasbeen reported to possess anti-WSSV defense [25]. The expressionlevels of LvLT initially decrease in the first 2 h of WSSV challenge[39], which is similar to our results forMrLec3 andMrLec4 upon theWSSV challenge. WSSV might protect itself from the host immunesystem attack by downregulating MrLec3 and MrLec4, which mayfunction as opsonins. Three novel lectins from M. japonicus haveanti-WSSV abilities [24]. FcLec3, a single-CRD lectin, could interactwith VP28, one major envelope protein of WSSV [21]. Our resultssuggest the roles of four dual-CRD lectins in giant freshwaterprawns in anti-WSSV innate immunity.


Fig. 5. qRT-PCR analysis of MrLec1eMrLec4 in the hemocytes, heart, hepatopancreas, gills, stomach, intestine, of M. rosenbergii.

Fig. 6. qRT-PCR analysis of MrLec1eMrLec4 in hepatopancreas of M. rosenbergii at 0, 2, 6, 12, and 24 h post-Vibrio challenge. Asterisks indicate significant differences (*P < 0.05,**P < 0.01, ***P < 0.001) compared with values of the control. Error bars represent �S.D. of three independent investigations.


12811282128312841285128612871288128912901291129212931294129512961297129812991300130113021303130413051306130713081309131013111312131313141315131613171318131913201321132213231324132513261327132813291330133113321333133413351336133713381339134013411342134313441345

13461347134813491350135113521353135413551356135713581359136013611362136313641365136613671368136913701371137213731374137513761377137813791380138113821383138413851386138713881389139013911392139313941395139613971398139914001401140214031404140514061407140814091410


Please cite this article in press as: Ren Q, et al., Immune response of four dual-CRD C-type lectins to microbial challenges in giant freshwaterprawn Macrobrachium rosenbergii, Fish & Shellfish Immunology (2012), doi:10.1016/j.fsi.2012.03.009

Fig. 7. qRT-PCR analysis of MrLec1eMrLec4 in hepatopancreas of M. rosenbergii 0, 2, 6, 12, and 24 h post-WSSV challenge. Asterisks indicate significant differences (*P < 0.05,**P < 0.01) compared with values of the control. Error bars represent �S.D. of three independent investigations.


14111412141314141415141614171418141914201421142214231424142514261427142814291430143114321433143414351436143714381439144014411442144314441445144614471448144914501451145214531454145514561457145814591460146114621463146414651466146714681469147014711472147314741475

14761477147814791480148114821483148414851486148714881489149014911492149314941495149614971498149915001501150215031504150515061507150815091510151115121513151415151516151715181519152015211522152315241525152615271528152915301531153215331534153515361537153815391540


Acknowledgments

The current study was supported by the National NaturalScience Foundation of China (Grant No. 31101926), the StartupScientific Research Fund from Jiangsu University for AdvancedProfessionals (Grant No. 10JDG122), the Open Project of Key Labo-ratory of Ministry of Education for Medicinal Resources, andNatural Pharmaceutical Chemistry of Shanxi Normal University(Grant No. MR&NPC2010001), and the Jiangsu Planned Projects forPostdoctoral Research Funds (Grant No. 1002011B) and ChinaPostdoctoral Science Foundation (20110491362).

References

[1] Loker ES, Adema CM, Zhang SM, Kepler TB. Invertebrate immune systemsenothomogeneous, not simple, not well understood. Immunol Rev 2004;198:10e24.

[2] Medzhitov R, Janeway Jr CA. Decoding the patterns of self and nonself by theinnate immune system. Science 2002;296:298e300.

[3] Christophides GK, Vlachou D, Kafatos FC. Comparative and functional geno-mics of the innate immune system in the malaria vector Anopheles gambiae.Immunol Rev 2004;198:127e48.

[4] Watson FL, Puttmann-Holgado R, Thomas F, Lamar DL, Hughes M, Kondo M,et al. Extensive diversity of Ig-superfamily proteins in the immune system ofinsects. Science 2005;309:1874e8.

[5] Sharon N, Lis H. History of lectins: from hemagglutinins to biological recog-nition molecules. Glycobiology 2004;14:53Re62R.

[6] Janeway Jr CA, Medzhitov R. Innate immune recognition. Annu Rev Immunol2002;20:197e216.

[7] Zhang Y, Qiu L, Song L, Zhang H, Zhao J, Wang L, et al. Cloning and charac-terization of a novel C-type lectin gene from shrimp Litopenaeus vannamei.Fish Shellfish Immunol 2009;26:183e92.

[8] Weis WI, Taylor ME, Drickamer K. The C-type lectin superfamily in theimmune system. Immunol Rev 1998;163:19e34.

[9] Drickamer K. Two distinct classes of carbohydrate-recognition domains inanimal lectins. J Biol Chem 1988;263:9557e60.

[10] Zelensky AN, Gready JE. The C-type lectin-like domain superfamily. FEBS J2005;272:6179e217.

[11] Epstein J, Eichbaum Q, Sheriff S, Ezekowitz RA. The collectins in innateimmunity. Curr Opin Immunol 1996;8:29e35.


[12] Hayashida K, Kume N, Minami M, Kita T. Lectin-like oxidized LDL receptor-1(LOX-1) supports adhesion of mononuclear leukocytes and a monocyte-likecell lineTHP-1cellsunder static andflowconditions. FEBSLett2002;511:133e8.

[13] Dodd RB, Drickamer K. Lectin-like proteins in model organisms: implicationsfor evolution of carbohydrate-binding activity. Glycobiology 2001;11:71Re9R.

[14] Yu XQ, Kanost MR. Immulectin-2, a lipopolysaccharide-specific lectin from aninsect, Manduca sexta, is induced in response to Gram-negative bacteria. J BiolChem 2000;275:37373e81.

[15] Yu XQ, Kanost MR. Immulectin-2, a pattern recognition receptor that stimu-lates hemocyte encapsulation and melanization in the tobacco hornworm,Manduca sexta. Dev Comp Immunol 2004;28:891e900.

[16] Yu XQ, Gan H, Kanost MR. Immulectin, an inducible C-type lectin from aninsect, Manduca sexta, stimulates activation of plasma prophenol oxidase.Insect Biochem Mol Biol 1999;29:585e97.

[17] Yu XQ, Tracy ME, Ling E, Scholz FR, Trenczek T. A novel C-type immulectin-3from Manduca sexta is translocated from hemolymph into the cytoplasm ofhemocytes. Insect Biochem Mol Biol 2005;35:285e95.

[18] Yu XQ, Ling E, Tracy ME, Zhu Y. Immulectin-4 from the tobacco hornwormManduca sexta binds to lipopolysaccharide and lipoteichoic acid. Insect MolBiol 2006;15:119e28.

[19] Sun YD, Fu LD, Jia YP, Du XJ, Wang Q, Wang YH, et al. A hepatopancreas-specific C-type lectin from the Chinese shrimp Fenneropenaeus chinensisexhibits antimicrobial activity. Mol Immunol 2008;45:348e61.

[20] Wang XW, Zhang XW, Xu WT, Zhao XF, Wang JX. A novel C-type lectin(FcLec4) facilitates the clearance of Vibrio anguillarum in vivo in Chinese whiteshrimp. Dev Comp Immunol 2009;33:1039e47.

[21] Wang XW, Xu WT, Zhang XW, Zhao XF, Yu XQ, Wang JX. A C-type lectin isinvolved in the innate immune response of Chinese white shrimp. FishShellfish Immunol 2009;27:556e62.

[22] Xu WT, Wang XW, Zhang XW, Zhao XF, Yu XQ, Wang JX. A new C-type lectin(FcLec5) from the Chinese white shrimp Fenneropenaeus chinensis. AminoAcids 2010;39:1227e39.

[23] Zhang XW, Xu WT, Wang XW, Mu Y, Zhao XF, Yu XQ, et al. A novel C-typelectin with two CRD domains from Chinese shrimp Fenneropenaeus chinensisfunctions as a pattern recognition protein. Mol Immunol 2009;46:1626e37.

[24] Song KK, Li DF, Zhang MC, Yang HJ, Ruan LW, Xu X. Cloning and character-ization of three novel WSSV recognizing lectins from shrimp Marsupenaeusjaponicus. Fish Shellfish Immunol 2010;28:596e603.

[25] Luo T, Zhang X, Shao Z, Xu X. PmAV, a novel gene involved in virus resistanceof shrimp Penaeus monodon. FEBS Lett 2003;551:53e7.

[26] Sierra C, Lascurain R, Pereyra A, Guevara J, Martinez G, Agundis C, et al.Participation of serum and membrane lectins on the oxidative burst regula-tion in Macrobrachium rosenbergii hemocytes. Dev Comp Immunol 2005;29:113e21.



154115421543154415451546154715481549155015511552155315541555155615571558155915601561156215631564156515661567

15681569157015711572157315741575157615771578157915801581158215831584158515861587158815891590159115921593


[27] Sahul Hameed AS, Xavier Charles M, Anilkumar M. Tolerance of Macro-brachium rosenbergii to white spot syndrome virus. Aquaculture 2000;183:207e13.

[28] Jayaprakash NS, Pai SS, Philip R, Singh IS. Isolation of a pathogenic strain ofVibrio alginolyticus from necrotic larvae of Macrobrachium rosenbergii (deMan). J Fish Dis 2006;29:187e91.

[29] Wang S, Zhao XF, Wang JX. Molecular cloning and characterization of thetranslationally controlled tumor protein from Fenneropenaeus chinensis. MolBiol Rep 2008;36:1683e93.

[30] Kumar S, Nei M, Dudley J, Tamura K. MEGA: a biologist-centric software forevolutionary analysis of DNA and protein sequences. Brief Bioinform 2008;9:299e306.

[31] Yang Z. PAML 4: phylogenetic analysis by maximum likelihood. Mol Biol Evol2007;24:1586e91.

[32] Nielsen R, Yang Z. Likelihood models for detecting positively selected aminoacid sites and applications to the HIV-1 envelope gene. Genetics 1998;148:929e36.

[33] Yang Z, Nielsen R, Goldman N, Pedersen AM. Codon-substitution models forheterogeneous selection pressure at amino acid sites. Genetics 2000;155:431e49.

[34] Shi XZ, Zhao XF, Wang JX. Molecular cloning and expression analysis ofchymotrypsin-like serine protease from the Chinese shrimp, Fenneropenaeuschinensis. Fish Shellfish Immunol 2008;25:589e97.

[35] Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(�Delta Delta C(T)) method. Methods 2001;25:402e8.

[36] Liu YC, Li FH, Dong B, Wang B, Luan W, Zhang XJ, et al. Molecular cloning,characterization and expression analysis of a putative C-type lectin (Fclectin)gene in Chinese shrimp Fenneropenaeus chinensis. Mol Immunol 2007;44:598e607.

[37] Rattanaporn O, Utarabhand P. Molecular cloning of a C-type lectin with twoCRD domains from the banana shrimp Fenneropenaeus merguiensis: early geneup-regulation after Vibrio harveyi infection. J Invert Pathol 2011;106:196e204.


[38] Ma TH, Benzie JA, He JG, Chan SM. PmLT, a C-type lectin specific to hepato-pancreas is involved in the innate defense of the shrimp Penaeus monodon.J Invert Pathol 2008;99:332e41.

[39] Ma TH, Tiu SH, He JG, Chan SM. Molecular cloning of a C-type lectin (LvLT)from the shrimp Litopenaeus vannamei: early gene downregulation afterWSSV infection. Fish Shellfish Immunol 2007;23:430e7.

[40] Zheng P, Wang H, Zhao J, Song L, Qiu L, Dong C, et al. A lectin (CfLec-2)aggregating Staphylococcus haemolyticus from scallop Chlamys farreri. FishShellfish Immunol 2008;24:286e93.

[41] Guo HZ, Zou PF, Fu JP, Guo Z, Zhu BK, Nie P, et al. Characterization of two C-type lectin-like domain (CTLD)-containing proteins from the cDNA library ofChinese mitten crab Eriocheir sinensis. Fish Shellfish Immunol 2011;30:512e24.

[42] Zhao ZY, Yin ZX, Xu XP, Weng SP, Rao XY, Dai ZX, et al. A novel C-type lectinfrom the shrimp Litopenaeus vannamei possesses anti-white spot syndromevirus activity. J Virol 2009;83:347e56.

[43] Takase H, Watanabe A, Yoshizawa Y, Kitami M, Sato R. Identification andcomparative analysis of three novel C-type lectins from the silkworm withfunctional implications in pathogen recognition. Dev Comp Immunol 2009;33:789e800.

[44] Hayes ML, Eytan RI, Hellberg ME. High amino acid diversity and positiveselection at a putative coral immunity gene (tachylectin-2). BMC Evol Biol2010;10:150.

[45] Okino N, Kawabata S, Saito T, Hirata M, Takagi T, Iwanaga S. Purification,characterization, and cDNA cloning of a 27 kDa lectin (L10) from horseshoecrab hemocytes. J Biol Chem 1995;270:31008e15.

[46] Zhang XW, Wang XW, Sun C, Zhao XF, Wang JX. C-type lectin from red swampcrayfish Procambarus clarkii participates in cellular immune response. ArchInsect Biochem Physiol 2011;76:168e84.

[47] Akahani S, Nangia-Makker P, Inohara H, Kim HR, Raz A. Galectin-3: a novelantiapoptotic molecule with a functional BH1 (NWGR) domain of Bcl-2 family.Cancer Res 1997;57:5272e6.

[48] Ling EJ, Ao JQ, Yu XQ. Nuclear translocation of immulectin-3 stimulateshemocyte proliferation. Mol Immunol 2008;45:2598e606.

1594


Documents

wssv