Why is proper protein production so important?

Why is proper protein Why is proper protein production so important?production so important?

Cystic Fibosis – Cystic Fibosis – most common most common

genetic disease genetic disease

Progeria Progeria PorphyriaPorphyria

Sickle Cell Sickle Cell AnemiaAnemia

AchondrolplasAchondrolplasiaia

Tay Tay Sach’sSach’s

Developmental Developmental AbnormalitiesAbnormalities

DNADNA vs. vs. RNA RNA

Deoxyribose Deoxyribose sugarsugar

ATGC are the ATGC are the basesbases

Stable, immortalStable, immortal Double strandedDouble stranded 6 x 106 x 109 9 base pairsbase pairs

Ribose SugarRibose Sugar AUGC are the AUGC are the

basesbases Unstable, Unstable, short-short-

livedlived Single StrandedSingle Stranded Short pieces – Short pieces –

made one gene made one gene at a timeat a time

Types of RNATypes of RNA

mRNA – flat, single chain (no mRNA – flat, single chain (no secondary structure) – directs secondary structure) – directs protein productionprotein production

tRNA – shaped like a cloverleaf, tRNA – shaped like a cloverleaf, matches nucleotides in the mRNA matches nucleotides in the mRNA with the correct amino acidswith the correct amino acids

rRNA makes up the ribosome – rRNA makes up the ribosome – actually catalyzes peptideactually catalyzes peptide bond bond formationformation

Whole Process of Whole Process of Protein SynthesisProtein Synthesis

TranscriptionTranscription: making an : making an mRNA copy mRNA copy of the DNAof the DNA

Translation: Translation: matching up the matching up the mRNA with the mRNA with the

right aa – so right aa – so building the building the

proteinprotein

Transcription – making Transcription – making an mRNA copy of one an mRNA copy of one genegene

How do the transcription enzymes know How do the transcription enzymes know where the beginning of each gene is and where the beginning of each gene is and

on what strand the gene is locatedon what strand the gene is located?? The promoter is the beginning of the The promoter is the beginning of the

gene. It is a sequence of nucleotides gene. It is a sequence of nucleotides where RNA polymerase binds to start where RNA polymerase binds to start transcription.transcription.

Every promoter has the sequence Every promoter has the sequence TATAAAA with ATATTTT on the opposite TATAAAA with ATATTTT on the opposite strand. This sequence is called the strand. This sequence is called the TATA box. This identifies the promoter.TATA box. This identifies the promoter.

The enzyme reads the non-TATA strandThe enzyme reads the non-TATA strand

Since only some genes are read in Since only some genes are read in each cell, how does it know which each cell, how does it know which genes to read and when to read genes to read and when to read

them?them? Beside the TATA box, the promoter has other Beside the TATA box, the promoter has other

DNA sequences that are specific to that DNA sequences that are specific to that gene.gene.

Specific transcription factors bind to those Specific transcription factors bind to those sequencessequences

RNA polymerase can’t bind to naked DNA – it RNA polymerase can’t bind to naked DNA – it can only bind to a promoter if it already has can only bind to a promoter if it already has transcription factors bound to ittranscription factors bound to it

Each cell only has certain transcription Each cell only has certain transcription factors and sometimes only activates them factors and sometimes only activates them when signaled to.when signaled to.

DNA DNA →→ mRNA mRNA →→ ProteinProtein An enzyme (RNA polymerase binds to DNA at An enzyme (RNA polymerase binds to DNA at

the start of a gene called the promoter (TATA the start of a gene called the promoter (TATA box – TATAAAA)box – TATAAAA)

As the RNA polymerase binds, it opens the As the RNA polymerase binds, it opens the DNA and begins to move forward, adding DNA and begins to move forward, adding matching complementary ribonucleotides. It matching complementary ribonucleotides. It can only go in 1 direction.can only go in 1 direction.

As the RNA polymerase moves forward, the As the RNA polymerase moves forward, the DNA recoils behind it, pushing the single DNA recoils behind it, pushing the single strand of RNA off. This continues until the strand of RNA off. This continues until the termination sequence.termination sequence.

RNA gains no secondary structureRNA gains no secondary structure

Transcription

Translation

Transcription:Transcription:

PracticePractice

Give the mRNA transcript for the gene below:Give the mRNA transcript for the gene below:

[GGCTAGGCAATATAAAAGCTTGG]AAAATGCGGGAATT[GGCTAGGCAATATAAAAGCTTGG]AAAATGCGGGAATTCC

[CCGATCCGTTATATTTTCGAACC] TTTTACGCCCTTAAG[CCGATCCGTTATATTTTCGAACC] TTTTACGCCCTTAAG

AAAAUGCGGGAAUUCAAAAUGCGGGAAUUC

Copy the Non-TATA strand, don’t copy the promoterCopy the Non-TATA strand, don’t copy the promoter

RNA ProcessingRNA Processing

Cap is added to the front end – helps it Cap is added to the front end – helps it leave the nucleus and bind to the leave the nucleus and bind to the ribosome, help protect the mRNA, and ribosome, help protect the mRNA, and makes it go into the ribosome front firstmakes it go into the ribosome front first

Poly-A tail is added to the end (~200 A’s) Poly-A tail is added to the end (~200 A’s) – keeps mRNA from getting chewed up – keeps mRNA from getting chewed up too fasttoo fast

SplicingSplicingSplice out the introns, leave the Splice out the introns, leave the

exonsexonsExons will actually code for the Exons will actually code for the

proteinprotein

ExonExon IntronIntron ExonExon ExonExon IntronIntron ExonExonDNADNA

↓↓ExonExon IntronIntron ExonExon ExonExon IntronIntron ExonExonCap-Cap- -AAA-AAA

Pre-Pre-mRNAmRNA

ExonExon ExonExon ExonExon ExonExonCap-Cap- -AAA-AAAmRNAmRNA

↓↓

↓↓CytoplasCytoplas

mm

RNA ProcessingRNA Processing

PracticPractice:e:Give the final mRNA as it would look before it Give the final mRNA as it would look before it

enters the cytoplasm:enters the cytoplasm:

Stand #1: introns are red, exons are whiteStand #1: introns are red, exons are white

[GGGCGATATTTTCCATG]TAATGCTACGGAGGC/[GGGCGATATTTTCCATG]TAATGCTACGGAGGC/

AACGGGAACGGG/CCCAAATAGTACAGC//CCCAAATAGTACAGC/CGAGACCGAGAC/CCGATC/CCGATC

Strand #2:Strand #2:

[CCCGCTATAAAGGTAC]ATTACGATGCCTCCG/[CCCGCTATAAAGGTAC]ATTACGATGCCTCCG/

TTGCCCTTGCCC/GGGTTTATCATGTCG//GGGTTTATCATGTCG/GCTCTGGCTCTG/GGCTAG/GGCTAG

capcapAUUACGAUGCCUCCGGGGUUUAUCUGCGGCUAGAUUACGAUGCCUCCGGGGUUUAUCUGCGGCUAGtailtail

Explanation for Explanation for practice answerpractice answer Reads non-TATA strandReads non-TATA strand Does not read the promoterDoes not read the promoter Adds complementary RNA Adds complementary RNA

nucleotides to match DNA nucleotides to match DNA nucleotides on the coding strandnucleotides on the coding strand

Cuts out the introns after copying Cuts out the introns after copying so not included in the final mRNAso not included in the final mRNA

A cap and a poly-A tail is addedA cap and a poly-A tail is added

Decoding - Decoding - TranslationTranslationSpace A B C D E F GSpace A B C D E F G 0,0,0 1,2,3 4,5,6 7,8,9 10,11,12 13,14,15 16,17,18 19,20,210,0,0 1,2,3 4,5,6 7,8,9 10,11,12 13,14,15 16,17,18 19,20,21

H I J K L M N OH I J K L M N O22,23,24 25,26,27 28,29,30 31,32,33 34,35,36 40,41,42 43,44,45 49,50,5122,23,24 25,26,27 28,29,30 31,32,33 34,35,36 40,41,42 43,44,45 49,50,51 37,38,39 46,47,48 52,53,5437,38,39 46,47,48 52,53,54

55,56,5755,56,57

P Q R S T U V WP Q R S T U V W58,59,60 61,62,63 64,65,66 67,68,69 70,71,72 73,74,75 76,77,78 79,80,8158,59,60 61,62,63 64,65,66 67,68,69 70,71,72 73,74,75 76,77,78 79,80,81

X Y ZX Y Z82,83,84 85,86,87 91,92,9382,83,84 85,86,87 91,92,93 88,89,9088,89,90

Code:

4,5,6,25,26,27,52,53,54,34,35,36,55,56,57,19,20,21,88,89,90,0,0,0,

25,26,27,67,68,69,0,0,0,70,71,72,22,23,24,13,14,15,0,0,0,4,5,6,13,14,15,

67,68,69,70,71,72,0,0,0,7,8,9,37,38,39,1,2,3,67,68,69,67,68,69



55,56,5755,56,57


X Y ZX Y Z82,83,84 85,86,87 91,92,9382,83,84 85,86,87 91,92,93 88,89,9088,89,90

Code: 64,65,66,13,14,15,1,2,3,10,11,12,25,26,27,46,47,48,19,20,21,0,0,0 4,5,6,25,26,27,52,53,54,34,35,36,55,56,57,19,20,21,88,89,90,0,0,0, 25,26,27,67,68,69,0,0,0,16,17,18,73,74,75,46,47,48



55,56,5755,56,57


X Y ZX Y Z82,83,84 85,86,87 91,92,9382,83,84 85,86,87 91,92,93 88,89,9088,89,90

Code: 25,26,27,0,0,0,34,35,36,52,53,54,76,77,78,13,14,15,0,0,0 4,5,6,25,26,27,52,53,54,34,35,36,55,56,57,19,20,21,88,89,90,0,0,0,4,5,613,14,15,67,68,69,70,71,72

Making a Protein from Making a Protein from mRNAmRNA If each nucleotide = 1 aa – how If each nucleotide = 1 aa – how

many aa?many aa? If 2 nucleotides = 1 aa – how If 2 nucleotides = 1 aa – how

many?many? If 3?If 3? 3 nucleotides = 1aa3 nucleotides = 1aa Only 20 aa so it’s a degenerate Only 20 aa so it’s a degenerate

codecode

Codon – triplet of mRNA that Codon – triplet of mRNA that codes for an aacodes for an aa

Anti-codon – triplet on tRNA that Anti-codon – triplet on tRNA that base pairs with mRNAbase pairs with mRNA

tRNA has the anti-tRNA has the anti-

codon on one side andcodon on one side and

The amino acid on theThe amino acid on the

other side so they matchother side so they match

Up.Up.

How does the ribosome How does the ribosome know where to begin know where to begin

translation?translation? The cap leads the transcript into The cap leads the transcript into

the ribosome in the right directionthe ribosome in the right direction The start codon (AUG) sets the The start codon (AUG) sets the

reading frame (the correct sets of reading frame (the correct sets of 3 nucleotides)3 nucleotides)

The start codon is always the first The start codon is always the first thing translated – it matches to thing translated – it matches to the amino acid methioninethe amino acid methionine

TranslationTranslation

Processed mRNA binds to Processed mRNA binds to ribosome at the start codon (AUG ribosome at the start codon (AUG on mRNA, anti-codon UAC, on mRNA, anti-codon UAC, methionine aa) Sets the reading methionine aa) Sets the reading frameframe

tRNA attaches to start codon tRNA attaches to start codon Next tRNA binds to 2Next tRNA binds to 2ndnd codon codon

Translation ContinuedTranslation Continued

The 2 aa are covalently bonded (peptide The 2 aa are covalently bonded (peptide bond)bond)

The aa lose their attachment to the tRNA in The aa lose their attachment to the tRNA in the first site so both are only attached to the the first site so both are only attached to the tRNA in the second site (so aa is transferred tRNA in the second site (so aa is transferred from it’s orginal tRNA to the new one)from it’s orginal tRNA to the new one)

The tRNA moves forward, dragging the mRNA The tRNA moves forward, dragging the mRNA with it.with it.

The first tRNA falls off and goes to get a new The first tRNA falls off and goes to get a new aa in the cytoplasmaa in the cytoplasm

More TranslationMore Translation

The tRNA with the aa chain has The tRNA with the aa chain has moved down one codon.moved down one codon.

A new tRNA and aa enters the open A new tRNA and aa enters the open site and a peptide bonds forms site and a peptide bonds forms between the new aa and the existing between the new aa and the existing chain again transferring the chain of chain again transferring the chain of aa to the newest tRNAaa to the newest tRNA

The mRNA moves forward again and The mRNA moves forward again and this continues until it reaches a stop this continues until it reaches a stop codon (UAA, UAG, UGA)codon (UAA, UAG, UGA)

The protein enters the RER.The protein enters the RER.

Translation AnimationTranslation Animation

Amino Acid Amino Acid ChartChart

MethioninMethioninee

ProlineProline LeucineLeucine IsoleucineIsoleucine ProlineProline LysineLysine stopstop

Post-translational Post-translational ModificationsModifications

Once inside the ER….Once inside the ER…. aa’s can be removedaa’s can be removed Lipids, carbs, sugars, phosphates may Lipids, carbs, sugars, phosphates may

be addedbe added The chain may be hooked up with The chain may be hooked up with

another protein to form subunits of a another protein to form subunits of a protein with quarternary structureprotein with quarternary structure

The chain may be cut into smaller The chain may be cut into smaller pieces that may hook togetherpieces that may hook together

Folds into tertiary structureFolds into tertiary structure

Mutations Mutations Changes in nitrogen bases in DNAChanges in nitrogen bases in DNA

How can mutations come How can mutations come about?about?

Errors in replication not picked up by Errors in replication not picked up by the proofreading enzyme attached to the proofreading enzyme attached to DNA polymerase (about 3-6/replication)DNA polymerase (about 3-6/replication)

Environmental insultsEnvironmental insults– RadiationRadiation

UV rays from the sunUV rays from the sun X-raysX-rays TV, cell phones, high power linesTV, cell phones, high power lines Radon gasRadon gas

– Chemicals – man-made and naturalChemicals – man-made and natural– Irritation – abestos, rubbingIrritation – abestos, rubbing

Results of Mutation to Results of Mutation to the Individual Cellthe Individual Cell

If a cell acquires a mutation :If a cell acquires a mutation : Repair enzyme fixes it or if occurs during Repair enzyme fixes it or if occurs during

replication – proofreading enzyme fixes itreplication – proofreading enzyme fixes it Cell diesCell dies Cell makes mutated proteins, doesn’t effect Cell makes mutated proteins, doesn’t effect

cell or doesn’t read that gene anywaycell or doesn’t read that gene anyway Damage activates cell suicide (apoptosis)Damage activates cell suicide (apoptosis) Cell becomes cancerous if mutate Cell becomes cancerous if mutate

apoptosis genes, cell cycle control genes, apoptosis genes, cell cycle control genes, crawling genes, etc.)crawling genes, etc.)

If cell is a sperm or egg, the child now has If cell is a sperm or egg, the child now has that mutated DNA in every cell of the bodythat mutated DNA in every cell of the body

Types of MutationsTypes of Mutations Point Mutations (1 single base Point Mutations (1 single base

change)change)– Due to Substitutions Due to Substitutions – DNA polymerase adds the wrong baseDNA polymerase adds the wrong base– Environmental insult alters a base to Environmental insult alters a base to

look more like a different base – once look more like a different base – once copied it becomes permanentcopied it becomes permanent

Frame-shift mutations (shift the Frame-shift mutations (shift the reading frame)reading frame)– Deletions – lose a base Deletions – lose a base – Insertions – add a baseInsertions – add a base

Effects of Mutations on Effects of Mutations on ProteinsProteins

Point Mutations (Substitutions)Point Mutations (Substitutions)No change in proteinNo change in protein

Degenerate code – codes for Degenerate code – codes for same aasame aa

Change in non-coding regionChange in non-coding regionChanges 1 aaChanges 1 aa (change shape a lot or (change shape a lot or a little)a little)Shortens proteinShortens protein – changes start – changes start codon so begins translation latecodon so begins translation lateLengthens proteinLengthens protein – changes stop – changes stop codon so it keeps going through the codon so it keeps going through the trailer and poly-A tailtrailer and poly-A tail

Effects of Insertions and Effects of Insertions and DeletionsDeletions Frame-shift Mutations (changes the Frame-shift Mutations (changes the

reading frame)reading frame)– All aa are wrong after the insertion or All aa are wrong after the insertion or

the deletionthe deletion

Only mutations in the sperm or egg Only mutations in the sperm or egg can be passed onto to offspring!can be passed onto to offspring!

Remember that mutations can be Remember that mutations can be good, bad, or neutral to the good, bad, or neutral to the organism!organism!

Documents

Why is proper protein production so important?