Upload
hollie
View
34
Download
0
Tags:
Embed Size (px)
DESCRIPTION
Hybridization. Inbreeding. Dissimilar organisms. Similar organisms. Organism breed B. Organism breed A. Organism breed A. Retains desired characteristics. Combines desired characteristics. Concept Map. Section 13-1. Selective Breeding. consists of. which crosses. which crosses. - PowerPoint PPT Presentation
Citation preview
Go to Section:
which crosses
consists of
Selective Breeding
for example
Inbreeding Hybridization
Similar organisms
Dissimilar organismsfor
example
Organism breed A
Organism breed A
Organism breed B
Retains desired characteristics
Combines desired characteristics
which
which crosses
which
Section 13-1
Concept Map
Go to Section:
The Smallest Scissors in the World
Have you ever used your word processor’s Search function? You can specify a sequence of letters, whether it is a sentence, a word, or nonsense, and the program scrolls rapidly through your document, finding every occurrence of that sequence. How might such a function be helpful to a molecular biologist who needs to “search” DNA for the right place to divide it into pieces?
Section 13-2
Interest Grabber
Go to Section:
1. Copy the following series of DNA nucleotides onto a sheet of paper. GTACTAGGTTAACTGTACTATCGTTAACGTAAGCTACGTTAACCTA
2. Look carefully at the series, and find this sequence of letters: GTTAAC. It may appear more than once.
3. When you find it, divide the sequence in half with a mark of your pencil. You will divide it between the T and the A. This produces short segments of DNA. How many occurrences of the sequence GTTAAC can you find?
Section 13-2
Interest Grabber continued
Go to Section:
13–2 Manipulating DNAA. The Tools of Molecular Biology
1. DNA Extraction2. Cutting DNA3. Separating DNA
B. Using the DNA Sequence1. Reading the Sequence2. Cutting and Pasting3. Making Copies
Section 13-2
Section Outline
Go to Section:
Recognition sequences
DNA sequence
Section 13-2
Restriction Enzymes
Go to Section:
Recognition sequences
DNA sequence
Restriction enzyme EcoRI cuts the DNA into fragments. Sticky end
Section 13-2
Restriction Enzymes
Go to Section:
DNA plus restriction enzyme
Mixture of DNA fragments
Gel
Power source
Longer fragments
Shorter fragments
Section 13-2
Figure 13-6 Gel Electrophoresis
Go to Section:
Section 13-2
Figure 13-7 DNA Sequencing
Go to Section:
DNA polymerase adds complementary strand
DNA heated to separate strands
DNA fragment to be copied
PCRcycles 1
DNAcopies 1
2
2
3
4
4
8
5 etc.
16 etc.
Section 13-2
Figure 13-8 PCR
Go to Section:
Sneaking In
You probably have heard of computer viruses. Once inside a computer, these programs follow their original instructions and override instructions already in the host computer. Scientists use small “packages” of DNA to sneak a new gene into a cell, much as a computer virus sneaks into a computer.
Section 13-3
Interest Grabber
Go to Section:
1. Computer viruses enter a computer attached to some other file. What are some ways that a file can be added to a computer’s memory?
2. Why would a person download a virus program?
3. If scientists want to get some DNA into a cell, such as a bacterial cell, to what sort of molecule might they attach the DNA?
Section 13-3
Interest Grabber continued
Go to Section:
13–3 Cell TransformationA. Transforming BacteriaB. Transforming Plant CellsC. Transforming Animal Cells
Section 13-3
Section Outline
Go to Section:
Recombinant DNA
Flanking sequences match host
Host Cell DNATarget gene
Recombinant DNA replaces target gene
Modified Host Cell DNA
Section 13-3
Knockout Genes
Go to Section:
Human Cell
Gene for human growth hormone
Recombinant DNA
Gene for human growth hormone
Sticky ends
DNA recombination
DNA insertion
Bacterial Cell
Plasmid
Bacterial chromosome
Bacterial cell for containing gene for human growth hormone
Section 13-3
Figure 13-9 Making Recombinant DNA
Go to Section:
Recombinant plasmid
Gene to be transferred
Agrobacterium tumefaciens
Cellular DNA
Transformed bacteria introduce plasmids into plant cells
Plant cell colonies
Complete plant is generated from transformed cell
Inside plant cell, Agrobacterium inserts part of its DNA into host cell chromosome
Section 13-3
Figure 13-10 Plant Cell Transformation
Go to Section:
The Good With the Bad
The manipulation of DNA allows scientists to do some interesting things. Scientists have developed many transgenic organisms, which are organisms that contain genes from other organisms. Recently, scientists have removed a gene for green fluorescent protein from a jellyfish and tried to insert it into a monkey.
Section 13-4
Interest Grabber
Go to Section:
1. Transgenic animals are often used in research. What might be the benefit to medical research of a mouse whose immune system is genetically altered to mimic some aspect of the human immune system?
2. Transgenic plants and animals may have increased value as food sources. What might happen to native species if transgenic animals or plants were released into the wild?
Section 13-4
Interest Grabber continued
Go to Section:
13–4 Applications of Genetic EngineeringA. Transgenic Organisms
1. Transgenic Microorganisms2. Transgenic Animals3. Transgenic Plants
B. Cloning
Section 13-4
Section Outline
Go to Section:
Cloning
Section 13-4
Flowchart
A body cell is taken from a donor animal.
An egg cell is taken from a donor animal.
The fused cell begins dividing, becoming an embryo.
The nucleus is removed from the egg.
The body cell and egg are fused by electric shock.
The embryo is implanted into the uterus of a foster mother.
The embryo develops into a cloned animal.
Go to Section:
A donor cell is taken from a sheep’s udder. Donor
NucleusThese two cells are fused using an electric shock.
Fused Cell
The fused cell begins dividing normally.
EmbryoThe embryo is placed in the uterus of a foster mother.Foster
Mother
The embryo develops normally into a lamb—Dolly
Cloned Lamb
Egg Cell
An egg cell is taken from an adult female sheep.
The nucleus of the egg cell is removed.
Section 13-4
Figure 13-13 Cloning of the First Mammal
Video
Click the image to play the video segment.
Gene Transfer
This slide is intentionally blank.