1536

q 2004 The Society for the Study of Evolution. All rights reserved.

Evolution, 58(7), 2004, pp. 1536–1548

WHEN VICARS MEET: A NARROW CONTACT ZONE BETWEEN MORPHOLOGICALLYCRYPTIC PHYLOGEOGRAPHIC LINEAGES OF THE RAINFOREST SKINK,

CARLIA RUBRIGULARIS

BEN L. PHILLIPS,1 STUART J. E. BAIRD,2 AND CRAIG MORITZ3

Department of Zoology and Entomology, The University of Queensland, St Lucia, Queensland, 4067 Australia

Abstract. Phylogeographic analyses of the fauna of the Australian wet tropics rainforest have provided strong evidencefor long-term isolation of populations among allopatric refugia, yet typically there is no corresponding divergence inmorphology. This system provides an opportunity to examine the consequences of geographic isolation, independentof morphological divergence, and thus to assess the broader significance of historical subdivisions revealed throughmitochondrial DNA phylogeography. We have located and characterized a zone of secondary contact between twolong isolated (mtDNA divergence . 15%) lineages of the skink Carlia rubrigularis using one mitochondrial and eightnuclear (two intron, six microsatellite) markers. This revealed a remarkably narrow (width , 3 km) hybrid zone withsubstantial linkage disequilibrium and strong deficits of heterozygotes at two of three nuclear loci with diagnosticalleles. Cline centers were coincident across loci. Using a novel form of likelihood analysis, we were unable todistinguish between sigmoidal and stepped cline shapes except at one nuclear locus for which the latter was inferred.Given estimated dispersal rates of 90–133 m 3 gen21/2 and assuming equilibrium, the observed cline widths suggesteffective selection against heterozygotes of at least 22–49% and possibly as high as 70%. These observations revealsubstantial postmating isolation, although the absence of consistent deviations from Hardy-Weinberg equilibrium atdiagnostic loci suggests that there is little accompanying premating isolation. The tight geographic correspondencebetween transitions in mtDNA and those for nuclear genes and corresponding evidence for selection against hybridsindicates that these morphologically cryptic phylogroups could be considered as incipient species. Nonetheless, wecaution against the use of mtDNA phylogeography as a sole criterion for defining species boundaries.

Key words. Carlia rubrigularis, hybrid zone, likelihood profiles, phylogeography, secondary contact, speciation.

Received August 23, 2002. Accepted March 29, 2004.

There is a general debate among evolutionary biologistsabout the nature of genetic differences that result in repro-ductive isolation and the relative roles of isolation, geneticdrift, and divergent selection in speciation (e.g., Orr andSmith 1998; Turelli et al. 2001; Gavrilets 2003). It is widelyaccepted that allopatric isolation combined with divergentselection on ecological or sexually dimorphic traits can resultin speciation, and it has also long been proposed that inci-dental genetic divergence in allopatry can result in substantialpostzygotic isolation (Dobzhansky 1937). Evidence for thelatter comes in particular from experimental crosses of al-lopatric and morphologically cryptic sibling species (e.g.,Dobzhansky 1970). The recent emphasis on mtDNA phylo-geography has revealed numerous cases of apparently deephistorical subdivisions within species, many of which weremorphologically cryptic or even discordant with subspeciesboundaries (Avise 2000). However, it remains unclear wheth-er divergent mtDNA phylogroups represent organismal lin-eages that are independently evolving and perhaps intrinsi-cally isolated, or ones that will simply merge on secondarycontact (Avise and Walker 1998; Wake and Schneider 1998).Further, it is possible that, for one reason or another, mtDNAphylogroups misrepresent organismal history and/or under-

1 Present address: Department of Biological Sciences, Universityof Sydney, New South Wales, 2006 Australia; E-mail: phillips@bio.usyd.edu.au.

2 Present address: Centre de Biologie et de Gestion des Popu-lations, INRA-CBGP, Campus International de Baillarguet, CS 30016 34988, Montferrier/Lez cedex, France; E-mail: stuart@holyrood.ed.ac.uk.

3 Present address: Museum of Vertebrate Zoology, 3101 Life Sci-ences Building, University of California, Berkeley, California94720-3160; E-mail: cmoritz@socrates.berkeley.edu.

lying patterns of genetic divergence (Ballard et al. 2002;Irwin 2002; Hudson and Turelli 2003).

Analysis of zones of secondary contact between lineagescan shed light on the extent and nature of reproductive iso-lation (Barton and Hewitt 1985, 1989). The majority of con-tact zones concern taxa that are distinct phenotypically orchromosomally and in many cases there is evidence for sub-stantial pre- and postzygotic isolation (Barton and Hewitt1985; Harrison 1993). However, despite the recent promi-nence given to phylogeographic structure as a criterion forspecies recognition (e.g., Goldstein and DeSalle 2000; Tem-pleton 2001; Wiens and Penkrot 2002; Sites and Marshall2003) and in conservation biology (Avise 2000; Moritz2002), there are remarkably few detailed studies of secondarycontacts between lineages that are strongly differentiated interms of mtDNA phylogeography, but which are morpho-logically cryptic (Hewitt 2001).

The ‘‘Wet Tropics’’ rainforests of northeastern Australiaoffer an excellent natural laboratory for such studies. Com-plementary biogeographic, palynological, and phylogeo-graphic data indicate that under cool-dry conditions that weretypical for much of the Quaternary, rainforest in this regionexisted as two major isolates, each consisting of severalsmaller refugia (Webb and Tracey 1981; Nix 1991; Kershaw1994; Schneider et al. 1998; Hugall et al. 2002). The sameevidence supports a rapid expansion of the rainforest duringa cool-wet phase commencing approximately 8000 years ago(Kershaw 1986; Walker 1990; Hopkins et al. 1993). Althoughthese data suggest long periods of isolation, it is also likelythat populations restricted to these rainforest isolates havebeen subject to intermittent secondary contact during briefintervals when conditions were optimal for expansion of the

1537SECONDARY CONTACT IN CARLIA RUBRIGULARIS

cool upland rainforests that harbor most of the endemic, rain-forest-restricted species. This history of habitat contractionis reflected by a repeated pattern of strong mtDNA phylo-geographic structure between the two major isolates (Josephet al. 1995; Schneider et al. 1998; Schneider and Moritz 1999;Hugall et al. 2002) with levels of intraspecific sequence di-vergence sometimes approaching interspecific levels for thetaxa concerned (Moritz et al. 1997; Stuart-Fox et al. 2002).Nevertheless, in all cases so far examined the highly diver-gent phylogeographic lineages are morphologically crypticor separable only in multivariate space. (Schneider and Mo-ritz 1999; Schneider et al. 1999; M. Cunningham, unpubl.data).

These observations raise the question of whether the highlydivergent phylogeographic lineages display any reproductiveisolation, either pre- or postmating, or whether they simplywill merge when they come into contact. To address thisquestion, we analyzed a zone of secondary contact betweendivergent mtDNA phylogeogroups of the rainforest skinkCarlia rubrigularis. These common, small (,52 mm snout/vent), red-throated, and heliothermic skinks are endemic tothe Wet Tropics region (Nix and Switzer 1991; Cogger 2000).The species is distributed across a wide variety of wet foresthabitats, typically at altitudes of less than 900 meters, andis most abundant in light gaps and along rainforest margins.Populations from the northern and southern wet tropics arereciprocally monophyletic for mtDNA with .15% net se-quence divergence—similar to that seen between recognizedspecies of Carlia (Stuart-Fox et al. 2002). Multivariate anal-ysis of five ecologically relevant morphological traits re-vealed that the northern and southern lineages of Carlia rub-rigularis are morphologically very similar, especially relativeto variation among habitats within each lineage (Schneideret al. 1999). However, a mtDNA phylogeny for the genus(Stuart-Fox et al. 2002) indicated that these lineages are notsister taxa; rather the southern lineage appears more closelyrelated to Carlia rhomboidalis, a morphologically similar butblue-throated species found in wet forests from the southernextremity of the wet tropics to mideastern Queensland (In-gram and Covacevich 1989; Cogger 2000). Thus, the twophylogroups of C. rubrigularis plus C. rhomboidalis consti-tute a complex of three morphometrically similar mtDNAlineages, replacing each other from north to south and withthe two southern elements (southern C. rubrigularis and C.rhomboidalis) being most closely related. Some authors (e.g.,Wiens and Penkrot 2002) would recognize each of the threelineages as independent, but related, species. However, givenour emphasis on evolutionary processes (Harrison 1998), weprefer to retain the current taxonomy until the nature andlevel of genetic isolation among these lineages is established.The nonsister status of northern and southern C. rubrigularis,together with extensive paleoecological evidence supportingcontraction of their habitat to isolated refugia during the colddry periods of the Pleistocene, demonstrates that the clinesexamined here are due to secondary contact rather than par-apatric divergence (c.f. Endler 1982a).

Our analyses of the contact zone between northern andsouthern lineages of C. rubrigularis are based on theory pre-dicting cline structure and patterns of genetic disequilibria(Barton and Hewitt 1985; Barton and Gale 1993; Barton

2000). In the initial stages of any contact a cline in characterstate frequencies must exist. The shape of the cline is deter-mined by the degree of selection against hybrids, the scaleof dispersal, and the time since contact (Endler 1977; Arnold1994). Neutral mixing and relatively large dispersal distanceswill quickly result in a wide shallow cline whereas strongselection against hybrids, coupled with relatively small dis-persal distances, will result in short, steep clines betweenpopulations. A strong barrier to gene flow between lineageswould elicit the following characteristics: (1) substantial de-viations from Hardy-Weinberg equilibrium at diagnostic locidue to assortative mating and/or selection against hybrids;(2) a positive statistical association between loci for allelescharacteristic of each lineage (linkage disequilibrium) due tothe dispersal of parental types into the zone and/or, the se-lective removal of recombinant genotypes; and (3) clines thatremain narrow rather than widening under neutral diffusion.

Here we survey populations between the known locationsof the northern and southern lineages of C. rubrigularis tolocate a zone of secondary contact. We then characterize thezone using multiple molecular markers and analyze the datafor patterns of genetic disequilibria and cline shape andwidth. As cline width scales with dispersal, we also estimateper generation dispersal distances from disequilibria withinthe zone, and independently from isolation-by-distanceamong populations removed from the contact zone.

METHODS

Sampling

The phylogeography presented in Schneider et al. (1999)suggested that the northern and southern lineages of C. rub-rigularis would be in contact somewhere in the southernLamb Range area. We sampled populations along the lengthof the Lamb Range and found that C. rubrigularis was at allsites other than those above 900 m altitude. Animals werecaptured by hand, measured, and a small piece of tail tip wasremoved from each individual and stored in 80% ethanol.Each locality was sampled up to a maximum of 20 individ-uals. These samples were initially screened at the mitochon-drial marker (see below). Upon locating populations withmixed northern and southern mtDNA haplotypes (popula-tions 2 and 6, see below) the surrounding area was sampledintensively. This process resulted in a 4-km transect throughthe contact zone consisting of nine populations with an av-erage of 18 individuals per population (Fig. 1).

Markers

In the laboratory total cellular DNA was extracted follow-ing standard Phenol-Chloroform extraction protocols. A di-agnostic restriction endonuclease (RE) assay for northern andsouthern haplotypes was designed using the mtDNA se-quence data in Schneider et al. (1999). The RE used (HaeIII)cut both northern and southern haplotypes in a diagnosticmanner (see Appendix). Polymerase chain reaction (PCR)amplification of the relevant Cytochrome-B (CytB) fragmentwas undertaken as described in Schneider et al. (1999) andRE fragment patterns were scored following digestion andagarose gel electrophoresis.

1538 BEN L. PHILLIPS ET AL.

FIG. 1. Map of the study area. Sampling sites and allele/haplotype frequency data are represented by pie charts. (A) shows CytBhaplotype frequencies throughout the Lamb Range. (B) shows 900 m contour and both Aldolase allele (left half of pie) and CytB haplotype(right half of pie) frequencies around the area of contact. Numbers 1–9 represent sites sampled within the contact (Pies shown only forsites 1 and 9). Coordinates for sites are as follows: Site 1: 145833.449E, 1789.129S; Site 2: 145833.869E, 1789.389S; Site 3: 145834.139E,1789.229S; Site 4: 145834.689E, 1789.169S; Site 5: 145834.869E, 1788.849S; Site 6: 145835.169E, 1788.899S; Site 7: 145835.159E, 1788.659S,Site 8: 145835.49E, 1788.599S; Site 9: 145835.719E, 1788.309S. Sites contributing to isolation by distance analysis are as follows: Northerngroup—BG: 145838.579E, 16850.789S; CR: 145836.749E, 16856.179S; DC: 145836.639E, 1782.09S; WH: 145836.009E, 1784.859S; Site 1(above). Southern group—B2: 145838.369E, 1785.899S; B1: 145838.659E, 1785.499S; T2: 145837.699E, 17817.129S; T1: 145837.749E,1787.649S; NT: 145837.279S, 1787.859N; LE: 145837.499E, 1789.629S.

Additionally, two diagnostic nuclear intron markers weredeveloped (Aldolase intron 1 (Ald) and Rh2 Opsin intron 4(Rho)). For each of these loci double stranded sequences wereobtained from C. rubrigularis specimens outside the zone ofcontact spanning much of the Wet Tropics (data not shown).Sequences were obtained using standard sequencing proto-cols and specifically designed primers (Appendix). Sequenc-ing of intron markers revealed that Ald showed a fixed dif-ference in alleles between northern and southern populations.One northern allele and two southern alleles were identifiedfrom sequences, all of which were diagnosable by RE assay(see Appendix). Sequencing at the Rho locus identified twoalleles private to each of the northern and southern popula-tions and one common to both. Both of the northern allelesand one of the southern alleles were distinguishable by RE

assay. The remaining southern allele could not be distin-guished from the common allele using restriction enzymes(Appendix). Populations within and adjacent to the contactwere screened at both intron loci. Fragment patterns for in-trons were scored following electrophoresis on a nondena-turing 8% polyacrylamide gel. Populations inside and outsidethe zone of contact were also screened at six microsatelliteloci (A11, A16, D4, D13, D19, D20; Appendix). One of theseloci (A16) showed a semidiagnostic shift in allele frequencybetween lineages (Table 1). The remaining five loci showeda broad overlap in allele sizes between northern and southernpopulations (data not shown). Although these loci are non-diagnostic there is no reason to discard the information theydo contain, thus they were combined to make multilocushybrid index estimates (see below). Eleven previously sam-

1539SECONDARY CONTACT IN CARLIA RUBRIGULARIS

TA

BL

E1.

Fre

quen

cyof

diag

nost

ical

lele

sus

edin

this

stud

yat

nort

hern

and

sout

hern

site

san

dat

site

sw

ithi

nth

eco

ntac

tzo

ne.

Nor

ther

npo

pula

tion

ssc

reen

edw

ere

BG

,C

R,

DC

,W

H,

and

Sit

e1.

Sou

ther

nsi

tes

scre

ened

wer

eL

E,

T6

(145

836.

569E

,17

85.9

79S

),L

B(1

4583

8.37

9E,

1781

4.76

9S),

NT,

and

B2.

Loc

usA

llel

eN

orth

ern

pops

Sou

ther

npo

psS

ite

1S

ite

2S

ite

3S

ite

4S

ite

5S

ite

6S

ite

7S

ite

8S

ite

9

Cyt

B

Ald

Nor

ther

nS

outh

ern

Nor

ther

nS

outh

ern

1S

outh

ern

2

1.00

(153

)0

1.00

(258

)0 0

0.00

(109

)1

0.00

(174

)0.

840.

16

1.00

(19)

01.

00(3

8)0 0

0.93

(14)

0.07

0.96

(28)

0.04

0

0.9

(20)

0.1

0.85

(40)

0.13

0.03

0.82

(17)

0.18

0.56

(34)

0.38

0.06

0.68

(19)

0.32

0.71

(38)

0.29

0

0.33

(15)

0.67

0.20

(30)

0.7

0.1

0.5

(20)

0.5

0.23

(40)

0.72

0.05

0.10

(20)

0.9

0.05

(40)

0.93

0.03

0.00

(20)

10.

00(3

6)0.

970.

03R

ho

A16

Nor

ther

n1

Nor

ther

n2

Sou

ther

n1

Sou

ther

n2

&C

omm

onN

orth

ern

Sou

ther

n

0.56

(80)

0.13

0 0.31

0.98

(200

)0.

02

0.00

(118

)0 0.

530.

470.

05(2

16)

0.95

0.74

(38)

0.11

0 0.15

0.92

(38)

0.08

0.50

(28)

0.1

0.04

0.36

1.00

(28)

0

0.63

(40)

0.08

0 0.3

0.83

(40)

0.17

0.44

(34)

0.21

0.06

0.29

0.88

(34)

0.12

0.31

(36)

0.06

0.11

0.53

0.76

(38)

0.24

0.14

(28)

0.07

0.25

0.54

0.23

(30)

0.77

0.13

(40)

0.1

0.23

0.55

0.40

(40)

0.6

0.00

(40)

0 0.38

0.62

0.38

(40)

0.62

0.00

(40)

0 0.4

0.6

0.21

(38)

0.79

pled pure populations (mtDNA haplotypes either 100% north-ern or 100% southern), spanning approximately 40 kms out-side the contact zone (Fig. 1), were screened at these micro-satellite loci allowing an isolation-by-distance estimate ofdispersal.

Analyses

After calculation of FIS values all markers were collapsedto two allele sytems (i.e., ‘‘northern’’ alleles and ‘‘southern’’alleles). Clines were fitted to population allele frequency datathrough the contact using the compound tanh and exponentialmodel of Szymura and Barton (1986) implemented in the‘‘Analyse’’ application (Barton and Baird 1995). Sigmoidclines are a very general product of gene flow, with or withoutvarious forms of selection (Barton and Gale 1993; Kruuk etal. 1999). A sigmoid cline in allele frequencies (p) is de-scribed as a function of its width and center such that,

p 5 (1 1 tanh[2(x2c)/w])/2, (1)

where x is the distance from the center of the cline, c is theposition of the center of the cline, and w is the width of thecline (defined as the inverse of the maximum slope) (Szymuraand Barton 1986). We also wished to explore a more complexscenario of stepped clines. Theory predicts that when a num-ber of selected characters change simultaneously across azone of contact, association between them can cause a sharpstep at the center of each cline. We follow the approach ofSzymura and Barton (1986) for stepped cline hypotheses.Outside the central region where these associations are lo-calized we assume that there is uniform impediment to in-trogression, such that clines in characters will decay expo-nentially towards their tails as

1/2p } exp(24xu /w) (2)

and the corollary for (1-p), where u is the rate of exponentialdecay. The central ‘‘barrier’’ region of a contact zone isspecified by equation (1) and encompasses a step in characterstate ß dp/dx. The exponential decay curve equation (2) isused to describe the distal regions under reduced selectionas tails with initial gradient dp/dx. The strength ß of thecentral selective barrier to hybridization is most convenientlyexpressed as the physical distance that would result in anequivalent change in character state in the absence of a bar-rier, and thus has units of distance. The decay rate of thetails is proportional to the level of selection acting on a char-acter outside the central region.

The present study system lends itself to a one dimensionalcline analysis because of the narrowness of the strip of habitatbetween the altitudinal limit of Carlia distribution and thephysical limit of the shore of Lake Tinaroo (Fig. 1). Clinefitting was undertaken along a best fit axis through sampledpopulations, equating to a compass bearing of 58.88. Localitysamples were weighted by effective sample size, a measureof the number of independent sampling events given observedgenetic disequilibria. Deviation of the population from Har-dy-Weinberg equilibrium means the states of the two allelessampled at a locus are not statistically independent. The sameargument applies when there is linkage disequilibrium be-tween loci, or reduced variance due to relatedness among

1540 BEN L. PHILLIPS ET AL.

individuals in a sample (FST). Effective sample sizes (Ne),taking into account maximum-likelihood estimates (MLEs)of FIS and FST, were calculated for each sample at each locusas (N. H. Barton, pers. comm.);

2NN 5 , (3)e 2NF 1 (1 1 F )ST IS

where N is the number of diploid individuals sampled. Ne isscaled such that complete relatedness results in effective sam-ple size ø1, whereas no relatedness but complete hetero-zygote deficit results in effective allele sample size N. Theaverage Ne/N ratio across sites ranged from ten to forty per-cent across loci. Clines were fitted to each locus indepen-dently using a maximum-likelihood (ML) approach that isnovel in some respects. We make comparisons within andbetween two classes of hypotheses: simple contact, repre-sented by symmetrical sigmoid clines (‘‘Sig,’’ two param-eters: w, c); and contact with a central barrier to gene flow,represented by stepped clines. Barrier hypotheses are furthersubdivided into simpler symmetric clines (‘‘Sstep’’ four pa-rameters: w, c, ß, u) and more complex asymmetric clines(‘‘Astep’’ six parameters: w, c, ßns, uns, ßsn, usn; subscriptsindicate south/north polarity). The models are nested; thus,when two models are compared and one has more free pa-rameters (and therefore greater potential to fit well), the par-simonious model is accepted over the more complex modelif their difference in log likelihood (DLL) is not significant(chi-squared on twoDLL with D parameters degrees of free-dom) (Edwards 1972; see Barton 2000 for discussion).

Our approach to comparing clines extends existing max-imum-likelihood cline fitting procedures (Barton and Baird1995) by, for each model and each locus, exploring the like-lihood surface stepwise along axes for both center positionc and width w with the other parameters free to vary at eachpoint. In this way the likelihood profiles (Hilborn and Mangel1997) for both c and w can be constructed. Working withthese likelihood profiles allows intuitively straightforwardinference about biologically relevant aspects of multilocushybrid zones. For example, coincident versus staggered clinecenter hypotheses can be compared as follows: Summing loglikelihood c profiles over a set of L loci results in the log-likelihood profile for the ML shared center of the L loci. Thecenter coincidence ML can be compared with the sum ofnoncoincident c profile MLs using a likelihood ratio test (Hil-born and Mangel 1997). Summing log likelihoods over lociimplicitly assumes that the information at each locus is in-dependent, so that the tightness of support bounds on thelocation of a consensus center may be overestimated. How-ever if associations among loci are all of the same order ofmagnitude this will have little effect on the likelihood valueat the consensus MLE, which is the basis for the comparisonof coincident center and staggered cline hypotheses.

When considering stepped clines, estimates and bounds forb and u were calculated by an exhaustive search within thetwo unit bound domain of our best cline fit. Due to the lowsampling density at the cline center (see Results) some so-lutions for some loci were able to yield cline widths ap-proaching zero. However the area across which selection actsin concert with linkage disequilibrium must be larger thanthe dispersal distance of the organism. Therefore we omitted

those solutions in which the estimated length of the steppedportion of the cline was less than our lower bound for dis-persal.

Within the contact zone (populations 1–9) Hardy-Wein-berg equilibrium (HWE) was assessed for each marker usingMLE FIS in Analyse. Hardy-Weinberg equilibrium was alsoassessed at each site for each marker within the contact zone.Average linkage disequilibrium (D) through the cline wasassessed for diagnostic markers by partitioning the variancein ‘‘hybrid index’’ summed across diagnostic loci (Bartonand Gale 1993).

Two methods were used to estimate dispersal distance pergeneration. The first used the relationship between pairwiseFST (represented as FST/[1 2 FST]) and the natural logarithmof distance between sites at six microsatellite loci for 25population pairs in the two dimensional range of habitat out-side the contact. Rousset (1997) showed that the slope b ofa regression through such data under a two dimensional mod-el should yield an estimate of the product of density (d) anddispersal (s2) such that 1/b 5 4ds2. Pairwise estimates fromfive populations fixed for the northern mtDNA lineage (10pairs) spanning ca. 35 kms, and from six populations fixedfor the southern mtDNA lineage (15 pairs) spanning about7 kms, were pooled for this analysis. Least squares regressionwas used to determine the slope and its standard error forthese data thus allowing the approximate probability distri-bution of ds2 to be calculated (using the standard errors andassuming a normal distribution of errors). Given a lack ofrigorous density estimates, s2 bounds were calculated for adensity range of 20–450 individuals per hectare, which en-compasses published estimates for ecologically similar spe-cies (e.g., Patterson 1984, 416 ha21; Braithwaite 1987, 316ha21; Sumner et al. 2001, 20 ha21).

The second method for estimating dispersal uses the re-lationship between maximum-linkage disequilibrium and thewidth of a cline (Barton and Gale 1993) and is appropriateto the transect through the effectively one-dimensional (lin-ear) habitat along the north shore of Lake Tinaroo. Underthis method, s2 5 Drw1w2 where r is the rate of recombi-nation between two markers and w1 and w2 are the widths ofthe clines for each marker. This method is independent ofdensity and has been shown to be robust for weak to moderatelevels of selection within a zone (Barton and Gale 1993).The five microsatellite loci that did not show diagnostic dif-ferences between northern and southern populations did dif-fer in allele frequency, enabling a multilocus assignment testto correctly assign individuals from non hybrid populationsto their respective lineage (Rieseberg et al. 1998). Using thesame procedure, individuals from hybrid populations wereanalyzed using pooled northern and southern populations asreference points. The most likely position on a linear vectorbetween these reference points was calculated for each in-dividual’s genotype with respect to the five microsatellitemarkers using the approach outlined in Rieseberg et al.(1998). This position is analogous to a ‘‘hybrid index’’ cal-culated by summation over diagnostic loci, and we refer toit here as the nondiagnostic hybrid index (NDHI). Log like-lihoods were summed over all individuals at each samplinglocality, giving a ML estimate and support surface for theNDHI through the contact zone. The NDHI must be treated

1541SECONDARY CONTACT IN CARLIA RUBRIGULARIS

FIG. 2. (A) Best fit clines in population allele frequency under aconstrained center for the consistent barrier scenario. (B) ConsensusFIS estimates for A16 and Rho through the cline. (C) Average link-age disequilibrium estimates through the cline. Hybrid index fre-quency histograms are shown for sites 4, 5, and 6 (insets: x-axisis the hybrid index, y-axis the frequency). In all cases, error barsrepresent two unit support bounds and the c-axis measures distance(m) through the cline (consensus center located at c 5 2840).

with the same caution as we would treat a hybrid indexsummed over five diagnostic loci. Although it might be rea-sonable to assume that the five loci have the same cline cen-ters, there is little reason to suppose they would all have thesame width or cline shape (see Discussion). Taking a con-sensus over clines of different widths and symmetries tendsto lead to an abrupt change in the central region where allclines concur. Therefore, the NDHI was deemed appropriatefor determining the center position of the zone, but unsuitablefor the estimation of other cline parameters.

RESULTS

Identification of Diagnostic Markers and Location of theContact Zone

Screening of intron markers confirmed that the Ald locusshowed a fixed difference between northern and southernpopulations. The Rho locus showed two alleles private toeach population with the common (1 southern 2) allele classpresent at approximately 30% in northern populations (Table1). At the A16 microsatellite marker, ‘‘northern’’ allelesranged from approximately 98% frequency in northern pop-ulations to less than 5% in southern populations (Table 1).The other five microsatellite loci showed extensive overlapin allele size between southern and northern populations, al-though there were significant differences in allele frequencyat all loci (data not shown).

The fact that there were multiple northern and southernalleles at some of the diagnostic loci allowed us to test forHardy-Weinberg equilibrium at these loci in populations out-side the contact zone. There was no significant deviation inpopulations outside the contact zone for the Ald (MLE FIS

5 0.07, two unit bounds 0.0–0.37) or Rho (MLE FIS 5 0.00,two unit bounds 0.0–0.09) markers. However a significantFIS (MLE FIS 5 0.18, two unit bounds 0.04–0.34) was de-tected at the A16 locus in pure southern populations sug-gesting that null alleles may complicate inference at this lo-cus. However, low FIS in the populations flanking the centerof the hybrid zone makes it unlikely that null alleles arecommon in the localities central to our analysis.

Initial haplotype screening revealed mixed populationswithin a discrete area of the Lamb Range (Fig. 1). Furthersampling and screening of markers showed an essentiallycomplete change from northern to southern types within fourkilometers at all four diagnostic loci along a narrow strip ofsuitable habitat (Fig. 1) defined by the 900 m contour to thenorth and the edge of a reservoir (established in 1958) to thesouth. Within this area we sampled nine sites with an averageof 18 individuals per site (Figs. 1, 2A). Two of these sites(2 and 6), being the populations that initially revealed thepresence of the contact, were sampled two months earlierthan other populations.

Genotypic and Allelic Disequilibrium in the Contact Zone

Nuclear loci with diagnostic differences between northernand southern mtDNA lineages showed rapid transition in al-lele frequencies across the 4 km contact zone in broad agree-ment with the location of the mtDNA cline (Table 1; Fig.

2A). For the five nondiagnostic microsatellite loci there wasa rapid shift in NDHI within the zone (Fig. 2A).

Estimates of FIS indicated deficiencies of heterozygotes attwo loci, Rho (FIS 5 0.42; 2 unit bounds 0.23–0.59) and A16(FIS 5 0.13; two unit bounds 0–0.28). By contrast, analysisof genotype frequencies at the third diagnostic nuclear locus,

1542 BEN L. PHILLIPS ET AL.

TABLE 2. Observed and expected number of heterozygotes totaledacross all sites in the contact. Heterozygotes have been split intoacross-lineage (i.e., N 3 S) and within-lineage (N1 3 N2 and/orS1 3 S2) classes.

Locus

Within lineageheterozygotes

(expected)

Within lineageheterozygotes

(observed)

Across lineageheterozygotes

(expected)

Across lineageheterozygotes

(observed)

AldRhoA16

6.740.224.3

53920

36.545.251.5

382644

TABLE 3. Maximum likelihood of Sig and Astep models for eachlocus. G-statistics (twice the difference in log likelihood) are usedto assess the significance of the improvement offered by the Astepmodel. No improvement between the models was shown by theNDHI data.

Locus Sig ML Astep ML G df P

A16A1dRhoCytB

26.637211.85424.11324.168

25.44924.12621.14621.567

2.37615.456

5.9345.202

2444

0.3050.0030.2040.267

FIG. 3. Marginal likelihood surfaces along the center position (c)axis. All three models (Sig, Sstep, and Astep) are compared foreach locus. Likelihood values are for the best fitting model at eachparticular center position (all other parameters free to vary).

Ald, produced an FIS estimate of zero (two unit bounds 0–0.16). Plotting consensus FIS estimates for A16 and Rhoagainst distance along the transect suggested that maximumdeficiency of heterozygotes occurred at site 4, just to the leftof cline centers (Fig. 2B). Within the zone, comparison of(total) expected versus observed values for individual ge-notypes indicated strong heterozygote deficit for combina-tions of N and S alleles, but not N 3 N or S 3 S alleles atRho and an approximately equal deficiency of heterozygotesin both classes at the A16 locus (Table 2).

Across the three diagnostic nuclear loci, significant averagepairwise linkage disequilibrium (D) was detected with high-est values at sites 4 and 6 near the center of the zone (Fig.2C). In this context, the lower estimate of D at site 5 appearsanomalous. Post hoc inspection of hybrid index distributionsfor sites 4, 5, and 6 (Fig. 2C, insets) showed that high linkagedisequilibrium was generated at sites 4 and 6, by the presenceof individuals with extreme hybrid index values. Interest-ingly, these extreme values were representative of northernand southern types at sites 4 and 6 respectively, as would beexpected if linkage disequilibrium was generated primarilyby immigration of parental genotypes into the zone. Giventhe noise inherent in this parameter, we constructed a con-servative estimate for the maximum linkage disequilibriumin the zone by averaging the estimates of sites 4 and 6 andtaking the lowest and highest support bounds over these sites.This yielded an estimate of maximum average pairwise link-age disequilibrum of 0.0885 (38% of its maximum possiblevalue) with limits ranging from 0.0538 to 0.128.

Likelihood Inference about the Nature of the Contact Zone

We plotted the log-likelihood profiles of center positionfor each cline model and for each diagnostic marker locus(Fig. 3). This process revealed several observations of note:First, for all loci except A16, the Sstep model provided neg-ligible improvement over the Sig model and was thereforedropped from further analyses. Second, in all cases the Astepmodel provided an increase in likelihood over the Sig model(Fig. 3, Table 3). The magnitude of this improvement de-pended upon where the center position was located and inthe individual locus tests the difference was significant forthe Ald locus (P 5 0.003, Table 3), but was not significantfor Rho or A16. The stepped nature of the ALD cline andthe heterozygote deficits at the other two nuclear loci, Rhoand A16, are clear evidence of selection against hybrids, andthus imply a barrier to gene flow at the center of the zone.

The detection of significant effects of a barrier at one locus,but nonsignificant effects at the other loci suggests two sce-

1543SECONDARY CONTACT IN CARLIA RUBRIGULARIS

TABLE 4. Summary of best-fit cline parameters under the consistent barrier and mixed holistic scenarios with a consensus center.Asterisks denote situations where our data could not provide robust estimates/bounds.

w (m) bSN qSN bNS qNS ML

Mixed (c 5 2600)Cyt

2u Min.MLE2u Max.

165022403150

———

———

———

———

24.087

Ald2u Min.MLE2u Max.

76010401490

460.451150–14303421

0.050.20–0.23

0.65

0*39.3-*

*

0.00*0.00–1*

1*28.861

A162u Min.MLE2u Max.

90450

1230

———

———

———

———

26.815

Rho2u Min.MLE2u Max.

67010701790

———

———

———

———

22.438

Consistent Barrier (c 5 2840)Cyt

2u Min.MLE2u Max.

6401121–1135

1412

121809–9378225

0.030.330.66

43*4452-*

*

0.00*0.00–0.80*

1*21.75

Ald2u Min.MLE2u Max.

5681030–1050

1980

104306–344683

0.080.31–0.32

1

1574813-

*

0.01*0.01–0.99*

1*29.317

A162u Min.MLE2u Max.

222588–610

1550

1313–21234*

0.12*0.99–1*

1*

1482514825-*

0.310.33–0.80

0.826.512

Rho2u Min.MLE2u Max.

210509–539

1280

78598

1830

00.050.99*

11663872–69500*

0.00*0.88–0.92*

1*22.646

narios in which to assess overall properties of the hybridzone (see discussion): (1) A mixed model (one locus 5 Astep;the rest 5 Sig), where a barrier to gene flow affects only thechromosome segment marked by the Ald locus. All other locihave sigmoid clines, and their higher likelihoods under abarrier model are assumed to be due to the greater degreesof freedom of that model. (2) A consistent barrier model (allloci 5 Astep), where the barrier affecting Ald is also affectsother loci, but their increased likelihood under the barriermodel is not significant due to insufficient power to detectweaker effects than that those operating on Ald.

Our choice of descriptive model (mixed vs. consistent bar-rier) does not affect the qualitative conclusion that selectionis operating against hybrids, but does influence estimates ofcline width and consequently the strength of that selection.Visual inspection of likelihood profiles (Fig. 3) suggest ap-proximate coincidence of cline centers under both mixed andconsistent barrier scenarios. Constraining all loci to a com-mon center does not result in a significant decrease in like-lihood under either model (mixed, P 5 0.20; consistent bar-rier, P 5 0.77). Under the mixed scenario, cline widths werevariable (MLEs 450–2240 m; Table 4), but under the con-

sistent barrier scenario, cline widths were more similar acrossloci (MLEs 509–1135 m) and narrowest at Rho and Ald, thetwo loci with heterozygote deficits (Table 4). Overall, esti-mates of cline width (mixed w ,2240 m, two unit bounds90–3150 m; consistent barrier w ,1135 m, two unit bounds210–1980 m) were narrow compared to the geographic scaleof many hybrid zones (65% of zones reported in Barton andHewitt (1985) had widths greater than our maximum esti-mate).

Estimates of Dispersal Distance and Selection Strength

Comparison among pure northern and pure southern pop-ulations at the microsatellite loci revealed pairwise FST valuesrange from 0.012 to 0.068 (over 35 km) among northernpopulations and 0.008 to 0.046 (over 7 km) among southernpopulations. Using the combined pairwise estimates, regres-sion of FST/(1 2 FST) and log distance revealed an isolationby distance effect with a slope of 0.00857 (R2 5 0.26, SE5 0.0031, P 5 0.010; because FST is imperfectly measured,the significance of the slope may be an overestimate andconfidence limits underestimated). These values were trans-

1544 BEN L. PHILLIPS ET AL.

formed to a probability density function of ds2. This gave amedian value for neighborhood size of 9.28 individuals anda (minimum) 95% confidence range of 5–35 individuals. As-suming Carlia densities lie in the range d 5 20–450 indi-viduals per hectare yields s values ranging approximately11–133 m 3 gen21/2.

Using the estimate of maximum D and its bounds from thecontact zone (see above) and the estimates of cline width forour narrowest clines under each scenario (because these are theones most likely to be contributing to disequilibrium, Table 4)yields s values ranging from 112 to 173 m 3 gen21/2 underthe mixed scenario and 90 to 140 m 3 gen21/2 under the con-sistent barrier scenario. This assumes that there is no physicallinkage between the two markers and that linkage disequilibriumis primarily due to migration rather than selection. Each methodfor estimating dispersal is subject to considerable uncertaintyand makes several untested assumptions. Nonetheless, the twoindependent approaches give reasonably consistent ranges ofvalues and in the following we use the overlap, 112–133 m 3gen21/2 (mixed model) and 90–133 m 3 gen21/2 (consistent bar-rier model), as our best estimate of dispersal rate (s) in thecontact zone.

Given these estimates of cline width and dispersal, andassuming clines have reached equilibrium between selectionand migration, we can calculate an effective level of selections*. This is the selection against heterozygotes which wouldbe required to maintain a cline of the same width were thehybrid zone a single locus system; s* 5 8(s/w)2 (Barton andGale 1993). Using our estimate of dispersal rate and the aboveequation, we estimate s* as lying between 0.50–0.70 (mixed)or 0.22–0.49 (consistent barrier). Given the uncertainties andassumptions involved, these should be treated only as indi-cations of the order of magnitude of selection in the zone.Nevertheless, the width of the clines relative to our estimateof dispersal indicates that selection against hybrids is strongirrespective of which cline model is chosen. Under the con-sistent barrier model, further information can be obtainedfrom the shape of the tails of the clines. The Astep modelestimates barrier strength (b) and the rate of exponential de-cay (u) for northern to southern (geographically west to east,Fig. 1) and southern to northern lineages simultaneously. Forall diagnostic markers the MLE selective barrier north tosouth (bns) is greater than the geographic extent of the hybridzone, and greater than the corresponding barrier south tonorth (Table 4). Intense sampling in the tails of clines isnecessary for precise estimates of the decay parameters (Bar-ton and Gale 1993), and as a result support limits here arewide. We restrict our inference to the following: Decay pa-rameter estimates (u) for all markers except A16 are consis-tent with relatively weak selection outside the barrier region(lower support limits , 10%). A16 not only has a strongcentral barrier, its decay estimates indicate it may also beinfluenced by selection outside the center of the zone.

DISCUSSION

We have located and characterized genetically a zone ofsecondary contact between northern and southern mtDNAlineages of C. rubrigularis in the southern reaches of theLamb Range. Paleoclimatological modeling of mesothermal

rainforests (Nix 1991; Hugall et al. 2002) and preliminarymodels specific for C. rubrigularis (B. Phillips, unpubl.) sug-gest that the major refugia for this species were in the Thorn-ton Uplands, 100 km north of the contact zone and the easternAtherton uplands 25 km south of the zone, and coastal regionsadjacent to each area. Thus, the contact zone is much closerto the presumed southern refugium than to the one in thenorth. This contrasts with Endler’s (1982b) assumption thatzones of secondary contact should be equidistant from re-fugia. Interestingly, zones of secondary contact betweennorthern and southern phylogeographic lineages have beenlocated for several other species in this region: the tropicalbettong Bettongia tropica, 5 km to the north (Pope et al.2000); the microhylid frog Cophixalus ornatus, 17 km to thesouth (C. Hoskin, unpubl. data); the snail Gnarosophia bel-lendenkerensis, 12.5 km to the south (Hugall et al. 2002);and the hylid frog Litoria genimaculata, 15–38 km north (B.Phillips and C. Hoskin, unpubl. data). Thus, the Lamb Rangerepresents a ‘‘phylogeographic’’ suture zone (Remington1968), as described by (Hewitt 2000) for the European Alps,although here with spatial congruence at a much finer spatialscale. Pollen cores from two nearby lakes (Lake Euramooand Lake Barrine, Fig. 1) provide evidence for the displace-ment of dry open forests by rainforest across this area be-tween 6100 and 7500 years ago (Walker 1990). Although C.rubrigularis could well have been at the forefront of rainforestexpansion because of its preference for edge habitats, it isalso possible that the contact examined here may not havearisen until the warmer wetter period 3600–5000 years ago(Nix 1991). Prior to this time, much of the Lamb Range mayhave acted as a physical barrier to contact (much as the 900m contour does today) due to the prevailing cooler, wetterconditions (Nix 1991) that are avoided by C. rubrigularis.Considering these factors, the contact observed here couldbe as old as 3600–7500 years.

Given the evidence from heterozygote deficits of nonneu-trality (i.e., selection acting against hybrids), we cannot sen-sibly estimate the age of the zone directly from its width.The presence of mixed populations to the south of Lake Tin-aroo (Fig. 1) implies that contact at least predates the creationof the lake in 1958 and the paleoecological evidence suggeststhat it could be thousands of years old. With moderate tostrong selection against hybrids, as appears to be the casehere, the equilibrium cline width should be determined pri-marily by dispersal distance (Barton and Gale 1993) andequilibrium should thus have been attained rapidly. We there-fore assume that the hybrid zone is at equilibrium.

Subsequent to locating the zone, it was characterized ge-netically for eight nuclear loci, three of which showed fixed(Ald) or nearly fixed (Rho, A16) differences between north-ern and southern mtDNA lineages. Key observations fromthis analysis are:

(1) The zone is narrow, with width estimates of 450 m to2.2 km and cline centers that are coincident.

(2) There is substantial linkage disequilibrium and some,but not all, diagnostic loci show strong deficiencies of het-erozygotes. Both heterozygote deficits and linkage disequi-librium show peak values on the northern side of cline cen-ters.

(3) At least one locus shows a stepped and asymmetrical

1545SECONDARY CONTACT IN CARLIA RUBRIGULARIS

cline, but we are unable to distinguish rigorously betweenthe mixed model in which some loci have sigmoidal clinesand others are stepped, and the consistent barrier model inwhich all loci are stepped.

(4) Under the consistent barrier scenario, all clines arefound to be asymmetric in the same direction and estimatesof cline width tend to decrease with an increase in observedheterozygote deficits.

Taken together, these observations on the genetic structureof the contact zone suggest strong selection against hybridsthat, in the absence of heterozygote deficit at one of thediagnostic loci, we assume to be primarily postzygotic ratherthan prezygotic. Further, the consistent asymmetry of anybarriers considered in the zone implies differences in fitnessor effective gene flow rate with greater introgression fromthe southern to northern lineage than vice versa.

Whether there is a deficit of hybrid genotypes depends onwhich locus is evaluated (cf. Ald vs. Rho and A16), despitestrong average pairwise linkage disequilibrium. This obser-vation suggests that strong postzygotic selection against hy-brid genotypes is occurring in association with some loci andnot others. The contact zone is positioned within an essen-tially homogeneous habitat with no obvious dispersal bar-riers. It follows that the shape and width of the clines arelargely a function of dispersal and the degree of endogenousselection against hybrids.

There have been numerous studies of cline properties atsecondary contacts between phenotypically and/or chromo-somally distinct taxa (reviewed by Barton and Hewitt 1985;Arnold 1994; Morgan-Richards and Wallis 2003). Howeverfew studies have combined quantitative estimates of dispersaland cline width to estimate effective selection strength (s*)under the tension zone model. In comparison to such esti-mates involving distinct species (Bombina, s* 5 22%, Szy-mura and Barton 1991; Heliconius, s* 5 20–30%, Mallett etal. 1990; Pontia, s* 5 47–64%; Porter et al. 1997) and chro-mosome races (e.g., Sceloporus, s* 5 30%, Marshall andSites 2001), our analyses suggest relatively strong effectiveselection (s* 5 22–49% for consistent barrier model; s* 550–70% for mixed model) against hybrids between phylo-geographic lineages within C. rubrigularis. Our estimates reston the assumptions of the models (above) and the validityof the dispersal estimate, the latter being a weak point inmany previous studies (Barton and Hewitt 1985). In the pre-sent case, two independent genetic approaches gave broadlyconsistent estimates of dispersal rate and, notwithstandinguncertainty about population density, produced results thatare plausible in relation to studies of other rainforest skinks(e.g., Sumner et al., 2001).

In the absence of assortative mating, these high values ofeffective selection against hybrids do not necessarily implythat the northern and southern lineages are evolving inde-pendently. The current selection barrier is sufficient to im-pede both negatively selected and neutral alleles, but allelesthat are selectively favored in both lineages should passthrough this barrier relatively quickly, in a time related tothe degree of increased fitness they confer, relative to thestrength of selection against hybrids (Pialek and Barton1997). Further, it is possible that there has been episodicintrogression during earlier (interglacial) periods of contact

between northern and southern lineages of C. rubrigularis,especially if selection against hybrids was weaker or if thecontact was maintained for longer. The contact zone couldbe considered as an evolutionary filter, allowing exchange ofalleles that are beneficial, but rarely ones that are neutral orsubject to divergent selection (Martinsen et al. 2001).

The observation of strong selection against hybrids be-tween morphologically similar but phylogeographically dis-tinct lineages of C. rubrigularis is consistent with the viewthat phylogeographic lineages can represent stages in the es-tablishment of reproductively isolated lineages via gradual,incidental divergence in allopatry (Avise and Walker 1998).The establishment of reproductive isolation by this means isexpected to be slow (Gavrilets 2003). In contrast to the mor-phologically conservative skinks studied here, it is notablethat some sister taxa of insects from these same rainforests,and which have experienced an analogous history of habitatfluctuation, have attained complete reproductive isolationwithin this suture zone (e.g., Bell et al. 2004). Additionalstudies of contact zones involving morphologically crypticphylogroups are needed to explore the relationship betweeninterlineage divergence and levels of selection against hy-brids and how this might vary across taxonomic groups (Tur-elli et al. 2001). As sequence divergence between mtDNAphylogroups can be a poor predictor of divergence time (Ed-wards and Beerli 2000; Hudson and Turelli 2003), such stud-ies would benefit from a multilocus perspective. That thereis evidence for partial reproductive isolation between mtDNAphylogroups of C. rubrigularis does not necessarily supportthe view that mtDNA differences alone can be used to di-agnose species (e.g., Wiens and Penkrot 2002). The diversityof views on concepts of species results in part from varyingemphases on diagnosis of taxa versus the processes by whichindependent evolutionary lineages arise (de Queiroz 1998;Harrison 1998). Inevitably, this debate spills over into oneabout explicit procedures and criteria for diagnosing species(Sites and Marshall 2003). The inherent ambiguity is ex-emplified by the complex studied here—the two lineages ofC. rubrigularis plus C. rhomboidalis. Using phylogeographic(Wiens and Penkrot 2002) or phylogenetic (Cracraft 1983;Goldstein and DeSalle 2000) approaches, the two (nonsister)lineages of C. rubrigularis clearly are diagnosable and wouldbe regarded as separate species. By contrast, they could beconsidered conspecific (albeit paraphyletic) under the cohe-sion species concept (Templeton 2001) as the null hypothesisof ecological exchangeability (using ecomorphology as a sur-rogate; Schneider et al. 1999) is not rejected. Their statusunder a genealogical species concept (Baum and Shaw 1995)is unclear as the attainment of genealogical concordance be-tween even 50% of nuclear loci and mtDNA is a slow andhighly stochastic process (Hudson and Coyne 2002). Also,there is potential for introgression of adaptive alleles (Bartonand Hewitt 1985; Porter et al. 1997). More generally, thesuggestion (Wiens and Penkrot 2002) that mtDNA representsan ideal marker for diagnosis of species boundaries suffersfrom three significant limitations. First, as Wiens and Penkrot(2002) acknowledge, as a maternally inherited locus, mtDNAcan indicate diagnostic differences between populations de-spite substantial exchange of nuclear genes, especially if thereis male-mediated gene flow or polygyny (e.g., Birky et al.

1546 BEN L. PHILLIPS ET AL.

1989; Hoelzer 1997). Second, as a single gene, estimates ofpopulation history derived from mtDNA alone are subject toconsiderable error arising from stochastic among-locus var-iance in coalescent processes (Edwards and Beerli 2000; Ir-win 2002; Hudson and Turelli 2003). Third, selection actingon nuclear and/or mitochondrial sequences can cause sub-stantial differences in both the rate of divergence and spatialpatterns of diversity, such that mtDNA can be no more ef-ficient, or perhaps even misleading as an indicator of lineageboundaries (e.g., Garcia-Paris et al. 2003). For these reasonswe, along with others (e.g., Jockusch and Wake 2002) urgethat diagnosis of species be based on multiple lines of evi-dence, that is, phenotypes or nuclear loci in addition tomtDNA.

ACKNOWLEDGMENTS

The authors wish to thank P. Fox, D. O’Connor, J. Dickson,C. Hoskin, C. Larroux, and S. Phillips for help in the field.Special thanks to A. Hugall for advice at all stages of thisproject. C. Schneider and M. Lara provided the microsatelliteprimers and associated technical assistance. D. Wake and J.Alexandrino provided valuable discussion. The manuscriptwas improved by comments from C. Schneider, C. Graham,A. Porter, and anonymous reviewers. The research was fund-ed by grants from the Cooperative Research Center for Trop-ical Rainforest Ecology and Management (Australia), the Na-tional Science Foundation, and the Australian ResearchCouncil.

LITERATURE CITED

Arnold, M. L. 1994. Natural hybridisation and evolution. OxfordUniv. Press, Oxford, U.K.

Avise, J. C. 2000. Phylogeography: the history and formation ofspecies. Harvard Univ. Press, Cambridge, MA.

Avise, J. C., and D. Walker. 1998. Pleistocene phylogeographiceffects on avian populations and the speciation process. Proc.R. Soc. Lond. B 265:457–463.

Ballard, J. W. O., B. Chernoff, and A. C. James. 2002. Divergenceof mitochondrial DNA is not corroborated by nuclear DNA,morphology, or behavior in Drosophila simulans. Evolution 56:527–545.

Barton, N. H. 2000. Estimating multilocus linkage disequilibria.Heredity 84:373–389.

Barton, N. H., and S. J. E. Baird. 1995. Analyse: an application foranalysing hybrid zones. Freeware, Edinburgh. Available athttp://helios.bto.ed.ac.uk/evolgen/mac/analyse.

Barton, N. H., and K. S. Gale. 1993. Genetic analysis of hybridzones. Pp. 13–45 in R. G. Harrison, ed. Hybrid zones and theevolutionary process. Oxford Univ. Press, Oxford, U.K.

Barton, N. H., and G. M. Hewitt. 1985. Analysis of hybrid zones.Annu. Rev. Ecol. Syst. 16:113–148.

———. 1989. Adaptation, speciation, and hybrid zones. Nature341:497–503.

Baum, D. A., and K. L. Shaw. 1995. Genealogical perspectives onthe species problem. Pp. 289–303 in P. C. Hoch and A. G.Stephens, eds. Experimental and molecular approaches to plantbiosystematics. Missouri Botanical Garden, St. Louis, Missouri.

Bell, K. L., D. K. Yeates, C. Moritz, and G. B. Monteith. 2004.Molecular phylogeny and biogeography of the dung beetle genusTemnoplectron Westwood (Scarabaeidae: Scarabaeninae) fromAustralia’s wet tropics. Mol. Phylogenet. Evol. In press.

Birky, C. W., Jr., P. Fuerst, and T. Maruyama. 1989. Organellegene diversity under migration, mutation and drift: equilibriumexpectations, approach to equilibrium, effects of heteroplasmiccells and comparison to nuclear genes. Genetics 121:613–627.

Braithwaite, R. W. 1987. Effects of fire regimes on lizards in theWet-Dry Tropics of Australia. J. Trop. Ecol. 3:265–275.

Cogger, H. G. 2000. Reptiles and amphibians of Australia. Reed,Melbourne.

Cracraft, J. 1983. Species concepts and speciation analysis. Curr.Ornith. 1:159–187.

de Queiroz, K. 1998. The general lineage concept of species, speciescriteria, and the process of speciation: a conceptual unificationand terminological recommendations. Pp. 57–75 in D. J. Howardand S. H. Berlocher, eds. Endless forms. Species and speciation.Oxford Univ. Press, Oxford, U.K.

Dobzhansky, T. 1937. Genetics and the origin of species. ColumbiaUniv. Press, New York.

——— 1970. Genetics and the evolutionary process. ColumbiaUniv. Press, New York.

Edwards, A. W. F. 1972. Likelihood. Cambridge Univ. Press, Cam-bridge, U.K.

Edwards, S. V., and P. Beerli. 2000. Perspective: gene divergence,population divergence and the variance in coalescence time inphylogeographic studies. Evolution 54:1839–1854.

Endler, J. A. 1977. Geographic variation, speciation and clines.Princeton Univ. Press, Princeton, NJ.

———. 1982a. Problems in distinguishing historical from ecolog-ical factors in biogeography. Am. Zool. 22:441–452.

———. 1982b. Pleistocene forest refuges: fact or fancy? Pp. 641–657 in G. Prance, ed. Biological diversification in the tropics.Columbia Univ. Press, New York.

Garcia-Paris, M., M. Alcobendas, D. Buckley, and D. B. Wake.2003. Dispersal of viviparity across contact zones in Iberianpopulations of fire salamanders (Salamandra) inferred from dis-cordance of genetic and morphological traits. Evolution 57:129–143.

Gavrilets, S. 2003. Models of speciation: what have we learned in40 years. Evolution 57:2197–2215.

Goldstein, P. Z., and R. DeSalle. 2000. Phylogenetic species, nestedhierarchies, and character fixation. Cladistics 16:364–384.

Harrison, R. G. 1993. Hybrid zones and the evolutionary process.Oxford Univ. Press, Oxford, U.K.

———. 1998. Linking evolutionary pattern and process: The rel-evance of species concepts for the study of speciation. Pp. 19–31 in D. J. Howard and S. H. Berlocher, eds. Endless forms.Species and speciation. Oxford Univ. Press, Oxford, U.K.

Hewitt, G. M. 2000. The genetic legacy of Quaternary ice ages.Nature 405:907–913.

———. 2001. Speciation, hybrid zones and phylogeography—orseeing genes in space and time. Mol. Ecol. 10:537–550.

Hey, J. 2001. The mind of the species problem. Trends Ecol. Evol.16:326–329.

Hilborn, R., and M. Mangel. 1997. The ecological detective: con-fronting models with data. Princeton Univ. Press, Princeton, NJ.

Hopkins, M. S., J. Ash, A. W. Graham, J. Head, and R. K. Hewett.1993. Charcoal evidence of the spatial extent of the Eucalyptuswoodland expansions and rainforest contractions in northQueensland during the late Pleistocene. J. Biogeogr. 20:59–74.

Hoelzer, G. A. 1997. Inferring phylogenies from mtDNA variation:mitochondrial-gene trees versus nuclear-gene trees revisited.Evolution 51:622–626.

Hudson, R. R., and J. A. Coyne. 2002. Mathematical consequencesof the genealogical species concept. Evolution 56:1557–1565.

Hudson, R. R., and M. Turelli. 2003. Stochasticity overrules the‘‘three-times rule’’: genetic drift, genetic draft and coalescencetimes for nuclear loci versus mitochondrial DNA. Evolution 57:182–190.

Hugall, A., C. Moritz, A. Moussalli, and J. Stanisic. 2002. Rec-onciling paleodistribution models and comparative phylogeog-raphy of the Wet Tropics rainforest land snail Gnarasophia bel-lendenkerensis (Brazier 1875). Proc. Natl. Acad. Sci. USA 99:6112–6117.

Ingram, G., and J. Covacevich. 1989. Revision of the genus Carlia(Reptilia: Scincidae) in Australia with comments on Carlia bi-carinata of New Guinea. Mem. Queensl. Mus. 27:443–490.

Irwin, D. 2002. Phylogeographic breaks without geographic barriersto gene flow. Evolution 56:2383–2394.

1547SECONDARY CONTACT IN CARLIA RUBRIGULARIS

Jockusch, E. L., and D. B. Wake. 2002. Falling apart and merging:diversification of slender salamanders (Plethodontidae: Batra-choseps) in the American West. Biol. J. Linn. Soc. 76:361–391.

Joseph, L., C. Moritz, and A. Hugall. 1995. Molecular support forvicariance as a source of diversity in rainforest. Proc. R. Soc.Lond. B 260:177–182.

Kershaw, A. P. 1986. Climatic change and Aboriginal burning innorth-east Australia during the last two glacial/interglacial cy-cles. Nature 322:47–49.

———. 1994. Pleistocene vegetation of the humid tropics of north-eastern Queensland, Australia. Paleogeog. Paleoclim. Paleoecol.109:399–412.

Kruuk, L. E. B., S. J. E. Baird, N. H. Barton, and K. S. Gale. 1999.A comparison of multilocus clines maintained by environmentaladaptation or by selection against hybrids. Genetics 153:1959–1971.

Mallett, J., N. Barton, G. M. Lamas, J. C. Santisteban, M. M. Mu-sedas, and H. Eeley. 1990. Estimates of selection and gene flowfrom measures of cline width and linkage disequilibrium in Hel-iconius hybrid zones. Genetics 124:921–936.

Martinsen, G. D., T. G. Whitham, R. J. Turek, and P. Keim. 2001.Hybrid populations selectively filter gene introgression betweenspecies. Evolution 55:1325–1335.

Marshall, J. C., and J. W. Sites. 2001. A comparison of nuclear andmitochondrial cline shapes in a hybrid zone in the Sceloporusgrammicus complex (Squamata: Phrynosomatidae). Mol. Ecol.10:435–449.

Morgan-Richards, M., and G. Wallis. 2003. A comparison of fivehybrid zones of the weta Hemideina thoracica (Orthoptera: An-ostostomatidae): degree of cytogenetic differentiation fails topredict zone width. Evolution 57:849–861.

Moritz, C. 2002. Strategies to protect biological diversity and theevolutionary processes that sustain it. Syst. Biol. 51:238–254.

Moritz, C., L. Joseph, M. Cunningham, and C. J. Schneider. 1997.Molecular perspectives on historical fragmentation of Australiantropical and sub-tropical rainforests. Pp. 442–454 in W. Laur-ence and R. Bierragaard, eds. Tropical forest remnants: ecology,management and conservation of fragmented communities.Univ. of Chicago Press, Chicago, IL.

Nix, H. 1991. Biogeography: pattern and process. Pp. 11–39 in H.Nix and M. Switzer, eds. Rainforest animals: atlas of vertebratesendemic to Australia’s Wet Tropics. Australian Nature Conser-vation Agency, Canberra.

Nix, H., and M. Switzer. 1991. Rainforest animals: atlas of ver-tebrates endemic to Australia’s Wet Tropics. Australian NatureConservation Agency, Canberra.

Orr, M. R., and T. B. Smith. 1998. Ecology and speciation. TrendsEcol. Evol. 13:502–506.

Patterson, G. B. 1984. The effect of burning-off tussock grasslandon the population density of common skinks Leiolopisma-nigri-plantare-maccanni. N.Z. J. Zool. 11:189–194.

Pialek, J., and N. H. Barton. 1997. The spread of an advantageousallele across a barrier: the effects of random drift and selectionagainst heterozygotes. Genetics 145:493–504.

Pope, L. C., A. Estoup, and C. Moritz. 2000. Phylogeography andpopulation structure of an ecotonal marsupial, Bettongia tropica,

determined using mtDNA and microsatellites. Mol. Ecol. 9:2041–2053.

Porter, A. H., R. Wenger, H. Geiger, A. Scholl, and A. M. Shapiro.1997. The Pontia daplidice-edusa hybrid zone in northwesternItaly. Evolution 51:1561–1573.

Remington, C. L. 1968. Suture-zone of hybrid interaction betweenrecently joined biotas. Evol. Biol. 2:321–428.

Rieseberg, L. H., S. J. E. Baird, and A. M. DesRocher. 1998. Pat-terns of mating in wild sunflower hybrid zones. Evolution 52:713–726.

Rousset, F. 1997. Genetic differentiation and estimation of geneflow from F-statistics under isolation by distance. Genetics 145:1219–1228.

Schneider, C. J., M. Cunningham, and C. Moritz. 1998. Comparativephylogeography and the history of endemic vertebrates in theWet Tropics rainforests of Australia. Mol. Ecol. 7:487–498.

Schneider, C. J., and C. Moritz. 1999. Rainforest refugia and evo-lution in Australia’s Wet Tropics. Proc. R. Soc. Lond. B 266:191–196.

Schneider, C. J., T. B. Smith, B. Larison, and C. Moritz. 1999. Atest of alternative models of diversification in tropical rainfo-rests: ecological gradients vs. rainforest refugia. Proc. Nat. Acad.Sci. USA 96:13869–13873.

Sites, J. W., Jr.,and J. C. Marshall. 2003. Delimiting species: arenaissance issue in systematic biology. Trends Ecol. Evol. 18:462–470.

Stuart-Fox, D. M., A. F. Hugall, and C. Moritz. 2002. A molecularphylogeny of rainbow skinks (Scincidae: Carlia): taxonomic andbiogeographic implications. Aust. J. Zool. 50:39–51.

Sumner, J., F. Rousset, A. Estoup, and C. Moritz. 2001. ‘‘Neigh-bourhood’’ size, dispersal, and density estimates in the pricklyforest skink (Gnypetoscincus queenslandiae) using individual ge-netic and demographic methods. Mol. Ecol. 10:1917–1927.

Szymura, J. M., and N. H. Barton. 1986. Genetic analysis of a hybridzone between the fire-bellied toads, Bombina bombina and B.variegata near Cracow in southern Poland. Evolution 40:1141–1159.

———. 1991. The genetic structure of the hybrid zone between thefire-bellied toads Bombina bombina and B. variegata: Compar-isons between transects and loci. Evolution 45:237–261.

Templeton, A. R. 2001. Using phylogeographic analyses of genetrees to test species status and processes. Mol. Ecol. 10:779–791.

Turelli, M., N. H. Barton, and J. A. Coyne. 2001. Theory and spe-ciation. Trends Ecol. Evol. 16:330–343.

Wake, D. B., and C. J. Schneider. 1998. Taxonomy of the pleth-odontid salamander genus Ensatina. Herpetologica 54:279–298.

Walker, D. 1990. Directions and rates of tropical rainforest pro-cesses. Pp. 22–32 in L. Webb and J. Kikkawa, eds. Australiantropical rainforests: science—values—meaning. CommonwealthScientific and Industrial Research Organization Australia, Can-berra.

Webb, L., and J. G. Tracey. 1981. Australian rainforests: patternand change. Pp. 605–694 in A. Keast, ed. Ecological biogeog-raphy of Australia. Junk, The Hague.

Wiens, J. J., and T. A. Penkrot. 2002. Delimiting species usingDNA and morphological variation and discordant species limitsin spiny lizards (Sceloporus). Syst. Biol. 51:69–91.

Corresponding Editor: J. Wiens

1548 BEN L. PHILLIPS ET AL.

APPENDIX

The diagnostic loci used in this study. The tables below indicate (A) the allele classes distinguishable and the specific fragment patternsgenerated by the REs used; and (B) the primers and their sequences used for each locus.

(A)

Locus Enzyme Northern 1 Southern 1 Southern 2 Southern 2 Common

Cytochrome B HaeIII 151271

128143151

— — —

Aldolase NlaIII 8892

111

8892

111

45668892

— —

NlaIV 1799

175

17274

1799

175

— —

Rhodopsin HinfI 151373

151373

524 151373

151373

AluI 2844516190

250

5190

133250

51617290

250

51617290

250

51617290

250

(B)

Marker Primer 1 Primer 2

CytB (MVZ04, Ph-1)Aldolase (Ald1CR, Ald2CR)Rhodopsin (Rho3CR, Rho4CR)A16 (rubA16a, rubA16b)A11 (A11a, A11b)D4 (D4a, D4b)D13 (D13a, D13b)D19 (D19a, D19b)D20 (rubD20a, rubD20d)

GCAGCCCCTCAGAATGATATTTGTCCTAAGAAGGATGGAGCTGACTTTGCCCTTGCCTGGACACCCTATGCTGGTTTACAATATAAGTTACCTTGAACAGGTTTAGGACTGACAGAATTTGCCTTGTTTCTGCCATTTGTCTCATATGATTTGTTTCCTCACGAGACACCGCATCGTTTCACAACAACCCTTTGAGATCAGGGGTCTTTGGAAAGAACTGGAAG

GACCCCAATACGAAAAACCACCCGCCATTCTGTAACACAACAGCCAACTCTGGAATAAAGGAGAGGGTCTCTCTTGACTGACTTGTCCCTTCGGACACCTATTTTGAGAACCACTGGACAGGATGGGGCATAAAGATTTTCCCTGCTGGTTTTTCACTTTCCTTGAATGTCTGTTCTAGCGGCTTCTGCGGGTGGTAAGTAGTCCAGAGCC