WHAT ABOUT THEM VIBRIOS?

D. Jay Grimes

The University of Southern MississippiGulf Coast Research LaboratoryDepartment of Coastal Sciences

Ocean Springs, MS 39564

A Presentation to theSchool of Public Health & Tropical Medicine

Tulane UniversityApril 2, 2009

• Vibrio cholerae was one of the first bacteria to be isolated in pure culture

• V. cholerae first observed by Pacini in 1854

• 30 years later the German physician Robert Koch reported the first cultivation of this pathogen

The Vibrios

Dr. Robert Koch

• Koch’s successful isolation was the result of working with fresh specimens from an epidemic in Calcutta, India

• Today, cholera continues to ravage India, Bangladesh, Pakistan and other developing nations

The Vibrios

Koch’s laboratory in Calcutta, India(photo courtesy of Dr. Crystal Johnson)

• Over 50 Vibrio species are now recognized• 24 species are pathogenic for animals and

plants• Of these 24, 12 occur in human specimens

and 11 are confirmed human pathogens• In general, the human pathogens cause

diarrhea or extra-intestinal infections –usually wound infections

• Several species cause diseases in other animals – both vertebrates (most commonly in fishes - vibriosis) and invertebrates – and in plants

The Vibrios

The Vibrios1

Vibrio cholerae*V. aerogenesV. aestuarianusV. alginolyticus*V. anguillarumV. campbelliiV. cincinnatiensis*V. cyclitrophicusV. damsela*V. diabolicusV. diazotrophicusV. fischeriV. fluviales*V. furnissii*V. gazogenes

V. halioticoliV. harveyi (carchariae)*V. hollisae*V. ichthyoenteriV. logeiV. mediterraneiV. metschnikovii*V. mimicus*V. mytiliV. natriegensV. navarrensisV. nereisV. nigripulchritudoV. ordaliiV. orientalis

V. parahaemolyticus*V. pectenicidaV. pelagiusV. penaeicidaV. proteolyticusV. rumoiensisV. salmonicidaV. scophthalmiV. splendidusV. tapetisV. trachuriV. tubiashiiV. vulnificus*V. wodanis

1Bergey’s Manual of Systematic Bacteriology, 2nd ed., Vol. 2, Part B, 2005 * = clinical specimens

• Vibrio spp. are Gram-negative, facultative anaerobes capable of respiring and fermenting of a variety of substrates

• Oxidase positive, usually with one or more Na+-powered, polar, ensheathed flagella –some species can also form H+-powered lateral flagella on solid media where they swarm (e.g., V. alginolyticus)

• Usually found in saltwater and most species require Na+ (energy via a Na+ motive force)

• Belong to the class Gammaproteobacteriaand the family Vibrionaceae

The Vibrios

• The Vibrios are metabolically versatile, capable of metabolizing many organic compounds– Sugars, amino sugars and sugar alcohols– Complex carbohydrates– Proteins– Lipids and alcohols– Aliphatic and polyaromatic hydrocarbons

• Comprise the dominant culturable heterotrophic bacteria in the ocean

• No correlation with any of the fecal indicators• Most prefer an attached existence (biofilms)• Most seem to be capable of quorum sensing

The Vibrios

• To date, seven strains representing five species of Vibrio have been fully sequenced

• At least 31 other strains are in the process of being sequenced

• All seven strains have two circular chromosomes – one large (Chr 1) and one small (Chr 2)

The Vibrios

V. vulnificus YJO16 (Chen et al. 2003. Genome Res. 13:2577-2587.)

• Chr 1 tends to contain housekeeping genes (DNA replication, transcription, translation, flagellar synthesis, metabolic pathways)

• Chr 2 tends to contain accessory genes (pathogenicity, antibiotic resistance, host defense avoidance, survival in adverse environments)

The Vibrios

V. fischeri ES114 (Ruby et al. 2005. PNAS 102:3004-3009.)

• This representation of Chr 1 and 2 shows locations of some Vp virulence genes that we are presently working with– Type III Secretion

System 1– Type III Secretion

System 2– tlh– tdhA and tdhS

• TTSS1 and TTSS2 are not redundant

The Vibrios

V. parahaemolyticus RIMD2210633 (Makino et al. 2003. Lancet 361:743-749.)

TTSS1

TTSS2

tdhA

tdhS tlh

The VibriosTable 1. Basic features of the Vibrio genomes that have been fully sequenced

V. cholerae O1 El Tor N16961

V. choleraeO395

V. fischeriES114

V. harveyiBAA-1116

V. parahaemolyticusRIMD 2210633

V. vulnificusCMCP6

V. vulnificusYJO16

Chr 1 (Mb) 3 3 2.9 3.8 3.3 3.3 3.4

Chr 2 (Mb) 1.1 1.1 1.3 2.2 1.9 1.8 1.9

ORFs(Chr 1+2) 3,885 3,875 3,802 5,944 4,832 4,489 4,959

GC content ofChr1/Chr2 47.7/46.9 46.9/47.8 38.3

(1+2) 45.5/45.3 45.4/45.4 46.4/47.1 46.4/47.2

rRNA operons onChr1/Chr2 8/0 n.r. 11/1 n.r. 10/1 n.r. 8/1

Major pathogenicity

factors

CT, RT,TCP, T2SS CT CT?, RT n.r. tdh, T3SS1, T3SS2 n.r.

Capsule,siderophores,hemolysins,

heme receptor,RT

Selectedenvironmental survival factors

Chitinase,MSHA Chitinase Chitinase Chitinase Polar and lateral

flagella, chitinase, Chitinase Siderophores,chitinase

Plasmids (Kb) n.r. n.r. pES100(45.8)

pVIBHAR(89.0) n.r. n.r. pYJO16 (48.5)

Ref 4 n.p. 8 n.p. 6 n.p. 1

Isolation of Vibrios

• Enrichment– Alkaline peptone water

• Non-selective – Marine agar 2216– T1N3 agar (1% tryptone and

3% NaCl)• Selective

– Thiosulfate-citrate-bile salts-sucrose (TCBS)

– Vibrio vulnificus agar (VVA)– Cellobiose-polymixin B-colistin

(CPC+) agar– Chromagar

APW

suc-

suc+

Vv

VVA

TCBS

VVA T1N3

Identification of Vibrios

• Classical phenotypic tests

• Biolog®

• Serology –serotyping, FAB

• Alkaline phosphatase-labeled DNA probes

• PCR, rtPCR, qPCR• FISH

Alkaline phosphatase-labeled DNA probesT1N3 filter before probing tdh VVA filter before probing

tlh trh vvh

The Big Three

• Vibrio cholerae– Over 180 defined O antigens (O1 and 179 non-O1)– Serogroup O1 (pandemics)– Serogroup O139 (epidemics) – O1 biogroups are classic and El Tor– Toxigenic and non-toxigenic (CT)

• Vibrio parahaemolyticus– 13 O antigens and 60 K antigens– Predominate strain is O3:K6 (pandemic)

• Vibrio vulnificus– 7 O antigens with O1 and O4 predominate

Vibrio cholerae Pacini 1854

• First Vibrio to be isolated and described, V. cholerae is the type strain

• Ubiquitous in estuarine and marine environments

• Temperature and salinity optima are 25oC and 2-14 ppt

• Commonly associated with marine animals and plants (epizootic and epiphytic)

• Colwell now describes V. cholerae as a vector-borne pathogen (copepods)

Vibrio cholerae

(Slide courtesy of Drs. Rita Colwell and Constantin de Magney, University of Maryland)

Vibrio cholerae

• There have been seven pandemics1. 1st – 1817-1823 – India and Asia2. 2nd – 1826-1837 – moved from Asia to Europe

and then Canada followed by the United States beginning in New York in 1932

• New Orleans was hit the hardest – 5,000 died• Almost as many died from yellow fever in NO• See L.A. Langridge, 1955, M.S. Thesis, LSU

3. 7th pandemic began in 1961 with a new strain of cholera – V. cholerae O1 biogroup El Tor

4. El Tor was replaced by the classic strain in 19825. In 1992 a new strain, O139, appeared in India

and Bangladesh – it has not moved out of Asia

Vibrio cholerae

• In 1854 , during the 3rd pandemic (1846-1866), London was once again being ravaged by cholera

• One outbreak in this pandemic was notable for its contribution to epidemiology and to understanding the spread of waterborne disease

• It occurred in the Soho district of London near the Broad Street pump and in the 1 month it lasted it killed over 600 people

• John Snow carefully mapped the cases

Vibrio cholerae

(Slide courtesy of Dr. Rita Colwell, University of Maryland)

• Most common agent of Vibrio disease in humans after V. cholerae

• The most common causes of foodborne disease in Japan (ca. 70%)

• Most common cause of seafood-borne disease in U.S.

• Causes acute gastroenteritis• Can cause septicemia and wound infection• First Vp pandemic began in 1996, involving

three major serotypes – O3:K6, O4:K68, and O1:K untypeable

Vibrio parahaemolyticusFujino et al. 1951

Vibrio parahaemolyticus

• All Vp strains possess the tlh (thermolabile hemolysin) gene

• Most pathogenic Vp strains possess the tdh(thermostable direct hemolysin) and/or thetrh (thermostable related hemolysin) genes

• TDH is associated with Kanagawa reaction• tdh and trh are uncommon in

environmental and food isolates• TTSS1, TTSS2 and urease

V. parahaemolyticusOutbreaks

• Historically, U.S. outbreaks were associated with cooked crabs – illness from raw molluscan shellfish had been sporadic

• Large U.S. outbreaks in 1969, 71, 72, 82, 92, 97, 98, and 2006

• In 1997, Vp from molluscan shellfish caused a large outbreak in the Pacific Northwest– involved 209 persons & one died from septicemia– isolates belonged to common U.S. serogroups (O1,

O4, O5) and all were TDH+ and urease positive

V. parahaemolyticusOutbreaks

• In 1998, outbreaks of shellfish-borne Vp occurred again in the U.S.– Over 500 individuals ill after consuming raw oysters– Three areas involved - Gulf Coast, NE, Pacific NW– Most of the cases were involved with consumption of raw oysters

from Galveston Bay– Predominant Vp serotype was O3:K6, which (with one exception)

had not occurred in the U.S. since 1972• In May through July, 2006 177 cases (72 lab

confirmed) resulted from consumption of raw oysters– 18 of 23 isolates were O4:K12– Cases occurred in New York, Oregon, and Washington– No fatalities

V. parahaemolyticusOutbreaks

• In 2004, there was an outbreak of Vp O6:K18 aboard an Alaska cruise ship– Of 189 passengers, 62 patients had this Vp (29% attack

rate) as did all oysters tested (PFGE)– Oysters came from an oyster farm in Prince William Sound– Mean water temperatures in Prince William Sound have

been increasing (0.21oC per yr) since 1997– For the first time in 2004, mean daily temperatures in the

sound did not drop below 15oC

• This outbreak pushed the Vp range 1,000 km north!

V. parahaemolyticusEcology

• Vp known to associate with marine animals, especially zooplankton (Kaneko & Colwell, 1973)– Vp overwintered in Chesapeake Bay sediment– Vp entered water column when water temp > 14oC– Abundance of Vp increased in direct proportion to

zooplankton - especially copepods– This was the first demonstrated

association of a human pathogenwith a estuarine animal subject toclimate-induced fluctuations

– Vp survives in MS sediment whentemperatures are < 15oC, but not inwater or oysters Vp in sediment at

Henderson Point, St. Louis Bay

V. parahaemolyticusEcology

• Watkins & Cabelli (1985) observed Vp -zooplankton relationship in Narragansett Bay similar to that described by Kaneko & Colwell 10 years earlier– wastewater nutrients stimulated phytoplankton– increased levels of phytoplankton provided food for

grazing zooplankton– Vp associated with the zooplankton

• There is a positive correlation with water temperature (R square is 0.51) and Vp seasonality during warmer months

• Optimum temp is 38oC and salinity is 17-23 ppt• Vp can become nonculturable under stress

Vibrio vulnificus(Reichelt et al. 1979) Farmer 1980

• Causes: – primary septicemia (ingestion of shellfish)– gastroenteritis (ingestion of shellfish)?– wound infections (contact)

• Preexisting liver dysfunction or disease greatly increases susceptibility and mortality

• High fatality rate among compromised• Highest fatality rate of any bacterium known

(>50%)

Vibrio vulnificus

• Virulence factors not well understood• Hemolysins and pathogenicity

– V. vulnificus hemolysin (vvh)– Two genotypes – clinical (C) and environmental

(E) and only C causes disease in humans– Powerful iron sequestration ability– Capsule and endotoxin– RT– ???

Recent V. vulnificusInfections

• May 1996 in Los Angeles– Three persons died from Vv– All three were immunocompromised– All had eaten raw oysters 2-3 days earlier– Case 1 traced to a lot from TX– Case 2 traced to a different lot from TX – Case 3 traced to a lot from LA

• September 2006 in Caltham County, GA– Two women died from Vv – both consumed raw

oysters believed to come from the GoM– Both women had severe health problems

V. vulnificus Ecology

• Vv isolated from all U.S. coastal areas• Most prevalent during warm months• Temperature and salinity ranges are 9-

40oC and 5-35 ppt• Optima are 30oC and 5-10 ppt• Appears to associate with marine

animals• Can become nonculturable with stress

KATRINA IMPACT:

PUBLIC HEALTH ISSUES

WATERBORNE DISEASES

D. Jay Grimes, Ph.D.Gulf Coast Research Laboratory

School of Ocean and Earth SciencesThe University of Southern Mississippi

July 27, 2006

“There are major outbreaks of infectious, waterborne disease following natural disasters such as hurricanes, earthquakes, and tsunamis.”

FACT OR FICTION?Threat of disease looms over hard-hit areasBy Robert Davis and Anita Manning, USA TODAY, August 31, 2005Residents of the devastated Gulf Coast region face new threats in the form of disease, health experts fear. Federal health officials are rushing in medical supplies and setting up 40 medical shelters with a total of 10,000 beds staffed by 4,000 health personnel, says Health and Human Services Secretary Michael Leavitt. …"The big worry next is disease. Any time there's that much water and you add heat, and debris and waste, both human and chemicals, we have concerns about chemical contamination, food safety, mosquitoes. … Among the most urgent concerns is the lack of clean water.People who ingest floodwaters contaminated with sewage could contract …

• There are viruses, bacteria, and animal parasites that can be conveyed by water

• Some are naturally occurring in the water

• Some are introduced by contamination of the water

WHAT ARE THE HAZARDS?VIRUSES•Hepatitis A virus•Rotaviruses•Norovirus (Norwalk)BACTERIA•Salmonella typhi (typhoid fever)•Shigella species (dysentery)•E. coli (gastroenteritis, bloody diarrhea)•Staphylococci (wound infections)•Pseudomonas aeruginosa (varied)•Vibrio cholerae (cholera, wound infections)•V. vulnificus (sepsis, wound infections)•V. parahaemolyticus (gastroenteritis,

wound infections)•Clostridium tetani (tetanus)ANIMAL PARASITES•Varied intestinal parasites

WHAT ARE THE SOURCES?

Blue Plains WWTP

Washington, DC

1. POINT SOURCE 2. NONPOINT SOURCE 3. INDIGENOUS

A Charmin® Bear

(Critters that live in the water - - -because it’s their home!)

•Est. that 70 % of the normal input to the U.S. coastal ocean is NPS

•Much of NPS input is anthropogenic

WHAT WERE THE PSs IN MS?Sewage??Biloxi (Keegan Bayou) WWTP – 5 mgd

South Gulfport WWTP – 8 mgd

13 mg

Hurricane Katrina surge –71 billion gal5 gal (790 oz)

1

420,000

1 part in 5,500,000,000(13 mg to 71,000 mg)

A “drop in the bucket” is approximately 1 part in 420,000

0.0016 oz 1

90 mi coastline, 20 ft water, 1,000 ft inland

• Indigenous agents– Vibrio infections (32)

• Introduced (point or nonpoint source)– Methicillin resistant Staphylococcus aureus (30)*– Nontyphoidal Salmonella (1)– Viral gastroenteritis (some Norovirus) (1,000)– E. coli gastroenteritis?*Is MRSA indigenous??

WHAT REALLY HAPPENED AFTER KATRINA & RITA?

• Gastroenteritis (8 cases)– Toxigenic V. cholerae O1 (2)– Nontoxigenic V. cholerae O1 (6)

• Wound Infections (24 cases – 6 deaths)– V. parahaemolyticus (3 - 2 deaths)– V. vulnificus (14 - 3 deaths)

Vibrio INFECTIONS

See MMWR – Sept. 14, 2005, Sept. 26, 2005, and Jan. 20, 2006

What are the Health Risks from Marine Vibrios in the Gulf of Mexico?• Vibrio cholerae

– Cholera– Wound infections– Gastroenteritis

• Vibrio vulnificus– Primary septicemiaa

– Wound infectionsb

– Gastroenteritis??• Vibrio parahaemolyticus

– Gastroenteritis– Wound infections

a b

Satellite-based Remote Sensing

• Satellites can now detectmany physical and chemicalsignals from the ocean

• Emitted signals, e.g., seasurface temperature (SST),are more dependable thanthan reflected signals

• Shallow coastal areas, cloud cover, haze, storms and sensor calibration present problems to accurate RS

• Many RS signals correlate well with real-time or in situ measurements

Our NOAA/OHHI Research Objectives

1. Ground-reference RS data to in situenvironmental factors

2. Determine the relationship between environmental factors and the abundance and distribution of V. parahaemolyticus

3. Generate predictive maps based on RS data4. Develop useful outreach tools: Shellfish Safety

brochure, public aquarium displays and health risk web page

• Methods– RS sea surface temperature, chlorophyll a, and

turbidity obtained from Naval Research Laboratory, Stennis Space Center, MS

– MODIS: MODerate Resolution Imaging Spectroradiometer

– Flies over twice per day– 1-km2 pixel resolution with

MODIS– 1-m2 possible from other

platforms and sensors

Ground-referencing: Does RS provide accurate measurements of

in situ parameters?

Artist’s rendering of Terra – the MODIS platform

Methods: Sampling sites in MS Sound

LAMS AL

2

5 6 8

MISSISSIPPI SOUNDHenderson Point

Grand Bay NERR

Graveline Bayou

Deer Island

Mississippi Sound

20.0

25.0

30.0

35.0

20.0 25.0 30.0 35.0

IS water temperature (deg. C)

RS

wat

er te

mpe

ratu

re (d

eg. C

) surface temperature (IS)bottom temperature (IS)

R2= 0.86, P= <0.001

Objective 1 Results: RS versus in situ SST correlated

Objective 1 Results: RS versus in situchlorophyll and turbidity did not correlate

R2= 0.42, P= <0.001R2= 0.43, P= <0.001

• RS measures emitted energy to determine SST• RS Chl and Turb are measured by reflected energy• Large, 1-km2 pixels

Objective 2 Results: Predicted Vp (SST) vs. observed Vp (tlh) correlated

Mean log10 V. parahaemolyticus/g = -0.84 + 0.11 x SSTr = 0.692 for IS and r = 0.673 for RS

(Phillips et al., 2007, J. Food Prot. 70:879-884, Figure 1)

Objective 2 Results: Relationship between total V. parahaemolyticus (tlh) and salinity

(Zimmerman et al., Appl. Environ. Microbiol., 73:7589-7596 , Figure 4.A.)

log(tlh /ml) = 0.0921 x salinity - 0.22R2 = 0.56

-1

0

1

2

3

0 10 20 30

salinity (ppt)

log 1

0 tlh

/ml

(A)

Objective 2 Results: Relationships between total V. parahaemolyticus (tlh) temperature and salinity

• At present, approximately 50% of Vp abundance and distribution can be explained by SST

• This relationship is explained by a FDA model:

mean V. parahaemolyticus/gram = 0.871 x exp[0.2648 x SST]

• Approximately 75% is explained if salinity is added:

mean log Vp/g = -1.904 + 0.084 x (RS SST) + 0.242 x salinity -0.006 x (salinity2)

(Phillips, et al., 2007. J. Food Prot. 70:879-884.)

Objective 3 Results: Prediction Maps Generated by Remotely Sensed Sea Surface Temperature

(Phillips, et al., 2007. J. Food Prot. 70:879-884, Figures 2 and 3.)

LAMS AL

LAMS AL

SST – May 4, 2004 Mean Vp per g – May 4, 2004

mean V. parahaemolyticus/g = 0.871 x exp[0.2648 x SST]

Objective 4 Brochure: "Remote Sensing: New Applications for Shellfish Safety"

• Fifth-grade level• Displays

– USM Marine Ed. Center– Dauphin Island Sea Lab– MS Dept. Marine Resources– FDA Gulf Coast Seafood

Laboratory– Area colleges and high schools

• Distribution– Area seafood dealers– Restaurants– Coastal MS tourist information sites

Objective 3 & 4 Results: Prediction Maps

• Early draft of the maps that will be available on a web site funded by NOAA’s Oceans and Human Health Initiative

• Initial focus was Mississippi Sound oyster reefs and the abundance and distribution (“risk”) of V. parahaemolyticus

SST – August 5, 2007 Vp risk - August 5, 2007

Bar - archive of past data, GIS information, mitigation scenarios, etc.

SST map, others will follow, e.g., salinity, chlorophyll, DOC

Risk map – what is risk associated with eating raw oysters?

Disclaimer! NOAA, FDA, MS (MDMR), MS (MDEQ), LA (LDWF), USM and others?

The Website Now

Current and Future Directions

• NSF Ecology of Infectious Diseases• Type Three Secretion Systems• Role of urease in vibriosis• Vibrios in Marine Aquaculture• Distribution of Vibrios in Sediment• Distribution of Vibrios in Plankton• Vibrio “Nowcasting” and Forecasting

NSF Ecology of Infectious Diseases

• NSF EID collaborative award to USM and UM• NOAA’s OHH center in Seattle is also a partner• Specific aims

1. Vp, Vv, and Vc densities in water, sediment, and oysters in three ecologically and geographically distinct locations will be correlated with zooplankton and phytoplankton densities and with SST, chl-a, turbidity, salinity, DOC, PP, POC, PN, DIN, and SPM

2. Microcosms containing natural seawater, copepods and pure and mixed cultures of antibiotic-resistant Vibrio spp. will be used to assess the roles of physicochemical changes on the population dynamics of the three Vibrio spp. in the presence of copepods

NSF Ecology of Infectious Diseases

• Specific aims, cont.3. Risk assessment models for raw oyster consumption are

currently available for Vp (U.S. FDA) and Vv (FAO), and a risk assessment for O1/O139 Vc is forthcoming from FAO. The abiotic and biotic data generated from this project will be used to describe the dynamics of the three Vibrio spp. in their environment the risk models will be optimized and developed in collaboration

4. Rep- and ERIC-PCR, PFGE, MLST, and VNTR analyses will be used to determine phylogenetic relationships among Vp, Vc, and Vv isolates from environmental and clinical samples from MS, WA, and MD

NSF Ecology of Infectious Diseases

• Specific aims, cont.5. Direct and indirect fluorescent antibody techniques and a

newly developed method, triangulation identification of genetic evaluation of risk (TIGER), will be used to identify total viable Vibrio spp. in environmental samples; this analysis will be done in collaboration with Dr. Chris Whitehouse at USAMRIID

6. Conduct public outreach programs consisting of (1) an 8-week internship (SumRI) for high school students in MS, WA, and MD; (2) hands-on activities for middle school students who will already be participating in GCRL campus activities via the USM administered Centers for Ocean Sciences Education Excellence: Central Gulf of Mexico (COSEE:CGOM) and the award-winning Project Marine Discovery Programs (PMD) program; and (3) actively pursuing speaking opportunities in area schools

NSF EID Grant – First 4 months

• The 3 sites are very different– Depth, ave. SST, productivity

• Preliminary conclusions– Mississippi Sound has a higher

vibrio detection rate by DP/CH and also higher temperatures than Puget Sound and Chesapeake Bay.

– In MS, there was site-to-site variability in detection rates, even when temperatures were similar.

Role of Type III Secretion Systems 1 and 2 in VpEcology

Vp1669 wild typeTGCTCCGCTCTGCAAGTCGAGTGATGAACCAGTTGTCGAGCCGGATCATCAAGCTTATGCCGCGCATCTGCGTGAAATGTTGGCGAAATATGAAGAGGTCGAGCTGCTTATCAAAATCGGCGAGTACCAACATGGCGCTGACCCGCGAGCCGATCTGGCAATCGCACAAAGTGACGATATTCGCGCCTTTTTACGTCAAGGTACCCATGAGCCAAGCGACCTTGAAGGTGCTATCGCTCAACTGAAAGGCATCGCAGGTCAATGATCGAACGATTATTAGAAATTAAGAAAATTCGTGCAGACCGCGCCGATAAAGCCGTTCAACGCCAAGAATACCGAGTTGCCAACGTGGCGGCAGAGCTGCAAAAAGCAGAACGCTCGGTAGCGGACTATCACGTTTGGCGTCAGGAAGAAGAAGAACGCCGCTTCGCGAAAGCCAAACAGCAAACCGTGCTTCTTAAAGAGCTGGAAACGCTAAGACAAGAAATCGCCCTACTTAGAGAACGGGAAGCCGAGCTCAAGCAGCGCGTAGCAGAAGTAAAAGTGACGTTAGAACAAGAGCGCACTCTGCTAAAACAAAAACAACAAGAGGCCCTTCAAGCCCATAAAACCAAAGAAAAATTCGTTCAGTTGCAACAACAAGAAATCGCGGAACAATCGCGCCAACAACAGTACCAAGAAGAACTCGAGCAAGAAGAGTTTCGCACTGTCGATATTATCTAAAGGTTCATCATGCGCATTAAACCAAGTACGGATACCCCAAGTACGCAGCCTCATTCACCACAATCTCCAATGCCGATTGACGATCATGCCATGCTTCAATCGCGTTTTGAGCGTGCGCTCAAGGAAAACCCAGACCAAACCAAACCACAGCCAAATGAAACCAATAATCAAGCGGCTTTAGAAGCTAAAAAACCGTTTACTGAAAATTACTCAGAGCGCTCTCTTGCGTCACTGCATTCGACAGGTAGCAACCAGCGTAAGACGGCTGAG

•Vp has two “Type Three Secretion Systems” (TTSS1 & TTSS2)

•TTSS1 found on Chr 1 and is common to many bacteria

•TTSS2 on Chr 2 and may be unique??

•Used 4 PCR primers to delete 288 bp from TTSS1

•Transformed the 670 bp deletion mutation into E. coli

•Next into Vp …

•We will also do this with TTSS2

(Nicholas Noriea, thesis research)

TTSS Multiplex Screening• PCR Multiplex screening of 4 genes:

– tlh– VP1669 (TTSS1)

• YscO homologue– VPA1346 (TTSS2)

• YopP homologue– VPA1354 (TTSS2)

• EscU homologue

VPA1354 (553)

VPA1346 (410)

VP1669 (326)

tlh (208)

• Screen all environmental and clinical isolates in collection

•Compare genetic relatedness (MLST), TTSS presence, and presence of hemolysins (tdh, trh, and tlh)

(Nicholas Noriea, thesis research)

Cocktail Sauce?

Maybe not. These shrimp were not boiled but suffered acute bacteremia. Cultures taken from the hemolymph were identified as Vibrio alginolyticus, one of the Vibrio spp. that cause shrimp mortality in aquaculture settings.

(Tracy Berutti)Litopenaeus vannamei (Pacific white shrimp)

Ladd

erNe

g. co

nt.Vp

TX

2103

AQHL

0007

AQHL

0007

- N.

A.Ne

g. co

nt.Vp

TX

2103

AQHL

0007

AQHL

0007

- N.

A.R e p -P C R E R IC -P C R

Generating a Marker in V. alginolyticus

•The pathogenic V. alginolyticus strain was selectively grown for resistance to nalidixic acid to facilitate further testing.

•However, this mutant strain had lost its virulence and could not be used to fulfill Koch’s Postulates.

•This type of resistance  has been shown previously to cause a decrease in bacterial pathogenicity.

(Tracy Berutti)

Vibrios in Red Snapper Aquaculture

• 2007 Morbidity: juvenile RdSn presented with bloating and pale kidneys• Symptomatic fish tested positive for Vv in kidney and ascites tissues• Asymptomatic fish tested negative for Vv• Samples were the clinical strain not the environmental strain (per Jim

Oliver, UNC Charlotte)• Tank water, filter, and flocculent also positive for the clinical strain• 2008 Mortality: RdSn dying; again, kidney and ascites of some fish vvh+

(not all)• Next step: exposure studies

(Adrienne Flowers)

Distribution of Vibrios in Sediment• Vp remains culturable in marine sediments during winter

months, while populations in water and oysters are NOT culturable

• Vp and Vv densities in sediment do NOT correlate with SST or salinity.

• Is marine sediment a source of cold-season infection?• Does it depend on re-suspension events?

Tcrit sediment 10- 15 C° ?Tcrit water 15-20 C° ?

(Adrienne Flowers, dissertation research)

Distribution of Vibrios in Sediment• Develop and standardize test methods (e.g., Modified Elutriate Test)• Direct plating using elutriate vs. slurry• Enumeration with AP labeled oligonucleotides (DP-CH)• Enumeration with indirect immunofluorescence and FISH methods• Vertical profiles: density, dissolved oxygen, grain size

(Adrienne Flowers, dissertation research)

Vibrios and PlanktonDo Vibrio levels correlate with density of

plankton in the water column?• Crustaceans (copepods, barnacle nauplii, amphipods, decapods,

etc.)?• Phytoplankton: diatoms, dinoflagellates, chlorophytes, HABs?• Are the Vibrio cells attached to plankton?• Methods: plankton counts, indirect immunofluorescence, FISH

Copepod(Crustacean)

Coscinodiscus(diatom)

Pseudo‐nitzschia(diatom)

Dinophysis(dinoflagellate)

Discolored water during raphidophyte 

bloom(Adrienne Flowers, dissertation research)

Nowcasting to Forecasting?

• V. parahaemolyticus in molluscan shellfish• V. vulnificus in molluscan shellfish• Vibrios in coastal water at bathing beaches

10,000 Vp/g at 30o15’52”N, 89o06’48”W

SST from MODISPrecise data from a “Tricorder?”

USM’s Marine Microbiology Group

Nick Adrienne Kim Tracy Crystal Jay

AcknowledgmentsThe University of Southern Mississippi

Dr. D. Jay GrimesDr. Crystal N. Johnson

Dr. Greg CarterDr. Kjell Gundersen

Andrea M. ZimmermanAdrienne Russell Flowers

Nick Noriea, IIIDawn RebarchikVeronica Young

Dan HolidayTracy BeruttiMarie Mullen

Verlee BrelandKim Griffitt

Halley Murray

U.S. FDA CFSAN Division of MathematicsJohn Bowers

U.S. FDA CFSAN Gulf Coast Seafood LabDr. Andy DePaola

Dr. Narjol Gonzalez-EscalonaJeffrey Krantz

Naval Research LaboratoryDr. Rick GouldSherwin Ladner

University of MarylandDr. Rita R. Colwell

Dr. Anwar HuqDr. N. Hasan

NOAA Northwest Fisheries CenterDr. Mark Strom

Dr. Rohinee Paranjpye

Supported by:

NOAA’s Oceans and Human Health InitiativeGrant NA-04-OAR4600214

Contract NA-06-OAR4310119

National Science FoundationEcology of Infectious Diseases

Award No. EF-0813285

U.S. Department of AgricultureU.S. Marine Shrimp Aquaculture Consortium