Upload
others
View
0
Download
0
Embed Size (px)
Citation preview
Thesis submitted to the University of Karachi in partial fulfillment of the requirement for the Degree of Doctor of Philosophy in Marine Biology
By
YASMEEN ZAMIR AHMED
M.Sc (Microbiology)
CENTRE OF EXCELLENCE IN M A R I N E B I O L O G Y
UNIVERSITY OF KARACHI
KARACHI-75270, PAKISTAN
October, 2016
MICROBIAL COMMUNITY AND ITS ROLE
IN MANGROVE ECOSYSTEM
i
به نام خدا
AL-KABIR
He is the one who has set free the two kinds of water, one sweet and
palatable, and the other salty and bitter. And He has made between them a
barrier and a forbidding partition.
(Quran, 25:53)
It has been discovered that what distinguishes fresh water from salt water
in estuaries is a “pycnocline zone with a marked density discontinuity
separating the two layers.” This partition (zone of separation) has a
different salinity from the fresh water and from the salt water.
(A brief illustrated guide to understanding Islam. 2nd edition, I.A.
Ibrahim pg., 18)
ii
DEDICATED TO
MY BELOVED PARENTS
PAPA, NAWAZ
‘He didn’t tell me how to live; he lived, and let me watch him do it’ (Clarence Kelland)
AMMI, NARGIS
She’s made of those rare elements that now and then appear,
As if remov’d by accident unto a lesser sphere,
Forever reaching up, and on, to life’s sublimer things, As if they had been used to track the universe with wings.
(A PORTRAIT by Nathaniel Parker Willis)
MY UNCLE MIRAJUDDIN KHAN
Thank you for always being there,
And showing me that you truly care. (Brittany S. Wright)
AND MY FRIENDS & FAMILY
Thank You for All Your Prayers and Moral Support
iii
iv
ABSTRACT
The aim of current experimental work was to explore the importance of microbial
mat present at the mangrove area of Sandspit backwaters, Karachi. The first chapter consists
of an introduction to mangroves in general. In chapter 2, nutrients in the backwater channels
were studied. It was found that nutrient levels were more on site where mat was present as
compared to without mat site. Overall phosphate levels were high throughout all seasons and
the nutrient levels were found in the following order phosphate>ammonium>nitrate>nitrite.
In chapter 3, it was observed that the presence or absence of microbial mat directly influence
the soil. The soil covered with mat have increased water retention, low salinity and pH, high
carbon as compared to soil without mat. In chapter 4, the seasonal rates of potential
nitrification were examined. This process is a significant step in nitrogen cycle and involves
the conversion of ammonium into nitrate. Although there were no drastic changes in rates
with respect to seasons, the presence of microbial mat significantly affects the rates of
potential nitrification. In chapter 5, microbial mats were surveyed. The primary members of
mat include few protozoa, cyanobacteria, bacteria and diatoms. The filamentous forms of
cyanobacteria were responsible for macroscopic green sheath formation on top soil.
Phormidium tenue, Spirulina labyrinthiformis, Spirulina major, Oscillatoria limosa,
Phormidium breve and Oscillatoria prínceps were present in all seasons. In chapter 6,
cyanobacterial metabolites were inspected. Seawater fraction of Aphanocapsa litoralis and
ethanol fraction of Phormidium breve were active against Candida albicans. Phormidium
breve extract was more cytotoxic (LC50 0.02 mg/ml) against Artemia salina as compared to
Aphanocapsa litoralis extract (LC50 6.2 mg/ml). In chapter 7, metabolites of bacteria
associated with microbial mat were screened. Out of 120 isolates only two isolates SSC1407
(Proteus sp.) and SSC14011 (Klebsiella pneumoniae strain) were found to have some
antagonistic activity against isolates of E. coli and Proteus O respectively. SSC1407
tolerated increased levels of temperature and different types of chemicals. SSC14011
tolerated high pH, UV-rays and also produced higher protein yield after successive
purifications. SSC14011 was slightly more cytotoxic (LC50 0.046 mg/ml) against Artemia
salina than SSC1407 (LC50 0.052mg/ml).
v
خالصہ
( کے عالقے میں موجود Mangrove) تمرکے Sandspit backwaters مقام کے کراچیکا مقصد مقالے تحقیقیموجودہ
غذاباب میں، پانی کے چینل کے دوسرے. ھے گیا کیا بیانعمومی تعارف کا تمر ,باب میں پہلےمشاہدہ کرنا تھا. کا میٹمائکروبیل
( عالقہ کا میٹبغیر مائکروبیل کا احاطہ کے تمر برعکس ) کہکیا گیا مشاہدہ( کا مطالعہ کیا گیا. یہ Nutrient Ionsاجزاء ) بردار
مندرجہ ذیل گُنیااجزاء کی بردار غذاتمام موسموں میں .تھیزیادہ وہاںجہاں موجود تھا میٹمائکروبیل مقداراجزاء کی بردار غذا
باب میں، یہ تیسرے. رہا اِضافہ میں مقدارفاسفیٹ< امونیم< نائٹریٹ< نائیٹریٹ. مجموعی طور پر فاسفیٹ کی گئی پائیترتیب میں
بلبالمقامٹی کے والی میٹاثر انداز ہے. بغیر مائکروبیل پہکی موجودگی براہ راست مٹی میٹمشاہدہ کیا گیا کہ مائکروبیل
نامیاتی اور کمیمیں ایچ پیاور نمکینیت، صالحیتمٹی میں پانی برقرار رکھنے کی والی جانے پائیکے ساتھ میٹمائکروبیل
موسمی شرحوں کی جانچ کی گئی. یہ عمل نائٹروجن کی Nitrificationباب میں، ممکنہ چوتھے .گیا پایااضافہ واضحمیں معیار
شرح میں اسکی. اگرچہ موسموں کے حوالے سے ہے کرتا تبدیلنائٹریٹ میں کوامونیم کہ جوہے عملکے چکر میں ایک اہم
کی شرح Nitrificationکی موجودگی نمایاں طور پر ممکنہ میٹ، مائکروبیل آئی نہیں نظرکوئی تبدیلیاں کر بڑھ سے نظر ُمطمح
نیلے اور سبز، پروٹوزوا)چند( میںباب میں، مائکروبیل میٹ سروے کیا گیا. میٹ کے بنیادی ارکان پانچواں. ہے ہوتیپر اثر انداز
والے ِفالمنت سبز. ہیںشامل ڈایاٹم کائی عصیوی، خمیر اور فُطُر(، بیکٹیریا، cyanobacteria) بیکٹیریا کائی رنگ
cyanobacteria کے عالقے کی زمین پر تمرmacroscopic ہیںکے ذمہ دار بنانے سرپوش ماندسبز. Phormidium tenue
Oscillatoria ر ,Spirulina major, Phormidium breve, Spirulina labyrinthiformis, Oscillatoria limosa او
prínceps باب میں، چھٹےموسموں میں موجود تھے. تمامcyanobacteria مادے متحولکے metabolites معائنہ کیا گیا. کا
Aphanocapsa litoralis فریکشن اور ہوا بنا کاکا سمندری پانیPhormidium breve فریکشن ہوا بنا کا الکُحل ایتھائلکا
Candida Albicans رہا َمعائدانہکے خالف .Phormidium breve عصارہ ستکا ( 50LC 0.02 mg / ml )
Aphanocapsa litoralis ( 506.2 LC mg/ ml کے مقابلے میں )salina Artemia ساتویںسائٹوٹوکسک تھا. زیادہکے خالف
نسلمیں سے صرف دو 120کی جانچ کی گئی. metabolitesکے ساتھ منسلک بیکٹیریا کے میٹباب میں، مائکروبیل
(Proteus sp.) SSC1407 اور(K. pneumoniae strain) SSC14011 بالترتیب نےEscherichia coli اور
Proteus O کیا ظاہر ردعمل ُمخاِصمانَہلیٹس کے خالف آئیسوکے .SSC1407 درجہ حرارت اور کیمیائی مادوں کی مختلف نے
steps تزکیہ مختلفاور کیبرداشت اشعہ- UV، ایچ پی زیادہ نے SSC14011. کیا برداشت متحملمیں اضافہ ارتکازاقسام کی
purifications مالاعلی پروٹین ماحصل زیادہکے بعد .SSC14011 (50LC 0046 mg/ ml )SSC1407 بالمقابل کے
(500.052 LC mg/ ml )Artemia salina ہوا ثابت کے خالف زیادہ سائٹوٹوکسک.
vi
ACKNOWLEDGEMENT
First of all, I would like to thank God Almighty for guiding me through every single step of
my life. I wish to express my sincere gratitude to my supervisor who is also my spiritual parent
and my mentor Dr. Seema Shafique, Assistant Professor, Centre of Excellence in Marine
Biology (C.E.M.B), University of Karachi (UoK). Through her vast experience in field and lab,
she has offered her hands on support 24/7 and guided me through to fulfill this Ph.D. study. I am
sincerely thankful to Prof. Dr. P.J.A. Siddiqui and Miss. Zaib-un-Nisa Burhan, Centre of
Excellence in Marine Biology, for their encouragement, expert advice and recommendations.
Many thanks to Dr. Munawwer Rasheed, Dr. Sher Khan Phanwer and Dr. Amjad Ali, Centre of
Excellence in Marine Biology for giving me full access to their labs. Thank you to Dr. Tariq Ali,
Department of Chemistry, for nitrogen tests and technical support. Dr. Adnan Khan, Department
of Geology, UoK , for granting me permission to use lab, Dr. Aqeel Ahmed, Department of
Microbiology, UoK, for providing clinical cultures and incubation facility, Mr. Faiz
Mohammed, Department of Microbiology, UoK, for PCR analysis, Miss. Samiya Kainat
Department of Microbiology, UoK for providing oxidase reagent, Dr. Faraz Moin, Proteomics
Department, UoK, for SDS-PAGE gel testing, Dr. Erum Hanif, Department of Biotechnology,
UoK for reviving and providing hospital culture especially for my research and Mr. Yousuf
Khan, Centralized Scientific Laboratory, UoK for providing gene sequencing software and
guiding me through BLAST analysis.
Many thanks to following honorable scientists for their comments and suggestions during
the compilation of this thesis, Emeritus Professor of Biology Dr. Stjepko Golubic, Boston
University, USA, Prof. Dr. Sairah Malkin, Assistant Professor, Horn Point Laboratory,
University of Maryland Center for Environmental Science, USA, Dr. Elisa Berdalet, Institute of
Marine Sciences (CSIC), Spain, Prof. Dr. Victor N. de Jonge (DSc), Institute of Estuarine &
Coastal Studies, University of Hull, UK and Dr. Mónica Puyana Hegedus, Bióloga Marina de la
Universidad Jorge Tadeo Lozano, Colombia.
Finally, my sincerest appreciation to all my C.E.M.B., UoK, colleagues particularly, Dr.
Shoaib Kiyani, Dr. Parveez Iqbal, Farah Naz, Ambreen Abbas, Rehan, Dr. Safia Mushtaq, Hina
Jabeen, Fouzia Bibi, Saira Naseem, Sundas Iqbal, Afshan Yasmeen, Mehwish Shoaib, Gul-e-
Zehra Naqvi, Aisha Majid Ali, Rabia Bukahri, Saeedul Bukhari and Noreen Farooq. Thank you
to field and lab attendants Naveed, Assad and drivers Naseer baba, Ibrhim for their assistance.
vii
TABLE OF CONTENTS
Page No.
Abstract iv
Abstract in Urdu v
List of Tables xi
List of Figures xiii
PART I. AN INTRODUCTION TO MANGROVES: ITS IMPORTANCE
AND FACTORS AFFECTING MANGROVE ECOSYSTEM
1
CHAPTER 1. General Introduction 2
1.1. Types of mangrove forests 4
1.2. Distribution of mangroves 4
1.2.1. World wide mangrove distribution 5
1.2.2. Worldwide families of Major mangrove 6
1.2.3. Minor mangrove families 7
1.2.4. Mangrove distribution in Asia 7
1.2.5. Mangrove distribution in Pakistan 10
1.3. Effect of climatic factors on mangrove ecosystem 13
1.3.1. Temperature 14
1.3.2. Salinity 14
1.3.3. Tides 15
1.3.4. Moisture and Rainfall 15
1.3.5. Winds and Storms 16
1.3.6. Nutrients 16
1.4. Commercial and curative aspects of mangrove products 17
1.4.1. Edible and non-edible uses 17
1.4.2. Medicinal uses 19
1.5. Community of flora and fauna associated with mangrove
ecosystem
19
1.5.1. Microbial community a major component of mangrove
ecosystem
22
1.6. Societal aspects of mangrove 24
1.7. Aims and objectives of present research 24
viii
Page No.
PART II. INFLUENCE OF MICROBIAL MAT ON SOIL, NUTRIENTS
AND SEDIMENT POTENTIAL NITRIFICATION OF
MANGROVE ECOSYSTEM
26
CHAPTER 2. Seasonal variations in nutrient levels of Sandspit mangrove
backwaters, Pakistan.
27
2.1. Abstract 28
2.2. Introduction 29
2.3. Material and Methods 31
2.3.1. Site Description 31
2.3.2. Sample Collection 35
2.3.3. Sample Analysis 35
2.3.4. Benthic Flux Formula 36
2.3.5. Statistical Analysis 37
2.4. Results and Discussion 37
2.4.1. Physicochemical properties and Nutrient rates 37
2.4.2. PCA and Cluster Analysis 45
CHAPTER 3. Microbial mats associated with mangroves provide soil
stabilization and modify nutrient chemistry over monsoon cycles:
Sandspit backwaters, Pakistan.
56
3.1. Abstract 57
3.2. Introduction 58
3.3. Material and Methods 61
3.3.1. Site Description 61
3.3.2. Field Sampling 61
3.3.3. Sediment Analysis 62
3.3.4. Channel water analysis 63
3.3.5. Statistical Analysis 63
3.4. Results and Discussion 64
3.4.1. Sediment Characteristics 64
3.4.2. Channel Water Characteristics 75
3.4.3. PCA and Cluster analysis 79
3.4.4. Environmental health and Recreational value 86
CHAPTER 4. Seasonal variations in Potential Nitrification rates in mangrove
sediment at Sandspit backwaters, Karachi, Pakistan.
86
4.1. Abstract 87
4.2. Introduction 88
4.3. Material and Methods 90
4.3.1. Sampling 90
ix
Page No.
4.3.2. Lab and Statistical Analysis 90
4.4. Results and Discussions 91
4.4.1. Physicochemical and Potential Nitrification rates 91
4.4.2. State of Potential Nitrification at Sandspit Mangrove 96
PART III. OBSERVATIONS OF DOMINANT CYANOBACTERIA
FORMING GREEN MICROBIAL MAT AND SCREENING OF
ANTAGONISTIC SUBSTANCES (BACTERIOCINS) FROM
MANGROVE MICRO-ORGANISMS.
99
CHAPTER 5. Seasonal abundance of six dominant filamentous cyanobacterial
species in microbial mats from mangrove backwaters in Sandspit,
Pakistan.
100
5.1. Abstract 101
5.2. Introduction 102
5.3. Material and Methods 104
5.3.1. Field Sampling 104
5.3.2. Physicochemical parameters, Microscopy, Biovolume
and Statistical Analysis
104
5.4. Results and Discussion 105
5.4.1. Physical and Chemical Parameters 105
5.4.2. Identification of Dominant Filamentous Cyanobacteria 108
5.4.3 Significance of Filamentous Cyanobacteria in microbial
mat
117
CHAPTER 6. Screening of antimicrobial and cytotoxic activities of marine
cyanobacteria Aphanocapsa litoralis and Phormidium breve
isolated from Sandspit mangrove forest, Pakistan.
120
6.1. Abstract 121
6.2. Introduction 122
6.3. Material and Methods 123
6.3.1. Site and Sampling 124
6.3.2. Isolation of Pure Culture 125
6.3.3. Culture Identification 125
6.3.4. Preparation of Cyanobacterial Extracts 126
6.3.5. Screening for Antagonistic Activity 126
6.3.5.1. Preparation of Test Cultures 127
6.3.5.2. Spot Agar method for screening of
Antagonistic Activity
6.3.6. Protein determination by Bradford Assay 127
6.3.7. Cytotoxic assay 127
6.3.8. Statistical Analysis 128
x
Page No.
6.4. Results and Discussion 128
6.4.1. Identification of Pure Culture 128
6.4.2. Antagonistic Activity 137
6.4.3. Protein Estimation and Cytotoxic Assay 137
CHAPTER 7. Characterization of two antagonistic substances produced by
mangrove bacteria of Sandspit backwaters, Pakistan.
144
7.1. Abstract 145
7.2. Introduction 146
7.3. Material and Methods 148
7.3.1. Sample collection and Preliminary Isolation 148
7.3.2. Identification of Bacterial Strains 149
7.3.3. Preparation of Crude Extracts 150
7.3.3.1. Bioassay of Bacteriocin/antagonistic
substance
150
7.3.3.2. Growth Curve Assay 150
7.3.3.3. Bacteriocin activity unit (AU) Assay 151
7.3.4. Characterization of test Bacteriocin 151
7.3.4.1. Temperature effect on Bacteriocin Activity 151
7.3.4.2. pH effect on Bacteriocin Activity 152
7.3.4.3. Chemical effect on Bacteriocin Activity 152
7.3.4.4. Ultra-violet effect on Bacteriocin Activity 152
7.3.5. Bacteriocin Purification 153
7.3.6. Protein Estimation 153
7.3.7. SDS-PAGE Gel Electrophoresis 153
7.3.8. Cytotoxicity Test 154
7.3.9. Statistical Analysis 154
7.4. Results and Discussion 155
7.4.1. Isolation and Identification of Bacterial Strains 155
7.4.2. Bioassay and Growth curve 158
7.4.3. Characterization of Bacteriocin 158
7.4.4. Purification of Bacteriocin 163
7.4.5. SDS-PAGE Gel Electrophoresis 163
7.4.6. Cytotoxicity Test 163
PART IV. GENERAL DISCUSSION 179
PART V. REFRENCES 187
APPENDIX 247
xi
LIST OF TABLES
S. No. Page No.
I. The main types of Mangrove forest. 4
II. The population percentages of mangrove distributed in the world. 5
III. The Families, Genus and Common names of mangroves widely
found in the world according to the study of Tomlinson, (1986).
6
IV. Table showing in detail the names of families and genus of
mangroves that are less prevalent in the world.
7
V. Mangrove genera of Asia according to the survey conducted by The
Food and Agriculture Organization of the United Nations.
8
VI. Asian countries having mangrove forest cover according to the study
by Adeel and Pomeroy, (2002).
9
VII. Physical parameters of Sandspit mangrove water channel. Mean
(±S.D.) of site during Pre-monsoon, Monsoon and Post-monsoon
seasons (N=03).
39
VIII. Benthic nutrient flux rates by bell jar method of mat and without mat
sites during Pre-monsoon, Monsoon and Post-monsoon seasons per
day mean (±S.D.).
42
IX. Pearson correlation matrix of nutrient ions by bell jar method and
physicochemical parameters.
44
X. PCA results showing the first two components for water
characteristic including nutrient ions and physicochemical variables
of twelve seasonal and mat conditions at Sandspit mangrove site.
47
XI. Nutrient Fluxes determined by Bell jar method in different regions. 50
XII. Nutrient exchange rates of water samples, means (±S.D.), collected in
microbial mat and without mat area.
77
XIII. PCA results showing the first three components for twenty physico-
chemical sediment and nutrient variables in twelve conditions at
Sandspit mangrove.
81
XIV. Pearson Correlations between soil properties (0-10 cm depth) and
Mangrove channel waters properties for the studied sites in Sandspit,
Karachi.
84
XV. Pearson correlation coefficient matrix showing relationship between
top, mid, bottom Rhizoidal and Non-Rhizoidal sections with time,
chlorate concentrations and physicochemical parameters.
95
XVI. Seasonal variations in physical and chemical parameters of water and
sediments from Sandspit backwaters mangroves (Mean± S.D., N=6).
106
XVII. List of organisms observed in microbial mats during the seasonal
study period of Sandspit mangrove area.
107
XVIII. Pearson correlations between dominant filamentous cyanobacterial
species at Sandspit mangrove and environmental field parameters,
(p<0.05).
114
XIX. Antagonistic activity of mangrove associated cyanobacteria (crude
extracts) against different strains.
133
xii
LIST OF TABLES
S. No. Page No.
XX. Cytotoxic assay of crude extracts of cyanobacteria 140
XXI. Probit analysis of Aphanocapsa litoralis (seawater fraction). 141
XXII. Probit analysis of Phormidium breve (Ethanolic fraction). 142
XXIII. General and Colonial characters of isolated mangrove bacterial
strains.
157
XXIV. Antagonistic activity of Sandspit mangrove cyanobacteria against
different clinical strains.
159
XXV. Effect of different chemicals on antagonistic activity of mangrove
bacteria
160
XXVI. Purification of bacteriocin(s) from culture supernatant of mangrove
bacteria.
165
XXVII. Probit analysis of Crude extract of Strain SSC14011. 169
XXVIII. Probit analysis of Crude extract of Strain SSC1407. 170
xiii
LIST OF FIGURES
S. No. Page No.
1. Coastline of Pakistan. The green belt of Keti Bandar covered by Mangroves is clearly visible via satellite image.
11
2. Sandspit mangrove site. (2A) 33
Map of experiment site, Sandspit Mangrove Area, Karachi. (2B) 34
3. Nutrient ion concentration according to tidal cycle during pre- monsoon,
monsoon and post-monsoon seasons.
43
4. PCA Two dimensional plot of field physicochemical variables. (4A) 48
Dendrogram (Cluster Analysis) of physical and chemical variables.
(4B) 49
5. Grain size percent composition of mat covered (M) and without mat
(WM) sediments during pre-monsoon, monsoon and post monsoon seasons.
65
6. Mean (±S.E.) Total Carbon and Nitrogen composition of the sediment in
the Sandspit Mangrove area, M=mat area, WM=without mat fringe area,
N=nitrogen, C=carbon.
66
7. Vertical profiles of (A) Water holding capacity, (B) Moisture content,
(C) Organic matter via Loss of ignition, (D) Carbon-Nitrogen ratio and
(E) Chlorophyll a-b ratio measured at mat covered (M) and fringe
(without mat) (WM) sites during pre-monsoon, monsoon, and post-monsoon seasons. Plotted values are mean of triplicate, (±S.E.).
67
8.
9.
Average values (±S.E.) of soil and water (A) pH, (B) salinity, (C)
temperature, recorded at the study sites of Sandspit mangrove mat area (M) and Fringe without mat area (WM) during the climatic pre-
monsoon, monsoon and post-monsoon seasons.
Average values (±S.E.) of soil and water (A) dissolved oxygen of
waterand (B) bulk density of soil recorded at the study sites of Sandspit mangrove mat area (M) and Fringe without mat area (WM) during the
climatic pre-monsoon, monsoon and post-monsoon seasons.
73
74
10.
Two dimensional PCA ordination of Sandspit mangrove channel waters
variables. 80
11. Dendrogram (Cluster analysis) of physical and chemical variables of channel water and sediments.
82
12. Seasonal observations of field parameters of study site, R= rhizoidal
area, NR= non-rhizoidal area. (N=3, ±S.D. error bars). 92
13. Box plot showing the difference in terms of Potential Nitrification
activity (PN) activity between Rhizoidal (R) and Non-Rhizoidal (NR)
sediments.
94
14.
Filamentous cyanobacteria most abundant at Sandspit mangrove backwaters during the study period. (A) Phormidium tenue (B) Spirulina
labyrinthiformis (C) Spirulina major (D) Oscillatoria limosa (E)
Oscillaoria brevis and (F) Oscillatoria princeps. All the pictures except
Fig. 2 (D) (200x) were taken at 400x.
111
xiv
LIST OF FIGURES
S. No. Page No.
15. Biovolume of the six dominant benthic cyanobacteria at Sandspit
mangrove backwaters. 112
16. Average proportional distribution of the six most dominant
cyanobacterial species at Sandspit mangrove backwaters for the period 2012-2014.
112
17. Abundance of the dominant cyanobacterial species in pre- monsoon
(January), monsoon (April, July) and post monsoon (October) at
Sandspit mangrove area.
113
18. Aphanocapsa litoralis circular cyanobacteria found in the microbial mat
at Sandspit mangrove area. 130
19. Phormidium breve filamentous cyanobacteria found in the microbial mat
at Sandspit mangrove backwaters. 131
20. Spot agar test of cyanobacterial extracts on potato dextrose agar plates
seeded with clinical strain of Candida albicans. 132
21. Probit analysis plot showing effect of Aphanocapsa litoralis seawater extract towards Artemia salina (brine shrimps). (21 A)
Probit analysis plot showing the cytotoxic effect of Phormidium breve
ethanol fraction towards Artemia salina (brine shrimps). (21 B)
134
135
22. Flow chart of extraction of bioactive protein extracts from cyanobacterial strains.
136
23. Bacteria isolated from the microbial mat of sandspit mangrove forest. 156
24. Effect of Temperature on Bacteriocin Activity. (24 A) 161
Growth curve and production of antagonistic activity in LB medium. The activity was monitored at 30 ºC. (24 B)
161
25. Effect of pH on Bacteriocin Activity. 162
26. The effect of UV-light on the isolated bacterial strains. 162
27. SDS-PAGE of Dialyzed fractions of test strains. Samples after dialysis
with 12 kDa cut off membrane. Test Strains showing multiple bands between the range of 95-29 kDa respectively.
166
28. Probit analysis plot showing effect of crude extracts of Bacterial Strain
SSC1407 on Artemia salina (brine shrimps). 167
29. Probit analysis plot showing effect of crude extract of strain SSC14011 on Artemia salina.
168
30. Neighbour joining phylogenetic tree (upper) and fast minimum evolution
tree (lower) based on 16S r RNA gene sequence of isolated SSC1407 bacterial strain.
174
31. Neighbour joining phylogenetic tree (upper) and fast minimum evolution
tree (lower) based on 16S r RNA gene sequence of isolated SSC14011
bacterial strain.
175
1
PART I
AN INTRODUCTION TO MANGROVES: ITS
IMPORTANCE AND FACTORS AFFECTING ON
MANGROVE ECOSYSTEM
2
CHAPTER 1
GENERAL INTRODUCTION
3
Mangroves are Halophytic plants which grow on swampy, clay, muddy and saline soil.
These forests are sometimes referred to as ‘mangrove swamps’ or simply termed as
‘mangal’ (Macnae, 1968). It could be a tree or shrub that reach height of up to 30 feet, and
bears thick leaves which are leathery in texture with various colors of flowers and fruits.
Mangrove plants have the ability to survive under harsh conditions and possess salt glands
or gall like formation that helps in exudation of excess salt. These plants have various
modified forms of root structure (knee, buttress, pneumatophores, stilt etc.). They have
osmoregulation mechanism, viviparous mode of reproduction, sunken stomata and aqueous
tissue (Chaudhuri, 2007). Mangroves can flourish below the high tide and above mean sea
level in intertidal humid salt laden conditions on arid or semi-arid environment, or estuarine
environments in tropical and subtropical region. They are one of the richest evergreen
ecosystems in terms of fertility and natural resources.
Mangrove ecosystems are of great importance because of its multiple benefits to living
beings as it acts as a natural barrier against severe storms, strong winds, extreme tides and
tsunami; mangrove not only provides a cool abode under high temperatures but also acts as a
sanctuary. Mangrove ecosystem enrich nearby waters as it bears mineral rich soil due to
increased rate of decomposition processes and nutrient regeneration (Alongi, Boto and
Robertson 1989; Kathiresan and Bingham, 2001; Shafique, Siddiqui, Aziz, Zaib-un-Nisa
and Mansoor, 2010). Mangrove protects coastlines by decreasing soil erosion rate
(Danielsen, Sørensen, Olwig, Selvam, Parish, Burgess, Hiraishi, Karunagaran, Rasmussen,
4
Hansen and Quarto, 2005) and provides commercially viable products and maintains
sustainable fisheries (FAO, 2007)
1.1. Types of Mangrove Forests:
Table I. The main types of Mangrove forest
S. No. TYPES DESCRIPTION REFERENCES
1) Riverine
Situated along the rivers and creek systems.
They are considered to be the largest
mangrove forests. These forests are exposed to
diurnal tidal activity and fresh water runoff.
Hograth, 1999
2) Fringe
Situated within the high tide range and covers
shoreline and water channel inlets, they can
withstand increased wave pressure and trap
marine and terrestrial sediments.
Hograth, 1999
3) Basin
Situated along the fringe mangrove towards
inland, infrequently inundated by waves or
tidal action, basin mangroves are compatible
with other halophytes.
Cintron, Lugo,
Martinez and
Correa, 1978
4) Dwarf
Wetlands with stunted mangrove, range of one
meter or less, restricted freshwater and
sediment inundation.
Lugo and
Snedaker, 1974
5) Hammock Combination of dwarf and basin mangrove,
found as islands aggregated along coastlines.
Cintron Lugo,
Martinez and
Correa, 1985
1.2. Distribution of Mangroves:
All the mangroves present around the world can be broadly classified into eastern mangrove
and western mangrove with the meridian being the borderline mangrove. The eastern
mangroves mainly cover eastern coast of Africa, Southeast Asia, Australia and New
Zealand. Whereas the western mangroves are present over both coasts of America and west
coast of Africa. The eastern hemisphere has five times more species of trees and shrubs as
5
compared to western hemisphere (McLeod and Rodney, 2006; Ricklefs, Schwarzbach and
Renner, 2006). Mangroves are mostly concentrated between 30º N and 30º S (Tomlinson,
1986) and are present in 112 countries and territories. Global estimates of mangrove
coverage vary considerably, for example, there was research suggesting that mangrove
covers about 14,653,000 ha of tropical and subtropical coastline areas (Wilkie and Fortuna,
2003). Another survey estimates, there were around 15.2 million ha mangroves in the year
2005 (FAO, 2007). Despite anthropogenic pollution, the mangroves of Sundarbans, Mekong
Delta, Amazon, Madagascar, Papua New Guinea and Southeast Asia are still under good
conditions. The largest extents of mangroves around the globe are found in the following
percentages (Giri, Ochieng., Tieszen, Zhu, Singh, Loveland, Masek and Duke, 2011):
1.2.1. Worldwide Mangrove distribution:
Table II. The population percentages of mangrove distributed in the world, (Giri, Ochieng.,
Tieszen, Zhu, Singh, Loveland, Masek and Duke, 2011)
S. No. NAME POPULATION IN %
1) Asia 42
2) Africa 20
3) North and Central America 15
4) Oceania 12
5) South America 11
The exact number of species varies from 50 to 70 depending upon different types of
classifications present. The most variety of species are found in Asia followed by eastern
Africa (FAO, 2007). Mangrove evolved steadily over the Tertiary and its species diversity
varies not only due to climatic factors but also due to certain environmental stress (Ricklefs,
6
Schwarzbach and Renner, 2006). The names of prominent mangrove families with genus are
listed as follows,
1.2.2. Worldwide families of Major Mangrove:
Table III. The Families, Genus and Common names of mangroves widely found in the
world according to the study of Tomlinson, (1986)
S. No. FAMILY GENUS COMMON NAME
1)
Acanthaceae,
Avicenniaceae or
Verbenaceae
Avicennia Black mangrove
2)
Combretaceae
Conocarpus, Laguncularia,
Lumnitzera
Buttonwood, white
mangrove
3) Arecaceae Nypa
Mangrove palm
4) Rhizophoraceae
Bruguiera, Ceriops,
Kandelia, Rhizophora
Red mangrove
5) Lythraceae Sonneratia
Mangrove apple
7
1.2.3. Minor mangrove families around the world:
Table IV. Table showing in detail the names of families and genus of mangroves that are
less prevalent in the world, (Tomlinson, 1986)
1.2.4. Mangrove distribution in Asia:
As compared to any other continent Asia has the largest mangrove population. Under a wide
range of climate and covering regions from arid Middle Eastern peninsula to subtropical
China, Japan to tropical South East Asia, these diverse conditions leads to high amount of
biodiversity in Asian mangrove ecosystem. At present South East Asia harbors 4.9 million
ha or nearly 35 per cent of the world’s total mangroves (Giesen, Wulffraat, Zieren and
Scholten, 2006).
S. No. FAMILY GENUS
1) Acanthaceae Acanthus, Bravaisia
2) Bombacaceae Camptostemon
3) Cyperaceae Fimbristylis
4) Euphorbiaceae Excoecaria
5) Lecythidaceae Barringtonia
6) Lythraceae Pemphis
7) Meliaceae Xylocarpus
8) Myrsinaceae Aegiceras
9) Myrtaceae Osbornia
10) Pellicieraceae Pelliciera
11) Plumbaginaceae Aegialitis
12) Pteridaceae Acrostichum
13) Rubiaceae Scyphiphora
14) Sterculiaceae Heritiera
8
The mangrove forests of Sundarbans are among the densest forests of the world. Although it
has the highest population density in the world, its net forest area is steady at the rate of
1.2% and the net area decreased is not very significant (Giri, Pengra, Zhu, Singh and
Tieszen, 2007). Sundarbans forests are located in Ganga- Brahmaputra delta, falling in India
and Bangladesh. It is a continuous patch of estuarine forest which is the largest patch of
estuarine forest in the world and contains numerous rivers, creeks and waterways
(Chaudhuri, 2007). Some 50 mangrove species are present in Asia belonging to the
following genera (FAO, 2007),
Table V. Mangrove genera of Asia according to the survey conducted by The Food and
Agriculture Organization of the United Nations (FAO, 2007)
S. No. Genus S. No. Genus
1) Acanthus 10) Heritiera
2) Acrostichum 11) Kandelia
3) Aegiceras 12) Lumnitzera
4) Avicennia 13) Nypa
5) Bruguiera 14) Osbornia
6) Camptostemon 15) Pemphis
7) Ceriops 16) Rhizophora
8) Cynometra 17) Scyphiphora
9) Excoecaria 18) Sonneratia
19) Xylocarpus
The top five countries of Asia in terms of mangrove vegetation are; Indonesia, Malaysia,
Myanmar, Bangladesh and India which covers about 80% of mangrove in Asia. Sundarban
forests cover approximately 1 million ha in India and Bangladesh; 60% of this forest is
present in Bangladesh having more species diversity as compared to India due to
considerably low salinity (FAO, 2007). India have 4, 18,828 ha in Sundarbans, 1, 15,000 ha
in Andaman and Nicobar Islands and 1, 47,888 ha in delta of Mahanadi, Godavari, Krishna,
9
Saurastra and Kutch (Chaudhuri, 2007). After Sunderbans the second most important
mangrove reserves are present in Irian, Kalimantan and Sumatra, Indonesia. Malaysia’s
Matang Mangrove Forest Reserve is a large forest and the world’s best managed forest.
Another well managed forest is in Ranong, Thailand. Mangroves on the delta of
Ayeyarwady River, Myanmar have been overexploited and degraded but are still significant.
Towards the Middle Eastern regions, the species diversity reduces to a minimum level due
to arid conditions; Bahrain, Oman, Qatar, Saudi Arabia, UAE, Yemen, and Kuwait have
minimal mangrove vegetation (FAO, 2007). The Table VI below gives an idea about an
extent of mangrove areas in Asia (Adeel and Pomeroy, 2002).
Table VI. Asian countries having mangrove forest cover according to the
study by Adeel and Pomeroy, (2002)
S. No. Country Area (km2)
1) Bangladesh 5,767
2) Brunei Darussalam 171
3) Cambodia 851
4) China and Taiwan 366
5) Hong Kong 2.82
6) India 6,700
7) Indonesia 42,550
8) Japan 4
9) Malaysia 6,424
10) Myanmar 3,786
11) Pakistan 1,683
12) The Philippines 1,607
13) Singapore 6
14) Sri Lanka 89
15) Thailand 2,641
16) Vietnam 2,525
Regional total 75,173
10
1.2.5. Distribution in Pakistan:
Pakistan’s coastline is 1050 km long out of which 350 km belongs to Sind and 700 km to
Baluchistan provinces, respectively (Amjad and Kamaruzaman, 2007a). The vegetation lies
between 24◦ 10’ and 25◦ 37’ latitude North and 61◦ 38’ and 68◦ 10’ Longitude east (Qureshi,
1990). Pakistan have semi-arid climatic conditions and have the largest semiarid region
mangroves in the world (Amjad, Kasawani and Kamaruzaman, 2007b). Climatic factors
play an important role in the current distribution of mangrove in Pakistan. These factors are
also responsible for gradual decrease of mangrove population (Saifullah, Chughtai and
Akhtar, 2007).
Indus delta is fan shaped delta present on the boarders between Pakistan and India. It
occupies south eastern coast in Sind from north of Karachi to Indian boarder in southeast
and along the Baluchistan coast. It contains huge quantities of silt from Karakoram and
Himalayan ranges. It covers total area of about 600,000 ha and consists of 17 major creeks
and numerous minor creeks, mudflats and fringing mangroves (IUCN, 2007; Baig, Ahmed,
Khan, Ahmed and Straquadine, 2008). In Sind 95% of mangrove of Indus Delta comprises
of mainly monospecific Avicennia marina (locally called in Sind as Timmer) (FAO, 2007)
that can reclaim waterlogged and saline areas of Sind (WWF, 2005; Nazim, Ahmed, Khan,
Khan, Wahab and Siddiqui, 2010). The rest comprises of Ceriops tagal (Chaanhr) and
Aegiceras corniculatum (Chor). Apart from these three species, Rhizophora Mucronata have
successfully been established in over five thousand ha of the Indus Delta (IUCN, 2007).
11
Fig
ure 1
. C
oast
lin
e o
f P
akis
tan. T
he
gre
en b
elt
of
Ket
i B
andar
co
ver
ed b
y
Man
gro
ves
is
clea
rly
vis
ible
via
sat
elli
te i
mage (
WW
F, 2
00
5).
12
The soil of the mangrove is fine alluvium derived from land drainage and erosion (Qureshi,
1990). The other province which have mangrove forests is Baluchistan. It possesses
relatively lower density and commonly found in prier conditions. About 4.68 % of total
mangroves of Pakistan are situated here. Miani Hor, Kalmat Hor, Gawadar Bay and Jiwani
are the primary areas that contain 84% of total mangrove of Baluchistan province. Miani
Hor is a tidal lagoon having most of mangrove vegetation around 3431, 36 ha (42%). It is
approximately 50 km long and 20 km wide. Aviciennia marina (locally called in Baluchistan
as Timmer), Rhizophora mucronata (Kumri) and Ceriops tagal (Kain) are the only
mangroves species which are naturally occurring in this province (IUCN, 2007; WWF,
2005). Miani Hor is also the only area in Pakistan where all three species are present
naturally (Amjad and Kamaruzaman, 2007a).
Pakistan Space and Upper Atmosphere Research Commission (SUPARCO) conducted a
study on Pakistan mangrove ecosystem in the year 2005 and it was estimated that the total
mangrove forests covered an area of about 557, 60 sq km that started form Dabbo Creek to
Sir Creek near the Rann of Kutch (SUPARCO, 2006). The mangrove area of Pakistan has
reduced from 345, 000 ha in 1980 to 158, 000 ha in 2001 which makes 8,905 ha or 1.15%
loss of vegetation per annum (FAO, 2005). To overcome these losses various projects have
been initiated to create awareness and rehabilitation of mangrove in Pakistan such as
UNESCO (United Nations Educational, Scientific and Cultural Organization) Regional
Mangroves Project, Rehabilitation and Replanting of Indus Delta Mangroves Project, The
International Union for Conservation of Nature and Natural Resources (IUCN) -Pakistan's
Korangi Ecosystem Project, Social forestry project by IUCN-Pakistan and the Sindh forests
13
department, and IUCN Korangi Phitti Creek Mangrove Project. All these were conducted in
association with foreign environmental protection organizations (Baig, Ahmed, Khan,
Ahmed and Straquadine, 2008). The 1990 joint venture between Govt. of Pakistan and
World conversation Union was successful and resulted in the rehabilitation of approximately
19,000 ha of Avicennia marina and Rhizophora mucronata. Similarly, in 1999 World Bank
facilitation provided restoration of about 17,000 ha of Indus delta mangrove (FAO, 2007).
1.3. Effect of Climatic factors on Mangrove Ecosystem:
Climatic factors are very essential for mangrove sustainability. The mangrove forests are
distributed around different regions of the world according to temperature and rainfall
regimes which are the leading factors as these factors influence species richness, average
height, and maximum size of mangrove trees. Soil at low precipitation and high evaporation
rates ultimately results in hypersaline conditions. The mineral and nutrient content in
sediments are also affected by these factors (Hamilton and Snedaker, 1984; Kathiresan and
Bingham, 2001). Mangroves are mainly found in following climatic regions all around the
world:
1) Equatorial zone: between 10◦ N and 5 to 10◦ S.
2) Tropical summer rainfall zone: N and S of equatorial zone, 25-30◦ N and S., partly in
subtropical dry zone, pole ward.
3) Warm temperate climate, eastern border of the continents.
14
1.3.1. Temperature, influence and limit the mangrove population directly. During winter the
number of species decline. Generally increased varieties of species are found where
temperatures along with rainfalls are highest. In dry seasons precipitation is equal to or less
than twice the mean temperature, while the precipitation is above the temperature curve, the
period is considered to be humid and vice versa results in dry condition. Mangroves are
extremely sensitive to lengthy periods of frost with exception to some Avicennia species (A.
marina, A. germinans). Most mangroves are unable to germinate under 16ºC (Hamilton and
Snedaker, 1984). In mangrove area of Pakistan climate is considered to be warm where mild
winter months extends from November to February and summer lasts from March till June.
The temperature may range from 10ºC up to 41 ºC (IUCN, 2005; Gilman, Ellison, Duke and
Field, 2008).
1.3.2. Salinity, appears to control mangrove species distributed according to their salinity
tolerance range (Saifullah, Shaukat and Shams, 1994. Therefore, different species have a
preferred location from sea mouth to tidal limit upstream. Salinity gradient can be roughly
divided into upstream (where salinities are influenced by hypersaline runoff or fresh water
input), intermediate and downstream areas (where salinities are influenced by sea water).
Under humid conditions less salt resistant species are found in landward zone having swamp
forest ecosystem nearby. Whereas, under dry conditions the area may be affected by severe
droughts, as a result, high salt tolerant species are found in landward zone having bald areas
nearby. Bald patch areas have such high salinity that all the plantations are completely
wiped out except extreme halophiles (Hamilton and Snedaker, 1984; Kathiresan and
Bingham, 2001).
15
1.3.3. Tides, are also one of the major climatic factors influencing mangrove’s diversity and
distribution. Mangroves are adapted to survive in tidal marine locations and it keeps up with
the tides extreme actions by constantly regenerating and acclimatizing in the exposed tidal
environments. Mangrove areas exposed to heavy tidal actions are usually dominated by
small number of relatively hardy species. Different mangrove species occupy different
positions with respect to tidal profile present in that area thus forming distinct tidal areas.
Tidal zones of mangroves can be divided into lower, middle, and higher zones. Apart from
tidal actions, floral species competition and predation by faunal elements also influence
different species of mangrove to cover different high, low or intertidal areas (Shafique,
Siddiqui and Farooqi, 2015). The heavy tidal waves begin from June and lasts till
September. The tidal water runs four times in 24 hours. The source of mangrove areas soils
of Pakistan is mainly from Indus River which is then worked up by coastal tides and
deposits sediment close to coastal area (Kathiresan and Bingham, 2001; IUCN, 2005;
Gilman, Ellison, Duke and Field, 2008; Siddiqui, Farooq, Shafique and Farooqui, 2008).
1.3.4. Moisture and Rainfall, influence the mangrove population immensely. There is
maximal species diversity along the warm northern tropical coast where the climatic
conditions are uniformly present. Greatest species numbers of flora and fauna are found in
the regions where mean annual rainfalls are at higher rates. Mangrove develops best where
rain falls abundantly and evenly throughout the year. In mangrove areas of Pakistan, the
rainfall patterns are unevenly distributed throughout the year and the average rainfall is 200-
220 mm. June, July and August are the peak months of rainfall reported by IUCN, (2007),
Gilman, Ellison, Duke and Field, (2008) and Farooqui, (2012).
16
1.3.5. Wind and Storms, effect mangrove ecosystem as they simultaneously act as a
constructive and destructive force. Winds carrying sand not only modify the coastal
morphology but affect the evolution of mangrove in that area. It also transports huge amount
of sand, silt, and clay along with nutrient content. On the other hand, storms may seem very
destructive resulting in the blunt destruction of mangrove but it also plays a very vital role in
the dispersal of propagules either to adjacent areas or to distant offshore regions where
mangrove develop best. In terms of intensity, the storms can be classified from minor to
destructive respectively (Hamilton and Snedaker, 1984). In Pakistan, severe storm at the
speed of 130 km/h was recorded in June 1936 near Karachi. Otherwise the coastline rarely
faces heavy cyclones. Recently in the year 2014, cyclone Nanauk caused some major
damage to Karachi coastline and adjacent mangrove forests. The wind speed in Pakistan’s
mangrove area is highest in monsoon season in summer the wind speed is 7.5 to 20.5 km/h
(Kathiresan and Bingham, 2001; McLeod and Rodney, 2006; IUCN, 2007; Gilman Ellison,
Duke and Field, 2008; Benfield, 2014). It is evident from the above studies that climatic
factors help mangrove to achieve the maximum size, density and specific diversity
respectively.
1.3.6. Nutrients, in mangrove forest apperas to be the function of decomposers that
mineralize accumulated organic matter, transform and immobilize nutrients in mangrove
habitat and (Cherif and Loreau, 2009). Nutrient exchange between water and sediment is a
biogeochemical process (Pederson, Nielson and Banta, 2004) which may occur during tidal
inundation and also by pore water translocation (Ovalle, Rezende, Lacerda and Silva, 1990).
Sediment plays a predominant role in nutrient cycling. The microbial communities
17
(cyanobacteria, bacteria, fungi etc.) also catalyze increasing the rate of nitrogen content
(Hograth, 1999). In mangrove ecosystem, Nitrite, Nitrate, Ammonia and Phosphate are
considered to be among essential nutrients which are required by mangroves for metabolic
processes (Hwang and Chen, 2001) these inorganic ions are available due to the nitrification
and denitrification processes. Ammonium is disseminated form the mangrove sediment
(Robertson and Alongi, 1992) which is ultimately assimilated via nitrification by sediment
associated micro flora (Fernandes, Bonin, Michotey, Garcia and LokaBharathi, 2012). The
net nitrogen flux is influenced by the process of denitrification (Alongi, 1993). Phosphate is
significant in terms of bacterial metabolic activities and is an integral component of the
genetic material essential for reproduction hence it is readily assimilated by sediment
microbes and also improves mangrove growth (Glick, 1995; Behera, Singdevsachan,
Mishra, Sethi and Thatoi, 2016). In Pakistan, there is no recent the research on nutrient
exchange rates related to Sandspit mangrove and channel water. Earlier studies related to
mangrove tiadl creek nutrients by Harrison, Khan, Yin, Saleem, Bano, Nisa, Ahmed, Rizvi
and Azam, (1997) and pore water analysis conducted by Farooqui, (2012) and Shafique,
(2004) but, those observations were mainly supporting works for Phytoplanktons, litter
decomposition meiofaunal abundance.
1.4. Commercial and Curative aspects of Mangrove products:
1.4.1. Edible and Non edible uses, Mangrove primarily is a source of wood for many
fishermen, farmers and nearby population. This wood is used for firewood, timber, charcoal,
posts, for construction of domestic houses, bridges, fences, lattice, drainage pipes,
18
chipboard, fishing traps, furniture, tool handles, toys, match sticks, floats and boats. The non
woody parts are used as fodder, glues, fish poison, tannins, green manure, paper production,
sugar, alcohol, sugar, honey and wax production etc. The edible vegetables are obtained
from propagules, fruits and leaves which are also used as salads. Legumes are a good protein
source to be used for human consumption; condiments are obtained from bark, incense.
Synthetic fibers, cloth dyes, packing materials, shell decoration pieces, ropes, mats, baskets,
perfume material, rayon and pesticides are all obtained from mangroves, respectively. The
mangrove fauna provides food source such as, finfish, prawns, shrimps, crabs, oysters,
mussels, cockles, honey, wax, are used for protein source, feathers for bait making, the
grazing animals can be used for food. Mangrove forest itself serves as an ideal place for
aquaculture, apiculture and eco-tourism etc. (Hamilton and Snedaker, 1984; Untawala,
1998; Rönnbäck, 1999; Depommier, 2003; Chaudhari, 2007; FAO, 2007; Pattanaik, Reddy,
Dhal and Das, 2008; Walters, Rönnbäck, Kovacs, Crona, Hussain, Badola, Primavera,
Barbier and Dahdouh, 2008).
In Africa, Asia, North and Central America, Oceania, South America mangroves are used
mainly for Fuel, construction, tannin, medicine, beverage and fisheries (FAO, 2007). There
are few exceptions such as use of natural pesticides (Laguncularia racemosa) in Africa,
Thatching material (Nypa fruticans) is used in Asia commonly, In Cuba mangrove
communities mainly depend on oysters, honey and wax and in Caribbean the mangrove are
converted into Marianas (FAO, 2007). In Pakistan mangroves are mainly used as breeding
grounds for commercially important fishes and as sanctuary by migratory birds. Its fuel
wood and fodder is used by nearby fishermen village community (Snedaker, 1984; Qureshi,
19
1990; Qureshi, 1996; Saifullah, 1997; Bandaranayake, 1998; Khalil, 1999; Khalil, 2000;
Amjad and Kamaruzaman, 2007; Siddiqui, Farroqui, Shafique and Farooq, 2008; Adhikari,
Baig and Iftikahr, 2010; Mukhtar and Hannan, 2012; Abbas, Mueen, Ghaffar, Khurram and
Gilani, 2013; Salik, Jahangir, and Hasson, 2015).
1.4.2. Medicinal uses, traditionally, various types of medicines are obtained from bark,
leaves and fruits of mangrove which are used for the treatment of several health
complications and diseases such as, wound healing, antiseptic, asthma, diabetes,
rheumatism, cuts and bites, boils, skin disorders, ulcers, contraceptives, small pox, diuretic,
leprosy, hepatitis, jaundice, scabies, malaria, haemorrhage, veneral infection, stomach aches,
paralysis, diarrhea, laxative, cough, nausea, sore throat, fever. (Pattanaik, Reddy, Dhal and
Das, 2008). Mangrove contains antioxidants and have potential antitumor, cytotoxic, anti-
inflammatory, antiulcer and antiradical activity (Banerjee, Chakrabarti, Hazra, Banerjee,
Ray and Mukherjee, 2008).
1.5. Community of Fauna & Flora associated with mangrove ecosystem:
A mangrove ecosystem sustains and harbors variety of fauna and flora including unicellular
(bacteria, cyanobacteria, diatoms, fungi, and fungi like protists) to multicellular (macro
algae, seagrasses zooplankton, sponges, ascidians, epibenthos, infauna and meiofauna,
prawns, shrimps, crabs, crustaceans, insects, mollusks, fishes, amphibians, reptiles, birds and
mammals). All these organisms form a food web and maintain energy fluxes in mangrove
ecosystem (Macnae and Kalk, 1962; Sasekumar, 1974; Kathiresan and Bingham, 2001).
20
Mangrove ecosystem also provides breeding and nursery grounds for wide variety of
commercially important fish and shellfish species. Over all, around the world 48 bird, 14
reptiles, 1 amphibian, and 6 mammal species endemic to mangroves have been reported
(Luther and Greenberg, 2009).
In Pakistan, various research projects have been undertaken that were related to mangrove
flora and fauna. Studies on Avicennia marina were related to Inorganic content analysis of
leaves (Ilyas and Siddiqui, 1989), population density (Saifullah, Shaukat and Shams, 1994;
Saifullah and Rasool, 2002), potential salt tolerance and osmoregulation (Dagar, 1995; Aziz
and Khan, 2000; Khan and Aziz, 2001; Khan, Adnan and Aziz, 2016), pneumatophore
(Saifullah and Elahi, 1992), associated macro algal puffs flora and fauna (Siddiqui,
Mansoor, Burhan, Shafique and Farooqi, 2000), microalgal community assessment
(Yasmeen, Shafique, Zaib un Nisa and Siddiqui, 2016) disease control (Tariq and Dawar,
2011) foliage and litter decomposition (Qasim, Barkati, Siddiqui ans Ilyas, 1986; Siddiqui
and Qasim, 1990; Siddiqui and Qasim, 1994; Siddiqui, Farroqui, Valeem, Rasheed and
Shafique, 2009; Farooqui, Shafique, Khan, Ali, Iqbal and Siddiqui, 2012; Shafique,
Siddiqui, Aziz, Burhan, Mansoor and Nafisa, 2013). Other studies include mangrove forest
eocphysiology (Khan, 1998; Siddiqui, Farooq, Shafique, Burhan and Farooqi, 2000; Aziz
and Ajmal, 2001) and mangrove forest cover along the coastline of Pakistan (Abbas, Qamer,
Hussain, Saleem and Nitin, 2011).
Fauna that are frequently recorded in local mangrove ecosystems mostly consists of fishes,
crustaceans and molluscs (Ahmad, 1997; Barkati and Rahman, 2005). Ali, Arshad and
21
Akhtar (2003) observed 125 birds, 12 reptiles and 11 mammals’ species near Mekran
wetland complex of Baluchistan province. Gondal, Saher and Qureshi (2012) observed 84
different species of fauna (mainly belonging to families Mugilidae, Sillaginidae, Portunidae,
Penaeidae, Diogenidae, Nassariidae and Dentaliidae) of Somiani bay, Baluchistan province
mangroves and neighboring areas. Barkati and Rahman, (2005) listed detailed composition
of 66 species of invertebrates from Sandspit, Clifton and port Qasim mangrove areas of Sind
province. Khan, (1999) reported intermittent herpatofauna associated with mangrove and
adjacent areas. Saifullah and Chaghtai, (1993) reported some diatoms from Sandspit
mangrove site. Population of mangrove related gsatorpods were earlier survayed by Barkati
and Tirmizi, (1987). Feeding patterns of Cerithium sp. (Seema, 2004) and population
structure and distribution of Cerithideopsilla cingulata (Khan, Saifullah, Qureshi, Shaukat
and Chaghtai, 1999; Shafique, Siddiqui and Farooqui, 2015) which are common mangrove
gastropods were also reported.
Studies related to mangrove fisheries were focused on red snapper’s population, nutritional
evaluation and its influence on growth (Abbas, 2002; Abbas and Siddiqui, 2003; Ghulam,
Khalid, Rukhsana and Lin, 2005; Jamil, Abbas, Akhtar, Lin and Li, 2007; Abbas and
Siddiqui, 2009; Abbas, Siddiqui and Jamil, 2011). Population and abundance of shrimps
(Sultan and Mustaquim, 2001; Ayub and Muzammil, 2001; Sultan and Mustaquim, 2006),
distribution and morphology of mud crabs (Mustaquim, Imtiaz and Sultana, 2001; Mushtaq
and Mustaquim, 2009) and population of other crustaceans (sandspit backwaters), that were
reported by Khanam, Mustaquim, and Ayub, (2014). The mesozooplankton (Qureshi and
Saher, 2014) and meiobenthos studies (Qureshi and Sultana, 1999; Qureshi, Naz and Saher;
22
2016) of mangrove areas were also carried out respectively. Hymenoptera (bees) study at
mangrove of Sandspit, Karachi was conducted for the first time by Farooq (2010)
1.5.1. Microbial community a major component of mangrove ecosystem:
Microbial communities are very significant pillars of mangrove ecosystem and mainly
comprises of decomposers i.e. bacteria and fungi which are responsible for providing
pathways for primary productivity and effective recycling (Alongi, Boto and Tirendi, 1989;
Venkatesan and Ramamurthy, 1971; Hall-Stoodley, Costerton and Stoodley, 2004; Graham,
2013). These decomposers are present in sediment, water and are also associated with
different part of mangrove (roots, barks, leaves etc.) in the form of microbial mat. This mat
also sustains other microorganisms such as diatoms and protozoa. The major inhabitants of
mangrove microbial communities includes cyanobacteria, bacteria, fungi and diatoms
(Mehdi and Saifullah, 1992; Saifullah and Chaghtai, 1993; Bano, Nisa, Khan, Saleem,
Harrison, Ahmed and Azam, 1997; Manzoor, Siddiqui, Bano and Zaib-un-nisa, 2000; Mehdi
and Saifullah, 2000; Tariq, Qawar and Mehdi, 2006; Sahoo and Dhal, 2009; Gosh, Dey,
Bera, Tiwari, Sathyaniranjan, Chakrabarti and Chattopadhyay, 2010; Nizam, Khan, Ameen,
Naz and Noureen, 2012; Ahmed, Shaukat and Khan, 2013; Latif, Ayub and Siddiqui, 2013;
Yasmeen, Shafique, Zaib un Nisa and Siddiqui, 2016), that generate nutrient in the adjacent
sediments and water areas, (Garnier, Billen, Némery and Sebilo, 2010) and plays an
important role in terms of nutrient flux , assimilation (mainly conversion of nutrient from
complex into simpler forms) management and also litter decomposition on muddy mangrove
sediment (Holguin, Guzman and Bashan, 1992; Bano, 1997; Harrison, Khan, Yin, Saleem,
23
Bano, Nisa, Ahmed, Rizvi and Azam, 1997; Seema, 2004; Hara, Havehidoko, Desyatkin,
Hatano and Tahara, 2009; Woulds, Schwartz, Brand, Cowie, Lawb and Mowbray, 2009).
The bacteria present in microbial communities also have some defensive antagonistic
substances (bioactive compounds) which enable it to survive among variety of different
microbial species (Rajesh, Karthikeyan and Jayaraman, 2012). These substances act as
quorum sensing and defensive agents against other species of bacteria and have a potential
to act as a probiotic against certain pathogenic strains of commercially important fisheries
(Verschuere, Rombaut, Sorgeloos and Verstraete, 2000; Powell, 2006; Mollendroff, 2008;
Yi, Zhang, Tuo, Han and Du, 2010; Ghanbari, Rezaei, Soltani and Shah-Hosseini, 2009;
Ghanbari and Jami, 2013).
Studies in Pakistan are mainly from terrestrial sources which shows a positive antagonistic
effect against harmful strains (Ahmad, 2003; Faheem, Saeed and Rasool, 2007; Tariq,
Dawar, Mehdi and Zaki, 2007; Hussain, Khan, Wajid and Rasool, 2008; Jabeen, Gul,
Subhan, Hussain, Ajaz and Rasool, 2009; Yasmin and Bano, 2011; Naeem, Ilyas, Haider,
Baig and Saleem, 2012; Naz and Rasool, 2013; Yasmin, Bano and Samiullah, 2013) but
there are very few studies exploring marine bacteria’s bacteriocin (and bacteriocin like)
potential (Pirzada, Nasir and Rasool, 2000) and there is no recent study exploring the role of
microorganisms in mangrove areas of Pakistan.
1.6. Societal aspects of mangrove:
24
Mangroves serve as a way of living and permanent home for locals around the world. In
Australia the mangrove areas were managed by Indigenous people and still bears cultural
significance to them as they obtain food, timber, and heal stingray stings from Avicennia
marina bark. In Colombia, Ecuador, Guyana and Peru production of charcoal form
mangrove forests is a traditional practice (FAO, 2007). In Pakistan, the main communities
that live near Baluchistan province mangroves are the people of Damb village, Baloch
Goath and Bira village. Whereas Indus Delta’s main communities are Mallaha and Dablas
whose main profession is fishing and cattle farming, but due to reduced silica content,
decreased river flow, Sea water intrusion, sea level rise, over harvesting and other forms of
anthropogenic mangrove exploitations, there is now 70% decline in fishing and farming in
these areas. All of which resulted in to mass migration of locals over the period of several
years (Amjad and Kamaruzaman, 2007a; Amjad, Kasawani and Kamaruzaman, 2007b).
This sort of anthropogenic destruction is common all over the world (FAO, 2007; Islam,
2007).
1.7. Aims and Objectives of Present Research:
In Pakistan very little is known about the nutrient flux, microbial communities and
their role in mangrove ecosystem. Therefore, due to the scarity of data present study
was initiated. The aim and objective of the present research are:
To explore the mangrove ecosystem with specific reference to microbial mats.
25
To understand the pattern of microbial mat composition with respect to seasonal
fluctuations.
To estimate major nutrients present using physical and chemical variables and
observe the net nutrient flux in terms of tidal cycle and microbial mat influence on
nutrients.
To investigate the different soil and water parameters involved in mangrove area its
effect on our study area.
To observe the potential nitrification rates with respect to seasonal variations and
observe whether the presence of mat effect the rates or not.
To explore whether mangrove related bacteria and cyanobacteria have the ability to
produce bioactive or pharmacologically significant antagonistic substances against
common clinical and environmental bacterial strains.
26
PART II
INFLUENCE OF MICROBIAL MAT ON SOIL,
NUTRIENS AND SEDIMENT POTENTIAL
NITRIFICATION OF
MANGROVE ECOSYSTEM
27
CHAPTER 2
SEASONAL VARIATIONS IN NUTRIENT LEVELS OF
SANDSPIT MANGROVE BACKWATERS, PAKISTAN
(Manuscript submitted for Publication)
28
SEASONAL VARIATIONS IN NUTRIENT LEVELS OF
SANDSPIT MANGROVE BACKWATERS, PAKISTAN
2.1. Abstract:
Nutrient flux of Sandspit mangrove backwaters was determined using Bell jar method. The
inorganic nutrients NO2-, NO3
-, NH4+ and PO4
3- were measured in situ in areas of the
mangrove forest with and without the microbial mat cover. To observe the variations in
nutrient rates outside the bell jar, samples were withdrawn using polyethylene bottles. The
nutrient flux ranged for NO2- (-0.08 ±0.35 to 0.11 ±0.09 mol.m-2 d-1), NO3
- (-1.52 ±0.80 to
1.18 ±0.31 mol.m-2 d-1), NH4+ (-31.68±46.44 to 5.3 ±1.65 mol.m-2 d-1) and PO4
3- (-0.16
±0.23 to 0.67 ±0.05 mol.m-2 d-1) respectively. The results show that the overall nutrient
exchange rate was Higher in the mat-covered area than in the area without the mat cover.
The directly measured concentration of nutrient ions was higher inside the bell jar then
outside. Seasonal variations had a prominent effect on the nutrient fluxes. Tidal height had
significant effect on nutrient concentrations within the water channel. Other physical
parameters such as pH, salinity, temperature, dissolved oxygen and chlorophyll-a content
had variable apparent effect on nutrient ions and some were significantly correlated
(p<0.005) with NH4+ and NO3
-. Results indicate that nutrient flux at the benthic level is
responsible for nutrient dynamics and serve as a nutrient sink. The net nutrient rates were
low implying that direct terrestrial runoff in the area of study is not significant to the nutrient
flux rates.
29
2.2. Introduction:
Estuarine ecosystem creates a unique biodiversity. Sandspit mangrove forests are located at
the southern parts of Karachi city. It borders a tidal channel, which constantly receives
seawater from the Arabian sea and drainage water from surrounding residential and
industrial areas located at various points (Harrison, Khan, Yin, Saleem, Bano, Nisa, Ahmed,
Rizvi and Azam, 1997). The narrow channels have varying depth from 0.03 to 2.7m. The
area is exclusively occupied by the mangrove species Avicenna marina. Mangrove forests
are highly productive ecosystems of tropical intertidal areas (Rivera-Monroy, Day, Twilley,
Vera-Herrera and Coronado-Molina, 1995; Alongi, 2002). They maintain high nutrient
turnover rates (Alongi, 1994; Kristensen, Andersen, Holmboe, Holmer and Thongtham,
2000). Sandspit mangrove area release considerable levels of organic matter (Siddiqui and
Qasim, 1986). These studies revealed the significance of mangroves habitat as they provide
food, fodder and fuel, as well as serving as sanctuary for various fishes and shellfishes
(Hotel 1995; Badola and Hussain, 2003). Mangrove complex ecosystem is heavily
influenced by several factors that are involved in an efficient nutrient transformation and
exchange (Mendelssohn and Morris, 2000), including the tidal cycle, fresh water input and
rainfall, as well as microbial activities such as denitrification rates (Nixon, Oviatt and Hale,
1976; Widdows, Brinsley, Bowley and Barrett, 1998; Ensign, Hupp, Noe, Krauss and Stagg,
2014). Nutrient transformation within mangrove area provides nutrients to sustain the food
web (Bragadeeswaran, Rajasegar, Srinivasan and Rajan, 2007) and it is essential to maintain
water quality. Microbial processes act as a catalyst and efficiently transform nutrients from
complex to its simpler forms. Mangrove associated microbial flora efficiently mineralizes
the organic material (Nedwell, 1994). It also converts nitrogen from organic and dissolved to
30
gaseous state (Francis, Beman and Kuypers, 2007; Gomezulu, 2013). The cell growth of
bacteria associated with the sediment of mangrove forest may also contribute to the rates of
microbe-associated mineralization (Alongi, 1989). The Benthic microalgal communities
forming the mat cover are directly involved in mangrove nutrient dynamics (Rizzo and
Christian 1996; Pinckney and Zingmark, 1993) and play an important role in nitrification
and denitrification in intertidal sediment area (Magalhães, Joye, Moreira, Wiebe and
Bordalo, 2005; Koop-Jakobsen and Giblin, 2009). The microbial mats consist of
cyanobacteria (microalgae), bacteria, fungi, diatoms and some protozoa; they are diverse
and form a close community (Hosack, Dumbauld, Ruesink and Armstrong, 2006).
Considering the significance of mangrove ecosystem in nutrient generation, extensive
studies have been conducted to evaluate the nutrient budget (Ray, Majumder, Das,
Chowdhury and Jana, 2014), rate of nitrogen and phosphorus accumulation (Chiozzini,
Agostinho, Delfim and Braga, 2014), effects of seasons and tides on nutrient flux rates
(Mwashote and Jumba, 2002; Prabu, Rajkumar and Perumal, 2008), role of microbes in
elemental cycling of nutrients (Lee, Porubsky, Feller, McKee and Joye, 2008) and rate of
nitrogen transformation and uptake in mangrove sediment (Alongi, Sasekumar, Chong,
Pfitzner, Trott, Tirendi, Dixon and Brunskill, 2004).
In Pakistan, there are some supplementary data related to concentration of nutrient ions,
general hydrography (Shafique, 2004) and pore water chemistry (Farooqui, 2012) of
Sandspit mangrove area, but there are no data on nutrients of the Sandspit mangrove area. In
view of this, a study was conducted to observe the seasonal and tidal variation in nutrient
rates (ammonia, nitrite, nitrate and phosphate) of the estuarine area of sandpit mangrove
31
forest, comparing areas covered by benthic microbial mat (M) with areas without mat
(WM). The nutrient estimation was done by bell jar method in mangrove back waters.
Nutrients rates for inside (IN) and outside chamber (OUT) of mat (M) and without mat
(WM) sites were observed by manually operated bell jars. This investigation was conducted
for the first time in the Sandspit mangrove area of Pakistan. The Basic hydrographical
parameters such as temperature (of air, water and sediment), salinity, pH, dissolved oxygen
and Chlorophyll-a content (in sediment) were also recorded in order to correlate them with
the nutrient ion content. As the mangrove areas are susceptible to anthropogenic factors
(Beck, Heck, Able, Childers, Eggleston, Gillanders, Hughes, Kendrick, Kenworthy,
Olyarnik and Weinstein, 2001; Barbier, Hacker, Kennedy, Koch, Stier and Silliman, 2011)),
the present study is essential to create baseline data for further studies in establishing the
future hazard free sanctuaries for this habitat. This data will also benefit future impact
assessment study related to management and rehabilitation of Sandspit mangrove forest.
2.3. Material and Methods:
2.3.1. Site Description:
Sandspit mangrove forest area is among one of the five sites of similar kind in Pakistan (Fig.
2 a, b). It is relatively small as compared to its Indus Delta counterpart in the Sind province.
It is situated in the southwest of Karachi city (24º49’05.63” N, 66º56’37.21” E). It covers
the area of around 1056 ha (out of 98,128 ha) (Abbas, Mueen, Ghaffar, Khurram and Gilani,
2013). Climate of this site is mostly arid with annual rain fall up to 200 mm. The site is
mainly influenced by three seasons, pre-monsoon (Jan-march), monsoon (April-early Oct)
and post-monsoon (late Oct-Dec) respectively. The Sandspit study area is divaricated by
32
land having mudflats and mangrove forest area on its northern side whereas, sandy coastal
beach alongside the Arabian sea on its southern site. The area is exclusively covered by
monospecific Avicennia marina mangrove having 51% dense canopy (Abbas, Mueen,
Ghaffar, Khurram and Gilani, 2013). This backwater forest is connected to Arabian Sea via
Karachi harbor. The sea water enters from southeastern site of harbor area and pass through
Chari Kund channel finally entering into the back water channel of Sandspit area. The forest
floor is submerged under water 2 times a day due to tidal cycle. Average temperature is
around 29 ºC -30+ ºC. Salinity of water and soil may reach up to +40 PSU, +50 PSU.
Average pH of water is usually 7.8 and soil is up to 8.5 respectively. The study channel is
0.8 km long. The mean depth is 2.4 meters. Average tidal range is between 0.3 to 1.5m. The
freshwater supply is mostly form rainfall. River Indus is another source which flows from
the northern areas of Pakistan and finally into the Arabian Sea (Siddiqui and Qasim, 1986).
Forest sediment is mainly muddy and becomes sandy-silt around seaward fringe. The soil is
rich in organic carbon content and can range from 3.2 to 8.3% (Sultana and Mustaquim,
2003). The forest floor is covered with dense microbial mat which covers 1-2 mm top soil.
The mat mainly consists of cyanobacteria (such as Oscillatoria sp, Micrococcus sp.,
Phormidium sp.), diatoms, bacteria and fungi. Other primary benthic communities of this
site include gastropods, slugs, Polychaeta and fiddler crabs (Shafique, 2004; Qureshi and
Saher 2012; Nizam, Ahmed, Shaukat and Khan, 2013). The area between Manora channel
and Hawksbay are adjacent to residential, industrial and navy dockyard areas that are
heavily polluted and the waste water from northern sites of Lyari and Malir Rivers flows
into this mangrove site (Harrison, Khan, Yin, Saleem, Bano, Nisa, Ahmed, Rizvi and Azam,
1997).
33
Figure 2A. Sandspit mangrove backwaters. (1) channel at high tide, (2) channel at low tide,
(3) without mat covered fringe site, (4) microbial mat covered site, (5) mangrove fringe area
and entrance point, (6) picture showing distinction between mat covered (right) and
uncovered (left) area. (Photos provided by courtesy of Dr. Seema Shafique.)
(6) (5)
(4) (3)
(2) (1)
34
Figure 2B. Map of experiment site, Sandspit Mangrove Area, Karachi. (showing the
position of mangrove Backwater channel and the location of the sampling area (A) microbial
mat covered mangrove channel site (B) Fringe area without microbial mat cover. (with
permission form Google maps)
35
2.3.2. Sample Collection:
Nutrient flux experiment was carried out by selecting one-meter square quadrate area which
was cordoned and the bell jars were placed. Bell jars were manually operated according to
the methods of Bulleid, (1984), Asmus, Sprung and Asmus, (2000). Sampling was
conducted during pre-monsoon (mid of Jan) monsoon (mid of July) and post-monsoon (end
of Oct) seasons during the years late 2013- to early 2015 respectively. In order to minimize
variations in our observations same tidal cycles (high-low-high) were followed throughout
all the seasons. Clear PVC bell jars (area, 71cm2 and capacity, 21 liters) were pushed in to
the selected sediment with mat (IN M) and sediment without mat (IN WM) sites at low tide
level. There were no pneumatophores or macro algae at the survey site. Water samples were
withdrawn from the center of the chamber (Reay, Gallagher and Simmons, 1992) at regular
intervals (45 min.) during 13-hour high-low-high tide cycle. Sampling outside the bell jar,
near mat (OUT M) and without mat areas (OUT WM) was done simply by manually
collecting water using polyethylene bottles (capacity 500 ml), samples were collect within
one-meter quadrate where bell jars were placed. Sediment samples from mat (M) and
without mat (WM) area were collected during low tide period. The samples were cored
using (50.8 mm) diameter PVC corers wrapped in aluminum foil. Top 5.0 cm sections were
used for Chlorophyll a analysis. All samples were stored at -2 ºC and analyzed within 24
hours.
2.3.3. Sample Analysis:
For nutrients, water was filtered (0.45 m, Whatman GF/F) through filtration assembly
(Millipore), and the filtrate was analyzed Spectrophotometrically (UV-1800 /Shimadzu)
36
through the following procedures, Ammonium (NH4 +) by phenate method, Nitrite (NO2
-) by
diazotizing with C6H8N2O2S coupling N-(l- naphthy1)-ethylenediamine method, Nitrate
(NO3-) by Cu-Cd column method and Phosphate (Po4
3-) was determined by complex-reagent
method, Chlorophyll a was examined by acetone extraction method and Dissolved oxygen
was observed by using modified Winkler method (Strickland and Parsons 1972). Physical
parameters were also observed. The temperature of air, water and sediment were recorded
using standard ºC mercury thermometer. Salinity was determined by portable refractometer
(ATAGO 0161633, Japan) and pH was noted via pH meter (ELEMETRON, CP-401).
Sample collection and analysis were performed in triplicate and mean (±S.D.) calculated.
2.3.4. Benthic Flux Formula:
Total benthic flux was determined by following equation (Hargrave and Connolly, 1978;
Bartoli, Nizzoli and Viaroli, 2003) which is based on the assumption that the observed water
column is under steady state conditions (Miller-Way and Twilley, 1996). The positive flux
indicates interchange from the sediment into the water (release) and negative result indicates
interchange from water to the sediment respectively (uptake). All the observations were
taken in triplicate (mean, ±S.D., N=03).
Following equation was used to estimate hourly and daily flux rates,
F= {V. (Cf-Ci)/A. T}
Where, F = element flux (mol m-2 h-1), Ci= Initial concentration (M), Cf= Final
concentration (M), A= Surface area of the sediment (m2), V = Volume of water (l) and T=
Time of incubation (h).
37
2.3.5. Statistical Analysis:
Data was analyzed by using Microsoft Excel, (2013) for analysis of results in M and
estimation of daily flux rates. To examine the similarities of physicochemical parameters
under various seasonal and tidal conditions, the statistical software Minitab 17.0 was used
for the Pearson correlation (p< 0.005), PCA principle component analysis and Cluster
analysis. R-programming was done to initially analyze the raw data and observe the
variations which were then represented by excel graphs detailing the difference in nutrient
concentrations between inside and outside the bell jar with respect to seasons and tidal
cycles. The standard errors presented in graphs is of N=3 mean.
2.4. Results and Discussions:
2.4.1. Physicochemical properties and nutrient rates of mangrove backwaters:
Table VII. summarizes the mean (±S.D.) values of physical parameters recorded during this
study. The temperature ranges from 15 to 28 ˚C during all three seasons. The sediment
temperature was steady as compared to the air and water temperatures which fluctuated
more frequently during the high-low-high tidal cycle. The monsoon season have more
temperature variations as compared to other seasons. The salinity along with dissolved
oxygen is the most unstable parameter. Its values changed with respect to every tidal cycle.
It varied from 30+ to 42 PSU on daily basis throughout all seasons. Mean salinity levels of
post-monsoon season were lower as compared to other seasons. Although the pH level of the
38
study site usually ranged from 6.9 to 8.6 (Shafique, 2004), we observed the pH values
between 7.1-7.5 respectively. The pH levels were stable in all seasons with no drastic
change where as, the dissolved oxygen varied from 0.4 to 0.8 ppm. Its values also differed
with tidal change but remained within higher limit during monsoon seasons as compared to
pre and post monsoon seasons. The mat area chlorophyll-a concentrations were found to be
0.48 to 1.44 mg/m-3. The tidal height levels were high in monsoon season 1.5m among
frequent rainfall.
39
Tab
le
VII
. P
hy
sica
l par
am
eter
s o
f S
and
spit
m
angro
ve
chan
nel
w
ater
. M
ean
(±S
.D.)
o
f si
te
du
rin
g
Pre
-mo
nso
on,
Mo
nso
on a
nd
Po
st-m
on
soon
sea
son
s (N
=0
3).
40
The exchange of nutrients occurred inside the bell jar chambers of IN M and without mat IN
WM areas. There was significant variation in benthic nutrient flux of M and WM sediment
areas. The daily benthic flux rates were estimated (Table VIII) and we observed that in M
area, there was NO2- release in the pre- monsoon and monsoon seasons and uptake during
post monsoon. The NO3- flux pattern was not similar and showed uptake in monsoon season
and release in post monsoon and pre monsoon seasons. The NH4+ uptake was more in pre
monsoon season and release rate was higher during post monsoon season as compared to
monsoon season. The PO43- uptake occurred during the post monsoon season and the release
was low during monsoon and high in pre monsoon season. In the WM area, the nutrient flux
rates release and uptake levels were lower as compared to M area values. There was
frequent nutrient release as than uptake. The rate of nutrient ions does not directly coincide
with the tidal cycle. The mean nutrient ion concentrations of IN M, IN WM, OUT M and
OUT WM were plotted against tidal cycles of all seasons (Fig. 3). During the pre-monsoon
season all the nutrients concentration were low to moderate during the first high tide.
Decreased values were observed in low tide and finally increased rates were recorded in
second high tide cycle respectively. The highest values of NO2- (0.004±0.001 mol.m-2.h-1),
NO3- (-0.004 to 0.02±0.010 mol.m-2.h-1), NH4
+ (-0.138 ±0.120 to 1.308±0.640 mol.m-2.h-
1) and PO43- (0.030±0.010 mol.m-2.h-1) were observed during pre-monsoon season with the
tidal height reaching 0.5 (± 0.10) meters. In the monsoon season, the NO2- (0.010±0.002
mol.m-2.h-1) and NH4+ (0.210±0.05 mol.m-2.h-1) values increased and decreased with tides
but NO3- (-0.010±0.020 to 0.050±0.020 mol.m-2.h-1) and PO4
3- (-0.002±0.010 to
0.020±0.010 mol.m-2.h-1) levels exhibited an inversely proportional relationship. Tidal
height was recorded up to 1.5 (± 0.10) m. Throughout the post monsoon season, we
41
observed fluctuations in NO2- values. The remaining nutrients showed lower levels in 1st
cycle of high tide and higher levels during low tide and 2nd high tide cycle. Tidal height of
0.8 (± 0.10)m was recorded. The maximum rates of NO2- (-0.002±0.003 to 0.010± 0.004
mol.m-2.h-1), NO3- (-0.004±0.010 to 0.05±0.020 mol.m-2.h-1), NH4
+ (0.641±0.170 mol.m-
2.h-1) and PO43- (0.010±0.003 mol.m-2.h-1) were observed in post monsoon respectively.
Overall, the nutrient rates of OUT M and OUT WM sites were towards the lower end.
Increased values were found during high tide levels and the low tide mostly presented steady
concentrations. Frequently, 1st high tide cycle exhibited lower levels as compared to 2nd high
tide cycle.
42
Tab
le V
III.
Ben
thic
nu
trie
nt
flu
x r
ates
by
bel
l ja
r m
eth
od o
f m
at a
nd w
ithou
t m
at s
ites
du
rin
g P
re-m
on
soo
n,
Mo
nso
on a
nd
Po
st-m
on
soon
sea
son
s per
day m
ean
(±
S.D
.).
(WM
= w
ith
out
mat
sit
e, M
= m
at s
ite,
NO
2- N
itri
te,
NO
3- N
itra
te,
NH
4+ a
mm
on
ium
an
d P
O43- p
hosp
hat
e).
43
Figure 3. Nutrient ion concentration according to tidal cycle during pre-monsoon, monsoon
and post-monsoon seasons. (A) Pre-monsoon IN WM, (B) Pre-monsoon OUT WM, (C) Pre-
monsoon IN M, (D) Pre-monsoon OUT M, (E) Monsoon IN WM, (F) Monsoon OUT WM,
(G) Monsoon IN M, (H) Monsoon OUT M, (I) Post-monsoon IN WM, (J) Post-monsoon
OUT WM, (K) Post-monsoon IN M and (L) Post-monsoon OUT M. where, M= mat area,
WM= without mat area, IN= inside the bell jar, OUT= outside bell jar The hours 1-4= 1st
high tide, 5-8= low tide and 9-13= 2nd high tide cycle respectively.
44
Table IX. Pearson correlation matrix of nutrient ions by bell jar method and
physicochemical parameters.
(p< 0.005, *significant, **highly significant)
The correlation matrix with p<0.005, showed a significant positive relationship between
water temperature and NH4+ and negative relation between Chl a and NH4
+. NO3- exhibited a
positive relation with air temperature and pH and negative correlation with salinity and
dissolved oxygen. pH was negatively correlated with salinity and DO, salinity was
positively related with DO and chlorophyll a content and finally, tidal height was positively
correlated with DO (Table IX).
45
2.4.2. PCA and Cluster Analysis:
The principal component analysis (PCA) of nutrients ions and physicochemical parameters
under various seasons exhibited clear cluster of different seasonal and mat conditions. PCA
score plot (Fig. 4A) showed positive aggregates of conditions 11,5,6 and 12 and negative
aggregates of conditions 9,4,10 and 3 on PC1 axis (first component). The cluster of
conditions 7, 1, 2, and 8 on the positive axis of PC2 (second component) were recorded. The
table of loading for principle components of nutrient and field parameters was detailed
(Table X). According to the initial scree plot analysis and eigenvalues determining 80.90%
variability, two principle components were found to be significant. PC1 contributed 47.40%
of total variance whereas; PC2 was accounted for 80.90% of the total variability. PC1
showed high negative loading for salinity and dissolved oxygen and strong positive loading
for nitrate and water temperature was observed. PC2 indicates high negative factor of soil
temperature and tidal height, and exhibit strong positive factor for air temperature and
chlorophyll content. In both components PC1-2, Nitrite and air temperature were positively
loaded while, phosphate, soil temperature and dissolved oxygen were negatively loaded.
The cluster analysis of water parameters (nutrients and physico-chemical variables) under
different seasonal and mat conditions result in four clusters (Fig. 4B). Accordingly, the same
seasonal conditions form close aggregates. This result is similar to principal component
analysis with slight variations. The first cluster includes conditions 1, 2, and 8 which
indicates that during pre-monsoon season the water quality of mangrove channel was similar
both inside and outside the bell jar both in M and WM areas. The conditions 2 and 8 were
46
closely aggregated suggesting similar state of water quality outside the bell jar of M and
WM areas. The second cluster consists of 3, 4,10 and 9 conditions, which shows that during
monsoon season the water quality is similar at M and WM site. The closely related 4 and 10
conditions demonstrate that, water conditions were unvaried outside the bell jar of both mat
and without mat areas. The third cluster exhibit aggregates of conditions 5,6,11 and 12
which indicate during the period of post-monsoon season, the mangrove channel water was
indistinguishable in and out of bell jar while the closely associated clusters were arranged on
the basis of N and WM sites. The fourth cluster was found to be distinctly different. It
contained only condition 7 which is pre-monsoon season inside the bell jar in mat area. This
may be justified due to the presence of favorable conditions for mat bloom as we observed
higher chlorophyll a level in pre-monsoon than rest of the seasons which impact the water
quality resulting in a separate group. The four clusters generated may relate to identical
characteristic of water parameters represented in these cluster groups (Fig. 4B).
47
Table X. PCA results showing the first two components for water characteristic including
nutrient ions and physicochemical variables of twelve seasonal and mat conditions at
Sandspit mangrove site.
Variables PC1 PC2
NH4+ 0.150 -0.327
NO2- 0.265 -0.036
NO3- 0.343 0.092
PO43- -0.106 -0.173
Air°C 0.291 0.354
Water°C 0.335 -0.290
Soil°C -0.014 -0.494
pH 0.416 -0.003
SalinityPSU -0.403 0.121
DO ppm -0.401 -0.134
Chla mg/m-3 -0.220 0.418
Tide m -0.192 -0.439
Eigenvalue 5.692 4.012
Proportion 0.474 0.334
Cumulative 47.400 80.900
48
Figure 4A. PCA Two dimensional plot of field physicochemical variables (pH, Salinity,
Dissolved Oxygen, Chlorophyll a content, temperature (Air, Water, Soil) and Tidal height)
and nutrient content (Nitrite, Nitrate, Ammonia and Phosphate) of twelve conditions located
at Sandspit mangrove site. [1) Pre-monsoon IN WM, 2) Pre-monsoon OUT WM, 3)
Monsoon IN WM, 4) Monsoon OUT WM, 5) Post-monsoon IN WM, 6) Post-monsoon
OUT WM, 7) Pre-monsoon IN M, 8) Pre-monsoon OUT M 9) Monsoon IN M, 10)
Monsoon OUT M, 11) Post-monsoon IN M and 12) Post-monsoon OUT M. where, M= mat
area, WM= without mat area, IN= inside the bell jar, OUT= outside bell jar.]
49
Figure 4B. Dendrogram (Cluster Analysis) of physical and chemical variables (pH, Salinity,
Dissolved Oxygen, Chlorophyll a content, temperature (Air, Water, Soil) and Tidal height)
and nutrient ions content (Nitrite, Nitrate, Ammonia and Phosphate) of twelve seasonal and
mat conditions observed at Sandspit mangrove site. (1) Pre-monsoon IN WM, 2) Pre-
monsoon OUT WM, 3) Monsoon IN WM, 4) Monsoon OUT WM, 5) Post-monsoon IN
WM, 6) Post-monsoon OUT WM, 7) Pre-monsoon IN M, 8) Pre-monsoon OUT M 9)
Monsoon IN M, 10) Monsoon OUT M, 11) Post-monsoon IN M and 12) Post-monsoon
OUT M. where, M= mat area, WM= without mat area, IN= inside the bell jar, OUT= outside
bell jar, The brackets colour code the following clusters, Blue and Brown= Pre-monsoon
season, Red= Monsoon season, Green=Post-Monsoon season).
71 21 16591 043821
0.00
33.33
66.67
1 00.00
Conditions
Sim
ilari
ty
50
Table XI. Nutrient Fluxes determined by Bell jar method in different regions.
(n.a.= not available, NOx- = NO2- + NO3
-, NO2- Nitrite, NO3
- Nitrate, NH4+ ammonium and PO4
3- phosphate)
STUDY SITE COUNTRY NUTRIENT FLUX RATES (mol.m-2 d-1)
SOURCE NOX- NO2
- NO3- NH4
+ PO43-
Sawi bay Thailand 105 to 690 n.a. n.a. 280 to 2260 n.a. Alongi, Trott, Wattayakom and
Clough, 2002.
Southern everglades USA n.a. n.a. n.a. -754 to -158 -199 to -50 Davis, Childers, Day, Rudnick and
Sklar, 2001.
GBR Shelf Australia n.a. 48 216 1920 168 Lourey, Alongi, Ryan and Devlin,
2001.
Gazi bay Kenya n.a. 190 4941 -950 2215 Mwashote and Jumba, 2002.
Matang mangrove forest
reserve Malaysia n.a. n.a. n.a. -440 to -250 n.a. Alongi, 2004.
Citanduy mangrove Indonesia n.a. n.a. 0.1 to -14.4 -0 - 0 to -845 Moll, 2011.
51
We were successful in conducting bell jar survey to determine the nutrient flux rate of
mangrove Sandspit backwaters for the first time in Pakistan. Samples were also collected in
bottle outside the bell jar to observe the variation in the nutrient concentration. It was found
that the nutrient levels were lower outside the bell jar but the rate of increase and decrease of
nutrients level outside was similar to that of inside indicating, both methods are effective in
determining the water quality of mangrove area. These methods may be useful in
quantifying the nutrient exchange rates in wetland ecosystems all over the Pakistan coast.
The nutrient fluxes in this area were associated with benthic mat and without mat sediment -
water dynamics.
The physical parameters along with the runoff from industrial area mainly through Layari
river (Khan and Saleem, 1988; Rizvi, Saleem and Baquer, 1988) are of some significance in
the hydrodynamics and chemical properties of mangrove area water channel (Ovalle,
Rezende, Lacerda and Silva, 1990; Nedwell, 1994). The present measurements of
physicochemical parameters of Sandspit mangrove channel were generally in the same range
characterized earlier by Seema, (2004) and Farooqui, (2012). During our study period
salinity was generally high throughout most of year. The salinity levels were high even
during the monsoon season due to late and low precipitation and low during post monsoon
season due to late rain fall which lasted till early post monsoon season. There were no
marked variations in salinity and pH levels concurring with earlier data from the same
mangrove site ((Seema, 2004; Farooqui, 2012; Nizam, Ahmed, Shaukat, Khan and Ali,
2013). The pH remained <8 due to regular waste water input. Transition period from pre-
monsoon to monsoon exhibited the highest tidal range and dissolved oxygen. The medium
for nutrient upwelling is induced by tidal cycle managing the flow from sediment into the
52
water channel. Therefore, tidal level determines the nutrient exchange rates (Dittmar and
Lara, 2001a). There was a gradual increase in dissolved oxygen from post monsoon to
monsoon season and we found strong correlation between DO and salinity (0.866) There
was no significant correlation between nutrients and DO which showed that dissolved
oxygen in this channel is not mainly dependent on wastewater input (Ray, Majumder, Das,
Chowdhury and Jana, 2014). Low DO levels were observed in the present observations may
be due the heterotrophic activity in water column (Reddy and DeLaune, 2008). The study
area received sufficient light and chlorophyll a content to sustain benthic microbial
communities during all seasons. The chlorophyll a levels recorded during the present study
were higher than that of earlier reports (Farooqui, 2012). The higher values were observed
during pre monsoon season. This may be because the waters during this season is
comparatively less erratic and the conditions for microbial colony especially cyanobacterial
blooms are favorable for mat formation (Negri, Montoya, Carreto, Akselman, Inza,
Steidinger, Landsberg, Tomas and Vargo, 2004).
In the present study nutrient levels were relatively low as compared to other systems (Table
XI). The flux pattern found at mangrove site showed positive net flux of nutrients during
monsoon and post-monsoon season and negative flux occurred more during the pre-
monsoon season. The concentration of nutrients appears to be under the influence of tidal
height and seasons (Farooqui, 2012). The post monsoon season contained maximum
nitrogen content of NO2- (0.11 ±0.09 mol.m-2.d-1), NO3
- (1.18 ±0.31 mol.m-2.d-1), NH4+
(5.3 ±1.65 mol.m-2.d-1) respectively whereas, PO43- (0.67 ±0.05 mol.m-2.d-1) was highest
during pre- monsoon. The nitrate and phosphate concentrations of the Sandspit mangrove
53
channel is within the range of Citanduy mangrove study (Moll, 2011). The difference in
NH4+ flux appears more for rate of sediment uptake. The difference in the processes
occurring within the sediment for nutrients may be responsible for variations in the flux
rates among these two sites (Cabrita and Brotas, 2000).
As the consistent release of dissolved forms of nitrogen usually occurs in mangrove areas
(Rivera-Monroy, Day, Twilley, Vera-Herrera and Coronado-Molina, 1995), it was observed
that the NO2- and NO3
- levels in the survey area were marked by more release than uptake.
Reverse was true for NH4+ levels. Nitrate uptake by sediment during the monsoon season
suggests that denitrification may be occurring in the sediment (Twilley and Kemp, 1987).
Occurrence of nitrogen fixation has been studied earlier in mangrove soil (Holguin, Vazavez
and Bahon, 2001) having low denitrification rates (Kristensen, Jensen, Banta, Hansen,
Holmer and King, 1998). The Decreased levels of NO2- and NO3
- results in low nitrification
activity probably due to competition among primary producers and nitrifiers for ammonium
ion (Bartoli, Nizzoli and Viaroli, 2003). Low nitrification rates also decline denitrification
rates (Rivera-Monroy and Twilley, 1996). Overall low nitrogen flux rates may also be due to
algal oxygen production during light period resulting in decreased denitrification (Nielsen,
Christensen, Revsbech and Sorensen, 1990). NH4+ was found to have maximum flux rates.
Highest uptake occurred during pre-monsoon season (-31.68 ±46.44 mol.m-2.day-1). The
ammonium ion exchange indicates a linkage between sediment communities producing and
degrading organic matter at sediment water interface (Simmons, 1995). NH4+ levels suggest
that the benthic microbial community preferred it as the primary nitrogen source. The
gradual decline of NH4+ from post monsoon to pre monsoon and finally to monsoon concurs
54
with the Sundarban mangrove area study (Ray, Majumder, Das, Chowdhury and Jana,
2014). Phosphate act as a limiting factor for microorganisms related to coastal ecosystems
(Cole and Sanford, 1989). The PO43- flux showed similar pattern as that of NO2
- and NO3-.
Relative to M area, more positive flux was found in WM area due to large waste water
runoff. This implies that the mangrove sediment serves as a water column phosphorus
source as, sedimentation and mineralization sustains the phosphate export (Dittmar and
Lara, 2001b). The phosphate levels reported were mostly <0.8 reflecting that this site is
phosphate limited (Boyer, Fourqurean and Jones, 1999) this is similar to earlier study
showing low stocks of inorganic phosphate forms (Alongi, Boto and Robertson, 1992) in
mangrove area. Our levels were between 0.05-0.67 uM which are similar to the study of
Davis, Childers, Day, Rudnick and Sklar, (2001).
The primary members of microbial mat include cyanobacteria which can assimilate
nitrogenous compounds (Hogarth, 2015) and some such as Aphanocapsa sp. (which is
present in the micro mat sandspit mangrove area) also internally store phosphates in form of
polyphosphates (Kromkamp, 1987). We observed an inverse relationship between phosphate
efflux from sediment and microbial mat (Andersen and Kristensen, 1988). Net low levels of
PO43- release rates indicate sediment resuspention in terms of solid state diffusion and
adsorption thus forming a PO43- sink (Vidal, 1994).
Mangrove sediment is the reservoir of nitrogen which also play a significant role in nutrient
exchange (Sundback, 2005). We observed net fluxes to be occasionally higher in clay mud
(M) than sand-silt (WM) site. The rates of nutrient exchange coincide with the presence and
absence of microbial mat. Benthic organisms related to mat are also the cause of lower
55
levels of overall nutrient content (Sundback, 2005). The process of biosorption executed by
microorganisms present in mat can considerably reduce the nutrient ion levels thus creating
a nutrient sink in mangrove area (Alongi, 1996). During our study period we also observed
significant changes in the density and composition of microbial mat present throughout the
seasons (Yasmeen, Shafique, Zaib un Nisa and Siddiqui, 2016) that may have contributed to
nutrient level variation. Most exchange occurred at the mat area (Davis, Childers, Day,
Rudnick and Sklar, 2001). This enhanced the significance of benthic microbial mat in
regulating the nutrient exchange in Sandspit mangrove channel. The nitrogen flux was
relatively higher in the mat area than the non mat area. It was observed that the mangrove
area without mat was involved in nutrient transformation. This may be due to the presence
of sediment associated denirifiers (Fan, Shieh, Wu and Chen, 2006) and bacteria involved in
the nitrification process (Krishnan, Fernandes, Chandan and Bharathi, 2007) which were
also abundant in deeper layers of mangrove soil and not necessarily associated with mat.
Our data indicated successive trapping of nitrogen leading to reduction by nitrification and
denitrification respectively. Most of the nutrients were translocated into the sediment. The
mat along with sediment acted as a sink for nutrients. Our results allowed us to determine
the significance of study site in nutrient exchange across the area. Despite huge coverage
along the coastal belt. few studies were generated based on nutrient levels. Our study fills
that gap by creating a baseline data and understanding the regional pattern of nutrient rates
in this ecosystem. This tidal fringe mangrove area at Sandspit serves as an active site for
nutrient balance and availability throughout all seasons.
56
CHAPTER 3
MICROBIAL MATS ASSOCIATED WITH
MANGROVES PROVIDE SOIL STABILIZATION AND
MODIFY NUTRIENT CHEMISTRY DURING
MONSOON CYCLES: SANDSPIT BACKWATERS,
PAKISTAN.
(Manuscript submitted for Publication)
57
MICROBIAL MATS ASSOCIATED WITH MANGROVES
PROVIDE SOIL STABILIZATION AND MODIFY
NUTRIENT CHEMISTRY DURING MONSOON
CYCLES: SANDSPIT BACKWATERS, PAKISTAN.
3.1. Abstract:
We examined the characteristic of sediments and water nutrient levels in channels of the
Sandspit backwater mangroves. By using bell jar method and characterization of soil
physicochemical parameters, we found that there was seasonal variation in water nutrients
and edaphic characters. We observed a positive impact of microbial mat on mangrove soil.
The soil covered with microbial mat consists mainly of fine sands whereas the fringe area
soils have high medium sand content. Statistical analysis exhibited positive correlations
(p<0.05) between selected soil variables (Temperature, pH, salinity, bulk density,
chlorophyll a/b, total carbon, organic matter, moisture content, water holding capacity and
C/N) and water channel nutrients (NO2-, NO3
-, NH4+, PO4
3-). According to PCA soil salinity-
temperature, organic matter, water holding capacity, soil moisture, NH4+ and PO4
3- were
found as significant variables for two different soil types. Cluster analysis results were
similar to PCA. It is concluded from the results that seasonal changes within individual soil
types were not exceptional. Instead, the soil sediments were more influenced by the presence
of mat than by pre-monsoon, monsoon and post- monsoon seasons. Microbial mat
associated with mangrove forest floor played a considerable role in increased percentages of
total nitrogen and total carbon whereas, waste water runoff affected the inorganic nitrogen
and phosphate concentrations. These results suggest complex interactions among edaphic
and hydrological factors and provide valuable data for future modeling, rehabilitation and
productivity of similar mangrove sites. The current study provides the means to establish
management strategies for tropical mangrove ecosystems based on the interpretation of the
responses of a tropical system to seasonal changes as a tool, taking in consideration the
sediment properties and nutrient flux rates. These findings are relevant not only for Sandspit
investigation but also for other mangrove ecosystems, especially those compromised by
marine pollution. This small scale study provides general knowledge and understanding of
seasonal ecological interactions, which are of global significance.
58
3.2. Introduction:
Mangroves are productive tropical and subtropical ecosystems, which serve as an efficient
ecological and economic resource. Mangroves provide unique estuarine habitats for a
variety of animals and act as an excellent breeding and nursery grounds for many
commercial fisheries (IFAP, 2008). They protect against harmful effects of coastline
erosion, thunder storms and tsunami. Mangrove is considered to be carbon sink as well as
the site of accumulation of sediment and nutrients (Alongi and Carvalho, 2008; Bouillon,
Borges, Castaneda, Diele, Dittmar, Duke, Kristensen, Lee, Marchand, Middelburg, Rivera,
Smith and Twilley, 2008). Mangrove forest floor is covered by dense microbial mat. The
mat is a complex community mainly structured by benthic organisms like bacteria,
cyanobacteria and diatoms (Noffke, Knoll and Grotzinger, 2002; Yasmeen, Shafique, Zaib
un Nisa and Siddiqui, 2016) and serve as a food source for various members of benthic
fauna (Andersen and Kristensen, 2002). The microorganisms in the form of biofilms and
microbial mats prevent sediment erosion and biologically stabilize the sediment substrate.
These structures act as an efficient tool for sediment trapping and mineral-nutirent
deposition (Friend, Lucas, Holligan and Collins, 2008; Noffke, 2010). Mangrove sediments
entrap organic carbon from detrital and other marine sources. Microbial mat associated with
mangrove environment influence the carbon sequestration resulting in an increased carbon
budget (Bouillon, Moens, Overmeer, Koedam and Dehairs, 2004; Alongi, 2007). The
microbial mat also contributes to input of detrital material present in mangrove top soil
which is consumed by fiddler crabs, gastropods and other organisms (Kristensen and
Alongi, 2006).
59
The mangrove sediment degrades and stores organic material and other nutrient and
minerals but it also transports these material selectively to adjacent ecosystems via tidal
cycle (Dittmar, Hertkorn, Kattner and Lara, 2006; Kristensen, 2008). The remineralization
of detrital material by fungi and bacteria, generates essential nutrients for microalgae present
in microbial mat (Lee, 2008). The two main components e.g. soil and water, are extremely
relevant to analyze because hydrological changes affect the soil and its associated flora
(Deco, Hummon and Fleeger, 1985) and the sediment structure directly and indirectly
influences the associated habitat (Hogue and Miller, 1981). Properties of sediments such as
porosity, grain size, water content, organic matter content (Chapman and Tolhurst, 2007),
salinity (Jensen, 1985) play a significant role in maintaining the diversity and abundance of
associated communities.
Pakistan has the world largest arid zone mangrove forest (Abbas, Mueen, Ghaffar, Khurram
and Gilani, 2013). The coastal area of Pakistan is broadly distributed into Baluchistan coast
(745 Km) and Sindh coast (245 km, including Karachi coastal area and Indus Delta) (GoP,
2007). Karachi coast is included in Global 200 Ecoregions and it consists of two significant
sites: Karachi Harbour and Sanspit backwaters area. Sandspit is situated 18 Km southwest of
Karachi city and runs parallel to the Arabian sea coast (Damhoureyeh and Ghalib, 2014).
The manora channel adjacent to Sandspit area is heavily polluted due to municipal and
industrial waste that are discharged into backwaters area through Layari and Malir rivers
respectively (Zaigham, 2004). This input directly influences the Mangrove ecosystem and
causes poor water quality and reduced species diversity and flourishing of invasive pollution
indicator species (Rizvi, 1997). Earlier studies showed that the mangrove ecosystem is under
60
severe stress due to marine pollution caused by anthropogenic factors (Qureshi, Sajjad,
Mashiatullah, Waqar, Jan, Akram, Khan and Siddiqui, 1997).
In Pakistan, Studies on various aspects of mangrove area were conducted including,
sediment grain size (Qureshi and Sultana, 2001), vegetation (Saifullah and Rasool, 1998;
Rashid and Abbas, 2011), Mangrove flora and fauna (Siddique, Farooq, Shafique and
Farooqi, 2008; Zaib-un-Nisa, Mansoor and Siddiqui, 2000; Shafique, 2004 ), Litter
production and pore water nutrients (Farooqui, 2012), Benthic fauna and granulometric
characters (Qureshi, Farah and Saher, 2015), Elemental Soil analysis (Noor, Shaukat and
Naseem, 2015), and Sediment chlorophyll content (Farooq and Siddiqui, 2011). But the
seasonal studies related to mangrove sediment and hydrological parameters were not up to
date. The present work compares the dynamics of seasons; (pre monsoon, monsoon and post
monsoon with physicochemical soil-water associated variables. The two types of sediment
characteristics of mangrove forest floor: soil covered with microbial mat (M) and fringe area
without microbial mat (WM), were defined using analytical tools such as total carbon (TC)
and nitrogen content (TN), organic carbon (LOI), moisture, bulk density (B.D.), water
holding capacity (WHC) and grain size analysis. Dissolved inorganic nutrients ions such as
nitrite (NO2-), nitrate (NO3-), phosphate (PO43) and ammonium (NH4
+) in channel water
were also examined by the bell jar method.
61
3.3. Material and methods:
3.3.1. Site description:
Sandspit mangrove backwaters forest area is situated at (24º49’05.63” N, 66º56’37.21” E)
southwest of Karachi city (Fig. 2 a, b) (for detailed description see page 31).
3.3.2. Field Sampling:
The study was conducted for the period from 2012 to 2013. The collection period was
distributed into Pre-monsoon (Jan-march), Monsoon (April-early Oct) and Post-monsoon
(late Oct-Dec) seasons. As the main objective of this study was to examine the relationship
between seasons, sediment and inorganic nutrients. The ecological characteristics were
determined within 1 sq. meter quadrates that were placed at two study sites of mangrove mat
area (M) and, mangrove without mat area (WM). Data recorded form quadrates includes
field parameters (temperature, salinity, pH and dissolveld oxygen) and sediments analysis
(organic matter content, moisture content, bulk density, total organic carbon and total
nitrogen content, chlorophyll a and b content, grain size, water holding capacity). Bell jar
was used to determine hydrological parameters. All the samples were collected and analyzed
in triplicate and mean of data, ± standard deviation was computed.
62
3.3.3. Sediment analysis:
Sediment samples were retrieved via corer (29 mm diameter, 4 inches). The samples were
wrapped in aluminum foil and stored in icebox. In laboratory, the cores were sectioned in to
equal top mid and bottom sections (3 cm each). Each section was sub-sectioned for different
analysis. Sediment moisture content was determined by standard A.O.A.C. 1970 method. 1
gm of soil sample from each section was weighted before and after 24 hrs., 110 ºC oven
treatment. Sediment organic content was recorded using standard A.O.A.C. 1970 method.
Difference of 1gm sample was taken after 8hrs-450ºC muffle furnace treatment. Sediment
Chlorophyll a and b content were examined spectrophotometrically (630, 664, 647 and 750
nm) according to the methods of Strickland and Parson, (1972).
Total organic carbon and total nitrogen content were determined by the wet oxidation of
carbon by acid dichromate and spectrophotometric method described by Strickland and
Parson, (1972) and Kjeldahl method (Mann and Saunders, 1978), respectively. Soil pH was
examined by the method of Pansu and Gautheyrou, (2007) using 1mM KCL (Merk) and
salinity was recorded by using the method of Rhoades and Chanduvi, (1999). Soil bulk
density was estimated according to the method of USDA-NRCS, (1996) and water holding
capacity was determined by method of ISO 11274/1998 (Wilke, 2005). For Grain size
analysis separate (50 cm iron corer) was used) in triplicate and sediment samples (100 gm
each) were sieved through different mesh sizes followed by method described by Alfaro,
(2006).
63
3.3.4. Channel water analysis:
Bell jars capacity 21 liters were placed and manually operated (Asmus, Sprung and Asmus,
2000) at M and WM sites. The water physicochemical and nutrient parameters were
analyzed (for details see page 29).
3.3.5. Statistical analysis:
Net benthic flux was calculated by the equation of Bartoli, Nizzoli and Viaroli, (2003) (see
page 30). The positive values represented exchange from sediment into water column
(release rate) and negative values corresponded with exchange from water to sediment
(uptake rate) respectively
The observed data were computed by R programming for initial processing of raw data.
Microsoft Excel, 2013 was used for graphical interpretations and estimation of flux rates
within 24 hours. To examine correlation of physical and chemical factors under different
seasonal conditions, Minitab 17.0 software was used for the determination of Pearson
correlation (p<0.05, double checked by statistical software PAST), one-way ANOVA (p α
0.05), Principle component analysis (PCA) and Cluster analysis (dendrogram). The
graphical values plotted were of N=3 means (± S.E).
64
3.4. Results and Discussion:
3.4.1. Sediment Characteristics:
The overall soil properties observed in mangrove M and WM areas reflected that the mat
area is considerably organic in nature. The total nitrogen (TN%), total carbon (TC%),
dissolved oxygen DO, organic content by loss of ignition (LOI%), water holding capacity
WHC%, Moisture content, chlorophyll content (Chl a and Chl b) were generally higher in
the mat area than the corresponding fringe area. Data obtained on soil physico-chemical
properties revealed following,
Grain size, profile suggests variation in sediment deposition during three seasons (Fig. 5).
The sediment was categorized into coarse (250<500m/ 1-2), medium (125<250m/ 2-
3), fine sand (90<125m/ 3-3.5) and silt (<63m/4-6) (Hennig, Eagle, Fielder, Fricke,
Gledhill, Greenwood and Orren, 1983). The medium sand was found to be in highest
percentage followed by fine sands. The grain size data was seasonally analyzed and it was
observed that highest % of medium sediment was found in WM site during post monsoon
season. High fine sand % was recorded in M site in pre monsoon season. This may be due to
frequent wind, wave actions and storms that may induce translocation of sediment. This
initial textural analysis suggests that the sediment displacement may be taking place with
respect to seasonal changes. Sedimentation rates were more during monsoon due to
favorable biological (crab borrow activity) sediment associated interactions (Cuadrado,
Carmona and Bournod, 2011; author observation). Seasons have an influence on nutrient
rates and edaphic factors. The results of moisture content, LOI%, chlorophyll a content and
sediment texture concur with earlier studies of Farooqui, (2012) and Shafique, (2004)
although the investigations were in different area but with similar soil type.
65
Figure 5. Grain size percent composition of mat covered (M) and without mat (WM)
sediments during pre-monsoon, monsoon and post monsoon seasons.
0
10
20
30
40
50
60
-1 0 1 1.5 2 2.5 3 3.5 4
Fre
qu
en
cy (
wt%
)
Size
Pre-Monsoon M
Pre-Monsoon WM
Monsoon M
Monsoon WM
Post-Monsoon M
Post-Monsoon WM
66
Figure 6. Mean (±S.E.) Total Carbon and Nitrogen composition of the sediment in the
Sandspit Mangrove area, M=mat area, WM=without mat fringe area, N=nitrogen, C=carbon.
0.00
0.20
0.40
0.60
0.80
1.00
1.20
1.40 0.0
2.0
4.0
6.0
8.0
10.0
12.0
051005100510
Pre-MonsoonMonsoonPost-Monsoon
M N % WM N% M C % WM C%
Seasons/Sediment depth (cm)
To
tal
Carb
on
%T
ota
l Nitr
og
en%
67
Fig
ure 7
. V
erti
cal
pro
file
s o
f (A
) W
ater
hold
ing c
apaci
ty, (B
) M
ois
ture
co
nte
nt,
(C
) O
rgan
ic m
att
er v
ia L
oss
of
ignit
ion,
(D)
Car
bon
-Nit
rog
en r
atio
an
d (
E)
Chlo
rop
hyll
a-b
rat
io m
easu
red a
t m
at c
ov
ered
(M
) and f
rin
ge
(wit
hou
t m
at)
(WM
) si
tes
du
ring p
re-m
on
soo
n,
mon
soon
, an
d p
ost
-mon
soon s
easo
ns.
Plo
tted
val
ues
are
mea
n
of
trip
lica
te, (±
S.E
.).
Sediment Depth (cm)
68
Total organic carbon, content varied from 0.47 to 1.01% (Fig. 6). The autochthonous and
allochthonous sources are responsible for organic carbon in the mangrove ecosystem. We
observed that the distribution of TC% corresponds with sediment type that is; its
concentration was high in M area and low in WM area. This may be attributed to the
microorganisms associated with microbial mat which provide increased percentage of
organic content (Wooller, Smallwood, Jacobson and Fogel, 2003). Increased values were
observed during monsoon period. The carbon content in M area increases with depth and in
WM area the top soil contained more TC% than deeper layers (Bhavsar, Jasrai, Pandya,
Singh and Patel, 2014). This may be due to regular tidal flooding and low decomposition
rate that may results in high content of organic matter on these sites at depths of 10 cm and
more (Ceron-Breton, Cerón, Rangel, Murielgarcia, Cordova and Estrella, 2011).
There was a positive correlation between TC% and air–water-soil temperatures, water pH,
WHC%, LOI%, moisture content, nitrate and negative correlation with soil pH, water
salinity and C: N. The vertical profile of C: N showed that the ratio is variable with depth
(Fig. 7d). The total organic content was not high as compared to other south east Asian
mangrove ecosystem studies of Bhavsar, Jasrai, Pandya, Singh and Patel, (2014) and Moll,
(2011). But it was similar to Bangladesh mangrove study of Hossain, Aziz and Saha, (2012).
Lower ranges of TC% may be due to root system of Avicennia which is present in close
proximity of top soil (Marchand, Baltzer, Lallier and Albéric, 2004). Increased rates of C
and N may attribute to nutrient content reclaimed by soil through litter fall (Shafique, 2004).
As monsoon season was characterized by favorable conditions for primary producers and
also for mangrove trees (Mackey and Smail, 1995), this may also result in the observed
69
overall increased input of C and N content during monsoon period as compared to other
seasons.
Total nitrogen content, varied from 5.90 – 10.95% (Fig. 6). In present study, TN% in
sediment samples was high during pre-monsoon and monsoon and low during post-monsoon
season. The decreased levels of TC% corresponds to lower level of TN and vice versa.
Increase in N content may also favor rapid mineralization and assimilation by microbial
biomass (Levin, Boesch, Covich, Dahm, Erséus, Ewel, Kneib, Moldenke, Palmer, Snelgrove
and Strayer, 2001). Sediment particles trap fine detritus matter generating an increased
population of nitrifiers thus resulting high nitrogen levels in sediments up to 10 cm deep
(Wheeler and Kirchman, 1986). Increased TN% was observed in bottom section of 10 cm
sediment core samples at both M and WM sites. There was a positive correlation between
TN% and C: N, soil pH. The C: N ratios were mostly low with depth as compared to top soil
indicating that microbial mat associated organic matter was rapidly degraded (Marchand,
Elisabeth and Baltzer, 2003) and detrital matter associated with sediment may be a
significant source of nitrogen. Low C/N ratios also favor growth benthic algae resulting in a
thick microbial mat (Molnar, Marchand, Deborde, Patrona and Meziane, 2014) which we
observed over our studied M sediment top soil (Fig. 7d) (Table XIV).
Water holding capacity, of M area was higher than that of the WM area. WHC% was
highest during the monsoon season (34%) and lowest during post monsoon season (16%).
Vertical profile showed that the 0 cm top and 5 cm mid-section have high WHC% as
compared to 10 cm bottom section. There was a significant correlation between WHC% and
70
TN%, water pH, B.D., moisture content, Chl a, ammonia and negative correlation with
phosphate (Fig. 7a).
Moisture content, of M area was high (top soil) as compared to WM area. The top 10 cm
layer of sediment collected from each site contained 16 to 37% moisture. The highest value
was recorded during monsoon season M site. The lowest was observed during post-monsoon
at WM site. The vertical profile of moisture content showed some variation at top soil level
(Fig. 7b). We found a (+ve) correlation between moisture% and TN%, DO, air temperature,
water pH, Chl b and nitrate. Similar to earlier studies (Rao and Burns, 1990), we found that
microbial mat does improve water holding capacity.
Organic content, induces primary productivity, influence nutrient levels and WHC (Neue,
1985) in the mangrove area. LOI% in estuarine marsh may usually be up to 0-10% (450c 8h)
(Craft, Seneca and Broome, 1991). Sediment collected from M and WM sites were in the
range between 13 and 38%. The highest value was recorded during monsoon season and the
lowest recorded in post monsoon season. Increased organic contents in water column and on
top soil may facilitate the accumulation of Organic matter in to deeper layers of sediments.
Vertical profile showed high values in mid-section of WM site and top sections of M site.
LOI% was significantly (+) correlated with TN%, B.D., WHC%, moisture content, Chl a,
nitrate (Fig. 7c). Decomposition rate and Sediment type also plays a significant role in the
entrapment of organic matter (Ramanathan, 1997), resulting in increased rates of carbon
content in M area as compared to WM area.
71
Chlorophyll content, the mangrove area sediment was covered by microbial mat that was
0.1 to 0.5 cm thick on the sediment and consists of shades of brown, black and green. The
chlorophyll a and b content in the sediment cores showed variations in different sections
(that ranged between Chl a, 0.17-1.41; Chl b, 0.11-0.79 g. g-1). Chlorophyll a content was
higher as compared to chlorophyll b. Increased levels of chlorophyll a were observed in
monsoon season whereas, Chl b was more in post monsoon season. Vertical profile of Chl a:
b showed variable values at all sections (Fig. 7e). There was a strong correlation (+) between
Chl a and TN%, TC%, soil-water temperature, soil pH, water salinity, NH4+ and negatively
correlated with PO43-. The Chl b which is also an integral component used by cyanobacteria
(Grossman, Lemaux, Conley, Bruns and Anderson, 1981) that is present in mat of M site,
was positively significant with TN%, TC%, air-soil-water temperature, soil pH, water
salinity, Chl a and nitrate. Temperature, nutrients and cyanobacterial mats are also
responsible for Chl a distribution and variations in sediments (Saifullah, 1977; Facca and
Sfriso, 2007).
Soil pH, the soil pH was alkaline in nature throughout all seasons ranging between 8.43 up
to 9.44 which were normal for mangrove sites (Tam and Wong, 1998). Soil pH was low
during monsoon season. It was positively correlated with DO, water salinity, C: N and
negatively correlated with moisture content, LOI%, WHC%, and nitrate (Fig. 8a).
Soil salinity, showed significant variations between two M and WM soil types. The WM
site contained higher salinity rates as compared to M area in all seasons. Salinity ranged
between 35 and 69PSU (Fig.8b). Positive correlation was found between DO, B.D., soil
72
salinity and TC%, soil pH, nitrite and negative correlation was observed with, moisture
content, LOI%, WHC%, and Chl b content.
Soil temperatures, we observed no significant variations in the soil temperature-pH levels of
M and WM sites. The temperature and salinity values were similar to the mangrove study of
(Saravanakumar, Sesh, Thivakaran and Rajkumar, 2008). The soil temperature ranged
between 15 and 28 ºC. The maximum temperatures were observed during monsoon season.
The sediment was cooler as compared to air possibly due to fresh water input. Also, the
Avicennia marina canopy cover provides limited absorption of solar radiation (Tolhurst and
Chapman, 2007). The soil temperature correlated positively with DO, water pH, NO2-, NO3-
and negatively with soil pH, water salinity and C: N. (Fig.8c).
Soil bulk density, (B.D.) of M site is lower than WM due to presence of organic content
(Chen and Twilley, 1999b) the values were high during the monsoon season. B.D. was
found within the range of 0.83-1.25 g.cm-3 and was correlated (+) with TN%, TC%, soil-
water pH, nitrite, ammonia, C: N and negatively correlated to Chl b, phosphate (Fig. 9b).
73
(A)
(B)
(C)
Figure 8. Average values (±S.E.) of soil and water (A) pH, (B) salinity, (C) temperature,
recorded at the study sites of Sandspit mangrove mat area (M) and Fringe without mat area
(WM) during the climatic pre-monsoon, monsoon and post-monsoon seasons.
0
20
40
60
80
Sal
init
y
(‰)
Soil M Soil WM Water
0
10
20
30
Pre-Monsoon Mnosoon Post-Monsoon
Tem
per
atu
re º
C
Seasons
Air Soil M Water Soil WM
0.0
3.0
6.0
9.0
pH
Water Soil M Soil WM
74
(A)
(B)
Figure 9. Average values (±S.E.) of soil and water (A) dissolved oxygen of waterand (B)
bulk density of soil recorded at the study sites of Sandspit mangrove mat area (M) and
Fringe without mat area (WM) during the climatic pre-monsoon, monsoon and post-
monsoon seasons.
0.0
0.4
0.8
1.2
1.6
Dis
solv
ed O
xygen
(m
g/L
) M WM
0.0
0.5
1.0
1.5
Pre-Monsoon Monsoon Post-Monsoon
Bu
lk D
ensi
ty (
g/c
m3
)
Seasons
75
3.4.2. Channel water characteristics:
Sandspit mangrove area holds many marine water channels. The presently studied sites like
others were flooded daily by tides. The forest is occupied 100% by Avicennia marina trees.
The means of total nutrients released into the water column and uptake by sediment is
illustrated (Table XII). The water channel salinity levels remained high (up to 42PSU) in
pre-monsoon and were lower during rest of the seasons (Fig.8b). Water salinity was highly
positively significant with total TN%, DO, C/N and negatively significant with (bulk
density) B.D., NO2-, NO3-. We observed some variations in dissolved oxygen levels; the M
site contained more DO as compared to WM site (Fig.9a). The DO levels were high during
monsoon and low in other seasons because rainfall and river runoff were also attributed to
affect the rate of dissolved oxygen (Saravanakumar, Sesh, Thivakaran and Rajkumar, 2008).
DO was significantly positively correlated with TC%, Chl a, NH4+, Chl a/b, B.D. and
negatively correlated with PO43-. Values for water pH were low during monsoon may be due
to influx of freshwater, and carbon dioxide removal via photosynthesis (Fig.8a). There was a
positive correlation between NO2-, NO3- and negative correlation between soil pH, water
salinity, C/N and Chl a/b respectively. Highest water temperature was recorded during
monsoon season (28ºC) (Fig. 8c). We observed a significant positive correlation (+) between
temperature and DO, water pH, NO2-, NO3- and negative correlation with water salinity and
C: N. Factors influencing above mentioned parameters include rate of transpiration,
evaporation, rainfall, tidal cycle and waste water runoff (Table XIV).
76
The nutrients present in the mangrove water channel are responsible for metabolic growth
and sustenance of primary producers and decomposers. N and P are also essential for growth
of mangrove trees (Lovelock, Feller, McKee and Thompson, 2005). We observed that
concentrations of nutrients were influenced by seasons and physico-chemical parameters.
Overall there was more nutrient exchange in M area as compared to WM area. During the
pre -monsoon season, increased levels of ammonia were exchanged. In monsoon season
increased levels of nitrate and ammonia (release) and phosphate (uptake) were recorded.
Finally, in post-monsoon season high levels of phosphate (release) and ammonium (uptake)
were observed. (Table XII). Maximum average PO43- concentrations were found to be (up
take) -3.58(± 10.81) and (release) 15.85(± 10.05) mol.m-2.day-1 which was positively
correlated with TN%, TC%, moisture, soil salinity, nitrite, nitrate and negatively correlated
with Chl a: b. The increased concentrations of Nitrate (uptake -9.2(± 38.12), release 12.41(±
17.45) mol.m-2day-1) and nitrite (uptake -6.88(± 2.51) release 2.63(± 1.17) mol.m-2.day-1)
were relatively low as compared to ammonium. No strong correlation was found between
nitrite and other factors except for Chl b and LOI% (+ correlation). There was a significant
positive correlation between nitrate and DO, TN%, soil salinity, Chl a and a strong negative
correlation with C/N. The highest rates of NH4+ (uptake) -17.48(± 15.46) and (release)
13.04 (± 25.44) mol.m-2.day-1 that showed a significant positive correlation with TN%,
TC%, NO2-, NO3-, Chl a: b, C%, water pH, soil salinity, moisture content and a negative
correlation with PO43- respectively (Table XIV). In both studied sites M and WM, the nitrite
concentrations were lowest as compared to other observed nutrients. NH4+ and PO43- levels
were found to be the highest during all seasons.
77
Phosphate is not a rate-limiting factor in our study area. Earlier studies suggested that
increased phosphate at moderate salinity levels increases primary productivity of wetland
areas (Cardona and Botero, 1998). We can corroborate this information. The reason for high
concentrations of PO43- in mangrove channel water may be due to P content transported in
dissolved state to mangrove area from seawater input via tidal current in to creek area (Chen
and Twilley, 1999a). Other factors include mixing of sediment into water column due to
turbulence (Chandran and Ramamoorthy, 1984), Increased P loads from anthropogenic
sources which contains phosphate-based domestic and industrial waste and poor
management of discharged water quality which may increase the influence of P distribution
in mangrove habitat (Chen and Twilley, 1999a).
Table XII. Nutrient exchange rates of water samples, means (±S.D.), collected in microbial
mat and without mat area.
(Where, –values: uptake rate, +values: release rate, M: bell jar over microbial mat covered soil, WM: bell jar
over fringe area, without microbial mat, NO2- nitrite ion, NO3
- nitrate ion, NH4+ ammonium ion, PO4
3-
phosphate ion.)
M (mol.m-2.day-1) WM (mol.m-2.day-1)
Seasons NO2- NO3
- NH4+ PO4
3- NO2- NO3
- NH4+ PO4
3-
Pre-monsoon 6.88
(2.51)
9.20
(38.13)
(25.44)
3.58
(10.81)
1.41
(2.62)
4.50
(5.17) 10.96
(128.26)
7.63
(6.47)
Monsoon 1.02
(1.46)
11.77
(10.89)
11.37
(61.97)
2.85
(18.01)
1.79
(2.22)
3.38
(17.01)
6.68
(69.09)
1.75
(15.18)
Post- monsoon 3.05
(12.14)
(17.45)
17.48
(15.46)
15.85
(10.06)
2.63
(1.17)
.00
(3.01)
10.13
(12.68)
14.97
(9.79)
78
Nitrification process imputes to high ammonium rates (Allen, Dalal, Rennenberg and
Schmidt, 2011) and it could also be an indication of increased decomposition and
mineralization rates. Decreased nitrate rates may mean denitrification is efficient. Nitrate in
seawater could reduce to NH4+ via soil water interphase in mangrove area (Buresh and
Patrick, 1981). These types of systems where mangrove area is compromised by unregulated
deposition of wastewater, the associated bacteria were likely to fix nitrogen at low rate
(Mann and Steinke, 1989), which may result in increased levels of ammonia.
Ammonification rates may be independent of nitrogen concentration in mangrove area
(Chen and Twilley, 1999b) as we found no strong correlation between TC%, TN% and C:
N, there lies a complex relation between quality of sediment substrate with mineralization
rates of nitrogen and phosphate (Chen and Twilley, 1999b). Bacteria also efficiently convert
nitrogenous organic compounds into ammonium ions (Rivera-Monroy, Twilley, Boustany,
Day, Vera-Herrera and Ramirez, 1995) and nitrate reduction to ammonium may also
conserve nitrogen (Tiedje, 1988) in mangrove ecosystem, which may lead to increased N
content through all seasons. Ammonification, nitrification, denitrification and decomposition
of detrital matter by bacteria also influence the nitrate and nitrite rates (Rajasegar, Peramal
and Santhanam, 2005). Other variables that increase the rates of nitrogen content in
mangrove ecosystems may also include the presence of cyanobacterial mats present on
forest floor (Toledo, Bashan and Soeldner, 1995), freshwater input (Morell and Corredor,
1993) and nutrient input due to tidal cycle, (Boto, 1979). Lastly, anthropogenic activities
resulting in high nitrogen and phosphorous concentrations may lead to increased rates of
microbial respiration and nitrogen transformation (Chen, Tam and Ye, 2012). The Physico-
chemical parameters were similar to other southeast Asian Gulf of Kach mangrove study
79
conducted by Saravanakumar, Sesh, Thivakaran and Rajkumar, (2008) and earlier studies of
Sandspit area conducted by Farooqui, (2012) and Shafique, (2004). The nutrient values were
comparable with Indonesian Citanduy mangrove study conducted by Moll, (2011).
3.4.3. PCA and Cluster analysis:
The PCA was applied to minimize the complexity of variables data. It showed how sediment
relates to 20 different variables during seasons. The PCA ordination of sediment reveal
positive aggregation of conditions 1, 2, 5, 6 9,10 and negative group of conditions
3,4,7,8,11,12, on PC1 axis. On PC2 axis positive cluster of conditions 1,2, 5, 6, 7, 8 and
negative aggregation of conditions 3,4,9,10, 11,12 were recorded (Fig. 10). PC1 axis was
accounted for 44% of the variance and was strongly related to soil salinity (-0.65), LOI
(0.38), WHC (0.26), Moisture content (0.40) and ammonia (0.34). The second significant
axis PC2 was accounted for 32% of variance and was mainly related to soil temperature
(0.24), soil salinity (0.49), ammonia (0.65) and phosphate (-0.43) respectively (Table XIII).
These are considered to be integral factors related to mangrove sediment associated
microbes (Gonzalez-Acosta, Bashan, Hernandez, Ascencio and De la Cruz, 2006). A score
plot of these two soil and nutrient parameters illustrates the strong relationship between soil
site and presence or absence of microbial mat (Fig. 10).
80
Figure 10. Two dimensional PCA ordination of Sandspit mangrove channel waters
variables (dissolved oxygen, air temperature, water temperature, water pH, water salinity,
nitrite, nitrate, ammonia, phosphate) and sediment characters (total nitrogen, total carbon,
soil temperature, soil pH, soil salinity, soil bulk density, loss of ignition, water holding
capacity, moisture, chlorophyll a, chlorophyll b) in twelve different conditions (1)Pre-
Monsoon M top, 2)Pre-Monsoon M bottom, 3)Pre-Monsoon WM top, 4)Pre-Monsoon WM
bottom, 5)Monsoon M top, 6)Monsoon M bottom, 7)Monsoon WM top, 8)Monsoon WM
bottom, 9)Post-Monsoon M top, 10)Post-Monsoon M bottom, 11)Post-Monsoon WM top,
12)Post-Monsoon WM bottom) at two sites mat area (M) and without mat fringe area (WM)
located in Sandspit mangrove. (top= 0-5 cm sediment, bottom= 5-10 cm sediment). Ihe
Component 1 strongly separate the R vs NR distinction whereas the Component 2 displays
the seasonal differences. The vertical distinction between tops and bottoms of the mat are
clearly increased by the presence of the mat. Red= Pre-monsoon season, Green= Monsoon
season, Blue= Post-monsoon seasons.
81
Table XIII. PCA results showing the first three components for twenty physico-chemical
sediment and nutrient variables in twelve conditions at Sandspit mangrove.
[Where, (TN) total nitrogen, (TC) total carbon, (DO) dissolved oxygen, (AIR ºC) air temperature, (SOIL ºC)
soil temperature, (WATER ºC) water temperature, (Soil PSU) soil salinity, (B.D.) soil bulk density, (Water
PSU) water salinity, (LOI) organic matter via loss of ignition, (WHC) water holding capacity, (Chl a,b)
chlorophyll a,b. (NO2-) nitrite, (NO3-) nitrate, (NH4+) ammonia, and (PO43-) phosphate. The twelve different
conditions were as follows, (1)Pre-Monsoon M top, 2)Pre-Monsoon M bottom, 3)Pre-Monsoon WM top,
4)Pre-Monsoon WM bottom, 5)Monsoon M top, 6)Monsoon M bottom, 7)Monsoon WM top, 8)Monsoon WM
bottom, 9)Post-Monsoon M top, 10)Post-Monsoon M bottom, 11)Post-Monsoon WM top, 12)Post-Monsoon
WM bottom) at two sites mat area (M) and without mat area (WM) (top,0-5 cm and bottom,5-10 cm sediment
section)].
Variables PC1 PC2 PC3
TN (%) 0.01 -0.01 -0.03
TC (%) 0.00 0.00 0.01
DO (mg/L) 0.01 0.01 -0.01
Air (ºC) 0.04 0.21 0.18
Soil (ºC) 0.03 0.24 0.32
Water (ºC) 0.02 0.18 0.29
Soil pH -0.01 -0.01 -0.01
Water pH 0.00 0.00 0.01
Soil (PSU) -0.65 0.49 0.26
Water (PSU) -0.01 -0.09 -0.13
B.D (g/cm-3) 0.00 0.01 0.00
LOI (%) 0.38 0.03 0.26
WHC (%) 0.26 0.04 0.08
Moisture (%) 0.40 -0.07 0.25
Chl a (g.g-1) 0.01 0.01 -0.01
C hl b (g.g-1) 0.00 -0.01 0.01
NO2- (mol.m-2.h-1) -0.11 0.09 0.18
NO3- (mol.m-2.h-1) 0.15 -0.03 0.62
NH4+ (mol.m-2.h-1) 0.34 0.65 -0.31
PO43- (mol.m-2.h-1) -0.23 -0.43 0.23
Eigenvalue 339.643 244.852 157.003
% variance 44.277 31.92 20.467
82
Figure 11. Dendrogram (Cluster analysis) of physical and chemical variables of channel
water and sediments (dissolved oxygen, air temperature, water temperature, water pH, water
salinity, nitrite, nitrate, ammonia, phosphate, total nitrogen, total carbon, soil temperature,
soil pH, soil salinity, soil bulk density, loss of ignition, water holding capacity, moisture,
chlorophyll a, chlorophyll b) under different seasonal conditions up to 10 cm depth (1)Pre-
Monsoon M top, 2)Pre-Monsoon M bottom, 3)Pre-Monsoon WM top, 4)Pre-Monsoon WM
bottom, 5)Monsoon M top, 6)Monsoon M bottom, 7)Monsoon WM top, 8)Monsoon WM
bottom, 9)Post-Monsoon M top, 10)Post-Monsoon M bottom, 11)Post-Monsoon WM top,
12)Post-Monsoon WM bottom) were observed at two sites mat area (M) and without mat
area (WM), (top 0-5 cm, bottom 5-10 cm soil sections). Red bracket, M= Microbial mat
covered and Blue bracket, WM= without mat covered observations.
83
The seasons were not easily discerned. The separate clusters were formed on the basis of M
and WM types. These sites were influenced by a combination of soil variables considered in
this study. As such on PC1, WM soils of pre monsoon (conditions 3,4) monsoon (7,8) and
post monsoon (11,12) were clustered closely and M soil of pre monsoon (1,2) monsoon (5,6)
and post monsoon (9,10) is expected to have a combined cluster. There was an exception of
WM (conditions 7, 8) and M (9,10) on PC2 which were clustered with opposite soil types
inferring some similarity in monsoon WM and post monsoon M soil condition. Ranking the
variables by cluster analysis showed seasonal data was divided into three groups (Fig. 11)
based on soil type. The sediments can be clearly differentiated in to M and WM, this
distribution showed that there are no drastic changes within M and WM sediments (up to 10
cm depth) with respect to seasons except for post monsoon M soil (conditions 9,10) that
formed a separate cluster. One-way ANOVA analysis revealed that the cluster results were
significantly different (p<0.05). These clusters appear to be based on sediment salinity, net
moisture, N and P content at each sediment site, though other variables may also play a role
in the cluster formation. The PCA and cluster analysis provides a qualitative analysis
suggesting that the mat plays an integral role in maintaining the complex nature of
associated soil through all seasons and is an important part of mangrove vegetation. There
must be other discriminating variables affecting these sites which were not revealed by our
current physico-chemical measurements of two sediment types.
84
Tab
le X
IV.
Pea
rso
n C
orr
elat
ion
s b
etw
een s
oil
pro
per
ties
(0
-10
cm
dep
th)
and M
ang
rov
e ch
ann
el w
ater
s pro
per
ties
for
the
stu
die
d
site
s in
Sand
spit
, K
arach
i.
[Wh
ere,
p-v
alue<
0.0
5,
row
s an
d c
olu
mns
abb
revi
atio
ns
are
as f
oll
ow
s, (
TN
) t
ota
l n
itro
gen
%,
(TC
) to
tal
carb
on %
, (D
O)
dis
solv
ed o
xygen
mg/l
, (A
.T.)
air
tem
per
atu
re º
C,
(S.T
.) s
oil
tem
per
ature
ºC
, (W
.T.)
wat
er t
em
per
atu
re º
C,
(S.S
.) s
oil
sal
init
y P
SU
, (B
.D.)
so
il b
ulk
den
sity
g/c
m3,
(W.S
.) w
ater
sali
nit
y P
SU
,
(LO
I) o
rgan
ic m
atte
r via
lo
ss o
f ig
nit
ion
%,
(WH
C)
wat
er h
old
ing c
apaci
ty %
, (M
.) M
ois
ture
co
nte
nt
%,
(Ch
l a,
b)
chlo
rop
hyll
a,b
. (N
O2- )
-2.h
-1,
(NO
3-
-2.h
-1,
(NH
4+
-2.h
-1,
(PO
43
--2
.h-1
, (C
/N)
carb
on
-nit
rogen
ra
tio,
and (C
hl
a/b)
chlo
rophyll
a,
b
rati
o.L
ow
sig
nif
ican
ce,
*, S
ign
ific
ant
**
, H
igh
sig
nif
ican
ce
**
*].
85
3.4.4. Environmental health and Recreational value:
The researched site is quite compromised and is not suitable for recreational activities and
commercial fishing due to contamination by wastewater which is detrimental to mangrove
(Wong, Tam and Lan, 1997), other immediate threats to the Sandspit mangrove ecosystem
includes reclamation of land for building projects, development of cottage and heavy
industries, desolation of habitat, overgrazing and seawater intrusion (Damhoureyeh and
Ghalib, 2014). Effective remedial strategies are required to minimize current adverse
conditions. Present study will initiate further assessment of significant coastal eco systems
associated with Pakistan’s coastal belt. There is further need of an elaborate temporal scale
study to analyze the intricacies of sediment associated microbial processes in the habitat and
their long term impact on the productivity of the mangrove ecosystem. There is also a need
to assess the long term changes to soil sediment which could benefit in future restoration of
Sandspit and other related ecosystems.
86
CHAPTER 4
SEASONAL VARIATIONS IN POTENTIAL
NITRIFICATION RATES IN MANGROVE SEDIMENT
AT SANDSPIT BACKWATERS, KARACHI,
PAKISTAN
(Manuscript accepted for Publication)
87
SEASONAL VARIATIONS IN POTENTIAL NITRIFICATION
RATES IN MANGROVE SEDIMENT AT SANDSPIT
BACKWATERS, KARACHI, PAKISTAN
4.1. Abstract:
Sandspit coastal area is located between Hawksbay and Manora channel, south of Karachi.
The area opposite to sandy beach is covered by mangrove forest of Sandspit backwaters.
The potential nitrification rates in sediment from rhizosphere and non-rhizosphere at
Sandspit backwater mangrove forest was examined using sodium chlorate inhibition
method. Samples collected during pre-monsoon (Jan), monsoon (late June) and post-
monsoon (Nov) seasons were analyzed using two different concentration of inhibitor. The
higher inhibitor concentration (30mM) was found to be more effective than lower (15mM)
concentration used. The potential nitrification rates were slightly higher during monsoon as
compared to other seasons. The potential nitrification values ranged from 0.06 (post-
monsoon) to 1.20 g NO2- Ng w-1h-1 (monsoon). The potential nitrification rates had
significant correlation with the incubation time (p<0.005, n=3). The nitrifiers in mangrove
sediments appear to tolerate a range of physical and chemical variations, such as,
temperature (17-28 ºC), pH (6.8-8.9), Salinity (36-42) and DO (3.7-6.5 mg/L) and maintain
steady potential nitrification rates, as observed by present experiment in two sediments types
during all seasons.
88
4.2. Introduction:
Mangrove belt of Sandspit are highly productive (Siddiqui, Farooq, Shafique and Farooqi,
2008; Faroouqi, Shafique, Khan, Ali, Iqbal and Siddiqui, 2012; Shafique, Siddiqui, Aziz,
Burhan, Mansoor and Nafisa, 2013) which are located in the harbor areas of Karachi that
stretches from Hawksbay to Mannora channel. It is an estuarine area with a tidal range of -
0.4 up to 3.2m. This area is an integral part of the fan shaped Indus delta and consist of
monospecific Avicenna marina which provides food, fodder, medicine and coastal
protection to nearby local community area. Sediments are transported via Indus river to
estuarine parts which consequently develops and sustains this region (Saifullah, 1997;
Siddiqui, Farooq, Shafique and Farooqi, 2008). The primary productivity of mangrove area
is relatively high as compared to other coastal systems due to the presence of a unique
ecosystem having microbial community that efficiently transforms and provides essential
nutrient supplies including various forms of nitrogen (Kristensen, Jensen, Banta, Hansen and
King, 1998; Tam, Wong, Wong and Wong, 2009). Nitrification process involves the
microbial oxidation of ammonia to nitrite and then to nitrate (Alongi, Boto and Robertson,
1993). Soil Nitrification is a vital biogeochemical process as the microbes belonging to the
family Nitrobacteraceae are responsible for recycling of nitrogen. Nitrogen is considered to
be the rate limiting factor in ecosystems (Rabalais, 2002; Elser, Bracken, Cleland, Gruner,
Harpole, Hillebrand, Ngai, Seabloom, Shurin and Smith, 2007). The oxidized nitrogen is
used as a source of energy for growth. This process is under the influence of various
environmental parameters such as temperature salinity and pH (Olsson and Falkengren-
Grerup, 2000; Isnansetyo, Thien, Seguchi, Koriyama and Koga, 2011). The nitrite which is
89
produced during nitrification is required for nitrogen leaching in soil and directly involved in
the production of gaseous nitrogen greenhouse compounds and removal of N from soil (Von
Cleemput and Samater, 1995; Yan, Wang, Mao, Ma, Li, Ouyang, Guo and Cao, 2015). A
recent study conducted in Germany revealed that nitrite acts as the direct precursor of nitric
oxide (NO) formation under both anaerobic and aerobic state respectively (Russow, Stange
and Neue, 2009). In Southeast Asia and China, it was observed that the potential nitrification
rates in mangrove area were influenced by salinity (Miranda, Balachandran, Ramesh and
Wafar, 2008), organic carbon (Krishnan and Bharathi, 2009), soil moisture content and
nutrients (Singh and Kashyap, 2007) and tidal cycle (Hou, Liu, Xu, Ou, Yu, Cheng, Lin and
Yang, 2007). In Pakistan, the significance of potential nitrification process has been
examined mostly on agricultural soils (Amin and Flower, 2004; Gill, Abid and Azam, 2006;
Ahmedani, Yasmin, Arain, Shah, Abro and Nahyoon, 2007; Ali, Iqbal, Tahir and Mahmood,
2008; Ali, Kanwal, Iqbal, Yaqub, Khan and Mahmood, 2012) but there is no study related to
mangrove areas.
The objective was to observe the seasonal effect on the rate of potential nitrification (PN) of
two sediment types, mangrove (Rhizoidal area, R) and fringe area (non-rhizoidal, NR) soils
by using the sediment slurry method of Belser and Mays, (1980). The sodium chlorate was
used as a nitrite oxidation inhibitor. It enabled us to measure NO2-N production in samples.
The samples after treatment were finally analyzed spectrophotometrically. The results were
to be graphically interpreted and statistically computed using Box plot method and Pearson
correlation method (p<0.005, N=3).
90
4.3. Material and Methods:
4.3.1. Sampling:
Sampling was conducted from study site (Fig. 2b and pg. 31) during late November 2014 till
late June 2015. Sediment samples rhizoidal (R, region having pneumatophores and covered
by benthic microbial mat) and non-rhizoidal (NR, region without pneumatophore and not
covered by benthic microbial mat) regions were collected during pre-monsoon (January),
monsoon (June) and post -monsoon (November) seasons respectively. The samples in
triplicate were cored with 50.8 mm diameter sterile plastic corers wrapped in aluminum foil
and immediately kept under crushed ice in an icebox and transported to laboratory. The
potential nitrification rate was determined by modified method of Belser and Mays, (1980)
(Kristensen, Jensen, Banta, Hansen, Holmer and King, 1998; Hoffmann, Schloter and
Wilke, 2007).
4.3.2. Lab and Statistical Analysis:
All samples were examined in triplicate. Briefly, each of the core samples were divided into
3 cm interval top (T), middle (M) and bottom (B) sediment sections. 3g of sediment slurry
was made in 15ml of phosphate buffer pH 7.5. Triplicate sets were amended with substrate
of ammonium sulphate 1mM (Merk). Because chlorate acts as an inhibitor of nitrification
process (Belser and Mays, 1980) therefore, samples were tested against two different
concentrations of sodium chlorate 15mM and 30Mm (BDH Chemicals) respectively, the
control set consists of flasks with no treatment of chlorate. All flasks were sealed with
stopper and incubated at room temperature on shaker at 150 rpm for 6h. Supernatant of
slurry samples were pipetted out after 2 hrs regular intervals over the incubation period and
91
filtered through 0.45 m (25 mm diameter, Whatman) and centrifuged at 3000 rpm for 5
min. The samples were then immediately frozen until further analysis. Finally, slurry
samples for N determination were analyzed spectrophotometrically by method of Strickland
and Parsons, (1972). The potential nitrification levels were observed by standard curve of
nitrite with time and concentrations during different seasons were observed. Field
parameters such as, temperature of air, water and sediment were recorded using standard
mercury thermometer. Field parameters such as temperature, salinity, pH and dissolved
oxygen were also observed (for details see page 29). The statistical analyses such as Pearson
correlation, box plots, graphs and tables were computed using the software Microsoft Excel
package, 2013 and Minitab Version, 17.1.0.
4.4. Results and Discussions:
4.4.1. Physicochemical and Potential Nitrification rates:
Sandspit Mangrove soils are made up of different combination of clay, sand and silt. The
rhizoidal (R) area is that part of the forest floor where topsoil is covered by thick microbial
mat and pneumatophores protrude out from the ground. That area is always moist, muddy
and often water logged. In contrast, the non- rhizoidal (NR) soil which is present on the
outskirts of mangrove vegetation having no microbial mat or pneumatophores, is relatively
less moist and comparatively loose with visibly low clay and high sand content. The
potential nitrification rates along with physico-chemical parameters were observed for these
two types of soil for all seasons (Fig. 12 a, b). Maximum figures recorded were temperature
28 ºC (monsoon), salinity 42 (pre-monsoon), DO 6.5 mg/L (monsoon) and pH 8.9 (post-
monsoon) respectively.
92
Figure 12. Seasonal observations of field parameters of study site (A) showing temperature
and salinity, (B) showing pH and dissolved oxygen, R= rhizoidal area, NR= non-rhizoidal
area. (N=3, ±S.D. error bars)
0
5
10
15
20
25
30
35
40
45
50
0
5
10
15
20
25
30
35
Pre-Monsoon Monsoon Post Monsoon
Salin
ity‰
Tem
per
ature
ºC
Air (ºC) Water (ºC) Soil (ºC) Salinity ‰(A)
0
1
2
3
4
5
6
7
0
1
2
3
4
5
6
7
8
9
10
Pre-Monsoon Monsoon Post Monsoon
DO
mg
/L
pH
pH water pH Soil R pH Soil NR DO mg/L (B)
93
It was observed that overall, the potential nitrification (PN) rates in the top layer (T) of both
sediments (R 0.43, NR 0.38g NO2- Ng w-1h-1) samples were relatively more as compared to
the middle(M) (R 0.27, NR 0.27 g NO2- Ng w-1h-1) and bottom(B) (R 0.30, NR 0.25 g
NO2- Ng w-1h-1) sections. The rhizoidal (R) samples have higher potential nitrification rates
as compared to non-rhizoidal (NR) soil samples. During 6h incubation maximum PN rates
of R soil sections were found to be 1.20(top, 0-3cm), 0.50(mid, 3-6cm), 0.60(bottom, 6-9
cm) g NO2- Ng w-1h-1. And, the highest rates of NR soil sections were 0.60(top, 0-3cm),
0.50(mid, 3-6 cm) and 0.50(bottom, 6-9cm) g NO2- Ng w-1h-1 respectively (Fig. 13)
We observed more fluctuations in PN values of Rhizoidal T section as compared to rest of
the sections. Similarly, the NR T section has more activity as compared to NR M and NR B
sections. The nitrite accumulation vs incubation period showed significant correlation.
Different concentrations of sodium chlorate (15mM and 30mM) at equal time interval were
also examined. It was found that the inhibition of NO2-N was affected more by 30mM than
15mM concentration. There was a significant correlation between dissolved oxygen and
temperature. The pH of water and soil were found to be highly significant (Table XV).
94
Figure 13. Box plot showing the difference in terms of Potential Nitrification activity (PN)
activity between Rhizoidal (R) and Non-Rhizoidal (NR) sediments. The top 0-3cm (RT,
NRT) mid 3-6cm (RM, NRM) and bottom 6-9cm (RB, NRB) sections during 0-6h
incubation time interval and 0,15,30mM concentration of Sodium Chlorate in Monsoon,
Pre-Monsoon and Post-monsoon seasons (N=3).
1 .2
1 .0
0.8
0.6
0.4
0.2
0.0
NR
M
1 .2
1 .0
0.8
0.6
0.4
0.2
0.0
RT
seasons
conc.
time
pre monsoonpost monsoonmonsoon
301 50301 50301 50
642064206420642064206420642064206420
1 .2
1 .0
0.8
0.6
0.4
0.2
0.0
NR
B
1 .2
1 .0
0.8
0.6
0.4
0.2
0.0
NR
T
1 .2
1 .0
0.8
0.6
0.4
0.2
0.0
RM
seasons
conc.
time
pre monsoonpost monsoonmonsoon
301 50301 50301 50
642064206420642064206420642064206420
1 .2
1 .0
0.8
0.6
0.4
0.2
0.0
RB
95
Tab
le X
V.
Pea
rso
n c
orr
elat
ion c
oef
fici
ent
mat
rix s
ho
win
g r
elat
ion
ship
bet
wee
n t
op
mid
bott
om
Rhiz
oid
al a
nd N
on
-Rhiz
oid
al s
ecti
on
s w
ith t
ime,
ch
lora
te c
on
centr
atio
ns
an
d p
hy
sico
chem
ical
par
amet
ers.
*=
Sig
nif
ican
t at
p<
0.0
05
, R
hiz
oid
al t
op
(R
T)
mid
(R
M)
bo
tto
m (
RB
), N
on
-Rh
izo
idal
top
(N
RT
), m
id (
NR
M),
bott
om
(NR
B),
Tim
e (h
), C
hlo
rate
Co
nce
ntr
atio
n (
mM
), *
sign
ific
ant]
.
96
Seasons significantly affected the potential nitrification rates. During monsoon season the
values varied between 1.20 g NO2- Ng w-1h-1 (RT,15 mM, 6h) to 0.08 g NO2
- Ng w-1h-1
(RB, 30mM, 2h). The rates decreased during pre- monsoon season 0.89 g NO2- Ng w-1h-1
(RT, 15 mM, 6h) to 0.17g NO2- Ng w-1h-1 (NRB, 15 mM, 6h) and were lowest during post
monsoon season 0.58 g NO2- Ng w-1h-1 (NRT, 30mM, 6h) to 0.06 g NO2
- Ng w-1h-1
(RM,15 mM, 2h) respectively.
4.4.2. State of Potential Nitrification at Sandspit Mangrove:
For the first time in Pakistan the potential nitrification PN rates of mangrove backwater area
were recorded. It was observed that the rates were higher in mangrove sediment (which was
covered with microbial mat) as compared to the fringed area (devoid of microbial mat). Our
results were in agreement with earlier study conducted by Luo, Qiu, Wei, Du, Zhao and
Yan, (2014) that also reported higher nitrification rates in mangrove areas in China as
compared to mud flats. Nitrification is a 2-step process in which nitrite is an intermediate
product and due to its fast reaction rate sodium chlorate NaClO3 was used as a specific
nitrite oxidation inhibitor. This type of inhibitor is useful in understanding the process of
nitrification and its associated bacteria as it permits the accumulation of nitrite by inhibiting
the oxidation. The rate of inhibition is proportional to the concentration of nitrite (Belser and
Mays, 1980). By using PN method we indirectly observed the nitrifying bacteria population
(Hansen, Henriksen and Blackburn, 1981; Schmidt and Belser, 1982). The increased rate of
reaction in RT section indicates high rate of bacterial population (Abbasi, Shah and Adams,
97
2001). Certain environmental factors were involved in the regulation of nitrification process
such organic matter, dissolved oxygen, temperature, salinity, pH (Isnansetyo, Thien,
Seguchi, Koriyama and Koga, 2011).
We found PN rates to be fairly constant throughout all seasons indicating that the nitrifying
bacteria involved in these processes are hardy and tolerant to variety of extreme physical
and chemical factors. The salinity tends to fluctuate during seasons due to waste water
runoff, rainfall input and evaporation rates. Current studys physicochemical observations
concur with the study of Miranda, Balachandran, Ramesh and Wafar, (2008) conducted in
Kochi backwaters. The soil pH values were usually above 8.5 suggesting that alkaline
conditions favors nitrification process which was found in earlier studies (Brierley and
wood, 2001; Isnansetyo, Thien, Seguchi, Koriyama and Koga, 2011). The nitrification
process manifested in sediments of up to 6-9cm throughout all seasons which proved that
the nitrifiers were present at such depth. The PN rates do not decrease with the passage of
incubation time at chlorate concentration 15 mM but at 30 mM the rates gradually started to
deplete. The inhibitor started to take visible effect after 5th hour of incubation. The PN rate is
increased in R soil because the Sandspit mangrove area have muddy soil and high clay
content (Farooqui, 2012) and clay due to its small size and potential to exchange cations
results in the ability to exhort a positive effect on microbial processes associated with soil
and water (Macura and Stotzky, 1980; Hoffmann, Schloter and Wilke, 2007). NR sediment
have relatively low water potential which can somewhat limit the bacterial movement (Berg
and Rosswall, 1987) result in less NP values. The amount of substrate which is flowing
continuously and may be changing slowly with seasons can also be the factor in decrease in
98
rates through pre-monsoon, increase in monsoon and then decrease again post-monsoon.
Another reason for yearlong PN activity is the presence of these bacteria in form of very
loose to tough slime layer creating a restrictive barrier between water stress and air drying.
The formation of micro colonies within soil particles helps nitrifiers survival up to 9 cm
deep in soil (Marshall, 1976; Klemedtsson, Berg, Clarholm, Schnürer and Rosswall, 1987).
We were unable to find a significant relation between nitrification rates and field parameters
but there was a strong correlation amid physicochemical factors such as water-soil pH and
dissolved oxygen-temperature. There was a significant correlation in PN rate and incubation
time. The PN rates of two soil types (R, NR) were also positively correlated with soil
sections (T, M, B) respectively (p<0.005). In future multidisciplinary approach is required to
observe the peak nitrification rates along with study of soil nitrifies in order to comprehend
the role of various physico-chemical aspects and rate limiting factors such as carbon content,
total nitrogen, chlorophyll and nutrient ion content involved so that we may gain better
understanding of nitrification process taking place in our Sandspit backwaters mangrove
forests.
99
PART III
DOMINANT CYANOBACTERIA FORMING GREEN
MICROBIAL MAT AND SCREENING OF
ANTAGONISTIC SUBSTANCES (BACTERIOCINS)
100
CHAPTER 5
SEASONAL ABUNDANCE OF SIX DOMINANT
FILAMENTOUS CYANOBACTERIAL SPECIES IN
MICROBIAL MATS FROM MANGROVE
BACKWATERS, SANDSPIT PAKISTAN
(Manuscript Published)
101
SEASONAL ABUNDANCE OF SIX DOMINANT
FILAMENTOUS CYANOBACTERIAL SPECIES IN
MICROBIAL MATS FROM MANGROVE BACKWATERS,
SANDSPIT PAKISTAN
5.1. Abstract:
Microbial mats in the mangrove forests of Sandspit coastal area, south of Karachi, Pakistan
were studied between Jan 2012-Jan 2014. Six major filamentous cyanobacteria belonging to
three genera Oscillatoria (3), Spirulina (2) and Phormidium (1) were identified in the
backwaters mat samples. One of the cyanobacterium species Spirulina labyrinthiformis is
reported from this site for the first time in Pakistan. The most dominant species was
Oscillatoria brevis (22% abundance), closely followed by Phormidium tenue (21%). These
filamentous forms were present in all seasons and tolerated varying physico-chemical
ranges, such as, temperature (15-28ºC), pH (6.8-7.5), salinity (36-42PSU) and dissolved
oxygen (0.201-0.543ppm). Chlorophyll a levels in mat area sediments were ranged between
0.039 up to 5.050 mg/g. The minimum and maximum biovolume was 0.174 and 1.649mm3/l
respectively. We observed a strong positive correlation (p<0.05) between observed
filamentous form of cyanobacteria and field parameters such as water-soil-air temperatures,
pH and dissolved oxygen. The outcome suggests a potential for detailed molecular study on
microbial mat. Further studies are required to understand the interactions of microbial mat
with soil and water components.
102
5.2. Introduction:
Pakistan has a coastline of 1050 km in the Arabian Sea (Amjad and Kamaruzaman, 2007;
Siddiqui, Farooq, Shafique and Farooqi, 2008). The mangrove population in Pakistan thrives
in the Indus delta. This fan shaped delta affects the coast of the Sindh and Baluchistan
provinces where mangrove forests are present at Sandspit, Korangi, Keti Bundar, Miani,
Kalmathor Jiwani and Gawadar bay respectively. Mangrove swamps are considered
significant in terms of coastline protection; they provide economic and cultural support
through food, fodder and fuel wood for local populations. Mangroves are also ecologically
significant, as they serve as breeding grounds and sustain various species of flora and fauna.
This habitat is influenced by tidal height and variations in temperature, salinity, pH, oxygen
content, organic and inorganic nutrients and humidity, among others. The forest floor is
covered by conspicuous microbial mats constituted by decomposers and primary producers
including bacteria, cyanobacteria, fungi and protista. Benthic cyanobacteria,
photoautotrophic, gram negative bacteria, (Prescott, 1998; Hoiczyk and Hansel, 2000)
constitute a significant proportion of these microbial communities (Cole, Hutchison,
Renslow, Kim, Chrisler, Engelmann, Dohnalkova, Hu, Metz, Fredrickson and Lindemann,
2014) as free–living, in associative or endo-symbiotic relationships (Puyana, Acosta, Bernal,
Velásquez and Ramos, 2015). In aquatic systems, cyanobacteria and some eukaryotic
microorganisms (e.g. diatoms) can form microbial mats and contribute to the local primary
productivity. Heterocystous and some non-heterocystous cyanobacteria fix nitrogen (Zehr,
Waterbury, Turner, Montoya, Omoregie, Steward, Hansen and Karl, 2001) reducing it to
ammonia that becomes available to other organisms including mangrove plants which then
103
proliferate in otherwise nitrogen-limited conditions. Cyanobacteria have a significant
potential in terms of nutrient recycling (Hegazi, Mostafa and Ahmed, 2010), prevention of
soil erosion (Sugumar, Ramanathan, Rajarathinam, Jeevarathinam, Abirami and
Bhoothapandi, 2011), increased tolerance to extreme variations in temperature and pH
levels, phosphorous and nitrogen storage (Özbay, 2011), and increased oxygen
concentrations (Mandal, Vlek and Mandal, 1999). Cyanobacteria can obtain carbon dioxide
where it is limited, decreased concentration sites, supporting low water retention times in
nitrogen limited sites (Miyachi, Iwasaki and Shiraiwa, 2003; Wu, Zou and Gao, 2008).
Although there has been a significant number of studies on the coastal flora of Pakistan
including macro and micro algae (Shameel and Tanaka, 1992; Siddiqui, Mansoor, Zaib-un-
Nisa, Shafique and Farooq, 2000; Bano and Siddiqui, 2004; Rizvi and Shameel, 2004;
Saifullah and Ahmed, 2007; Siddiqui, Farooqui, Valeem, Rasheed and Shafique, 2009;
Shafique, Siddiqui, Aziz, Burhan, Mansoor and Nafisa, 2013; Faroouqi, Siddiqui and
Rasheed, 2014), benthic filamentous cyanobacteria have not been studied yet in the
country´s mangrove swamps. Only one report describing in detail the systematic
characterization of mangrove associated microalgae, including cyanobacteria, is available
(Zaib-un-Nisa, Mansoor and Siddiqui, 2000). Therefore, the objective of this investigation
was to assess the abundance and seasonal variation of filamentous cyanobacteria growing at
the Sandspit mangrove forest, and identify some of the dominant species.
104
5.3. Material and Methods:
5.3.1. Field Sampling:
Sandspit backwaters are located approximately at 24º 49´ N and 66º 56´ E between Manora
and Hawksbay waters and adjacent to a Navy dockyard (Fig. 2b, site A, for details of site
description see pg. 31). Sampling took place every three months between January 2012 to
January 2014. The collection period was broadly divided into pre-monsoon (winter, NE
monsoon season), monsoon (spring, SW monsoon season) and post monsoon seasons
(autumn). Microbial mats from different forest floor areas were collected in triplicate using
glass slides and transferred into sterile plastic containers. These were marked (culture code,
site, date, and color) and kept in an ice cooler, then transferred to the laboratory for further
analysis.
5.3.2. Physicochemical parameters, Microscopy, Biovolume and Statistical analysis:
Samples (3.0 mm fractions ) were observed in triplicate within 24 hours using artificial
seawater without fixatives and kept at ambient temperature under light source (2000lux)
during analysis. Cells were observed under light microscope (Olympus, Japan) to record
morphological characteristic and measure morphometric features of interest. Despite
molecular taxonomic assessment which have facilitated a more detailed assessment of
cyanobacterial species (Engene, Paul, Byrum, Gerwick, Thor and Ellisman, 2013), classic
taxonomic assessment is still relevant for some preliminary evaluation (Puyana, Acosta,
Bernal, Velásquez and Ramos, 2015). Hence for our observations, cyanobacteria were
105
taxonomically identified following the identification keys of Komarek, (1992), Komárek
and Hauer, (2013), Guiry and Guiry, (2016). Environmental variables were recorded at
every collection. Air, sediment and water temperature (ºC) were measured with a (mercury
thermometer), salinity was measured with a ATAGO 0161633 refractometer (Japan) and pH
was determined with an ELEMETRON CP-401 pH meter., Chlorophyll a (benthic samples
using 30 mm polyethylene corers) and dissolved oxygen (channel water flowing over mat
area, sampled in ambient 80ml bottles) determinations were performed in triplicate
following Strickland and Parsons, (1972). Pearson correlations were calculated to determine
the relationship between field environmental variables and relative abundance of species.
Bio-volume, which is a measure of cyanobacterial biomass, was calculated using the
standard formulae (Hillebrand, Dürselen, Kirschtel, Pollingher and Zohary, 1999; Türkmen
and Kazanci, 2010). To determine the predominate filamentous cyanobacterial species
present in mat samples, the abundance of individual species was calculated by the methods
of Roger, Jimenez and Santiago, (1991) and Laslett, Clark and Jones, (1997). Statistical
analyses were performed using the Microsoft Excel 2013 and Minitab statistical software
Version 17.1.0.
5.4. Results and Discussion:
5.4.1. Physical and Chemical Parameters:
Experimental variables noted showed seasonal fluctuations (Table XVI). Slight differences
in temperature range were noted for air (19-24ºC), water (17-24.5 ºC) and sediments (15-24
ºC). Lower values were obtained during the pre-monsoon (Jan) and higher during the
106
monsoon (Apr, Jul) and post-monsoon (Oct) seasons. Both pH (6.8-7.5) and salinity (36-
42PSU) varied with seasons and lower values were observed during the monsoon season.
The dissolved oxygen concentration in water samples ranged from 3.70 to 7.18 ppm,
showing greater values during the monsoon season. Chlorophyll a (0.038 to 5.05 mg/g) had
greater values during the pre- monsoon and post-monsoon seasons, and lower values were
observed during the monsoon season.
Table XVI. Seasonal variations in physical and chemical parameters of water and sediments
from Sandspit backwaters mangroves (Mean± S.D., N=6).
Seasons Months DO Temperature ºC
pH Sal
PSU
Chl a
mg/g ppm Air Water Soil
Pre -Monsoon JAN 3.85
± 1.74
20
±2.22
17
±3.33
15
±5.50
7.2
±0.33
42
±3.00
1.13
±2.34
Monsoon
APR 6.25
±1.80
24
±2.65
23
±2.29
24
±2.31
7.5
±0.40
36
±3.06
0.24
±2.84
JUL 7.18
±2.46
19
±0.71
20
±3.18
28
±2.83
6.8
±0.50
42
±2.83
0.04
±3.54
Post -Monsoon OCT 3.70
±1.72
20
±2.65
24.5
±3.00
24
±6.66
7.5
±0.35
38
±3.46
5.05
±0.58
DO = Dissolved Oxygen; Chl a = Benthic Chlorophyll a content; Sal PSU = Salinity, JAN= January,
APR=April, JUL=July and OCT=October
107
Table XVII. List of organisms observed in microbial mats during the seasonal study period
of Sandspit mangrove area.
Seasons
Organisms Pre -monsoon Monsoon Post -monsoon
Cyanobacteria
Phormidium tenue ++ ++ ++
Spirulina major + + ++
S. labyrinthiformis + + ++
Oscillatoria brevis ++ ++ ++
O.limosa - ++ ++
O.princeps ++ ++ ++
O. subbrevis + + +
Aphanocapsa sp. + + +
Synechococcus sp. + + +
Diatom
Navicula sp. ++ ++ ++
Nitzschia sp. + + +
Cymbella sp. + + +
Amphora sp. + + +
Cocconeis sp. + + +
Pinnularia sp. + + +
Gyrosigma sp. + + +
Pleurosigma sp. + + +
Hantzschia sp. + + +
Protista
Ciliates - + +
- absent; + not densely present; ++ densely present)
108
5.4.2. Identification of Dominant Filamentous Cyanobacteria:
Six filamentous cyanobacterial species were dominant throughout the sampling periods at
Sandpit backwaters. The characteristics of these cyanobacterial species are outlined as
follows:
1) Phormidium tenue Gomont, 1892. Ann. Sci. Nat. Bot., ser. 7, 16: 91-264, pls 1-7.
(Komárek, 1992; Guiry and Guiry, 2016) General characters: Filamentous; filaments
long, solitary or coiled into clusters and fine mats, arcuated, intensely coiled, isopolar,
thin, fine, 2 m wide, with simple, thin but firm, usually colourless facultative sheaths;
sheaths joined to the trichomes. Trichomes fine, cylindrical, slightly attenuated, with
rounded apical cells, slightly constricted at the cross walls, immotile. Cells longer than
wide, cylindrical, with homogeneous content, without aerotopes, pale blue-green, end
cells without thickened cell walls or calyptras, heterocytes and akinetes are absent (Fig.
14A).
2) Spirulina labyrinthiformis Kützing ex Gomont 1892. Ann. Sci. Nat. Bot., ser. 7, 16:
255. (Komárek, 1992; Komárek and Hauer, 2013) General characters: Filamentous;
unbranched, no sheaths, free floating in fine mats, screw- like coiled along the whole
trichome length, screws are very densely tight trichomes; spirals width ratio being 2.
Trichomes isopolar, 2 m wide uniserial, not attenuated towards the ends, intensely
motile (rotation), usually with homogeneous content, olive green end cells widely
109
rounded, without thickened cell walls or calyptras. Heterocytes and akinetes absent (Fig.
14B).
3) Spirulina major Kützing ex Gomont 1892. Ann. Sci. Nat. Bot., ser. 7, 16: 251.
(Komárek, 1992; Komárek and Hauer, 2013) General characters: Filamentous;
unbranched, no sheaths, free floating in fine mats, screw- like coiled along the whole
trichome length, screws are less densely tight trichomes; spirals width ratio being 2- 2.5.
Trichomes isopolar, 2 m wide and 4m distant uniserial, not attenuated towards the
ends, intensely motile (rotation), usually with homogeneous content, dark olive green
end cells widely rounded, without thickened cell walls or calyptras. Heterocytes and
akinetes absent (Fig. 14C).
4) Oscillatoria limosa Agardh ex Gomont 1892. Ann. Sci. Nat. Bot., ser. 7, 16: 210.
(Komárek, 1992; Komárek and Hauer, 2013) General characters: Filamentous; never
branched, usually in fine, smooth, layered (but not leathery) strata (mats), Trichomes
slightly waved, 22 μm wide, uniserial, composed of shortly discoid cells, slightly
constricted at the cross walls, shortly attenuated to the ends, motile (waving, trembling,
oscillation). Cells without aerotopes but with fine granulation (at the cross walls), dark
green and brownish. End cells widely rounded, heterocytes and akinetes absent (Fig.
14D).
5) Oscillatoria brevis Kützing ex Gomont 1892. Ann. Sci. Nat. Bot., ser. 7, 16: 229 =
Phormidium breve (Komárek, 1992; Komárek and Hauer, 2013) General characters:
Filamentous; unbranched, smooth, layered, rarely solitary or in small groups, without
110
sheaths, Trichomes isopolar, straight, 5 μm wide, uniserial, composed of shortly barrel-
like cells (always shorter than wide), unconstricted at the cross walls, shortly attenuated
to the ends, motile (waving, trembling, oscillation). Cells without aerotopes, olive green.
End cells widely rounded, heterocytes and akinetes absent (Fig. 14E).
6) Oscillatoria princeps Vaucher ex Gomont 1892. Ann. Sci. Nat. Bot., ser. 7, 16: 206.
(Komárek, 1992; Komárek and Hauer, 2013) General characters: Filaments simple,
never branched, usually in fine, smooth, layered, rarely solitary or in small groups,
without sheaths, Trichomes straight, 16 μm wide, uniserial, composed of shortly
cylindrical cells (always shorter than wide), unconstricted at the cross walls, shortly
attenuated to the ends, motile (waving, trembling, oscillation). Cells without aerotopes,
greenish brown, end cells widely rounded, heterocytes and akinetes absent (Fig. 14F).
111
Figure 14. Filamentous cyanobacteria most abundant at Sandspit mangrove backwaters
during the study period. (A) Phormidium tenue (B) Spirulina labyrinthiformis (C) Spirulina
major (D) Oscillatoria limosa (E) Oscillaoria brevis and (F) Oscillatoria princeps. All the
pictures except Fig. 14 (D) (200x) were taken at 400x.
112
Figure 15. Biovolume of the six dominant benthic cyanobacteria at Sandspit mangrove
backwaters.
Figure 16. Average proportional distribution of the six most dominant cyanobacterial
species at Sandspit mangrove backwaters for the period 2012-2014. (where, pie section
21%= Phormidium tenue, 9%= Oscillatoria limosa, 16%= Oscillatoria princpes, 22%=
Oscillatoria brevis, 18%= Spirulina major and 14%= Spirulina labyrinthiformis.)
113
Figure 17. Abundance of the dominant cyanobacterial species in pre- monsoon (January),
monsoon (April, July) and post monsoon (October) at Sandspit mangrove area
114
Ta
ble
XV
III.
Pea
rso
n c
orr
elat
ion
s b
etw
een
do
min
ant
fila
men
tou
s cy
anobac
teri
al s
pec
ies
at S
and
spit
man
gro
ve
and
en
vir
on
men
tal
fiel
d p
aram
eter
s.
(p
<0.0
5, *
sign
ific
ant,
**
hig
hly
sig
nif
ican
t, D
O=
Dis
solv
ed o
xyg
en, S
al=
Sal
init
y P
SU
)
115
The distribution and biovolume of the six most dominant cyanobacterial species are shown
in Figures 15 and 16, respectively. Spirulina major, S. labyrinthiformis, Oscillatoria brevis,
O. princeps, O. limosa, and Phormidium tenue were the major constituents of cyanobacterial
mats throughout the year. Among them O. limosa and O.princeps had the greater bio-
volume compared to the other dominant species (Fig. 15). On the other hand, Phormidium
tenue and O. brevis were the most abundant (Fig. 16) among the dominant species.
The dominance of cyanobacterial species in microbial mats at Sandspit mangroves remained
fairly constant throughout the study. Some species varied in their abundance depending on
the season. Spirulina sp. and O. limosa were not observed in the pre monsoon season. By the
end of the post monsoon season, Spirulina labyrinthiformis and, S. major started to decline.
The growth pattern of Spirulina species was low in July (second half of monsoon season)
(Fig. 17). Other microorganisms which were observed frequently along with major
filamentous forms are listed in Table, (XVII).
The mats that were present all over the sediment displayed an array of colors. Although light
intensity is one of the main factors which exhibit these shades but we also observed that
these mat colors were stable under 4ºC temperatures for up to 72 hours in dark. This may be
due to the abundance or scarcity of certain observed diatoms and cyanobacterial species
(Delfano, Wanderley, Silva, Feder and Lopes, 2012; Taj, Aref and Schreiber, 2014). They
had different tones of brown, yellow or green in different intensities, sometimes attaining
very dark shades. Oscillatoria brevis and O. princepes appears to have cal poly (artichoke)
green, O. limosa displayed an olive green color and Phormidium tenue revealed a lighter
116
shade of forest green whereas, both Spirulina labyrinthiformis and S. major exhibited a dark
apple green shade. Often, O. brevis, O. princepes and O. limosa turned into black colonies.
Biofilms of Navicula sp. diatoms were observed during the winter and displayed dark brown
colour. Yellow and light brown mats usually contained more diatoms and less
cyanobacteria. Protista were occasionally found in mixed mats.
The Pearson correlation analyses (Table XVIII) showed a positive relation between major
filamentous cyanobacterial species and physico-chemical parameters. Oscillatoria sp. were
positively correlated with salinity (0.500), chlorophyll a (0.513), soil-water temperatures
(0.999, 1.000) and pH (0.999). Phormidium sp. was positively correlated with soil-water
temperature (0.971, 0.999), pH (0.971) and chlorophyll a concentration (0.558) whereas,
Spirulina spp. were positively correlated with dissolved oxygen (0.993), air-soil temperature
(0.993, 0.596) and pH (0.596) respectively. Field variables such as Dissolved oxygen was
positively correlated with air temperature (0.999), air temperature was correlated with soil
and water temperatures (0.500, 0.500), water temperature was correlated with soil
temperature, pH and chlorophyll a concentration (0.982, 0.982 and 0.513) and finally soil
temperature was positively significant with pH (1.000). We also observed a positive
correlation among major species. The presence of Oscillatoria brevis influenced by other
filamentous forms except O. princepes. O. limosa was positively correlated with
Phormidium tenue (Table XVIII).
117
5.4.3. Significance of Filamentous Cyanobacteria in microbial mat:
Sandspit backwater mangrove forests consist exclusively of stands of Avicennia marina. The
forest sediments are covered with dense microbial mats. Different microbial communities
are involved in these mats, where cyanobacteria are the dominant group. It was observed in
earlier studies (Seckbach, 2007; Rigonato, Alvarenga, Andreote, Dias, Melo, Kent and
Fiore, 2012; Shafique, Siddiqui, Aziz, Burhan, Mansoor and Nafisa, 2013) that microalgae
(including the genera from our study) associated with mangrove ecosystems enrich the soil
by releasing nutrients, fix carbon and nitrogen, and control soil moisture content thus
playing an integral part in sustaining the primary productivity of related habitats. Under the
same set of environmental conditions, Phormidium tenue and Oscillatoria brevis were the
hardiest of the six dominant cyanobacterial species. They tolerated extreme temperature,
salinity and pH ranges during all the seasons. Phormidium tenue is known to be halotolerant
(Thajuddin and Subramanian, 1992). Oscillatoria and Spirulina species have been known to
thrive in acidic and alkaline soil substrates (Nayak and Parsana, 2003).
There were different physical and chemical variables that correlated with the abundance of
the observed cyanobacterial species. When forming mats, these organisms when have a
greater assimilation efficiency when compared to phytoplankton (Fong and Zedler, 1993).
Cyanobacteria can tolerate a broad range of pH levels and salinity (Bano and Siddiqui,
2004). The pH was lower (6.8) during the monsoon season and greater during the pre
monsoon (7.2) and post monsoon (7.5), probably due to the uptake of carbon dioxide from
photosynthesis processes by cyanobacteria and phytoplankton (Chen and Durbin, 1994). Our
118
site is affected by moderate to high temperatures which are favorable for cyanobacterial
growth (Miyazono, Odate and Maita, 1992). Rainfall is also one of the main features which
brings about various hydrographical changes in the mangrove environment. The monsoon
season with flash flooding started in July and continued until September (approx.137.5 mm,
Pakistan Meteorological Data 2012-2013). The rainfall rate was below average ranges,
resulting in a late cyanobacterial bloom. Our observations (similar to the earlier studies of
Redekar and Wagh, 2000; Vargo, Heil, Ault, Neely, Murasko, Havens, Lester, Dixon,
Merkt, Walsh and Weisberg, 2004) showed that the level of chlorophyll a was high in the
pre monsoon season (1.13 mg/g, ±2.34), low during the monsoon (0.24 mg/g, ±2.84 and
0.04 mg/g, ±3.54) and higher in the post monsoon (5.05mg/g, ±0.58).
Although we found a significant positive correlation (p<0.05) between physical and
chemical parameters and predominate filamentous cyanobacteria, there was no consistent
positive relation between Chlorophyll a and other physical parameters (except for water
temperature) (Odate, Yanada, Castillo and Maita, 1990). Dissolved oxygen values were
greater during the monsoon due to increased biological activity, turbid conditions near the
microbial mat and fresh rainwater input (Satpathy, Mohanty, Sahu, Sarguru, Sarkar and
Natesan, 2011). Oxygen concentrations were low in the remaining seasons. Tidal height,
duration as well as wave movement and turbulence, these factors also affects development
of benthic cyanobacteria (Steinberg and Hartmann, 1988). Other reasons that might explain
their abundance and dominance can be their strong chemical defense system (Pajdak-Stos,
Fiakowska and Fyda, 2001) toxin production (Graham, Loftin, Ziegler and Meyer, 2008;
Frazão, Martins and Vasconcelos, 2010) and less copasetic or unpalatable attribute (Repka,
119
Veen and Vijverberg, 1999; Okogwu and Ugwumba, 2008) which keeps the organisms
away from grazing type feeders like some zooplanktonic organisms along with the lack of
organisms which do prefer it (Rautio and Warwick, 2006) but might not be able to survive in
polluted waters.
We also observed that the six filamentous cyanobacterial dominant species did not perish
under extreme conditions rather, it diminished its growth and seem to adjust acclimatize to
the new set of conditions such temperature, salinity, pH, dissolved oxygen and others. As a
result of this apparent adaptation, it started to bloom again and maintain its presence
throughout the year. Dominant cyanobacteria can thrive in oxidizable organic matter and in
low levels of dissolved oxygen. These species can therefore be found in polluted habitat and
can be considered good pollution indicators (Vijayakumar, Thajuddin and Manoharan, 2007;
Okogwu and Ugwumba, 2008). Cyanobacteria also have a great potential to accumulate
certain hazardous materials like heavy metals and industrial dyes (Rawat, Kumar, Mutanda
and Bux, 2011; Vijayakumar and Manoharan, 2012). Further research is required to
understand the survival mechanisms, and the bioaccumulation and bioremediation potential
of these microorganisms. In current study, less cyanobacterial diversity was observed than
an earlier study of the same site by Zaib-un-Nisa, Mansoor and Siddiqui, (2000) suggesting
that minor cyanobacterial species are indifferent to waste water pollution that may have
compromised this site (author, unpublished data). Further molecular research is required to
explore microbial mat that may facilitate detailed observation of species interaction and their
biochemical aspects.
120
CHAPTER 6
SCREENING OF ANTIMICROBIAL AND
CYTOTOXIC ACTIVITIES OF MARINE
CYANOBACTERIA APHANOCAPSA LITORALIS AND
PHORMIDIUM BREVE ISOLATED FROM
MANGROVE FOREST AT SANDSPIT, PAKISTAN.
(Manuscript submitted for Publication)
121
SCREENING OF ANTIMICROBIAL AND CYTOTOXIC
ACTIVITIES OF MARINE CYANOBACTERIA
APHANOCAPSA LITORALIS AND PHORMIDIUM BREVE
FROM MANGROVE FOREST AT SANDSPIT, PAKISTAN.
6.1. Abstract:
Two strains of cyanobacteria form backwaters mangrove forest were isolated and examined
for potential antagonist activity against clinical and environmental strains of bacteria and
yeast. The cyanobacterial fractions (from sea and distilled water, ethanol, sodium hydroxide)
exhibited variable activity. Results from agar spot assay revealed that the ethanolic fraction
of Phormidium breve and seawater extract of Aphanocapsa litoralis, exhibited positive
antagonistic activity against Candida albicans. Most of bacterial strains were resistant to test
extracts. The cytotoxicity test was employed using Artemia salina. The probit analysis (95%
confidence interval) revealed that the bioassay was highly sensitive against Phormidium
breve ethanolic extract and moderately sensitive against Aphanocapsa litoralis sea water
fraction. The undiluted crude fractions of ethanolic and seawater were found to be lethal and
effective. Median lethal concentration (LC50) values of Phormidium breve ethanolic extract
was 0.02 mg/ml (20 ppm) and Aphanocapsa litoralis sea water fraction was found to be 6.2
mg/ml (6200 ppm) after 24-hours respectively. These findings indicate the fractions were
biologically active and provide a baseline for further antifungal protein research of
mangrove associated cyanobacterial strains.
122
6.2. Introduction:
Cyanobacteria are ubiquitous in moist environment and are highly adaptable under extreme
conditions (Golubic, 1994; Golubic, 2000). They are commonly found in soils and saline
environments (Bhatnagar, Makandar, Garg and Bhatnagar, 2008; Abed, Dobrestov, Al-
Kharusi, Schramm, Jupp and Golubic, 2011) and are responsible for microbial mat
formation on mangrove forest floors (Stal, 2000; Yasmeen, Shafique, Zaib un Nisa and
Siddiqui, 2016). Cyanobacteria serve as a natural source of bioactive substances. Some
cyanobacterial strains have nutritional health benefits (Morton and Steve, 2008) and others
are treated for first generation biofuel production (Bigogno, Goldberg, Boussiba, Vonshak
and Cohen, 2002). Several cyanobacteria contain metabolites that are agriculturally,
pharmaceutically and ecologically important (Schwartz, Hirsch and Sesin, 1990; Schaeffer
and Krylow, 2000; Kim and Lee, 2006; Prabakaran, 2011). Marine cyanobacteria are among
the extensively researched organisms and are source of most of novel marine associated
pharmaceutical products (Gerwick and Moore, 2012).
In Pakistan some studies were found that were associated with cyanobacteria. Frequent
researches were related to taxonomic assessment of cyanobacterial strains of coastal areas
(Mansoor, Siddiqui, Bano and Zaib-un-Nisa, 2000; Zaib-un-Nisa, Mansoor and Siddiqui,
2000; Shameel, 2001; Siddiqui and Bano, 2001; Saifullah and Ahmed, 2007; Bano and
Siddiqui, 2015). Few studies were found related to metabolite such as analysis of
Microcystis aeruginosa metabolite by Aftab and Shameel, (2006) and antimicrobial,
cytotoxic activity of some marine cyanobacteria by Hameed, (2009). But no research has
been reported on mangrove associated cyanobacterial metabolite’s and related antagonistic
123
activity. Sandspit mangrove backwaters parallel to Karachi coast is covered with microbial
mat which may contain commercially and economically relevant metabolites.
The aim of present study was to observe the antagonistic and cytotoxic activity of crude
extracts of two test cyanobacteria belonging to genus Aphanocapsa and Phormidium against
common clinical bacterial and yeast strains. Two environmental strains SSC14011 and
SSC1407 (that are native of microbial mat of test cyanobacterial cultures, gram negative,
rods) were also included in test analysis. Research showed that different cyanobacterial
strains belonging to genus Aphanocapsa and Phormidium produced metabolites
(extracellular and intracellular) that are antibacterial (Ishida, Matsuda, Murakami and
Yamaguchi, 1997; Mundt, Kreitlow and Jansen, 2003; Prabakaran, 2011; Sakthivel and
Kathiresan, 2012; Abd, Zaki and Merthad, 2015) and pharmaceutically significant. Hietala,
Reinikainen and Walls, (1995) worked with Aphanocapsa specie and found that it effects
the feeding pattern of Daphnia. Gullege, Aggen, Huang, Nairn and Chamberlin, (2002) and
Hameed, (2013) observed the cytotoxic effect of Aphanocapsa species against Daphinds and
found that its extracts are hepatotoxic in nature. Current study is an initial step towards
marine cyanobacterial metabolite research coalesced with Pakistan coast.
6.3. Material and Methods:
6.3.1. Site and Sampling:
Sampling was conducted at Sandspit mangrove backwaters forest (24º49’05.63” N,
66º56’37.21” E) (Fig. 2b, site A and for site description see page 31) . Samples were
collected from top soil of mangrove forest floor during monsoon season (end of July 2015).
124
The specimens of green colour microbial mat were collected by glass slide. They were
preserved in autoclaved (15 lb pressure, 121 ºC for 20 minutes) seawater and modified ASN
III (Rippka, 1988, Appendix I) both served as transport media. The samples were kept in ice
box during transport and in laboratory samples were stored at 4ºC.
6.3.2. Isolation of Pure Culture:
Culture modified BG-11 medium (Stiner, Kunisawa, Mandel and Cohen, 1971), amended
with seawater or 35g/L of NaCl, was used for filamentous Phormidium and modified ASN
III was used for isolation of Aphanocapsa. Once the preliminary isolation was completed,
both strains were stored (long term) and further subcultured on modified ASN III medium as
it was found to be an effective medium for pure culture propagation and remained
cotaminanant free for longer time period as compared to BG-11 medium. Both cultures were
isolated and purified as follows, field samples were transferred in BG-11 and modified ASN
III media and observed periodically after 2 weeks, sub samples were transferred into fresh
media under sterile conditions. This method was repeated for 3 months. Streak plate method
(Phang and Chu, 1999) was used in which, agar plates of two respective media were
prepared and cultures were serially diluted and aseptically spread on agar plates and
incubated at 28 ºC under continuous 2500 Lux light regimen, for 15 days. After successive
sub culturing for 3 months, isolated colony (in case of unicellular form) and single filament
(in case of filamentous form) was picked by capillary isolation method (Acreman, 1994;
Andersen and Kawachi, 2005; Bui, 2014). The pure culture was further subcultured for 3
months. The pure culture was regularly gram stained and observed microscopically (to
observe and prevent any bacterial contamination). The cultures were then inoculated in
125
Erlenmeyer flasks containing of fresh media and maintained in flasks containing 1000 ml
medium and recultured (1:10 culture/media) after 1 month until further analysis (Bui, 2014).
6.3.3 Culture Identification:
Two pure strains which were selected for further analysis were identified according to
Desikachary, (1959), Komárek and Anagnostidis, (1999), Komárek and Hauer (2013). 0.1
ml samples were examined using 40X microscope (Olympus). 50 specimens were measured
for the dimensions of single cell (unicellular form) and filament (filamentous form). Pictures
were taken by digital camera (Olypmpus-100, 12M.P).
6.3.4. Preparation of Cyanobacterial Extracts:
For extraction of antagonistic substances, pure cultures were introduced into fresh media and
incubated for 15 days. The biomasses were harvested by filtration (Whatman No.1) and
weighed. The following protocol was used for extraction (Barbarino and Lourenço, 2005;
Aniket, 2012) all extracts were stored at 4ºC until further analysis (Fig. 22),
Phase1: The aqueous extracts from Aphanocapsa and Phormidium were obtained 1-10%
w/v biomass in autoclaved seawater and heated in water bath up to 50 ºC for 60 minutes.
The samples slurries were centrifuged (10,000 rpm, 10 minutes) to obtain extract in
supernatant (liquid phase). The pellets (sediment phase) were used for next phase. The
supernatant that are the first crude extracts (MCE01 (Aphanocapsa), OCE01 (Phormidium ))
126
Phase2: The pellets were then suspended 1-10% w/v in distilled water and heated in water
bath to 50 ºC for 60 minutes. These slurries were then centrifuged (10,000 rpm, 10 minutes)
and the second crude extracts (MCE02, OCE02) were obtained in liquid phase. The pellets
were used for third phase.
Phase3: The biomasses were then suspended in Ethanol (Sigma), 70% w/v mixture. These
were heated to 75 ºC for up to 60 minutes, centrifuged (10,000 rpm, 10 minutes). The
supernatant was collected and stored (MCE03, OCE03). The sediments were used for final
fourth phase.
Phase4: In the final extraction phase the pellets were suspended in an alkaline solution that
consisted of aqueous sodium hydroxide (NaOH), the pH of this solution was 9. The slurries
70% w/v mixture, were heated to 50 ºC for 60 minutes. These were centrifuged (10,000 rpm,
10 minutes), and liquid phase (MCE04, OCE04) stored for further analysis.
6.3.5. Screening for Antagonistic Activity:
6.3.5.1. Preparation of Test cultures:
To investigate the antimicrobial potential of selected cyanobacterial species, common
clinical strains were obtained from Microbiology Reference culture collection laboratory,
Department of Microbiology and Department of Biotechnology, University of Karachi. Two
environmental strains, SSC1407 and SSC14011 isolated by author from microbial mat of
test cyanobacteria by serial dilution and subsequent sub culturing on sodium chloride based
LB agar and broth. The bacterial strains were maintained and propagated for tests on LB
(Luria-Bertani) broth and agar at 37 ºC. The yeast strain was cultured and maintained on
127
Sabouraud dextrose agar at 30 ºC. 0.5 MacFarland turbidity index was used for all test
strains.
6.3.5.2. Spot agar method for screening of antagonistic activity:
The 50l extracts of two cyanobacterial cultures were spot inoculated on LB/SD agar plates
seeded with test culture incubated for 18 hours at 37 ºC. The spot lawn plates were then
incubated for further 24 hours (bacterial test strains, at 37 ºC) and 72 hours (yeast strain, at
30 ºC) respectively. The antagonistic activity was examined by measuring the clear zone of
inhibition’s diameter in mm (Schlegel, Doan, Chazal and Smith, 1998; Pawar and Puranik,
2008).
6.3.6. Protein determination by Bradford Assay:
The protein contents present in crude extracts of two cyanobacterial strains were measured
using Bradford assay (Bradford, 1976). Bovine serum albumin (BSA) was used to obtain
standard curve. The protein was estimated both in mg/ml and g/ml.
6.3.7. Cytotoxic assay:
Artemia salina due to its euryplastic nature (Panagoula, Panayiota and Iliopoulou, 2002) was
considered for the cytotoxic assay. 50mg of Artemia salina cysts were set for hatching in
500 ml of filtered (Whatman, NC 45) and autoclaved aged seawater for 24-48 hours at
ambient temperature in dark round bottom flask and aerated with automated aerator motor.
Within 48 hours nauplii were observed. The nauplii were collected by beaming the light
with torch at one side of the dark flask. The nauplii were gathered towards the light source
128
side and sterile pasture pipette were used to transfer ten nauplii in each test vial. 2-fold serial
dilution of each crude extracts of cyanobacterial strains were prepared in autoclaved
seawater. 1 ml of each dilution was transferred in vials. The tests were conducted in
duplicate. Seawater was used as control. the final concentrations were determined in g/ml
dose (Table XX). The results obtained were calculated as LC50 (Finney, 1971).
6.3.8. Statistical Analysis:
Experiments were performed and computed in in triplicate except for the cytotoxic assay
which was conducted in duplicate. Data was presented as the arithmetic mean (± standard
error). To assess the LC50 of cyanobacterial extracts of two test species, probit analysis was
performed by Minitab 17 statistical software. Microsoft Excel 2016 was used to analyze raw
data, construction of graphs and tables.
6.4. Results and Discussions:
6.4.1. Identification of Pure Culture:
Two cyanobacterial strains were isolated from mix microbial mat culture present at Sandspit
mangrove forest. After pure cultures were successfully separated, These strains were grown
in high salinity level medium. The optimum temperature for growth was found to 30±2 ºC.
The cyanobacterial strains were identified on the basis of form, color, dimensions, colony
morphology and motility.
129
(1) Kingdom: Eubacteria, Phylum: Cyanobacteria,
Class: Cyanophyceae, Order: Synechococcales, Family: Merismopediaceae
Aphanocapsa litoralis (Hansgirg) Forti 1907: 89 (Basionym: Aphanocapsa litoralis
Hansgirg, 1892) (Desikachary, 1959, Komárek and Anagnostidis, 1999, Guiry and Guiry,
2016). Identification characters: Colonies macroscopic, long, irregularly arranged, covered
with transparent and amorphous mucilage. Cells unicellular, dark green in color, spherical, 5
m broad, non-motile, cells divide by binary fission, gas vacuoles absent. Found with other
cyanobacteria throughout year (author observation). Bano and Siddiqui (2003) described this
specie (as Microcystis litoralis) from the intertidal rocky shores of Buleji, Karachi (Fig. 18
A, B, C, D).
(2) Kingdom: Eubacteria, Phylum: Cyanobacteria,
Class: Cyanophyceae, Order: Oscillatoriales, Family: Oscillatoriaceae.
Phormidium breve Kützing ex Gomont 1892 (Desikachary, 1959; Komárek and
Anagnostidis, 2005; Komárek and Hauer, 2013; Guiry and Guiry, 2016). Identification
characters: Colonies macroscopic, transparent mucilage. Filament green, unbranched,
densely aggregated, filament straight composed of disc like cells stacked together in
filament, cell 5 m broad, end filament slightly bent, terminal region cell attenuated, cells
with granules, calyptra absent, heterocystes absent, motile resembles waving motion. Found
with other cyanobacteria abundantly in all seasons throughout the year (author observation) .
Bano and Siddiqui (2015) observed this cyanobacterium from the tide pool of Buleji,
Karachi (Fig. 19 A, B).
130
Figure 18. Aphanocapsa litoralis circular cyanobacteria found in the microbial mat at
Sandspit mangrove area. (A) at stationary stage, 40x, (B) and (C) at exponential stage, 100x,
(D) at late exponential stage, 100x.
10 m
A B
C D
131
Figure 19. Phormidium breve filamentous cyanobacteria found in the microbial mat at
Sandspit mangrove backwaters. (A) at early stationary phase, 100x, (B) at mid exponential
phase and close to stationary phase, 100x, (C) left flask containing Phormidium breve
culture, forms sheath like mats, right flask containing Aphanocapsa litoralis culture, forms
fine granular suspension. Both flasks contain modified ASN III medium.
A B
C
132
(A)
(
B)
(C
)
Fig
ure 2
0.
Sp
ot
agar
tes
t o
f cy
anob
acte
rial
ex
trac
ts o
n p
ota
to d
extr
ose
ag
ar p
late
s se
eded
wit
h c
lin
ical
stra
in
of
Ca
nd
ida
a
lbic
an
s.
(A)
(B)
(C),
p
late
s sh
ow
ing
zo
ne
of
inh
ibit
ion
fo
rmed
, M
CE
01
is
th
e
Ap
ha
noca
psa
li
tora
lis
seaw
ater
ex
trac
t,
OC
E0
3
is
the
Ph
orm
idiu
m
bre
ve
eth
ano
lic
extr
act.
5
0
l
Un
dil
ute
d c
rud
e ex
trac
ts w
ere
test
ed.
133
Table XIX. Antagonistic activity of mangrove associated cyanobacteria (crude extracts)
against different strains.
(Where, (+) zone of inhibition 2-5(mm) , (++)zone of inhibition 10 mm, (-) No zone of inhibition, (LH) This
Localized strain was isolated form civil hospital, Karachi and provided by department of biotechnology,
University of Karachi, (SSC14011) gram negative, short rods isolated from microbial mat of native
cyanobacteria, (SSC1407) gram negative, short rods isolated from microbial mat of native cyanobacteria.
Concentrations of crude extracts were 300 g/ml.)
Cyanobacterial
Fractions/ Test Strains
Aphanocapsa litoralis Phormidium breve
Sea
water
Distilled
water Ethanol NaOH
Sea
water
Distilled
water Ethanol NaOH
Clinical strains
Escherichia coli 1030 - - - - - - - - Staphylococcus aureus 1161 - - - - - - - - Staphylococcus aureus
(LH) + + - - - - - -
Klebsiella pneumoniae - - - - - - - - Beta Haemolytic
Streptococci G - - - - - - - - Pseudomonas aeruginosa - - - - - - - -
Micrococcus sp. - - - - - - - -
Acinetobacter sp. - - - - - - - -
Proteus O - - - - - - - -
Candida albicans ++ - - - - - ++ -
Environmental strains
SSC14011 + - - - - - + -
SSC1407 - - - - - - - -
134
Figure 21 A. Probit analysis plot showing effect of Aphanocapsa litoralis seawater extract
towards Artemia salina (brine shrimps). 50% mortality is expected at log dose 3.8 g/ml
whereas, 90% mortality is expected at 4.4 g/ml of log dose. LC50 is computed as 10^ (log
dose50) g/ml
135
Figure 21 B. Probit analysis plot showing the cytotoxic effect of Phormidium breve ethanol
fraction towards Artemia salina (brine shrimps). 50% mortality is expected around log dose
1.3 g/ml whereas, 90% mortality is expected at 1.4 g/ml of log dose respectively.
LC50 is computed as 10^ (log dose50) g/ml.
136
Fig
ure 2
2. F
low
char
t o
f ex
trac
tion
of
bio
act
ive
pro
tein
ex
trac
ts f
rom
cyan
obact
eria
l st
rain
s.
137
6.4.2. Antagonistic Activity:
The results obtained from the antagonistic activity test revealed that only two extracts
MCE01 (Aphanocapsa litoralis, seawater extract) and OCE03 (Phormidium breve, ethanol
extract) were found to have significant inhibitory effect against Candida albicans (Table
XIX). MCE01 showed minimal zone of inhibition against Staphylococcus aureus (2 mm)
(LH) and SSC14011 (3 mm). MCE02 (Aphanocapsa litoralis, distilled water extract)
exhibited minor zone of inhibition (2 mm) against Staphylococcus aureus (LH). OCE03 also
revealed minimal zone of inhibition (5 mm) against SSC14011 strain respectively. It was
observed that the antagonistic activity against test microorganisms differed with respect to
cyanobacterial species and extraction method (Rao, 1994). For instance, the ethanolic
fractions of filamentous Phormidium breve were highly potent against Candida albicans
than other fractions and form clearer zones of inhibition. (Fig. 19 A, B, C) whereas,
Aphanocapsa litoralis extracts exhibited lower potency and formed turbid zones of
inhibition. The sodium hydroxide extracts were least effective. Most of the clinical test
organisms did not respond to all the extracts. This may be due the presence of some
inhibitory substances in extract that effect the antibacterial activity against clinical strains
(Martins, Ramos, Herfindal, Sousa, Skærven and Vasconcelos, 2008).
6.4.3. Protein Estimation and Cytotoxic Assay:
Bradford assay revealed that Phormidium breve was found to contain 1.49 mg/ml protein
and Aphanocapsa litoralis sample contained 24.93 mg/ml protein content. In both
cyanobacterial extracts the mortality rate was lower in diluted fractions as compared to
undiluted fractions. In case of cyanobacterial culture of Aphanocapsa litoralis, out of four
138
concentrated crude extracts only one extract MCE01 (Sea water fraction) exhibited cytotoxic
activity. The toxicity of Aphanocapsa litoralis (MCE01) towards Artemia salina showed
LC50 of 6.2 mg/ml (6237.3 g/ml) (Table XX). Rest of the extracts were not cytotoxic and
showed 100% survival rates in fractions of MCE02 (Distilled water), MCE03 (Ethanol) and
MCE04 (NaOH). In case of Phormidium breve, out of four extracts, OCE03 was found to be
most effective and showed cytotoxic activity against brine shrimps. The crude undiluted
OCE03 (Ethanol fraction) demonstrated 100% lethality which remained constant upon
subsequent dilutions. The LC50 of OCE03 was 0.02 mg/ml (20.3g/ml). Other fractions
which were eluted in seawater (OCE01), distilled water (OCE02) and NaOH (OCE04)
showed no lethality to brine shrimp. The probit analysis revealed that between two effective
cyanobacterial extracts, OCE03 exhibited increased potency than MCE01. This shows that
there must be highly toxic compounds in extract that which were lethal to Artemia salina in
increased dilutions. The probit results also indicated that at stress level of 0.9 log dose, 99%
of test brine shrimps exposed to MCE01 and 100% exposed to OCE03 may be killed (Fig.
20 A, B; Table XXI, XXII).
In this study two members of cyanobacteria, a filamentous form and coccoid form belonging
to genus Phormidium and Aphanocapsa were observed for their antibiotic and cytotoxic
activity. It was found that the filamentous form was more potent as compared to coccoid
cyanobacteria against Candida albicans. The same was also true for cytotoxic activity
against brine shrimps. Our results concur with the earlier study of Scholz and Liebezeit,
(2012) where most of the potential activities occurred in biomass extracts. As temperature
and light intensity also plays a significant role on antagonistic protein production in both
139
cyanobacterial genus (Sivonen, 1990; Utkilen and Gjolme, 1992), it was observed in current
investigation that, the increased amount of biomass was obtained when the cultural
conditions were 6.8 pH, even light source 2000 lux, temperature 29-30 ºC, 10-15 days
incubation period and 2 minutes agitation/day respectively. Under natural field conditions it
was observed that monsoon period was more favorable for both strains as compared to pre-
monsoon and post- monsoon seasons. Both strains were observed to be among primary
members of green microbial mat present in mangrove forest. Aphanocapsa litoralis was also
reported earlier by Bano and Siddiqui, (2003) on the rocky shores of Buleji, Karachi. The
cyanobacterial strains of Sandspit mangrove forest were found to be halotolerant and retain
bioactive substances. These strains were selected because there are several studies related to
metabolites of genus Aphanocapsa and Phormidium demonstrating inherent natural
chemical products that can be effective against microorganisms of clinical and ecological
significance.
140
Table XX. Cytotoxic assay of crude extracts of cyanobacteria. (Where, *1 is the fraction
from seawater extract, *2 is the fraction from Ethanolic extract. The data of extracts showing
brine shrimp mortality are presented in tabular form.)
Cyanobacteria
Sample
Concentration
(g/ml)
Concentration
(Log)
Mortality
(%)
LC50
(g/ml)
Aphanocapsa
litoralis MCE01*1
0 0.0 0
779 2.9 10
1558 3.2 40
3116 3.5 30 5900.7
6232 3.8 60
12465 4.1 40
24930 4.4 90
Phormidium
breve
OCE03*2
0 0 0
23 1.4 80
47 1.7 100
94 2.0 100 20.3
188 2.3 100
375 2.6 100
750 2.9 100
1500 3.2 100
141
Table XXI. Probit analysis of Aphanocapsa litoralis (seawater fraction).
S.No. Parameters
1)
Statistics log dose g/ml
Mean 3.7709
StDev 0.871227
Median 3.7709
IQR 1.17527
2)
Regression
Variable Coefficient
Standard
Error Z P
Constant -4.32826 0.417732 -10.36 0.00
log Dose 1.14781 0.11285 10.17 0.00
3)
Goodness-of-Fit Tests
Method
Chi-
Square DF P
Pearson 55.9524 5 0.00
Deviance 55.8714 5 0.00
4)
Tolerance Distribution
Parameter Estimate Standard 95.0%CI
Error Lower Upper
Mean 3.7709 0.048538 3.67577 3.86603
StDev 0.871227 0.085658 0.718526 1.05638
5)
Table of Percentiles
Percent Percentile Standard 95.0% CI
Error Lower Upper
10 2.65438 0.110579 2.39089 2.83953
50 3.7950 0.048538 3.67776 3.87182
90 4.88742 0.128783 4.67289 5.19585
6)
Table of Survival Probabilities
Stress Probability 95.0%CI
Lower Upper
0.9 0.999508 0.997217 0.999976
142
Table XXII. Probit analysis of Phormidium breve (Ethanolic fraction).
S.No. Parameters
1)
Statistics log dose g/ml
Mean 1.30803
StDev 0.063806
Median 1.30803
IQR 0.086073
2)
Regression
Variable Coefficient
Standard
Error Z P
Constant -20.5002 996.518 -0.02 0.98
log Dose 15.6726 731.804 0.02 0.98
3)
Goodness-of-Fit Tests
Method
Chi-
Square DF P
Pearson 6E-07 6 1.00
Deviance 1.2E-06 6 1.00
4)
Tolerance Distribution
Parameter Estimate Standard 95.0%CI
Error Lower Upper
Mean 1.30803 2.50746 -3.6065 6.22256
StDev 0.063806 2.97929 0 -
5)
Table of Percentiles
Percent Percentile Standard 95.0% CI
Error Lower Upper
10 1.22626 6.32557 - -
50 1.30803 2.50746 - -
90 1.3898 1.31071 - -
6)
Table of Survival Probabilities
Stress Probability 95.0%CI
Lower Upper
0.9 1.00 - -
143
Aphanocapsa litoralis has been taxonomically studied (Shah, Garg and Madamwar, 2001;
Silambarasan, Ramanathan and Kathiresan, 2012; Sakthivel and Kathiresan, 2013) but there
are few antagonistic activity study of this strain. On the other hand, studies on Phormidium
breve both from fresh water and saline water sources are not rare. This cyanobacterial strain
has been researched for antimicrobial activity (Metting and Pyne, 1986; Scholz and
Liebezeit, 2012), taxonomic assessment (Nagarkar, 2002), presence of odorous compounds
such as geosmin and 2-methylisoborneol (Berglind, 1983; Naes, Aarnes, Utkilen, Nilsen and
Skulberg, 1985) and heavy metal tolerance (Tong, Nakashima, Shibasaka, Katsuhara and
Kasamo 2002) respectively, that signify the importance of investigating these strains from
native mangrove areas. Hameed, (2009) examined the antimicrobial and cytotoxic activities
of Synechocystis sp., Chroococcus sp., Pseudoanabaena sp. and Geitlerinema sp. form
Pakistan’s coastal region but there were no recent studies related to current test
cyanobacterial strains. Therefore, present research acknowledges the antibiotic potential of
marine cyanobacteria of the Sandspit mangrove backwaters. The information obtained can
be used as a base line to observe new peptides and minor compounds. Further molecular and
bioactive compounds analysis according to recent research works (Golubic, Abed, Palińska,
Pauillac, Chinain and Laurent, 2010; Richert, Golubic, Le Guédès, Ratiskol, Payri and
Guezennec, 2005; Abed, Golubić, Garcia, Camoin and Lee, 2003) are recommended to fully
examine the pharmaceutical potential of these two cyanobacteria.
144
CHAPTER 7
CHARACTERIZATION OF TWO ANTAGONISTIC
SUBSTANCES PRODUCED BY MANGROVE
BACTERIA FROM SANDSPIT BACKWATERS,
PAKISTAN.
(Manuscript in progress)
145
CHARACTERIZATION OF TWO ANTAGONISTIC
SUBSTANCES PRODUCED BY MANGROVE
BACTERIA PROTEUS SP. SSC1407 AND
KLEBSIELLA PNEUMONIAE SSC14011
FROM SANDSPIT BACKWATERS, PAKISTAN.
7.1. ABSTRACT:
Mangrove ecosystem sustains variety of microbes that are involved in various biological and
physicochemical processes. These bacteria are major components of decomposers and
primary producers and also facilitate in the expansion of mangrove forest floor. Present
study examines bacteriocin characteristics and its antagonistic activity against clinical
isolates of two cultivable heterotrophic bacteria SSC1407 and SSC14011, that were isolated
from the microbial mat present on the top sediment of Sandspit mangrove forest. 16S rRNA
gene sequencing was performed to confirm the identity of isolates. Isolate SSC1407 was
found to be closely related to Proteus sp. (99% homology) and displays an inhibitory pattern
against Escherichia coli 1030. The cell free crude extract was insensitive to different
chemical solvents except for toluene and butanol, tolerated temperatures from 4- 40 ºC and
pH 5-12. Cytotoxic activity against Artemia salina showed LC50 52.03 g/ml. Isolate
SSC14011 was found to be distinctly related to Klebsiella pneumoniae strain. The cell free
crude proteinaceous extract exhibited antagonistic activity against Proteus O clinical isolate.
This bacteriocin showed relatively higher growth rate, it was active between 4- 40 ºC
temperatures, tolerated 5-9 pH, was insensitive to prolonged UV- exposure (4 minutes) and
displayed relatively narrow inhibitory spectrum when exposed to chemical solvents and
provided higher purified protein yield. The LC50 values were found to be 46.17 g/ml. Both
strains were isolated and reported for the first time in Pakistan. Further studies are required
to fully explore the metabolites antagonistic potential against common bacterial and fungal
agents and to observe other bacteria associated with mangrove microbial mat.
146
7.2. INTRODUCTION:
Bacteriocins (Antagonistic substances in nature) are bacterial metabolites that are mainly
polypeptide in nature. These substances inhibit or kill the growth of both gram negative and
positive microorganisms (Cleveland, Montville, Nes and Chikindas, 2001). This antagonistic
phenomenon is common for survival and sustenance of bacterial colony. The mode of action
is effective against strains that are closely related to producer (Klaenhammer, 1988). These
protein antibiotics are heterogeneous in nature and consist of wide range of molecular mass
and exhibit variable biochemical and inhibitory traits (Sullivan, Ross and Hill, 2002). The
attributes responsible for stability of bacteriocin depend upon the nature of producing
organisms. These antagonistic substances are broadly divided into four classes according to
Klaenhammer, (1993), (A) Class І bacteriocin or Lantibiotics that are effective against broad
spectrum pathogenic and non-pathogenic bacteria, (B) Class ІІ bacteriocins are low
molecular weight and non heat labile, (C) Class ІІІ bacteriocin are high molecular weight
and heat sensitive proteins and (D) Class ІV are complex bacteriocins.
Marine microbes are an integral component of marine ecosystem (Ahmed and Yasmeen,
1988). The marine related bacteriocins usually exhibit restricted antagonistic activity
spectrum (Smarda and Taubeneck, 1968; Lee, Jun, Kim and Paik, 2001). Various
experiments were conducted to explore bacteriocin produced by marine microbes (Das
Sharma and Arora, 1997; Platas, Meseguer and Amils, 2002). These include exploring its
potential as a source of secondary metabolites (Jensen and Fenical, 1994). Extensive
research has been carried out to screen bacteriocins from sources such as seawater
(Jayaraman, Rajesh and Karthikeyan, 2012), estuarine waters (Singh, Sivasubramani,
147
Jayalakshmi, Satheesh and Selvi, 2013), marine sediments (Elayaraja, Annamalai, Mayavu
and Balasubramanian, 2014) and mangrove sediments (Lee, Zainal, Azman, Eng, Goh, Yin,
AbMutalib and Chan, 2014), sponges (Anand, Bhat, Shouche, Roy, Siddharth and Sarma,
2006), clams (Shayesteh, Ahmad and Usup, 2014).
Marine microbes are also responsible for diverse cache of flora in Pakistan coastal waters
(Jamil, Erum, Ahmed, Yasmeen and Ahmed, 1999). The coastline along with the estuarine
areas of Pakistan offers a valuable source for bacteriocin research of marine associated
bacteria. Mangroves (which are natural barriers of coastline and protects against natural
disasters such as tsunami and thunderstorms) are nutrient rich and provide a unique habitat
for estuarine flora and fauna (Jennerjahn and Ittekkot, 2002). Among them bacteria, serve as
the primary decomposers, that are an essential component of food, web (Becks, Hilker,
Malchow, Jürgens and Arndt, 2005; Long, Xiang, Zhuang and Lin, 2005; Benincà,
Huisman, Heerkloss, Jöhnk, Branco, Van Nes, Scheffer and Ellner, 2008). The presence of
extreme physico chemical factors such as salinity, pH and temperature culminate into
diverse and hardy microbial community in mangrove habitat that is bound to generate
unique metabolites to tolerate harsh conditions. Recent studies focusing on mangrove-
associated bacteria revealed a great potential in terms of Pharmacognosy (Long, Xiang,
Zhuang and Lin, 2005; Ara, Kudo, Matsumoto, Takahashi and Omura, 2007; Hong, Gao,
Xie, Gao, Zhuang, Lin, Yu, Li, Yao, Goodfellow and Ruan, 2009; Yan, Wang, Mao, Ma, Li,
Ouyang, Guo and Cao, 2010; Sánchez, Luna, Campa, Escamilla, del Carmen Flores and
Mazón, 2015).
148
In Pakistan, most bacteriocin studies were form terrestrial sources (Jabeen, Gul, Subhan,
Hussain, Ajaz and Rasool, 2009; Saleem, Ahmad, Yaqoob and Rasool, 2009). Some of the
marine bacteriocin studies were associated with marine catfish related vibriocin (Zai,
Ahmad and Rasool, 2009), fisheries, sediment and seawater associated bacteriocin (Ahmed,
Jamil, Khan, Yasmeen, Haq, Ahmed and Rahman, 2000; Pirzada, Nasir and Rasool, 2000).
Salt tolerance levels of some mangrove bacteria were determined by Amir, Ahmed and
Talat, (1993). These forests were investigated for variety of fauna and flora (Chaghtai and
Saifullah, 1992; Saifullah, Nizamuddin and Gul, 2005; Sohail and Solaha; 2005; Nazim,
Ahmed, Shaukat, Khan, Rao, Ali and Sherwani, 2012; Nazim, Ahmed, Shaukat, Khan and
Ali, 2013; Shafique, Siddiqui and Farooqui, 2015; Nasira and Shahina, 2016; Qureshi, Farah
and Saher, 2016) but no recent studies are available investigating the bioactive bacterial
metabolites of mangrove area. This location is expected to provide source of secondary
metabolites that may be relevant for either clinical or industrial use. The purpose of current
study is isolation, identification and characterization of bacteriocins/antagonistic substances
from indigenous microbial mat bacteria of mangrove forest at Sandspit backwater.
7.3. Material and Methods:
7.3.1. Sample Collection and Preliminary Isolation:
Top soil containing microbial mat samples were aseptically collected during the month of
July 2014 at Sandspit backwater forest (24º49’05.63” N, 66º56’37.21” E) (Fig. 2b, site A
and for site description see pg. 31) using sterile corers. 30 gm of top soil section containing
mat sample was dissolved (1:1w/v) in sterile distilled water, vortexed, stand for half hour at
ambient temperature, then serially diluted (1:10 v/v), spread 0.1 ml on nutrient and Luria-
149
Bertani (LB) agar plates (Sigma), incubated at 30ºC for 24-48 hours. Selected single
colonies were plated against several clinical strains (obtained from Reference Culture
Collection Lab, Microbiology department, University of Karachi) and antagonistic activities
were observed by agar stab and streak method. The strains that showed zone of inhibition
were finally selected for further analysis. All strains were maintained on LB agar slants and
kept at 4ºC respectively.
7.3.2. Identification of Bacterial Strains:
The morphological characters were observed by gram staining and microscopy (100x,
Olympus) and colonial characters were observed on nutrient agar (NA) plates. The
biochemical characteristics were analyzed by API 20E Kit (bioMerieux). The molecular
identification of selected isolates was carried out by 16S rRNA gene sequencing. Briefly,
for DNA extraction 1ml culture was centrifuged (12000xg, 5 minutes) and pellets washed
and suspended in phosphate buffered saline PBS (pH 7.2). The suspension was then boiled
and kept on ice (10 minutes each) before PCR analysis (Lauerman, Hoerr, Sharpton, Shah
and van Santen, 1993). The primer sequences were designed from the earlier reported
conserved regions for bacterial 16S rRNA gene (Weisburg, Barns, Pelletier and Lane, 1991).
Sequencing was done using the forward primer (fD1) (5`-AGAGTTTGATCCTGGCTCAG-
3`) and reverse primer (rP2) (5`ACGGCTACCTTGTTACGACTT - 3`). PCR reaction
mixture contained following reagents, 1.5mM MgCl2, 200M of each dNTP (Promega),
1M of primers fD1 and rP1, 1l template DNA, 1.0 U Go Taq DNA polymerase, and 1x
Go Taq reaction buffer (Promega) in a 40 μl final reaction volume. The PCR reactions were
150
performed under following conditions, denaturation at 95ºC for 2 min, 35 cycles of 95ºC for
15 seconds, 55ºC for 30 seconds, 72ºC for 2 minutes, followed by a final extension at
72ºCof 7 minutes (Applied Biosystem, Veritti 96 well). The presence and approximate
concentration of the PCR products were verified by electrophoresis using 1% Agarose gel
stained with Ethidium bromide in (1x) TBE Buffer. An automated DNA Sequencer
(Macrogen) examined the 16S rRNA gene sequence
7.3.3. Preparation of Crude Extracts:
Bacteria were grown in 200ml of LB broth at 30ºC for 24 hours. The cells were harvested
after centrifugation at 10,000xg for 15 minutes. The cell free supernatant (CFS) were
syringe filtered (0.45m) and stored in sterile screw cap tubes at 4ºC. pH was adjusted to 7.5
using 1N NaOH/1N HCL (Jabeen, Gul, Subhan, Hussain, Ajaz and Rasool, 2009).
7.3.3.1. Bioassay of Bacteriocin (Antagonistic Substance):
To examine the viability of crude extract, agar well diffusion method was carried out to
detect the antagonistic activity against indicator strains. Indicator strains corresponding to
0.5 McFarland turbidity index were plated and agar well was cut using gel borer. 50 l test
supernatant introduced into respective wells and incubated at 30ºC for 24 hours (Geis, Singh
and Teuber, 1983; Bizani and Brandelli, 2002). Distilled water used as control.
7.3.3.2. Growth curve assay:
The growth assay was performed to obtain the viable number of cells or colony forming
units (CFU/ml) for maximum bacteriocin yield. The culture(s) (1:10 v/v) were added in
151
fresh LB broth and incubated at 30ºC for 9 hours. After each 3 hrs interval, 1ml of the
bacterial suspension was withdrawn and loaded onto LB agar plates and incubated at 30ºC
for 24 hours. The plates were then counted for number of colonies and data recorded (Motta
and Brandelli, 2002).
7.3.3.3. Bacteriocin activity unit (AU) assay:
Two-fold serial dilutions of (a) test CFS crude extract (b) partially purified ammonium
sulphate (NH4)2SO4 precipitated (80%) bacteriocin and (c) purified dialyzed (12 kDa)
bacteriocin were prepared and antagonistic activity was observed by disk diffusion assay
(Kimura et. al., 1998). The zone of inhibition around each disk was measured in mm. The
bacteriocin titer was expressed as activity unit/ml. One activity/arbitrary unit of bacteriocin
is the reciprocal of last serial dilution exhibiting significant inhibitory effect and is presented
in the following formula (Barefoot and Klaenhammer, 1983),
AU/ml= Reciprocal of highest dilution/ Volume of test bacteriocin added × 100
7.3.4. Characterization of test Bacteriocin:
Partially purified supernatants of test bacteriocins were characterized with respect to pH,
temperature, chemicals and ultra violet light.
7.3.4.1. Temperature effect on bacteriocin Activity:
Effect of temperature on partially purified bacteriocin was performed by incubating 5ml
samples at different temperatures ranging from ambient to 121ºC (15 psi) for 30 minutes and
4ºC for 6 months. Each fraction was then, assayed for bacteriocin residual activity (Ten
brink, Minekus, Van der Vossen and Leer, 1994; Ogunbanwo, Sanni and Onilude, 2003) by
152
agar well method. Residual activity was defined as the ratio of the diameter (mm) of
inhibition halo produced by the treated test sample compared to the untreated control
(Mathys, Ah, Lacroix, Staub, Mini, Cereghetti and Meile, 2007). Residual activity is
expressed in percent (%).
7.3.4.2. pH effect on bacteriocin activity:
To determine bacteriocin activity at different pH levels, partially purified bacteriocins were
adjusted to various pH ranges from 3 up to 11. The acidic pH was adjusted by sterile 1N
HCL and basic pH was obtained by adding sterile 1N NaOH. The samples were incubated
for one hour at 28 ºC. The agar well diffusion method was used to examine the residual
activity against sensitive strains (Larsen, Vogensen and Josephsen, 1993; Saeed et. al.,
2006).
7.3.4.3. Chemical effect on bacteriocin activity:
Partially purified bacteriocin (18hour old culture) was assessed for its sensitivity to different
chemicals. Chemicals (Sigma) of 10% v/v (liquid) or 10 mmol/lit (soild) concentrations
were introduced to bacteriocin and the samples were incubated for one hour at 28 ºC before
being analyzed for residual activity via agar well diffusion assay against sensitive strains
(Bizani and Brandelli, 2002).
7.3.4.4. Ultra-violet effect on bacteriocin activity:
Two 10ml partially purified test bacteriocin samples were placed in sterile petri plates and
exposed to ultra violet light (15-watt Philips) at 25 cm distance. The plates were exposed to
time intervals from 0 to 5 minutes. After each one-minute time interval samples withdrawn
153
via pipette and bacteriocin residual activity was determined by agar well diffusion method
(Zaid, Nasir and Rasool, 2000).
7.3.5. Bacteriocin Purification:
Crude extract of bacteriocin was precipitated with 80% ammonium sulphate (Merck). The
ammonium sulphate saturation was conducted at 4ºC with continuous stirring for 2 hours
followed by overnight incubation at 4 ºC. The precipitates were collected by centrifugation
at 10,000g for 20 minutes. The precipitates were re-dissolved in 10mM PBS buffer (pH 7.5)
and stored at 4ºC for dialysis (Harris and Angal, 1989). Dialysis was carried out in dialysis
bag (10 kDa, Sigma). 1 ml precipitate was dialyzed against 500x buffer (500 ml autoclaved
distilled water) with constant stirring at 4ºC for 4hrs then buffer was changed for overnight
dialysis at 4ºC (Scopes, 2013). The samples were kept at 4ºC for further analysis.
7.3.6. Protein Estimation:
The amount of protein (g/ml and mg/ml) present in crude and purified extracts were
calculated by the method of Bradford, (1976). Bovine serum albumin (BSA) was used as
standard.
7.3.7. SDS-PAGE Gel Electrophoresis:
The molecular weight of purified extracts was analyzed by 12% SDS polyacrylamide gel
electrophoresis unit. The gel was run under reducing and denaturing conditions. The
samples were treated with beta mercaptoethanol and heated at 99±1ºC. The gel was run at
constant voltage of 80 volts for 2hours. After, electrophoresis, the gel was stained with
154
Coomassie brilliant blue R-250 stain (Laemmli, 1970). Standard Protein Marker
(MOLECULE-ON PINK) was run with 11 proteins that resolve in to bands in the range of
10-175 kDa respectively.
7.3.8. Cytotoxicity Test:
Brine shrimp lethality test was conducted to observe the cytotoxic effect of selected
bacteriocin on brine shrimp (Meyer, Ferrigni, Putnam, Jacobsen, Nichols and McLaughlin,
1982; Rajaram, Manivasagan, Gunasekaran, Ramesh, Ashokkumar, Thilagavathi and
Saravanakumar, 2010). Briefly, the Artemia salina eggs were hatched in an autoclaved
seawater. 10 nauplii stage larvae were kept in each sample vials. The test bacteriocin crude
extract was serially diluted 2-fold in an autoclaved seawater and 10 ml of each dilution was
added in each vial. The test was conducted in duplicate. Autoclaved seawater plus 10
shrimps were used as control. The samples were incubated at ambient temperature under
constant aeration for 24 hours. The mortality rate was observed and lethal percentage of
each extract was recorded (Bhatt, Khushboo and Maitreyi, 2016; Waliullah, Yeasmin, Alam,
Islam and Hassan, 2016).
7.3.9. Statistical analysis:
All experimental results are presented in means of triplicate or duplicate trials. For
computation of raw data and graphs, Microsoft excel 2016 was used. Minitab 17.0 statistical
software package was used to analyze data of lethal concentration (LC50) of selected
extracts by probit analysis method (Finney, 1971). LC50 is computed as 10^ (log dose50)
g/ml
155
For molecular identification, The PCR products were sequenced at Macrogen Inc., South
Korea. Sequencing was successful and partial sequences for both strains were obtained.
Homology with sequences in GenBank database was evaluated using BLASTN 2.5.1+
software. Using these obtained sequences, phylogenetic tree by neighbor-joining method
was constructed by the NCBI Tree Viewer 1.11.1. software (Altschul, Gish, Miller, Myers
and Lipman, 1990; Zhang, Schwartz, Wagner and Miller, 2000; Morgulis, Coulouris,
Raytselis, Madden, Agarwala and Schäffer, 2008).
7.4. Results and Discussions:
7.4.1. Isolation and Identification of bacterial strains:
In current study, two mangrove microbial mat bacterial strains (culture code, SSC1407 and
SSC14011) exhibiting antagonistic activity against two clinical cultures Escherichia coli
1030 and genus Proteus O strain were selected for detailed bacteriocin analysis. The culture
SSC1407 showed inhibitory activity against Escherichia coli 1030 and bacterial culture
SSC14011 showed antagonistic activity against Proteus O strain respectively (Table XXIV).
Based on the biochemical characteristics the strain SSC1407 belongs to genus Proteus
whereas the strain SSC14011 is closely related to Klebsiella genus. The microscopic,
colonial and biochemical characters of both strains are represented in Table XXIII (Fig. 23).
A BLAST search using the FASTA sequences of the two cultures showed a close match
with ‘Uncultured Proteus sp. clone W60 16S ribosomal RNA gene, accession JF733467.1’
for Strain SSC1407 and with ‘Klebsiella pneumoniae strain CCFM8368 16S ribosomal
RNA gene, accession KJ803925’ for strain SSC14011 respectively.
156
Figure 23. Bacteria isolated from the microbial mat of sandspit mangrove forest. Strain
SSC1407 is shown in plates A to F, the inhibitory effect was examined against E. coli 1030.
Strain SSC14011 is represented in plates G to L, the antagonistic effect was observed
against Proteus O sp. (A), (G) showing inhibitory effect against sensitive strains, (B), (H)
showing isolated test cultures, (C), (I) showing general morphology and gram negative
reaction under 100x magnification, (D), (J) showing disk diffusion assay crude extracts, (E),
(K) showing agar well diffusion assay of crude extracts, (F), (L) showing disk diffusion
assay after dialysis, (M) showing biochemical reactions via analytical profile index (API) kit
method. Arrows mark the formation of zone of inhibiton (measured in mm).
A
F E
D C
B G
H
I
L
J
K
M
157
Table XXIII. General and Colonial characters of isolated mangrove bacterial strains.
(Where, (-) negative, (+) positive, No2 nitrate redution test, H2S production of hydrogen sulfide, Pellicle=
growth concentrated more towards surface as compared to bottom, Entire= margin without serration, Staph=
in groups, Dipplo= in groups of two cells, Colonial Characters on LB agar.)
Observations SSC1407 SSC14011
Morphology
Gram Reaction - -
Shape Rods Rods
Arrangement Scattered/dipplo forms Bunches/Staph forms
Spores + +
Colonial Characters
Form Circular Circular
Size Pinpointed Pinpointed
Margin Entire Entire
Surface Smooth Smooth
Elevation Convex Convex
Opacity Translucent Opaque
Color Off white creamy White
Turbidity (LB broth) Uniform Granular
Sediment (LB broth) Powdery Granular
Surface growth (LB broth) Fine Pellicle
Biochemical Characters
Indole + -
Methyl red + -
Voges Proskauer - +
Citrate - +
Carbohydrate test
Glucose + +
Sucrose + +
Mannitol + +
Sorbitol - +
Rhamnose - +
Oxidase - -
NO2 + +
H2S + +
Urease + +
Gelatinase + +
158
7.4.2. Bioassay and growth curve:
Bacterial biomass was determined in LB broth and agar. The two strains showed variable
growth conditions. Strain SSC1407 showed optimum growth at 0-3 hrs. interval and the
strain SSC14011 showed steady growth rate up to 9 hours. The rate of bacteriocin
production corresponds to their growth rate (Fig. 24 A).
7.4.3. Characterization of bacteriocin:
Temperature, both strains were found to be temperature sensitive and showed minimal to no
activity after 80 ºC. SSC1407 was not stable at freezing temperature in contrast with 011
that give 85% residual activity. Both strains were stable at 4ºC for about a year and half
(with subsequent sub culturing) (Fig. 24 B). Although both strains were found to give
optimal activity up to 40ºC, the 30ºC was found to be most favorable temperature for culture
propagation and bacteriocin yield.
pH, the optimum pH range was found to be between 6.7-7.9. Both cultures were able to
tolerate either extreme acidic or basic conditions and exhibited residual activity. Strain
SSC1407 was found to tolerate range of basic pH effectively (Fig. 25).
159
Chemicals, different chemicals were tested to observe the effect chemicals on bacteriocin
activity. strain SSC1407 was more stable against test chemicals as compared to SSC14011
strain. SSC1407 exhibited 100% residual activity against Acetone, Di ethyl ether, Di methyl
sulfoxide, and Acetic acid, whereas, SSC14011 strain was resistant to Acetone and Acetic
acid (Table XXV).
Ultra-violet, effect of UV-light on bacteriocin activity was also carried out. It was observed
that out of the two SSC14011 test bacteriocin was able to provide minimal activity after 4
minutes of exposure. The SSC1407 did not maintain its stability that long and give moderate
activity at one -minute exposure (Fig. 26). These results reveal that the bacteriocin activity
produced by the test strains is sensitive to UV-light.
Table XXIV. Antagonistic activity of Sandspit mangrove cyanobacteria against different
clinical strains.
(key = (+) zone of inhibition (mm), (-) No zone of inhibition)
Indicator Strains SSC1407 SSC14011
Escherichia coli 1030 + -
Staphylococcus aureus 1161 - -
Klebsiella pneumoniae - -
Beta Haemolytic Streptococci G - -
Pseudomonas aeruginosa - -
Micrococcus sp. - -
Acinetobacter sp. - -
Proteus O - +
Candida albicans - -
160
Table XXV. Effect of different chemicals on antagonistic activity of mangrove bacteria.
The test crude extracts were obtained after18 hours incubation and then test chemical was
introduced for one hour, after incubation test bacteriocin extracts were assayed for
antagonistic activity against selective sensitive strains.
(1*= 1mg/ml concentration used.)
S. No. Chemicals Concentration
(V/V)
Strain Residual
activity (%)
SSC1407 SSC14011
1) Ethanol 10% 60 0
2) Methanol 10% 60 0
3) Acetone 10% 100 100
4) Chloroform 10% 50 20
5) Di ethyl ether 10% 100 50
6) Dimethyl sulfoxide 10% 100 50
7) Acetic acid 10% 100 100
8) Toluene 10% 0 50
9) Butanol 10% 0 0
10) Sodium dodecyl sulfate 1* 50 0
11) Tween 80 10% 60 60
161
Figure 24 A. Growth curve and production of antagonistic activity in LB medium. The
activity was monitored at 30 ºC.
Figure 24 B. Effect of Temperature on Bacteriocin Activity.
0
200
400
600
800
1000
1200
9.910.010.110.210.310.410.510.610.710.810.911.0
0 2 4 6 8 10
Bacterio
cin (A
U/m
l)log C
FU
/mL
Time (hours)
AU, SSC1407 AU, SSC14011 log, SSC1407 log, SSC14011
0
20
40
60
80
100
-10 10 30 50 70 90 110
Res
idu
al a
ctiv
ity (
%)
Temperature (ºC)
SSC1407 SSC14011
162
Figure 25. Effect of pH on Bacteriocin Activity.
Figure 26. The effect of UV-light on the isolated bacterial strains. Bacteriocin producing
activity after exposure were examined. (zone size, 0-2 mm= minimal activity, 3-5 mm=
moderate activity)
0
20
40
60
80
100
0 2 4 6 8 10 12
Res
idu
al a
ctiv
ity (
%)
pH
SSC1407 SSC14011
0
1
2
3
4
5
0 1 2 3 4 5
Zone
size
(m
m)
Exposure Time (minutes)
SSC1407 SSC14011
163
7.4.4. Purification of Bacteriocin:
Purification step required filtration, centrifugation, ammonium sulphate precipitation and for
final purification, desalting by dialysis. The final recovered proteins along with proteins
present in every subsequent step were quantified and the overall protein activity and %
recovery/yield was calculated. It was observed that the SSC1407 showed low purification
fold (0.10) and yield (0.13%) as compared to SSC14011 that showed high (3.37)
purification fold and (3.28%) yield (Table XXVI).
7.4.5. SDS-PAGE Gel electrophoresis:
Bacteriocins of both of two test cultures were resolved using standard SDS-polyacrylamide
gel electrophoresis. The peptide bands were visualized (Fig. 27). SSC1407 sample showed
multiple light bands in the range of 70-42 kDa. SSC14011 sample showed multiple bands in
the range of 95-29 kDa respectively.
7.4.6. Cytotoxicity Test:
Test bacterial crude extracts in two fold dilutions were analyzed for cytotoxic assay.
Concentrations were determined after pilot ad-Hoc experiment. The premediated experiment
revealed that each concentration exhibited different mortality rates. Increased concentrations
of test extracts rise the mortality rate of brine shrimps. The SSC14011 extract showed high
mortality rate than SSC1407 test extract. The LC50 values with confidence limits 95% were
164
determined by Probit analysis (Table XXVII, XXVIII). Linear correlation was found
between concentration dose (log) and Probit mortality (%). LC50 values for extracts
SSC1407 were 0.052 mg/ml (52.03 ug/ml) and for SSC14011 0.046 mg/ml (46.17 ug/ml)
respectively (Fig. 28, 29). The results indicate that the test extracts were significantly
effective and biologically active as both concentrated extracts were found exhibit lethal
effect.
165
Ta
ble
XX
VI.
Pu
rifi
cati
on
of
bac
teri
oci
n(s
) fr
om
cu
ltu
re s
up
ern
atan
t o
f m
ang
rov
e b
acte
ria.
(Th
e to
tal
acti
vit
y w
as c
alcu
late
d m
ult
iply
ing
sam
ple
vo
lum
e b
y a
ctiv
ity
, to
tal
pro
tein
was
det
erm
ined
by
un
its
ob
tain
ed b
y a
ctiv
ity
ass
ay (
Bra
dfo
rd m
etho
d)
mu
ltip
lied
by
to
tal
vo
lum
e, s
pec
ific
act
ivit
y w
as
exam
ined
by d
ivid
ing
th
e to
tal
acti
vit
y b
y t
ota
l p
rote
in,
pu
rifi
cati
on
fo
ld w
as o
bta
ined
by
div
idin
g t
he
bef
ore
an
d a
fter
val
ues
of
spec
ific
act
ivit
y,
reco
ver
y o
r y
ield
is
the
rem
ain
ing
per
cen
t o
f p
rote
in o
ut
of
the
init
ial
con
cen
trat
ion
o
f p
rote
in
(Og
unb
anw
o,
San
ni
and
O
nil
ud
e,
200
3;
Raj
aram
, M
aniv
asag
an
,
Gu
nas
ekar
an, R
ames
h, A
sho
kk
um
ar, T
hil
agav
ath
i an
d S
arav
anak
um
ar,
20
10
))
166
Figure 27. SDS-PAGE of Dialyzed fractions of test strains. Samples after dialysis with 12
kDa cut off membrane. Test Strains showing multiple bands between the range of 95-29 kDa
respectively.
175
95
130
62
70
42
51
22
29
14
10.5
SSC1407 SSC14011 Std.
kDa
167
Figure 28. Probit analysis plot showing effect of crude extracts of Bacterial Strain SSC1407
on Artemia salina (brine shrimps). 50% mortality is expected at log dose (1.6532) 52.03
g/ml whereas, 90% mortality is expected at (1.9542) 4.4 g/ml of log dose.
168
Figure 29. Probit analysis plot showing effect of crude extract of strain SSC14011 on
Artemia salina. 50% mortality is expected at log dose (1.663) 46.17 g/ml whereas, 90%
mortality is expected at (1.968) 89.51 g/ml of log dose.
169
Table XXVII. Probit analysis of Crude extract of Strain SSC14011.
S.No. Parameters
Statistics log dose g/ml
1) mean 1.66438
median 1.66438
Std Dev 0.224332
Inter Qurtile 0.302619
2) Regression Table
Variable Coefficient Standard Error Z P
Constant -7.42 0.59 -12.68 0.00
log Dose 4.46 0.35 12.79 0.00
3) Goodness-of-Fit Tests
Method Chi-Square DF P
Pearson 1.17 4 0.88
Deviance 1.97 4 0.74
4) Tolerance Distribution
Parameter Estimate Standard
95.0% Normal
CI
Error Lower Upper
Mean 1.66 0.02 1.63 1.70
StDev 0.22 0.02 0.19 0.26
5) Table of Percentiles
Percent Percentile Standard 95.0% CI
Lower Upper
10 1.38 0.03 1.31 1.43
50 1.66 0.02 1.63 1.70
6) 90 1.95 0.03 1.90 2.02
Table of Survival Probabilities
Stress Probability 95.0% Fiducial CI
Lower Upper
0.9 0.99967 0.99830 0.99997
170
Table XXVIII. Probit analysis of Crude extract of Strain SSC1407.
S.No. Parameters
Statistics log dose mg/ml
1) mean 1.71629
median 1.71629
Std Dev 0.168991
Inter
Qurtile 0.227966
2) Regression Table
Variable Coefficient
Standard
Error Z P
Constant -10.16 0.95 -10.71 0.00
log Dose 5.92 0.55 10.83 0.00
3) Goodness-of-Fit Tests
Method Chi-
Square DF P
Pearson 2.92 4 0.57
Deviance 4.28 4 0.37
4) Tolerance Distribution
Parameter Estimate Standard 95.0% Normal CI
Error Lower Upper
Mean 1.72 0.02 1.68 1.75
StDev 0.17 0.02 0.14 0.20
5) Table of Percentiles
Percent Percentile Standard 95.0% CI
Lower Upper
10 1.49971 0.02682 1.43805 1.54605
50 1.71629 0.01683 1.68241 1.7495
90 1.93286 0.02543 1.88869 1.99102
6) Table of Survival Probabilities
Stress Probability 95.0% Fiducial CI
Lower Upper
0.9 1.00000 0.99998 1.00000
171
Marine environments mostly consist of gram negative bacteria (Sattar and Ahmed, 1988)
that are generally halotolerant (Siddiqui, 1990). Amir, Ahmed and Talat, (1993) isolated
some bacterial species from mangrove soils of Pakistan that were found to be halotolerant
and antibiotic resistant. Some were found to be gram negative rods but unlike current
observations, isolates were not identified up to genus or species level. In present research we
examined the productions of bacteriocins by isolates SSC1407 and SSC14011from
mangrove soil associated microbial mat. The bacteriocin activity of bacterial strain may be
due to the presence of peptides, alkaloids and lippopolysaccharides. In present study we
were successfully able to cultivate two isolates reported via 16S rRNA gene sequencing on
LB media. It was observed that the antagonistic substances were proteinaceous in nature.
The overall inhibitory spectrum of both isolates were narrow, as gram negative bacteria
usually exhibit narrow spectrum as compared to gram positive bacteria (Burns and Slater,
1982). Loss of activity was observed at temperatures less than 50ºC indicating that the
metabolite was less heat stable.
It was observed that both metabolites have different characteristics as bacteriocins usually
differ in their antagonistic nature and structures (Sablon, Contreras and Vandamme, 2000).
Both isolates were able to grow in peptone containing medium exhibiting that the
bacteriocin producing cells can grow in a complex medium. Extraction of bacteriocin from
enriched media indicates that both bacteriocins can be recovered from aqueous phase.
Concurring with earlier studies, temperature and pH was found to be one of the significant
factors that influence the bacteriocin production (Noman, Khaleafa and Zaky, 2004;
172
Todorov, Velho and Gibbs, 2004). Antagonistic activity may also be influenced by
physiological factors and test organisms (Schlegel, Doan, de Chazal and Smith, 1998).
The decrease of bacteriocin activity during growth curve experiment indicates that the
bacteriocins are sensitive to extracellular proteases. This may be due to the fragmentary
digestion of metabolites by proteolytic enzymes from native cells (Ghanbari, Rezaei, Sultani
and Hosseini, 2009). The growth curve also revealed that the bacteriocin activity of both
strains SSC1407 and SSC14011 were observed during stationary phase indicating that the
antagonistic substances are secondary metabolic products. Both bacteriocins of present
research are able to tolerate extreme saline conditions as they were isolated from mangrove
area having salinity usually ranging from 28 to 43 PSU. The UV- exposure experiment
suggested that the bacteriocins of both isolates were not inducible and exhibited tolerance to
radiations. This concur with earlier studies revealing that marine associated bacteria usually
remain uninduced (Hescox and Carlberg, 1972; Meseguer and Rodriguez, 1985; Pirzada,
Nasir and Rasool, 2000). The protein purification steps resulted in loss of concentration of
protein content. The distilled water dialysis buffer was more efficient against SSC1407 than
SSC14011. The highest recovery was achieved during precipitation via ammonium sulphate
which are in agreement with the studies of Ivanova, Kabadjova, Pantev, Danova and
Dousset (2000) and Ogunbanwo, Sanni and Onilude (2003). Brine shrimp lethality tests
revealed that the isolate’s extracts were biologically active.
173
The phylogenetic trees were constructed using the strains sequences, isolate SSC1407 was
placed in a broad cluster comprising of all Proteus species supported by a high bootstrap
value of 99% to previously reported Proteus sp. clone W60, JF733467.1 isolated from
wetland area and it is sulphate reducing and aluminum degrading in nature (Martins,
Taborda, Silva, Assunção, Matos and Costa, 2012) (Fig. 30).
Whereas, isolate SSC14011 was situated with Klebsiella pneumoniae strain in phylogenetic
tree, separated by a boot strap value of 92% earlier reported as K. pneumoniae CCFM8368
that can utilize lactose and is associated with human gastrointestinal system (Mao, Li, Zhao,
Liu, Gu, Chen, Zhang and Chen, 2014) (Fig.31). Our both observed isolates did not match
100% with any of the sequences of Gene bank. This indicates that these cultures were
unidentified bacteria that are present in mangrove associated microbial mat under polluted
conditions.
174
Figure 30. Neighbour joining phylogenetic tree (upper) and fast minimum evolution tree
(lower) based on 16S r RNA gene sequence of isolated SSC1407 bacterial strain. Bootstrap
probability values of > 90% are showing by green colour. Yellow dots indicates limited
identification of bacterial. Scale bars indicates substitutions per nucleotide position.
175
Figure 31. Neighbour joining phylogenetic tree (upper) and fast minimum evolution tree
(lower) based on 16S r RNA gene sequence of isolated SSC14011 bacterial strain. Bootstrap
probability values of > 90% are showing by green colour it also represents
enterobacteriaceae. Yellow indicates limited identification of bacteria and blue dots
indicates unknown sequences. Scale bars indicates substitutions per nucleotide position.
SSC14011
176
Recent study conducted on mangrove bacteria by Sakhia, Prajapati, Shetty, Bhatt and
Bhadalkar, (2016) observed bacteria that also belong to family of our isolates indicating they
are commonly found in mangrove area. Similar to earlier studies (Sakhia, Prajapati, Shetty,
Bhatt and Bhadalkar, 2016), we also observed that the 16S rRNA gene sequencing was
primary method that can confirm genus level identification. We observed that biochemical
tests and molecular tools work hand in hand and are relevant for conclusive examination of
environmental samples. The strain SSC1407 that was isolated in current experiment
corresponded morphologically to genus that is commonly found in most ecosystems.
Proteus are some of the most abundant bacteria which successfully colonize versatile soil
substrates. Bacteria related to genus Proteus are ubiquitous in nature and are present in soil
and water and are found to produce enzymes L-asparaginase and α-amylase which are used
for chemotherapeutic purposes and ethanol, corn syrup, sugar production (Sudha, 2009;
Oseni and Ekperigin, 2013). The polluted mangrove habitat adaptations might have resulted
in genetic and may be in biochemical modifications that are reported in present study. This
also suggests that these isolates are one of the hardiest bacteria that can survive under
extreme conditions. Proteus sp. isolated form Niger delta, Nigeria was found to be among
hydrocarbon utilizing bacteria (Benka-Coker and Ekundayo, 1997). Strains belonging to
genus Proteus were also isolated from mangrove water and soil of Paraiba do Norte, Brazil
(Grisi and Gorlach, 2010).
The second isolate SSC14011 was closely related to Klebsiella species that are conventional
enteric halobacteria (Gilmour, 1990). Genus Klebsiella is commonly found in mangrove
soils (Sen and Naskar, 2003). Klebsiella sp. present in mangrove soils also possess bio-
177
surfactant properties (Saimmai, Tani, Sobhon and Maneerat, 2012). The Klebsiella
pneumoniae isolates from anthropogenically compromised mangrove forests (similar to our
Sandspit study area) have been reported from Mattang Malaysia (Ghaderpour, Nasori,
Chew, Chong, Thong and Chai, 2014). Swarnakumar, Thangaradjou, Sivakumar, Kannan,
(2007) and Ashokkumar, Rajaram, Manivasagan, Ramesh, Sampathkumar and Mayavu,
(2011) reported Klebsiella pneumoniae from Indian Muthupettai and Nicobar mangroves
respectively. This organism is commonly found in water, soil and human gastrointestinal
tract (Aissani, Messai, Alouache and Bakour, 2013). It is associated with fauna and
halophytic plants such as Salicornia bigelovii and can fix nitrogen in saline ecosystem
(Sengupta and Chaudhuri, 1990; Rueda‐Puente, Castellanos, Diéguez, Alvarez, and Amador,
2003). Jalal, Mardiana, Shahbudin and Omar, (2010) observed various bacterial strains from
mangrove soil, among them Klebsiella pneumoniae was found to be resistant against
different antibiotics. Klebsiella pneumoniae from mangrove soil can also degrade glycerol to
1,3-propanediol which is used in polymer industry (Zhou, Li, Wei and Qin, 2013).
Bacteriocin associated treatment is relatively cost effective, non-toxic and ecofriendly and
can be considered as an alternative for management of certain disease control (Miles, Lesser
and Sears, 1992; De Oliveira, Abrantes, Cardoso, Sordelli and Bastos, 1998). As bacteria
can develop resistance against conventional bacteriocins (Rasch and Knöchel, 1998; van
Schaik, Gahan and Hill, 1999), the search for novel antibacterial metabolites or antagonistic
substances is always significant. Present knowledge related to isolates will contribute
towards detailed experimentations for natural antibiotics. As the tests were performed using
crude extracts, presences of other antibacterial and antifungal compounds cannot be ruled
178
out. Further studies are required to observe the protein structures and effect of other possible
factors (such as media composition) on the production of these biocontrol substances against
other clinical/environmental bacterial, fungal and yeast strains. The isolated strains could be
further developed to produce more effective bacteriocins against gram negative
enterobacteria.
179
PART IV
GENERAL DISCUSSION
180
Mangrove forests are halophilic, highly productive, ecologically and commercially
significant ecosystems (Walters, Rönnbäck, Kovacs, Crona, Hussain, Badola, Primavera,
Barbier and Dahdouh, 2008). These forests are sometimes sole habitat for fishes and other
crustaceans (Brown, 1997; Nagelkerken, Blaber, Bouillon, Green, Haywood, Kirton,
Meynecke, Pawlik, Penrose, Sasekumar and Somerfield, 2008) and provides sanctuary to
variety of migratory and non-migratory animals (Field, 1998). All these facts lead to the
following study to investigate native forests. In Pakistan, mangrove forests of Sandpit have
been studied in past for various aspects. The present research augments to scientific data
associated with this mangrove area. Microbial mat contributes nutrients to adjacent systems
in terms of biogeochemical cycling (Bouillon, Moens, Overmeer, Koedam and Dehairs,
2004; Visscher and Stolz, 2005). The nutrients are an essential component (Lovelock and
Feller, 2003; Alongi, Clough and Robertson, 2005) and microbial organisms are key group
responsible for most of these nutrient flux cycles and decomposition of carbon based content
(Holguin, Vazquez and Bashan, 2001; Cherif and Loreau, 2009). Concurring with the
research of Cowan and Boynton, (1996) and Friedrich, Dinkel, Friedl, Pimenov, Wijsman,
Gomoiu, Cociasu, Popa and Wehrli, (2002), the seasonal variations in nutrient content were
also observed in present study. The mean average nutrient values of the Sandspit mangrove
backwaters were similar to median figures Indonesian mangrove study of Moll, (2011).
Overall It was estimated that during monsoon season there were lower rates of release or
export of nutrients (Table VIII). This concur with earlier works of Robertson, Alongi and
Boto, (1992) and Moll, (2011). It was observed that the cyclone ‘Nanauk’ in the year 2014
which devastated the mangrove area, also influenced the nutrient levels. The samples
collected before the storm showed increased nutrient levels (Table XII) as compared to
181
samples after the storm (Table VII). Even after the recolonization, the levels were still not
similar as before. Another thunderstorm ‘Nilofar’ was also reported in the late October of
2014, but comparatively did not cause much damage.
Sultana and Mustaquim (2003) conducted a survey of physico-chemical properties and grain
size analysis of sandspit area in 1988. The current mean average salinity, temperature, DO
and grain size ratios are similar to earlier observations. But the mean pH values have
increased from 7.6 to 8.4 and the organic carbon content is decreased form average 8.32% to
<2%. This may be due to increased pollution that has minimized the faunal population and
as a result lowered the average carbon content over the years. The analysis of sand spit
mangrove soil revealed steady conditions for potential nitrification. There was a direct
relationship between soil texture and other physical and chemical parameters with soil
associated microbial mat (Rietz and Haynes, 2003; Sardinha, Müller, Schmeisky and
Joergensen, 2003; Stolz, 2003; Müller and Höper, 2004). Recent study conducted by
Kirwan and Mudd, (2012) revealed that the fluxes of organic material mainly carbon are
dependent on two factors, first the climate change that favors top soil vegetation and second,
the sea level rise which increase burial space thus increasing carbon rates in sediments. The
presence of mat along with invertebrate activity such as fiddler crabs transforms the highly
saline, loose, dry soil into lesser saline, compact, wet, aerated soil (Smith, Boto, Frusher and
Giddins, 1991; author observation) that pave a way for advancement and increase efficacy in
mangrove sediment such as sediment trapping up to 40-80% (Furukawa, Wolanski and
Mueller, 1997; Kitheka, Ongwenyi and Mavuti, 2002; Victor, Golbuu, Wolanski and
Richmond, 2004) and water movement (Mazda and Ikeda, 2006). This as a result, structures
182
a favorable habitat for associated flora and fauna (Guadrado, Carmona and Bournod, 2011).
It is imperative to find out more factors that might influence the nutrient rates and soil
characteristics.
The microbial mat consists of variety of cyanobacterial and diatoms strains which give mat
its green or brown colour (Stal, van Gemerden and Krumbein, 1985; Pierson, Oesterle and
Murphy, 1987). The population and abundance of species affects the colour intensity of
microbial mat. Filamentous cyanobacteria were most abundant (author unpublished data).
The community structure was somewhat similar to Kerala mangrove forests of India
described by Rejil, (2012). Culture independent methods used in the experiments of Stolz,
(1983), Ram, VerBerkmoes, Thelen, Tyson, Baker, Blake, Shah, Hettich and Banfield,
(2005), Ley, Harris, Wilcox, Spear, Miller, Bebout, Maresca, Bryant, Sogin and Pace,
(2006) and Bachar, Omoregie, Wit and Jonkers, (2007) must be used in future to fully
observe the diversity of microbial mat studied site. The Sandspit mat related bacteria and
cyanobacteria were primary members along with others organisms (Castenholz, 2001;
Noffke, Knoll and Grotzinger, 2002). They were found to be hardy microbes and as
substances from natural sources are significant component of miscellany pharmaceutics,
research in this direction may lead to new bioactive substances. Several studies have
assessed antagonistic potential of cyanobacteria from marine source (Burja, Banaigs, Abou,
Burgess and Wright, 2001; Kelecom, 2002; Berdy, 2005; Tan, 2007; Gademann and
Portmann, 2008; Bhatnagar and Kim, 2010; Nunnery, Mevers and Gerwick, 2010; Tan,
2010). Present investigation revealed that secondary metabolites of mangrove associated
183
bacteria (gram negative) and cyanobacteria were found to be antimicrobial and Cytotoxic in
nature.
One of the reasons Cyanobacterial metabolite exhibited active inhibition, may be owing to
similarity with gram negative bacteria (Mundt, Kreitlow, Nowotny and Effmert, 2001;
Dahms, Xu and Pfeiffe, 2006). The antagonistic effect against Candida albicans favors
earlier suggestions that these cyanobacterial extracts serves the purpose of defense against
outer environment (Piccardi, Frosini, Tredici and Margheri, 2000; Bhadury and Wright,
2004) and were found to exhibit antifungal activity (Soltani, Khavari, Yazdi, Shokravi and
Fernandez, 2005; Kim, 2006; Pawar and Puranik, 2008). Current investigation revealed that
filamentous form of cyanobacteria may exert more toxic effect. This was similar with the
study of Lopes, Fernández, Martins and Vasconcelos, (2010) where, filamentous
Leptolyngbya and Microcoleus from estuarine waters were found to have most toxic
extracts. As ethanolic extract showed strong antagonistic activity, therefore mid to low
polarity enzymatic and fatty acid assessment are recommended. Furthermore, molecular
assessment is required in future to understand the overall bioactivity of these strains.
Like bacteria (which produce peptide that can be either bacteriostatic or bactericidal in
nature (Cleveland, Montville, Nes and Chikindas, 2001)), marine cyanobacteria also
produce metabolites that were cytotoxic in nature and may be used for innovative drugs
(Dunlap, Battershill, Liptrot, Cobb, Bourne, Jaspars, Long and Newman, 2007). Brine
shrimp lethality test was conducted for both cyanobacterial and cyanobacterial extracts
because it was inexpensive and there were no ethical restrictions associated with this test
184
(Sánchez-Fortún, Sanz and Barahona, 1996; Caldwell, Bentley and Olive, 2003; Jaiswal,
Singh and Prasanna, 2008). Also, it serves as a basic screening tool for preliminary
assessment of ecological, biological and chemical substances (Carballo, Hernández, Pérez
and García, 2002; Nunes, Carvalho, Guilhermino and Van Stappen, 2006; Abourashed,
2010). In future, cytotoxicity of crude extracts to mammalian cell lines are recommended as
the test solely on brine shrimp may not reveal the true potency against human cells (Hisem,
Hrouzek, Tomek, Tomšíčková, Zapomělová, Skácelová, Lukešová and Kopecký, 2011).
Presence of versatile bacteria in mangrove environment is very common. As compared to
other mangrove flora and fauna studies, observations related to mangrove bacteria are
relatively low. Earlier studies on Karachi coast including Sandspit mangrove areas reported
bacteria belonging to genus Pseudomonas, Micrococcus, Methanococcus, Staphylococcus,
Salmonella, Marinococcus and Bacilli (Zubari, 1986; Ahmed and Yasmin, 1988; Amir,
Ahmed and Talat, 1993). Some of them were extreme halotolerant and resistant to common
antibiotics. Now years later in 2016, the presence of enterobacteriaceae in mangrove soil of
same locality indicates increased levels of pollution stress caused mainly by anthropogenic
factors.
Two of the previously uncultured bacteria (SSC1407 and SSC14011) were found to exhibit
antagonistic activity against two common clinical strains (E. coli and Proteus O). The 16S
rRNA gene sequencing is among modern molecular tools to identify unknown mangrove
bacterial strains at least up to genus level (Sakhia, Prajapati, Shetty, Bhatt and Bhadalkar,
2016). It was observed that our isolates belong to genus Proteus (SSC1407) and Klebsiella
185
(SSC14011) which are also pathogenic in nature and were found in polluted areas
(Swarnakumar, Thangaradjou, Sivakumar and Kannan, 2007). They were insensitive to
increased salinity, pH, radiations and chemical solvents. Bacterial extracts were more active
against clinical strain whereas, cyanobacterial strain were effective against yeast strain.
During the initial screening process, no gram positive bacterial strain was effective against
any clinical or environmental culture this may be due to the fact that gram positive is less
resistant than gram negative bacteria (Taton, Grubisic, Ertz, Hodgson, Piccardi, Biondi,
Tredici, Mainini, Losi, Marinelli and Wilmotte, 2006; Volk and Furkert, 2006; Martins,
Ramos, Herfindal, Sousa, Skarven and Vasconcelos, 2008). The gram negative bacteria
possess lippopolysaccharides on outer membrane which makes these microbes resistant to
foreign toxic substances (Martins, Ramos, Herfindal, Sousa, Skarven and Vasconcelos,
2008). Due to constant exposure to extreme environment, these type of bacteria become
hardy enough to breakdown complex pollutant into simpler forms (Martins, Taborda, Silva,
Assunção, Matos, and Costa, 2012). All these characteristics can help in experimental
engineering of organisms for environmental cleanup or as antibacterial and antifungal
agents. On the other hand, continuous presence may potentially transmit these organisms
into benthic and pelagic sites and incorporate into food chain. This leads to contaminated
fisheries and may permanently compromise the water quality. Consumption of such fish
food could cause serious illness in humans. By regularly observing soil and microbial mat
associated bacteria, we can observe the soil status, identify potential pathogens and
determine microbial pollution level.
186
Although mangroves have been found to remove pollutants from anthropogenic sources
(Tam and Wong, 1993), extreme stress caused by pollution limits this potential. It was
estimated that pollution stress leads to loss of almost 50,000 ha of Pakistani mangrove
forests (Damhoureyeh and Ghalib, 2014). Sandspit mangroves are among highly polluted
areas of Pakistan coast (Chan, Ibrahim, Saeed, Siddiqui, Zafar and Rasheed, 2016) and the
adverse effect was evident in terms of low number of species and presence of mainly
pollution tolerant flora (Yasmeen, Shafique, Zaib un Nisa and Siddiqui, 2016). This was also
true for fauna close to forest floor, only invertebrates such as fiddler and mud crabs, slugs,
some gastropods mainly Cerithideopsilla cingulate and Telescopium sp. (Shafique, 2004;
Shafique, Siddiqui and Farooqui, 2015), sponge, mudskippers and small school of fish (that
swim along with the tide) were evidently observed during the four-year study period. On
microscopic scale, nutrient enrichment due to anthropogenic factors may also lead to
increased rates of decomposition and negatively influence primary producers (Hessen,
Ågren, Anderson, Elser and De Ruiter, 2004). Remote sensing study of Sandspit area
conducted by Rehman, Khanum and Kazmi, (2016) revealed that the Sandspit area is under
serious threat of climate change and factors such sea water intrusion, reduced fresh water
input, low rainfall and storms stimulate degradation of this site and enhance risk levels. To
prevent this site from further destruction and maintain ecological balance, rigorous planning
for environmental cleanup is urgently required. These investigations basically cover the base
line data of Sandspit mangrove area. Further long term investigations are required to closely
observe more nutrient levels and fully explore new substances that might be ecologically or
pharmaceutically applicable.
187
PART V
REFERENCES
188
Abbas, G. (2002). Growth, Feed Conversion, and Body Composition of Juvenile Mangrove
Red Snapper, Lutjanus argeniimaculatus (Pisces, Lutjanidae) Reared in Concrete
Tanks (Doctoral dissertation). Centre of Excellence in Marine Biology, University of
Karachi, Pakistan.
Abbas, G. and Siddiqui, P. J.A. (2003). Effect of feeding rate on growth, feed conversion
and body composition of juvenile mangrove red snapper reared in seawater tanks.
Pakistan Journal of Zoology, 35(2), 151-156.
Abbas, G. and Siddiqui, P. J. (2009). Effects of different feeding level on the growth, feed
efficiency and body composition of juvenile mangrove red snapper, Lutjanus
argentimaculatus (Forsskal, 1775). Aquaculture Research, 40(7), 781-789.
Abbas, G., Siddiqui, P. J., and Jamil, K. (2011). The optimal protein requirements of
juvenile mangrove red snapper, Lutjanus argentimaculatus fed isoenergetic diets.
Pakistan Journal of Zoology, 44(2), 469-480.
Abbas, S., Mueen, Q. F., Ghaffar, A. N. K. T., Khurram, S. R. S. and Gilani, H. (2013). An
Assessment of status and distribution of mangrove forest cover in Pakistan. Journal
of Biodiversity and Environmental Sciences, 3(6), 64-78.
Abbas, S., Qamer, F. M., Hussain, N., Saleem, R. and Nitin, K. T. (2011, September).
National level assessment of mangrove forest cover in Pakistan. In: Workshop
Proceedings Earth Observation for Terrestrial Ecosystem, 187-192.
Abbasi, M. K., Shah, Z. and Adams, W. A. (2001). Mineralization and nitrification
potentials of grassland soils at shallow depth during laboratory incubation. Journal
of Plant Nutrition and Soil Science, 164(5), 497-502.
Abd, G. H., Zaki, N. H. and Merthad, A. S. (2015). The effect of some extracted compounds
from the algae Oscillatoria tenius against pathogenic bacteria. Journal of
Pharmaceutical and Scientific Innovation, 4(1), 36-39.
Abed, R. M., Golubić, S., Garcia-Pichel, F., Camoin, G. and Lee, S. J. (2003). Identity and
speciation in marine benthic cyanobacteria: The Phormidium-complex. Algological
Studies, 109(1), 35-56.
189
Abed, R. M., Dobrestov, S., Al-Kharusi, S., Schramm, A., Jupp, B. and Golubic, S. (2011).
Cyanobacterial diversity and bioactivity of inland hypersaline microbial mats from a
desert stream in the Sultanate of Oman. Fottea, 11(1), 215-224.
Abourashed, E. A. (2010). Book Review of Bioactive Natural Products− Detection,
Isolation, and Structural Determination. Journal of Natural Products, 73(8), 1460-
1460.
Acreman, J. (1994). Algae and cyanobacteria: isolation, culture and long-term maintenance.
Journal of Industrial Microbiology and Biotechnology, 13(3), 193-194.
Adeel, Z. and Pomeroy, R. (2002). Assessment and management of mangrove ecosystems in
developing countries. Trees, 16(2-3), 235-238.
Adhikari, B., Baig, S. P. and Iftikhar, U. A. (2010). The use and management of mangrove
ecosystems in Pakistan. The Journal of Environment and Development, 19(4), 446-
467.
Ahmad, M. (1997). Natural and human threats to biodiversity in the marine ecosystem of
coastal Pakistan. In: Coastal zone management imperative for maritime developing
nations, Springer Netherlands, 319-332.
Ahmad, S., Iqbal, A. and Rasool, S. A. (2003). Bacteriocin-like inhibitory substances (BLIS)
from indigenous clinical streptococci: Screening, activity spectrum and biochemical
characterization. Pakistan JournaL of Botany, 35(4), 499-506.
Ahmed, N. and Yasmeen, A. (1988). Isolation, Characterization and Genetic studies of
Marine Bacteria. In: Marine sciences of Arabian Sea, Thompson, M.F. and Trimizi,
N.M. (Eds.), AIBS, Washington, U.S.A. 485-492.
Ahmed, N., Jamil, N., Khan, O.Y., Yasmeen, S., Haq, -U., Z., Ahmed, V. and Rahman, A.
(2000). Commercially important products from marine bacteria: Marine
biotechnology. In: Proceedings of national ONR symposium on Arabian sea as a
resource of biological diversity. 104-114.
Ahmedani, M. A., Yasmin, S., Arain, M. A., Shah, K. H., Abro, H. and Nahyoon, M. A.
(2007). Effect of bactericidal plants treatments on urea hydrolysis and nitrification in
190
soils of different cropping histories. part-2. nitrification. Pakistan Journal of Botany,
39(7), 2673-2680.
Aissani, E.-F.R., Messai, Y., Alouache, S. and Bakour, R. (2013). Virulence profiles and
antibiotic susceptibility patterns of Klebsiella pneumoniae strains isolated from
different clinical specimens. Pathologie Biologie, 61(5), 209-216.
Alfaro, A.C. (2006). Benthic macro-invertebrate community composition within
mangrove/seagrass estuary in northern New Zealand. Estuarine and Coastal Shelf
Sciences, 66, 9-10.
Ali, R., Iqbal, J., Tahir, G. R. and Mahmood, T. (2008). Effect of 3, 5-dimethylpyrazole and
nitrapyrin on nitrification under high soil temperature. Pakistan Journal of Botany,
40(3), 1053-1062.
Ali, R., Kanwal, H., Iqbal, Z., Yaqub, M., Khan, J. A. and Mahmood, T. (2012). Evaluation
of some nitrification inhibitors at different temperatures under laboratory conditions.
Soil Environment, 31(2), 134-145.
Ali, Z., Arshad, M. and Akhtar, M. (2003). Biological analysis of Mekran coastal wetlands
complex, Pakistan. Proceedings Pakistan Congress of Zoology, 23, 99-140.
Allen, D., Dalal, R.C., Rennenberg, H. and Schmidt, S. (2010). Seasonal variation in nitrous
oxide and methane emissions from subtropical estuary and coastal mangrove
sediment, Australia. Plant Biology, 13, 126-133.
Alongi, D. M. (1989). The role of soft-bottom benthic communities in tropical mangrove
and coral reef ecosystems. CRC Critical Review in Aquatic Sciences-pages: 1: 243-
280.
Alongi, D. M., Boto, K. G. and Tirendi, F. (1989). Effect of exported mangrove litter on
bacterial productivity and dissolved organic carbon fluxes in adjacent tropical
nearshore sediments. Marine ecology progress series. Oldendorf, 56(1), 133-144.
Alongi, D. M., Boto, K. G. and Robertson, A. I. (1992). Nitrogen and phosphorus cycles.
Tropical Mangrove Systems, 251–292.
191
Alongi, D. M., Boto, K. G. and Robertson, A. I. (1993). Nitrogen and phosphorus cycles.
American Geophysical Union. 251-292.
Alongi, D. M. (1994). The role of bacteria in nutrient recycling in tropical mangrove and
other coastal benthic ecosystems. In Ecology and Conservation of Southeast Asian
Marine and Freshwater Environments including Wetlands (pp. 19-32). Springer
Netherlands.
Alongi, D. M. (1996). The dynamics of benthic nutrient pools and fluxes in tropical
mangrove forests. Journal of Marine Research 54, 123–148.
Alongi, D., Trott, L., Wattayakorn, G. and Clough, B. (2002). Below-ground nitrogen
cycling in relation to net canopy production in mangrove forests of southern
Thailand. Marine Biology, 140(4), 855-864.
Alongi, D. M., Sasekumar, A., Chong, V. C., Pfitzner, J., Trott, L. A., Tirendi, F., Dixon, P.
and Brunskill, G. J. (2004). Sediment accumulation and organic material flux in a
managed mangrove ecosystem: estimates of land–ocean–atmosphere exchange in
peninsular Malaysia. Marine Geology, 208(2), 383-402.
Alongi, D.M., Clough, B.F. and Robertson, A.I. (2005). Nutrient-use efficiency in arid-zone
forests of the mangroves Rhizophora stylosa and Avicennia marina. Aquatic Botany,
82, 121-131.
Alongi, D.M. (2007). The contribution of mangrove ecosystems to globalcarbon cycling and
greenhouse gas emissions. In: Tateda, Y., Upstill-Goddard, R., Goreau, T., Alongi,
D., Nose, A., Kristensen, E. and Wat-tayakorn, G. (Eds.), Greenhouse Gas and
Carbon Balances in Mangrove Coastal Ecosystems. Maruzen, Tokyo, 1–10.
Alongi, D.M. and Carvalho, N.A. (2008). The effect of small-scale logging on stand
characteristics and soil biogeochemistry in mangrove forests of Timor Leste. Forest
Ecology and Management, 255, 1359-1366.
Altschul, S. F., Gish, W., Miller, W., Myers, E. W. and Lipman, D. J. (1990). Basic local
alignment search tool. Journal of molecular biology, 215(3), 403-410.
Amin, M. and Flowers, T. H. (2004). Effect of two applications of substrate on nitrification
and pH of soils. Journal of Research Sciences. 15(3), 263-269.
192
Amir, R., Ahmed, N. and Talat, M. (1993). Salt-tolerance in mangrove soil bacteria.
Pakistan Journal of Marine Sciences, 2(2), 129-135.
Amjad, A. S. and Kamaruzaman, J. (2007). Mangrove Conservation through Community
Participation in Pakistan: The Case of Sonmiani Bay. International Journal of
Systems Applications, Engineering and Development, 1(4).
Amjad, A. S., Kasawani, I. and Kamaruzaman, J. (2007). Degradation of Indus delta
mangroves in Pakistan. International Journal of Geology, 3(1), 27-34.
Anand, T.P., Bhat, A.W., Shouche, Y.S., Roy, U., Siddharth, J. and Sarma, S.P. (2006).
Antimicrobial activity of marine bacteria associated with sponges from the waters off
the coast of South East India. Microbiological research, 161(3), 252-262.
Andersen, F. Ø. and Kristensen, E. (1988). The influence of macrofauna on estuarine
benthic community metabolism: a microcosm study. Marine Biology , 99, 591-603.
Andersen, M. and Kristensen, E. (2002). The importance of bacteria and microalgae in the
diet of the deposit feeding polychaete Arenicola marina. Ophelia, 56, 179-196.
Andersen, R.A. and Kawachi, M. (2005). Traditional microalgae isolation techniques. In
,Algal culturing techniques, Andersen, R.A. (Ed.). Physological Society of America׃
Elsevier academic Press, 83-100.
Aniket, K. (2012). Extraction of proteins by a two solvent method, U.S. Patent No.
US8211309 B2. Heliae Development, LlcWashington, DC: U.S. Patent and
Trademark Office.
AOAC. (1970). Official methods of analysis. Association of Official Analytical Chemists.
11th Ed.
Ara, I., Kudo, T., Matsumoto, A., Takahashi, Y. and Omura, S. (2007). Nonomuraea
maheshkhaliensis sp. nov., a novel actinomycete isolated from mangrove rhizosphere
mud. The Journal of general and applied microbiology, 53(3), 159-166
Ashokkumar, S., Rajaram, G., Manivasagan, P., Ramesh, S., Sampathkumar, P. and
Mayavu, P. (2011). Studies on hydrographical parameters, nutrients and microbial
193
populations of mullipallam creek in muthupettai mangroves (southeast coast of
India). Research Journal of Microbiology, 6(1), 71.
Asmus, R. M., Sprung, M. and Asmus, H. (2000). Nutrient fluxes in intertidal communities
of a South European lagoon (Ria Formosa)–similarities and differences with a
northern Wadden Sea bay (Sylt-Rømø Bay). Hydrobiologia, 436(1-3), 217-235.
Ayub, Z. and Muzammil, A. (2002). Distribution and Abundance of Penaeid Shrimp
Juveniles in the Backwaters and Creeks Along the Coast of Sindh. Pakistan Journal
of Zoology, 34(1), 19-28.
Aziz, I. and Khan, M. A. (2000). Physiological adaptations to seawater concentration in
Avicennia marina from Indus delta, Pakistan. Pakistan Journal of Botany, 32, 151-
170.
Aziz, I., and Ajmal, M. (2001). Seasonal variation in ecophysiology of Avicennia marina
populations growing in polluted Arabian sea coast around Karachi. Pakistan Journal
of Botany, 33(4), 429-441.
Bachar, A., Omoregie, E., de Wit, R. and Jonkers, H.M. (2007). Diversity and function of
Chloroflexus-like bacteria in a hypersaline microbial mat: phylogenetic
characterization and impact on aerobic respiration. Applied and environmental
microbiology, 73(12), 3975-3983.
Badola, R. and Hussain, S. A. (2003). Valuation of the Bhitarkanika mangrove ecosystem
for ecological security and sustainable resource use. Study report. Wildlife Institute
of India, Dehra Dun.
Baig, M. B., Ahmad, S., Khan, N., Ahmad, I. and Straquadine, G. S. (2008). The history of
social forestry in Pakistan: An overview. International Journal of Social Forestry,
1(2), 167-183.
Baig, S. P. and Iftikhar, U. A. (2010). Are the Mangroves for the Future? Empirical
evidence of the value of Miani Hor Mangrove Ecosystem as the basis for
investments. IUCN. Karachi.
Bandaranayake, W. M. (1998). Traditional and medicinal uses of mangroves. Mangroves
and salt marshes, 2(3), 133-148.
194
Banerjee, D., Chakrabarti, S., Hazra, A. K., Banerjee, S., Ray, J. and Mukherjee, B. (2008).
Antioxidant activity and total phenolics of some mangroves in Sundarbans. African
journal of biotechnology, 7(6).
Bano, A. and Siddiqui, P. J. A. (2003). Intertidal cyanobacterial diversity on a rocky shore at
Buleji near Karachi, Pakistan. Pakistan Journal of Botany, 35(1), 27-36.
Bano, A. and Siddiqui, P. J. A. (2004). Characterization of five marine cyanobacterial
species with respect to their pH and salinity requirements. Pakistan Journal of
Botany, 36(1), 133-144.
Bano, A. and Siddiqui, P. J. A. (2015). A Preliminary Report on Diazotrophic Ability of
Marine Cyanobacterial Isolates in Laboratory Conditions. Lasbela, University
Journal of Science and Technology, 4, 172-176.
Bano, N., Nisa, M. U., Khan, N., Saleem, M., Harrison, P. J., Ahmed, S. I. and Azam, F.
(1997). Significance of bacteria in the flux of organic matter in the tidal creeks of the
mangrove ecosystem of the Indus River delta, Pakistan. Marine Ecology Progress
Series, 157, 1-12.
Barbarino, E., and Lourenço, S. O. (2005). An evaluation of methods for extraction and
quantification of protein from marine macro-and microalgae. Journal of Applied
Phycology, 17(5), 447-460.
Barbier, E. B., Hacker, S. D., Kennedy, C., Koch, E. W., Stier, A. C. and Silliman, B. R.
(2011). The value of estuarine and coastal ecosystem services. Ecological
Monographs, 81(2), 169-193.
Barefoot, S.F. and Klaenhammer, T.R. (1983). Detection and activity of lactacin B, a
bacteriocin produced by Lactobacillus acidophilus. Applied and Environmental
microbiology, 45(6), 1808-1815.
Barkati, S. and Tirmizi, N. M. (1987). Population structure and some aspects of the breeding
behaviour of three gastropod species from Karachi mangroves. Pakistan Journal of
Scientific and Industrial Research, 30(7), 539-544.
Barkati, S. and Rahman, S. (2005). Species composition and faunal diversity at three sites of
Sindh mangroves. Pakistan Journal of Zoology, 37(4), 17.
195
Bartoli, M., Nizzoli, D. and Viaroli, P. (2003). Microphytobenthos activity and fluxes at the
sediment-water interface: interactions and spatial variability. Aquatic Ecology, 37(4),
341-349.
Beck, M. W., Heck Jr, K. L., Able, K. W., Childers, D. L., Eggleston, D. B., Gillanders, B.
M., Hughes, A.R., Kendrick, G.A., Kenworthy, W.J., Olyarnik, S. and Weinstein, M.
P. (2001). The identification, conservation, and management of estuarine and marine
nurseries for fish and invertebrates: A better understanding of the habitats that serve
as nurseries for marine species and the factors that create site-specific variability in
nursery quality will improve conservation and management of these areas.
Bioscience, 51(8), 633-641.
Becks, L., Hilker, F. M., Malchow, H., Jürgens, K. and Arndt, H. (2005). Experimental
demonstration of chaos in a microbial food web. Nature, 435(7046), 1226-1229.
Behera, B. C., Singdevsachan, S. K., Mishra, R. R., Sethi, B. K., Dutta, S. K. and Thatoi, H.
N. (2016). Phosphate Solubilising Bacteria from Mangrove Soils of Mahanadi River
Delta, Odisha, India. World Journal of Agricultural Research, 4(1), 18-23.
Belser, L. W. and Mays, E. L. (1980). Specific inhibition of nitrite oxidation by chlorate and
its use in assessing nitrification in soils and sediments. Applied and environmental
microbiology, 39(3), 505-510.
Benfield, A. (2014). Annual global climate and catastrophe report, impact forecasting 2014.
Benincà, E., Huisman, J., Heerkloss, R., Jöhnk, K.D., Branco, P., Van Nes, E.H., Scheffer,
M. and Ellner, S.P. (2008). Chaos in a long-term experiment with a plankton
community. Nature, 451(7180), 822-825.
Benka-Coker, M. O. and Ekundayo, J. A. (1997). Applicability of evaluating the ability of
microbes isolated from an oil spill site to degrade oil. Environmental Monitoring and
Assessment, 45(3), 259-272.
Berdy, J. (2005). Bioactive microbial metabolites. Journal of Antibiotics, 58(1), 1.
Berg, P. and Rosswall, T. (1987). Seasonal variations in abundance and activity of nitrifiers
in four arable cropping systems. Microbial ecology, 13(1), 75-87.
196
Berglind, L., Johnsen, I. J., Ormerod, K. and Skulberg, O. M. (1983). Oscillatoria brevis
(Kutz.) Gom. and some other especially odouriferous benthic cyanophytes in
Norwegian inland waters. Water Science and Technology, 15(6-7), 241-246.
Bhadury, P. and Wright, P.C. (2004). Exploitation of marine algae: biogenic compounds for
potential antifouling applications. Planta, 219(4), 561-578.
Bhatnagar, A., Makandar, M.B., Garg, M.K. and Bhatnagar, M. (2008). Community
structure and diversity of cyanobacteria and green algae in the soils of Thar Desert
(India). Journal of Arid Environment, 72, 73-83.
Bhatnagar, I. and Kim, S. K. (2010). Immense essence of excellence: Marine microbial
bioactive compounds. Marine drugs, 8(10), 2673-2701.
Bhatt, D., Khushboo J. and Maitreyi Z. (2016). Cytotoxicity Screening of the Commonly
Used Indigenous Medicinal Plants Using Brine Shrimp Lethality Bio-Assay.
International Journal of Pharmaceutical Sciences Review and Research, 37(2), 147-
150.
Bhavsar, D.O., Jasrai, Y.T., Pandya, H.A., Singh, V. and Patel, A. (2014). Monitoring
Mangrove Status using Remote Sensing and Geo-informatics in Piram Island, Gulf
of Khambhat, Gujarat State, India. International Journal of Scientific and
Engineering Research (IJSER), 5(6), 999-1005.
Bigogno, C., Goldberg, I.K., Boussiba, S., Vonshak, A. and Cohen, Z. (2002). Lipid and
fatty acid composition of the green oleaginous alga Parietochloris incisa, the richest
plant source of arachidonic acid. Phytochemistry, 60(5), 497–503
Bizani, D., and Brandelli, A. (2002). Characterization of a bacteriocin produced by a newly
isolated Bacillus sp. Strain 8 A. Journal of Applied Microbiology, 93(3), 512-519.
Boto, K.G. (1979). Nutrient and organic fluxes in mangroves. In: Mangrove ecosystems in
Australia, structure, function and management, Clough, B.F., (Ed.). Color craft,
Hong Kong, 239–257.
Bouillon, S., Moens, T., Overmeer, I., Koedam, N., and Dehairs, F. (2004). Resource
utilization patterns of epifauna from mangrove forests with contrasting inputs of
local versus imported organic matter. Marine Ecology Progress Series, 278, 77–88.
197
Bouillon. S., Borges, A.V., Castaneda-Moya, E., Diele, K., Dittmar, T., Duke, N.C.,
Kristensen, E., Lee, S.Y., Marchand, C., Middelburg, J.J., Rivera-Monroy, V.H.,
Smith, T.J. and Twilley, R.R. (2008). Mangrove production and carbon sinks, a
revision of global budget estimates. Global Biogeochemical Cycle, 2, 22.
Boyer, J. N., Fourqurean, J. W. and Jones, R. D. (1999). Seasonal and long-term trends in
the water quality of Florida Bay (1989–1997). Estuaries, 22, 417–430.
Bradford, M.M. (1976). A rapid and sensitive method for the quantitation of microgram
quantities of protein utilizing the principle of protein-dye binding. Analytical
biochemistry, 72(1-2), 248-254.
Bragadeeswaran, S., Rajasegar, M., Srinivasan, M. and Rajan, U. K. (2007). Sediment
texture and nutrients of Arasalar estuary, Karaikkal, south-east coast of India.
Journal of Environmental Biology, 28(2), 237-240.
Brierley, E. D. R. and Wood, M. (2001). Heterotrophic nitrification in an acid forest soil:
isolation and characterisation of a nitrifying bacterium. Soil Biology and
Biochemistry, 33(10), 1403-1409.
Brown, B.E. (1997). Integrated coastal Management: South Asia. Department of Marine
sciences and coastal Management, University of Newcastle, UK.
Bui, T.H. (2014). Cyanobacteria as source of new antifungals (Doctoral dissertation).
http://d-nb.info/1051958008/34.
Bulleid, N. C. (1984). Deoxygenation and remineralization above the sediment-water
interface; an in situ experimental study. Estuarine, coastal and shelf science, 19(1),
15-25.
Buresh, R.J. and Patrick, W.H. (1981). Nitrate reduction to ammonium and organic nitrogen
in an estuarine sediment. Soil Biology and Biochemistry, 13(4), 279-283.
Burja, A. M., Banaigs, B., Abou-Mansour, E., Burgess, J. G. and Wright, P. C. (2001).
Marine cyanobacteria—a prolific source of natural products. Tetrahedron, 57(46),
9347-9377.
198
Burns, R. G. and Slater, J. H. (1982). Experimental microbial ecology. Blackwell Scientific
Publications. 368-379.
Cabrita, M. T. and Brotas, V. (2000). Seasonal variation in denitrification and dissolved
nitrogen fluxes in intertidal sediments of the Tagus estuary, Portugal. Marine
Ecology Progress Series, 202, 51-65.
Caldwell, G. S., Bentley, M. G. and Olive, P. J. (2003). The use of a brine shrimp (Artemia
salina) bioassay to assess the toxicity of diatom extracts and short chain aldehydes.
Toxicon, 42(3), 301-306.
Carballo, J. L., Hernández, -I., Z. L., Pérez, P. and García, -G., M. D. (2002). A comparison
between two brine shrimp assays to detect in vitro cytotoxicity in marine natural
products. BMC biotechnology, 2(1), 1.
Cardona, P. and Botero, L. (1998). Soil characteristics and vegetation structure in a heavily
deteriorated mangrove forest in the Caribbean coast of Colombia. Biotropica, 30(1),
24-34.
Castenholz, R.W. (2001) Phylum BX. Cyanobacteria. Oxygenic photosynthetic bacteria. In:
Bergey’s manual of systematic bacteriology, Boone, D. R., Castenholz, R. W.,
Garrity, G. M. (Eds.). Springer, New York, 474–487.
Cerón-Bretón, J.G., Cerón, -B., R.M., Rangel, -M., M., Murielgarcia, M., Cordova, -Q.,
A.V. and Estrella, -C., A. (2011). Determination of carbon sequestration rate in soil
of a mangrove forest in Campeche, Mexico. WSEAS Transactions on. Environment
and Development, 7(2), 55-64.
Chaghtai, F. and Saifullah, S.M. (1992) First recorded bloom of Navicula Bory in a
mangrove habitat of Karachi. Pakistan Journal of Marine Sciences, 1(2), 139-140.
Chan, M.W.H., Ibrahim, M., Saeed, Q., Siddiqui, P.J.A., Zafar, U. and Rasheed, M. (2016,
January). Antimicrobial activity of mangrove extracts against multi-drug resistant
(MDR) strains. Poster presented at the 14th National and 5th International Conference
of Botany, University of Karachi, Pakistan.
199
Chandran, R. and Ramamoorthy, K. (1984). Hydrobiological studies in the gradient zone of
the Vellar estuary-nutrients. Mahasagar bulletin of the National Institute of
Oceanography, 17, 133-140.
Chapman, M.G. and Tolhurst, T.J. (2007). Relationships between benthic macrofauna and
biogeochemical properties of sediments at different spatial scales and among
different habitats in mangrove forests. Journal of Experimental Marine Biology and
Ecology, 343(1), 96-109.
Chaudhuri, A. B. (2007). Biodiversity of mangroves. Daya Books, India.
Chen, G.C., Tam, N.F. and Ye, Y. (2012). Spatial and seasonal variations of atmospheric N2
O2 and CO2 fluxes from a subtropical mangrove swamp and their relationships with
soil characteristics. Soil Biology and Biochemistry, 48, 175-181.
Chen, R. and Twilley, R.R. (1999a). Patterns of mangrove forest structure and soil nutrient
dynamics along the Shark River estuary, Florida. Estuaries, 22(4), 955-970.
Chen, R., and Twilley, R. R. (1999b). A simulation model of organic matter and nutrient
accumulation in mangrove wetland soils. Biogeochemistry, 44(1), 93-118.
Chenl, Y. and Celia, D. G. (1994). Effects of pH on the growth and carbon uptake of marine
phytoplankton. Department of Biological Sciences, Dartmouth College, Hanover,
New Hampshire, 3755, 83-94.
Cherif, M. and Loreau, M. (2009). When microbes and consumers determine the limiting
nutrient of autotrophs: a theoretical analysis. Proceedings of the Royal Society of
London B: Biological Sciences, 276(1656), 487-497.
Chiozzini, V. G., Agostinho, K. L., Delfim, R. and Braga, E. D. S. (2014). Tide influence on
hydrochemical parameters in two coastal regions of Sao Paulo (Brazil) under
different environmental occupations. In: Proceedings of Safety, Health and
Environment World Congress 10, 1-4.
Cintron, G., Lugo A. E., Martínez, R. and Correa A. (1985). Structural and functional
properties of mangrove forests. In: The botany and natural history of Panama, La
botánica e historia natural de Panamá, D’Arcy, W.G. and Correa M.D.A (Eds.). 53-
66. Monographs in systematic botany from the Missouri Botanical Garden, USA.
200
Cleveland, J., Montville, T. J., Nes, I. F. and Chikindas, M. L. (2001). Bacteriocins: safe,
natural antimicrobials for food preservation. International journal of food
microbiology, 71(1), 1-20.
Cole, C. V., and Sanford, R. L. (1989). Biological aspects of the Phosphorus cycle. In:
Proceedings and symposium on phosphorous requirements for sustainable
agriculture in Asia and Oceania, SCOPE/UNEP.
Cole, J.K., Hutchison, J.R., Renslow, R.S., Kim, Y.M., Chrisler, W.B., Engelmann, H.E.,
Dohnalkova, A.C., Hu, D., Metz, T.O., Fredrickson, J.K. and Lindemann, S.R.
(2014). Phototrophic biofilm assembly in microbial-mat-derived unicyanobacterial
consortia: model systems for the study of autotroph-heterotroph interactions.
Frontiers in microbiology, 5(109): 1-18.
Cowan JLW. and Boynton, W.R. (1996) Sediment-water oxygen and nutrient exchanges
along the longitudinal axis of Chesapeake Bay: seasonal patterns, controlling factors
and ecological significance. Estuaries, 19, 562-580.
Craft, C.B., Seneca, E.D. and Broome, S.W. (1991). Loss on ignition and Kjeldahl digestion
for estimating organic carbon and total nitrogen in estuarine marsh soils. Estuaries,
14, 175–179.
Cuadrado, D.G., Carmona, N.B. and Bournod, C. (2011). Biostabilization of sediments by
microbial mats in a temperate siliciclastic tidal flat, Bahia Blanca estuary
(Argentina). Sedimentary Geology, 237(1), 95-101.
Dagar, J. C. (1995). Characteristics of halophytic vegetation in India. In: Biology of salt
tolerant plants, Khan, M.A. and Ungar, I.A.(Eds), University of Karachi, Pakistan,
255-276.
Dahms, H.-U., Xu, Y. and Pfeiffer, C. (2006). Antifouling potential of cyanobacteria: a
minireview. Biofouling, 22, 317–327.
Damhoureyeh, S.A. and Ghalib, S.A. (2014). An overview of the status and distribution of
the mangrove forests and their wildlife in Sindh. Canadian Journal of Pure and
Applied Sciences, 8(3), 3051-3055.
201
Danielsen, F., Sørensen, M.K., Olwig, M.F., Selvam, V., Parish, F., Burgess, N.D., Hiraishi,
T., Karunagaran, V.M., Rasmussen, M.S., Hansen, L.B. and Quarto, A. (2005). The
Asian tsunami: a protective role for coastal vegetation. Science (Washington),
310(5748), 643.
Das Sarma, S. And Arora, P. (1997). Genetic analysis of the gas vehicle gene cluster in
haloarchaea. FEMS Microbiology Letters. 153, 1-10.
Davis, III S.E., Childers, D.L., Day, J.W., Rudnick, D.T. and Sklar, F.H. (2001). Wetland-
water column exchanges of carbon, nitrogen, and phosphorus in a Southern
Everglades dwarf mangrove. Estuaries, 24, 610-622.
Davis, S. E., Childers, D. L., Day, J. W., Rudnick, D. T. and Sklar, F. H. (2001). Nutrient
dynamics in vegetated and unvegetated areas of a southern Everglades mangrove
creek. Estuarine, Coastal and Shelf Science, 52(6), 753-768.
Decho, A.W., Hummon, D. and Fleeger, J.W. (1985). Meiofauna-sediment interactions
around subtropical seagrass sediments using factor analysis. Journal of Marine
Research, 43, 237-255.
Delfino, D. O., Wanderley, M. D., Silva, L. H. S., Feder, F. and Lopes, F. A. (2012).
Sedimentology and temporal distribution of microbial mats from Brejo do Espinho,
Rio de Janeiro, Brazil. Sedimentary Geology, 263, 85-95.
Depommier, D. (2003). The tree behind the forest: ecological and economic importance of
traditional agroforestry systems and multiple uses of trees in India. Tropical Ecology,
44(1), 63-71.
Dittmar, T. and Lara, R. J. (2001a). Do mangroves rather than rivers provide nutrients to
coastal environments south of the Amazon River? Evidence from long-term flux
measurements. Marine ecology Progress series, 213, 67-77.
Dittmar, T. and Lara, R.J., (2001b). Driving forces behind nutrient and organic matter
dynamics in a mangrove tidal creek in North Brazil. Estuarine, Coastal and Shelf
Science, 52(2), 249-259.
Dittmar, T., Hertkorn, N., Kattner, G., and Lara, R.J. (2006). Mangroves, a major source of
dissolved organic carbon to the oceans. Global Biogeochemical Cycles, 20, 1-7.
202
doi, 10.2112/JCOASTRES-D-15-00059.1.
Doran, J. W., Elliott, E. T. and Paustian, K. (1998). Soil microbial activity, nitrogen cycling,
and long-term changes in organic carbon pools as related to fallow tillage
management. Soil and Tillage Research, 49(1), 3-18.
Duke, N.C. (1992). Mangrove floristics and biogeography. In: Tropical Mangrove,
Robertson, A.I. and Alongi, D.M. (Eds.). 63-100. Ecosystems, American
Geophysical Union, Washington DC., USA
Dunlap, W.C., Battershill. C.N., Liptrot, C.H., Cobb, R.E., Bourne, D.G., Jaspars, M., Long,
P.F. and Newman, D.J. (2007) Biomedicinals from the phytosymbionts of marine
invertebrates: A molecular approach. Methods, 42(4), 358-376.
Durranee, J., Hasnain, S.A. and Ahmad, E. (2008). Observations On the Birds of
Sandspit/Hawkes Bay Coastal Wetland Complex, Karachi Coast. Pakistan Journal of
Zoology, 40(4), 229-237).
Elayaraja, S., Annamalai, N., Mayavu, P. and Balasubramanian, T. (2014). Production,
purification and characterization of bacteriocin from Lactobacillus murinus AU06
and its broad antibacterial spectrum. Asian Pacific Journal of Tropical Biomedicine,
4(3), 5-11.
Elser, J.J., Bracken, M.E., Cleland, E.E., Gruner, D.S., Harpole, W.S., Hillebrand, H., Ngai,
J.T., Seabloom, E.W., Shurin, J.B. and Smith, J.E. (2007). Global analysis of
nitrogen and phosphorus limitation of primary producers in freshwater, marine and
terrestrial ecosystems. Ecology letters, 10(12), 1135-1142.
Engene, N., Paul, V. J., Byrum, T., Gerwick, W. H., Thor, A. and Ellisman, M. H. (2013).
Five chemically rich species of tropical marine cyanobacteria of the genus Okeania
gen. nov.(Oscillatoriales, Cyanoprokaryota). Journal of phycology, 49(6), 1095-
1106.
Ensign, S. H., Hupp, C. R., Noe, G. B., Krauss, K. W. and Stagg, C. L. (2014). Sediment
accretion in tidal freshwater forests and oligohaline marshes of the Waccamaw and
Savannah Rivers, USA. Estuaries and Coasts, 37(5), 1107-1119.
203
Facca, C., and Sfriso, A. (2007). Epipelic diatom spatial and temporal distribution and
relationship with the main environmental parameters in coastal waters. Estuarine,
Coastal and Shelf Science, 75(1), 35-49.
Faheem, F., Saeed, S. A. D. I. A. and Rasool, S. A. (2007). Studies on brevicin AF01: a
bacteriocin like inhibitory substance active against methicillin resistant
Staphylococcus aureus. Pakistan Journal of Botany, 39(4), 1293.
Fan, L. F., Shieh, W. Y., Wu, W. F. and Chen, C. P. (2006). Distribution of nitrogenous
nutrients and denitrifiers strains in estuarine sediment profiles of the Tanshui River,
northern Taiwan. Estuarine, Coastal and Shelf Science, 69(3), 543-553.
FAO. (2007). The world’s mangrove 1980-2005. FAO forestry paper No. 153. Rome.
Farooq, S. (2010). Distribution of order Hymenoptera in mangrove forests near Karachi,
Pakistan. Pakistan Journal of Entomology, 25(2), 87-90.
Farooq, S., and Siddiqui, P. J. A. (2011). Distribution of chlorophyll in the mangrove
sediments of Sonmiani bay, Pakistan. Pakistan Journal of Botany, 43(1), 405-410.
Farooqui, Z. (2012). Studies on Mangrove ecosystem with respect to Biodiversity,
Productivity and Nutrient dynamics (Doctoral Thesis). Institute of Marine Sciences,
University of Karachi, Karachi, Pakistan.
Farooqui, Z., Shafique, S., Khan, K. L., Ali, A., Iqbal, P. and Siddiqui, P. J. A. (2012).
Assessment of litter production in semi-arid mangroves forests near active Indus
River mouth (Hajambro creek) and Karachi backwaters, Pakistan. Pakistan Journal
of Botany, 44(5), 1763-1768.
Farooqui, Z., Siddiqui, P. J. A. and Rasheed, M. (2014). Changes in Organic, Inorganic
contents, Carbon Nitrogen ratio in decomposing Avicennia marina and Rhizophora
mucronata leaves on tidal mudflats in Hajambro creek, Indus delta, Pakistan.
Journal of Tropical Life Science, 4(1), 37-45.
Fernandes, S. O., Bonin, P. C., Michotey, V. D., Garcia, N. and Loka, B., P. A. (2012).
Nitrogen-limited mangrove ecosystems conserve N through dissimilatory nitrate
reduction to ammonium. Scientific reports, 2, 419.
204
Field, C.D. (1998). Rehabilitation of mangrove ecosystems: an overview. Marine Pollution
Bulletin, 37, 383-392.
Finney, D.J. (1971). Probit analysis (3rd edition). Cambridge University Press.
Fong, R.M.D.P. and Zedler, J. B. (1993). Competition with macroalgae and benthic
cyanobacterial mats limits phytoplankton abundance in experimental microcosms.
Marine Ecology Progress Series, 100, 97-102.
Francis, C. A., Beman, J. M. and Kuypers, M. M. (2007). New processes and players in the
nitrogen cycle: the microbial ecology of anaerobic and archaeal ammonia oxidation.
The ISME journal, 1(1), 19-27.
Frazão, B., Martins, R. and Vasconcelos, V. (2010). Are known cyanotoxins involved in the
toxicity of picoplanktonic and filamentous North Atlantic marine cyanobacteria?
Marine drugs, 8(6), 1908-1919.
Friedrich J, Dinkel C, Friedl G, Pimenov N, Wijsman J, Gomoiu M-T, Cociasu A, Popa L.
and Wehrli, B. (2002) Benthic Nutrient Cycling and Diagenetic Pathways in the
North-western Black Sea. Estuarine, Coastal and Shelf Science, 54, 369-383.
Friend, P.L., Lucas, C.H., Holligan, P.M. and Collins, M.B., (2008). Microalgal mediation
of ripple mobility. Geobiology, (6), 70–82.
Furukawa, K., Wolanski, E. and Mueller, H. (1997). Currents and sediment transport in
mangrove forests. Estuarine, Coastal and Shelf Science, 44(3), 301-310.
Gademann, K. and Portmann, C. (2008). Secondary metabolites from cyanobacteria:
complex structures and powerful bioactivities. Current Organic Chemistry, 12(4),
326-341.
Garnier, J., Billen, G., Némery, J. and Sebilo, M. (2010). Transformations of nutrients (N, P,
Si) in the turbidity maximum zone of the Seine estuary and export to the sea.
Estuarine, Coastal and Shelf Science, 90(3), 129-141.
Geis, A., Singh, J. and Teuber, M. (1983). Potential of lactic streptococci to produce
bacteriocin. Applied and Environmental Microbiology, 45(1), 205-211
205
Gerwick, H. W. and Moore, S. B. (2012). Lessons from the past and charting the future of
marine natural products drug discovery and chemical biology. Chemistry and
Biology. 19(1): 85-98.
Ghaderpour, A., Nasori, K. N. M., Chew, L. L., Chong, V. C., Thong, K. L., & Chai, L. C.
(2014). Detection of multiple potentially pathogenic bacteria in Matang mangrove
estuaries, Malaysia. Marine pollution bulletin, 83(1), 324-330.
Ghanbari, M., Rezaei, M., Soltani, M. and Shah-Hosseini, G. (2009). Production of
bacteriocin by a novel Bacillus sp. strain RF 140, an intestinal bacterium of Caspian
Frisian Roach (Rutilus frisii kutum). Iranian Journal of Veterinary Research, 10(3),
267-272.
Ghanbari, M. and Jami, M. (2013). Chp.16: Lactic Acid Bacteria and Their Bacteriocins: A
Promising Approach to Seafood Biopreservation. 381-404, INTECH.
http://dx.doi.org/10.5772/50705
Ghosh, A., Dey, N., Bera, A., Tiwari, A., Sathyaniranjan, K. B., Chakrabarti, K. and
Chattopadhyay, D. (2010). Culture independent molecular analysis of bacterial
communities in the mangrove sediment of Sundarban, India. Saline systems, 6(1), 1.
Ghulam, A., Khalid, J., Rukhsana, A. and Lin, H. (2005). Effects of dietary protein level on
growth and utilization of protein and energy by juvenile mangrove red snapper
(Lutjanus argentimaculatus). Journal of Ocean University of China, 4(1), 49-55.
Giesen, W., Wulffraat, S., Zieren, M., & Scholten, L. (2007). Mangrove guidebook for
Southeast Asia. Mangrove guidebook for Southeast Asia. FAO and Wetlands
International, Rap Publications.
Gill, S., Abid, M. and Azam, F. (2006). Root-induced changes in potential nitrification and
nitrate reductase activity of the rhizospheric soil of wheat (Triticum aestivum L.) and
chickpea (Cicer arietinum L.). Pakistan Journal of Botany, 38(4), 991.
Gilman, E. L., Ellison, J., Duke, N. C. and Field, C. (2008). Threats to mangroves from
climate change and adaptation options: a review. Aquatic botany, 89(2), 237-250.
Gilmour, D. 1990. Holotolerant and holophilic microorganisms. In: Microbiology of extreme
environments, Edwards, C. (Ed.), McGraw-Hill Publishing Company, 147-177.
206
Giri, C., Pengra, B., Zhu, Z., Singh, A. and Tieszen, L. L. (2007). Monitoring mangrove
forest dynamics of the Sundarbans in Bangladesh and India using multi-temporal
satellite data from 1973 to 2000. Estuarine, coastal and shelf science, 73(1), 91-100.
Giri, C., Ochieng, E., Tieszen, L.L., Zhu, Z., Singh, A., Loveland, T., Masek, J. and Duke,
N. (2011). Status and distribution of mangrove forests of the world using earth
observation satellite data. Global Ecology and Biogeography, 20(1), 154-159.
Glick, B. R. (1995). The enhancement of plant growth by free-living bacteria. Canadian
Journal of Microbiology, 41(2), 109-117.
Golubic, S. (1994). The continuing importance of cyanobacteria. In: Early Life on Earth,
Bengtson, S. (Ed.). New York: Nobel Symposium 84. Columbia University Press.
334–340.
Golubic, S, Seong-Joo Lee. and Browne, K. (2000). Cyanobacteria: Architects of
sedimentary structures. In: Microbial Sediments, Riding, R and Awramik, S. (Eds.).
Berlin, Heidelberg, New York: Springer-Verlag. 57–67.
Golubic, S., Abed, R. M., Palińska, K., Pauillac, S., Chinain, M. and Laurent, D. (2010).
Marine toxic cyanobacteria: diversity, environmental responses and hazards.
Toxicon, 56(5), 836-841.
Gomezulu, E. S. (2013). Assessment of Nitrogen Nutrients Removal efficiency in
Constructed Mangrove Wetlands. TaJONAS: Tanzania Journal of Natural and
Applied Sciences, 4(2), 656-665.
Gondal, M. A., Saher, N. U. and Qureshi, N. A. (2012). Diversity and biomass distribution
of intertidal fauna in Sonmiani bay (Miani Hor), Balochistan (Pakistan). Egyptian
Journal of Biological Science, 4(1), 219-234.
Gonzalez, -A., B., Bashan, Y., Hernandez-Saavedra, N.Y., Ascencio, F. and De la Cruz-
Agüero, G. (2006). Seasonal seawater temperature as the major determinant for
populations of culturable bacteria in the sediments of an intact mangrove in an arid
region. FEMS Microbiology Ecology, 55(2), 311-321.
GoP. (2007). Pollution in Karachi harbor and areas around Pakistan air force bases in
Karachi. Senate Committee Report, 1-45.
207
Graham, A. (2013). Nitrogen Fixation and The Fate and Turnover of Carbon Fixed Through
Hydrogen-Coupled Carbon Dioxide Fixation in Soybeans (Master’s thesis). Queens
University Kingston, Ontario, Canada.
Graham, J. L., Loftin, K. A., Ziegler, A. C. and Meyer, M. T. (2008). Cyanobacteria in
lakes and reservoirs Toxin and taste and odor sampling guidelines. (ver. 1.0) U.S.
Geological Survey Techniques of Water Resources Investigations Book 9(A7), 7.5.
Grisi, T. And Gorlach, -L., K. (2010). The abundance of some pathogenic bacteria in
mangrove habitats of Paraiba do Norte estuary and crabmeat contamination of
mangrove crab Ucides cordatus. Brazilian archives of biology and technology, 53(1),
227-234.
Grossman, A.R., Lemaux, P.G., Conley, P.B., Bruns, B.U. and Anderson, L.K. (1988).
Characterization of phycobiliprotein and linker polypeptide genes in Fremyella
diplosiphon and their regulated expression during complementary chromatic
adaptation. Photosynthesis Research, 17, 23–56.
Guadrado, D. G., Carmona, N. B. and Bournod, C. (2011). Biostabilization of sediments by
microbial mats in a temperate siliciclastic tidal flat. Bahia Blanca estuary
(Argentina). Sedimentary Geology, 237, 95-101.
Guiry, M.D. and Guiry, G.M. (2016). AlgaeBase. World-wide electronic publication,
National University of Ireland, Galway.
http://www.algaebase.org.
Gulledge, B. M., Aggen, J. B., Huang, H.-B., Nairn, A. C. and Chamberlin, A. R. (2002).
The Microcystins and Nodularins: Cyclic Polypeptide Inhibitors of PP1 and PP2A.
Current Medicinal Chemistry, 9, 1991-2003.
Hall-Stoodley, L., Costerton, J. W. and Stoodley, P. (2004). Bacterial biofilms: from the
natural environment to infectious diseases. Nature reviews microbiology, 2(2), 95-
108.
Hameed, S. (2013). Investigation of the production and isolation of bioactive compounds
from cyanobacteria (Doctoral dissertation). United Kingdom.
http://openair.rgu.ac.uk
208
Hameed, S. (2009). Isolation, identification, screening of toxicity and oligopeptides of some
marine and brackish cyanobacteria from Norwegian and Pakistani waters, in the
search for bioactive natural compounds (Doctoral dissertation). Norway.
Hamilton, L. S., and Snedaker, S. C. (1984). Handbook for mangrove area management.
Han, L., Huang, X.S., Sattler, I., Fu, H.Z., Grabley, S., and Lin, W.H. (2007). Two new
constituents from mangrove Bruguiera gymnorrhiza. Journal of Asian natural
products research, 9(4), 327-331.
Hansen, J. I., Henriksen, K. and Blackburn, T. H. (1981). Seasonal distribution of nitrifying
bacteria and rates of nitrification in coastal marine sediments. Microbial Ecology,
7(4), 297-304.
Hara, S., Hashidoko, Y., Desyatkin, R. V., Hatano, R. and Tahara, S. (2009). High rate of
N2 fixation by East Siberian cryophilic soil bacteria as determined by measuring
acetylene reduction in nitrogen-poor medium solidified with gellan gum. Applied
and environmental microbiology, 75(9), 2811-2819.
Hargrave, B. T. and Connolly, G. F. (1978). A device to collect supernatant water for
measurement of the flux of dissolved compounds across sediment surfaces1.
Limnology and Oceanography, 23(5), 1005-1010.
Harris, E.L. and Angal, S. (1989). Protein purification methods. Oxford University: IRL
Press.
Harrison, P. J., Khan, N., Yin, K., Saleem, M., Bano, N., Nisa, N., Ahmed, S.I., Rizvi, N.
and Azam, F. (1997). Nutrient and Phytoplankton dynamics in two mangrove tidal
creeks of the Indus river delta, Pakistan. Marine ecology Progress series, 157, 13-19.
Hegazi, A. Z., Mostafa, S. S. and Ahmed, H. M. (2010). Influence of different
cyanobacterial application methods on growth and seed production of common bean
under various levels of mineral nitrogen fertilization. Nature and Science, 8(11),
183-194.
Hennig, H.F.O., Eagle, G.A., Fielder, L., Fricke, A.H., Gledhill, W.J., Greenwood, P.J. and
Orren, M.J. (1983). Ratio and population density of psammo littorial meiofauna as a
209
perturbation indicator of sandy beaches in South Africa. Environmental Monitoring
Assess, 3, 45-60.
Hescox, M. A. and Carlberg, D. M. (1972). Photoreactivation in Halobacterium cutirubrum.
Canadian journal of microbiology, 18(7), 981-985.
Hessen, D. O., Ågren, G. I., Anderson, T. R., Elser, J. J. and De Ruiter, P. C. (2004). Carbon
sequestration in ecosystems: the role of stoichiometry. Ecology, 85(5), 1179-1192.
Hietala, J., Reinikainen, M. and Walls, M. (1995). Variation in life history responses of
Daphnia to toxic Microcystis aeruginosa. Journal of Plankton Research, 17, 2307-
2318.
Hillebrand, H., Dürselen, C. D., Kirschtel, D., Pollingher, U. and Zohary, T. (1999).
Biovolume calculation for pelagic and benthic microalgae. Journal of phycology,
35(2), 403-424.
Hisem, D., Hrouzek, P., Tomek, P., Tomšíčková, J., Zapomělová, E., Skácelová, K.,
Lukešová, A. and Kopecký, J. (2011). Cyanobacterial cytotoxicity versus toxicity to
brine shrimp Artemia salina. Toxicon, 57(1), 76-83.
Hoffmann, H., Schloter, M. and Wilke, B. M. (2007). Microscale-scale measurement of
potential nitrification rates of soil aggregates. Biology and Fertility of Soils, 44(2),
411-413.
Hogarth, P.J. (1999). The Biology of Mangroves. Oxford University Press Inc. NY, USA.
Hogarth, P. J. (2015). The biology of mangroves and seagrasses. Oxford University Press
Inc. NY, USA.
Hogue., E.W. and Miller., C.B. (1981). Effects of sediment microtopography on small-scale
spatial distributions of meiobenthic nematodes. Journal of Experimental Marine
Biology and Ecology, 53(2), 181-191.
Hoiczyk, E. and Hansel, A. (2000). Cyanobacterial cell walls: news from an unusual
prokaryotic envelope. Journal of Bacteriology, 182(5), 1191-1199.
Holguin, G., Guzman, M. A. and Bashan, Y. (1992). Two new nitrogen-fixing bacteria from
the rhizosphere of mangrove trees: Their isolation, identification and in vitro
210
interaction with rhizosphere Staphylococcus sp. FEMS Microbiology Letters, 101(3),
207-216.
Holguin, G., Vazquez, P. and Bashan, Y. (2001). The role of sediment microorganisms in
the productivity, conservation, and rehabilitation of mangrove ecosystems: an
overview. Biology and fertility of soils, 33(4), 265-278.
Hong, K., Gao, A.H., Xie, Q.Y., Gao, H.G., Zhuang, L., Lin, H.P., Yu, H.P., Li, J., Yao,
X.S., Goodfellow, M. and Ruan, J.S. (2009). Actinomycetes for marine drug
discovery isolated from mangrove soils and plants in China. Marine drugs, 7(1), 24-
44.
Horincar, V.B., Parfene, G. and Bahrim, G. (2011). Evaluation of bioactive compound in
extracts obtained from three Romanian marine algae species. Romanian
Biotechnological Letters, 16(6): 72-78.
Hosack, G. R., Dumbauld, B. R., Ruesink, J. L. and Armstrong, D. A. (2006). Habitat
associations of estuarine species: comparisons of intertidal mudflat, seagrass
(Zostera marina), and oyster (Crassostrea gigas) habitats. Estuaries and Coasts,
29(6), 1150-1160.
Hossain, M.Z., Aziz, C.B. and Saha, M.L. (2012). Relationships between soil physico-
chemical properties and total viable bacterial counts in Sunderban mangrove forests,
Bangladesh. Dhaka University Journal of Biological Sciences, 21(2), 169-175.
Hotel, W. T. (1995). Ecology and management of mangrove restoration and regeneration in
East and Southeast Asia. Proceedings of the Ecotone IV, 18, 22.
Hou, L.J., Liu, M., Xu, S.Y., Ou, D.N., Yu, J., Cheng, S.B., Lin, X. and Yang, Y. (2007).
The effects of semi-lunar spring and neap tidal change on nitrification, denitrification
and N 2 O vertical distribution in the intertidal sediments of the Yangtze estuary,
China. Estuarine, Coastal and Shelf Science, 73(3), pp.607-616.
Hussain, M., Khan, M. T., Wajid, A. and Rasool, S. A. (2008). Technological
characterization of indigenous enterococcal population for probiotic potential.
Pakistan Journal of Botany, 40(867), e75.
211
Hwang, Y.H. and Chen, S.C., (2001). Effects of ammonium, phosphate, and salinity on
growth, gas exchange characteristics, and ionic contents of seedlings of mangrove
Kandelia candel (L.) Druce. Botanical Bulletin of Academia Sinica, 42, 131-139.
Ilyas, M. and Siddiqui, S.A. (1989). Inorganic constituents of mangrove leave Avicennia
marina from Karachi coast. Turkish Journal of Agriculture and Forestry, 13I, 595-
599.
Indus for All Program (IFAP). (2008). Mangroves of Pakistan. WWF- Pakistan, Karachi,
16.
Ishida, K., Matsuda, H., Murakami, M. and Yamaguchi, K. (1997) Kawaguchipetin B, an
antibacterial cyclic undecapeptide from the cyanobacterium Microcystis aeruginosa.
Journal of Natural Products, 60, 724-726.
Islam, M.S.N. (2007). Cultural Landscape Changing due to Anthropogenic Influences on
Surface Water and Threats to Mangrove Wetland Ecosystems: A Case Study on the
Sundarbans, Bangladesh. (Doctoral Thesis).
Isnansetyo, A., Thien, N. D., Seguchi, M., Koriyama, M. and Koga, A. (2011). Nitrification
Potential of Mud Sediment of the Ariake Sea Tidal Flat and the Individual Effect of
Temperature, pH, Salinity and Ammonium Concentration on its Nitrification Rate.
Research Journal of Environmental and Earth Sciences, 3(5), 587-599.
IUCN. (2007). The economic costs of upstream freshwater flow loss: Indus Delta. 6-7.
Islamic Republic of Pakistan Country Environment Analysis, Asian Development
Bank.
Ivanova, I., Kabadjova, P., Pantev, A., Danova, S. and Dousset, X. (2000). Detection,
purification and partial characterization of a novel bacteriocin substance produced by
Lactococcus lactis subsp. lactis B14 isolated from boza-Bulgarian traditional cereal
beverage. Biocatalysis, 41(6), 47-53.
Jabeen, N., Gul, H., Subhan, S.A., Hussain, M., Ajaz, M. and Rasool, S.A. (2009).
Biophysicochemical characterization of bacteriocins (S) from indigenously isolated
Agrobacterium radiobacter NA6. Pakistan Journal of Botany, 41(6), 3227-3237.
212
Jaiswal, P., Singh, P. K. and Prasanna, R. (2008). Cyanobacterial bioactive molecules-an
overview of their toxic properties. Canadian Journal of Microbiology, 54(9), 701-
717.
Jalal, K. C. A., UT, N. F., Mardiana, M. A., Shahbudin, S. and Omar, M. N. (2010).
Antibiotic resistance microbes in tropical mangrove sediments in east coast
peninsular, Malaysia. African Journal of Microbiology Research, 4(8), 640-645.
Jamil, K., Abbas, G., Akhtar, R., Lin, H. and Li, Z. (2007). Effects of replacing fishmeal
with animal by-products meal supplementation in diets on the growth and nutrient
utilization of mangrove red snapper. Journal of Ocean University of China, 6(3),
292-298.
Jamil, N., Erum, A., Ahmed, N., Yasmeen, S. and Ahmed, V.U. (1999). Biodiversity:
Characterization of bacteria isolated from marine environment. In: Aquatic
biodiversity of Arabian Sea, Qazmi, Q.B. (Ed.). University Press, Karachi. 77-85.
Jansen, D.H. (1985). Mangroves, where is the understory? Journal of Tropical Ecology, 1,
89-92.
Jayaraman, G., Rajesh, D. and Karthikeyan, S. (2012). Isolation and partial characterization
of a new bacteriocin from Bacillus pumilus DR2 isolated from seawater. CIBTech.
Journal of Microbiology, 133-41.
Jennerjahn, T. C., and Ittekkot, V. (2002). Relevance of mangroves for the production and
deposition of organic matter along tropical continental margins.
Naturwissenschaften, 89(1), 23-30.
Jensen, P.R. and Fenical, W. (1994). Strategies for the discovery of secondary metabolites
from marine bacteria: Ecological perspectives. Annual Review of Microbiology, 48,
559-584.
Kathiresan, K. and Bingham, B. L. (2001). Biology of mangroves and mangrove
ecosystems. Advances in marine biology, 40, 81-251.
Kelecom, A. (2002). Secondary metabolites from marine microorganisms. Anais da
Academia Brasileira de Ciências, 74(1), 151-170.
213
Khalil, S. (1999). Economic valuation of the mangrove ecosystem along the Karachi coastal
areas. The Economic Value of the Environment: Cases from South Asia. Published by
IUCN.
Khalil, S. (2000). The economic valuation methods of environment: Application to
mangrove ecosystem (products) along Karachi coastal areas. Pakistan Economic and
Social Review, 16-46.
Khan, A. M., Ameen, M., Naz, S. and Noureen, S. (2012). Bio screening of marine
organisms from the coasts of Pakistan. Journal of the Chemical Society of Pakistan,
34(1), 184-194.
Khan, A. U. (1998). Industrial operations and interaction with ecology: the case of Pakistan.
Forest, 3, 4-3.
Khan, F., Adnan, M. Y. and Aziz, I. (2016). Metabolic implications of salt induced osmolyte
accumulation in avicennia marina. Pakistan Journal of Botany, 48(1), 29-36.
Khan, M. A., Saifullah, S. M., Qureshi, N., Shaukat. S. and Chaghtai, F. (1999). Population
Structure and a Pattern of the Gastropod Potámides cingulatus (Gmelin) in a
Mangrove Habitat of Karachi, Pakistan. Pakistan Journal of Biological Sciences,
2(1), 178-181.
Khan, M. A. and Aziz, I. (2001). Salinity tolerance in some mangrove species from
Pakistan. Wetlands Ecology and Management, 9(3), 229-233.
Khan, M. S. (1999). Herpetology of habitat types of Pakistan. Pakistan journal of zoology,
31(3), 275-289.
Khan, S. H. and Saleem, M. (1988). A preliminary study of Pollution in Karachi Harbour.
Marine Science of the Arabian Sea, Thompson, M.F. and Tirmizi, N.M. (Eds.).
American Institute of Biological Sciences, Washington, DC, 539-548.
Khanam, S., Mustaquim, J. and Ayub, Z. (2014). Study of the Seasonal Abundance and
Occurrence of Macrobenthic Crustaceans in Mangrove Swamps of Sandspit
Backwaters, Karachi. International Journal of Biological Research, 2(2), 147-152.
214
Kim, J. D. and Lee, C. G. (2006). Diversity of heterocystous filamentous cyanobacteria
(blue-green algae) from rice paddy fields and their differential susceptibility to ten
fungicides used in Korea. Journal of microbiology and biotechnology, 16(2), 240-
246.
Kim, J.-D. (2006). Screening of cyanobacteria (blue-green algae) from rice paddy soil for
antifungal activity against plant pathogenic fungi. Mycrobiology. 34(3): 138-142.
Kimura, H., Matsusaki, H., Sashihara, T., Sonomoto, K. and Ishizaki, A. (1998). Purification
and partial identification of bacteriocin ISK-1, a new lantibiotic produced by
Pediococcus sp. ISK-1. Bioscience, biotechnology and biochemistry, 62(12), 2341-
2345
Kirwan, M. L. and Mudd, S. M. (2012). Response of salt-marsh carbon accumulation to
climate change. Nature, 489(7417), 550-553.
Kitheka, J. U., Ongwenyi, G. S. and Mavuti, K. M. (2002). Dynamics of suspended
sediment exchange and transport in a degraded mangrove creek in Kenya. AMBIO: A
Journal of the Human Environment, 31(7), 580-587.
Klaenhammer, T. R. (1988). Bacteriocins of lactic acid bacteria. Biochimie, 70(3), 337-349.
Klaenhammer, T. R. (1993). Genetics of bacteriocins produced by lactic acid bacteria.
FEMS microbiology reviews, 12(1-3), 39-85.
Klemedtsson, L., Berg, P., Clarholm, M., Schnürer, J. and Rosswall, T. (1987). Microbial
nitrogen transformations in the root environment of barley. Soil Biology and
Biochemistry, 19(5), 551-558.
Komárek, J. (1992). Diversita a moderní klasifikace sinic (Cyanoprocaryota) (Doctoral
dissertation), University of Trebon, Trebon, Czech Republic.
Komárek, J. and Anagnostidis, K. (1999). Cyanoprokaryota. 1. Chroococcales. In:
Süßwasserflora von Mitteleuropa. Begründet von A. Pascher. Band 19/1, Ettl, H.,
Gärtner, G., Heynig, H. and Mollenhauer, D. (Eds.). Heidelberg and Berlin:
Spektrum, Akademischer Verlag, 1-548.
215
Komárek, J. and Anagnostidis, K. (2005). Cyanoprokaryota: 2. Teil/2nd Part:
Oscillatoriales. In: Süsswasserflora von Mitteleuropa 19/2. München, Büdel, B., L.
Krienitz, G. Gärtner and Schagerl, M. (Eds.). Elsevier Spektrum Akademischer
Verlag, 1-759.
Komárek, J. and Hauer, T. (2013). On-line database of cyanobacterial genera. Word-wide
electronic publication, University of South Bohemia and Institute of Botany AS CR
http:// Cyanodb.cz/
Koop-Jakobsen, K. and Giblin, A. E. (2009). Anammox in tidal marsh sediments: the role of
salinity, nitrogen loading, and marsh vegetation. Estuaries and coasts, 32(2), 238-
245.
Krishnan, K. P., Fernandes, S. O., Chandan, G. S., and Bharathi, P. L. (2007). Bacterial
contribution to mitigation of iron and manganese in mangrove sediments. Marine
pollution bulletin, 54(9), 1427-1433.
Krishnan, K. P. and Bharathi, P. L. (2009). Organic carbon and iron modulate nitrification
rates in mangrove swamps of Goa, south west coast of India. Estuarine, Coastal and
Shelf Science, 84(3), 419-426.
Kristensen, E., Jensen, M. H., Banta, G. T., Hansen, K., Holmer, M. and King, G. M.
(1998). Transformation and transport of inorganic nitrogen in sediments of a
southeast Asian mangrove forest. Aquatic microbial ecology, 15(2), 165-175.
Kristensen, E., Andersen, F. Ø., Holmboe, N., Holmer, M. and Thongtham, N. (2000).
Carbon and nitrogen mineralization in sediments of the Bangrong mangrove area,
Phuket, Thailand. Aquatic Microbial Ecology, 22(2), 199-213.
Kristensen, E. and Alongi, D.M. (2006). Control by fiddler crabs (Uca vocans) and plant
roots (Avicennia marina) on carbon, iron and sulfur biogeochemistry in mangrove
sediment. Limnology and Oceanography, 51, 1557–1571.
Kristensen, E. (2008). Mangrove crabs as ecosystem engineers; with emphasis on sediment
processes. Journal of sea Research, 59(1), 30-43.
216
Kromkamp, J. (1987). Formation and functional-significance of storage products in
cyanobacteria. New Zealand Journal of Marine and Freshwater Research, 21, 457–
465.
Laemmli, U.K. (1970). Cleavage of structural proteins during the assembly of the head of
bacteriophage T4. Nature, 227, 680-685.
Larsen, A.G., Vogensen, F.K., and Josephsen, J. (1993). Antimicrobial activity of lactic acid
bacteria isolated from sour doughs: purification and characterization of bavaricin A,
a bacteriocin produced by Lactobacillus bavaricus MI401. Journal of Applied
Bacteriology, 75(2), 113-122.
Laslett, G. M., Clark, R. and Jones, G. J. (1997). Estimating the precision of filamentous
blue-green algae cell concentration from a single sample, Environmetrics, 8(4): 313-
339.
Latif, S., Ayub, Z. and Siddiqui, G. (2013). Seasonal variability of phytoplankton in a
coastal lagoon and adjacent open sea in Pakistan. Turkish Journal of Botany, 37(2),
398-410.
Lauerman, L.H., Hoerr, F.J., Sharpton, A.R., Shah, S.M., and Santen, -V.V.L. (1993).
Development and application of a polymerase chain reaction assay for Mycoplasma
synoviae. Avian Diseases, 829-834.
Lee, K.H., Jun, K.D., Kim, W.S. and Paik, H.D. (2001). Partial characterization of
polyfermenticin SCD, a newly identified bacteriocin of Bacillus polyfermenticus.
Letters in Applied Microbiology, 32, 146-151.
Lee, L.H., Zainal, N., Azman, A.S., Eng, S.K., Goh, B.H., Yin, W.F., Ab Mutalib, N.S. and
Chan, K.G. (2014). Diversity and antimicrobial activities of actinobacteria isolated
from tropical mangrove sediments in Malaysia. The Scientific World Journal, 1-14.
Lee, R. Y., Porubsky, W. P., Feller, I. C., McKee, K. L. and Joye, S. B. (2008). Porewater
biogeochemistry and soil metabolism in dwarf red mangrove habitats (Twin Cays,
Belize). Biogeochemistry, 87(2), 181-198.
Lee, S. Y. (1990). Primary productivity and particulate organic matter flow in an estuarine
mangrove-wetland in Hong Kong. Marine Biology, 106(3), 453-463.
217
Lee, S.Y. (2008). Mangrove macrobenthos, assemblages, services, and linkages. Journal of
Sea Research, 59(1), 16-29.
Levin, L.A., Boesch, D.F., Covich, A., Dahm, C., Erséus, C., Ewel, K.C., Kneib, R.T.,
Moldenke, A., Palmer, M.A., Snelgrove, P. and Strayer, D. (2001). The function of
marine critical transition zones and the importance of sediment biodiversity.
Ecosystems, 4(5), 430-451.
Ley, R.E., Harris, J.K., Wilcox, J., Spear, J.R., Miller, S.R., Bebout, B.M., Maresca, J.A.,
Bryant, D.A., Sogin, M.L. and Pace, N.R. (2006). Unexpected diversity and
complexity of the Guerrero Negro hypersaline microbial mat. Applied and
Environmental Microbiology, 72(5), 3685-3695.
Long, H., Xiang, W., Zhuang, T. and Lin, P. (2005). Microorganism resource of mangrove
ecosystems. Chinese journal of ecology, 24(6), 696-702.
Lopes, V. R., Fernández, N., Martins, R. F. and Vasconcelos, V. (2010). Primary screening
of the bioactivity of brackishwater cyanobacteria: Toxicity of crude extracts to
Artemia salina larvae and Paracentrotus lividus embryos. Marine drugs, 8(3), 471-
482.
Lourey, M. J., Alongi, D. M., Ryan, D. A. J. and Devlin, M. J. (2001). Variability of nutrient
regeneration rates and nutrient concentrations in surface sediments of the northern
Great Barrier Reef shelf. Continental Shelf Research, 21(2), 145-155.
Lovelock, C.E., Feller, I.C., McKee, K.L. and Thompson, R. (2005). Variation in mangrove
forest structure and sediment characteristics in Bocas del Toro, Panama. Caribbean
Journal of Science, 41(3), 456-464.
Lovelock, C.E. and Feller, I.C. (2003). Photosynthetic performance and resource utilization
of two mangrove species coexisting in a hypersaline scrub forest. Oecologia, 134,
455-462.
Lugo, A. E. and Snedaker, S. C. (1974). The ecology of mangroves. Annual review of
ecology and systematics, 39-64.
Luo, Z., Qiu, Z., Wei, Q., Du, L.G., Zhao, Y. and Yan, C. (2014). Dynamics of ammonia -
oxidizing archaea and bacteria in relation to nitrification along simulated dissolved
218
oxygen gradient in sediment–water interface of the Jiulong river estuarine wetland,
China. Environmental Earth Sciences, 72(7), 2225-2237.
Luther, D. A. and Greenberg, R. (2009). Mangroves: a global perspective on the evolution
and conservation of their terrestrial vertebrates. BioScience, 59(7), 602-612.
Mackey, A.P. and Smail, G. (1995). Spatial and temporal variation in litter fall of Avicennia
marina (Forssk) vierh in the Brisbane-River, Queensland, Australia. Aquatic Botany,
52, 133-142.
Macnae, W. and Kalk, M. (1962). The Ecology of the Mangrove Swamps at Inhaca Island,
Moξ̧ambique. The Journal of Ecology, 19-34.
Macnae, W. (1969). A general account of the fauna and flora of mangrove swamps and
forests in the Indo-West-Pacific region. Advances in marine biology, 6, 73-270.
Macura, J. and Stotzky, G. (1980). Effect of montmorillonite and kaolinite on nitrification in
soil. Folia microbiologica, 25(2), 90-105.
Magalhães, C. M., Joye, S. B., Moreira, R. M., Wiebe, W. J. and Bordalo, A. A. (2005).
Effect of salinity and inorganic nitrogen concentrations on nitrification and
denitrification rates in intertidal sediments and rocky biofilms of the Douro River
estuary, Portugal. Water Research, 39(9), 1783-1794.
Mandal, B., Vlek, P. L. G. and Mandal, L. N. (1999). Beneficial effects of blue-green algae
and Azolla, excluding supplying nitrogen, on wetland rice fields: a review. Biology
and Fertility of Soils, 28(4), 329-342.
Mann, F.D. and Steinke, T.D. (1989). Biological nitrogen fixation (acetylene reduction)
associated with green algal (cyanobacterial) communities in the Beachwood
Mangrove Nature Reserve. The effect of environmental factors on acetylene
reduction activity. South African Journal of Botany, 55, 438–444.
Mann, F.G. and Saunders, B.C. (1978). Practical Organic chemistry. 4th edition. Longman,
USA., 491-497.
Mansoor, S.N., Siddiqui, P.J.A., Bano, A. and Zaib-un-Nisa. (2000). Microbial flora
associated with mangroves. In: The Arabian Sea as a source of Biological Diversity,
219
Ahmed, V.U. (Ed.). Proceedings of the National O.N.R. Symposium. H.E.J. Institute
of Chemistry, University of Karachi, 157-164.
Mao, B., Li, D., Zhao, J., Liu, X., Gu, Z., Chen, Y.Q., Zhang, H. and Chen, W. (2014). In
vitro fermentation of lactulose by human gut bacteria. Journal of agricultural and
food chemistry, 62(45), 10970-10977.
Marchand, C., Elisabeth L., and Baltzer F. (2003). The composition of sedimentary organic
matter in relation to the dynamic features of the mangrove-fringed coast in French
Guiana. Estuarine, Coastal and Shelf Science, 56, 119-130.
Marchand, C., Baltzer, F., Lallier-Vergès, E. and Albéric, P. (2004). Pore-water chemistry in
mangrove sediments, relationship with species composition and developmental
stages (French Guiana). Marine Geography, 208, 361-381.
Marshall, K.C. (1976). Interfaces in microbial ecology. HUP, Cambridge, Mass., USA.
Martins, M., Taborda, R., Silva, G., Assunção, A., Matos, A. P. and Costa, M. C. (2012).
Aluminum and sulphate removal by a highly Al-resistant dissimilatory sulphate-
reducing bacteria community. Biodegradation, 23(5), 693-703.
Martins, R.F., Ramos, M., Herfindal, L., Sousa, J.A., Skarven K. and Vasconcelos V.M.
(2008). Antimicrobial and cytotoxic Assessment of Marine cyanobacteria
Synechocystis and Synechococcus. Marine Drugs, 6, 1-11.
Mathys, S., Ah, -V., U., Lacroix, C., Staub, E., Mini, R., Cereghetti, T. and Meile, L. (2007).
Detection of the pediocin gene pedA in strains from human faeces by real-time PCR
and characterization of Pediococcus acidilactici UVA1. BMC biotechnology, 7(1), 1.
Mazda, Y. and Ikeda, Y. (2006). Behavior of the groundwater in a riverine-type mangrove
forest. Wetlands Ecology and Management, 14(6), 477-488.
McLeod, E. and Rodney, S. V. (2006). Managing Mangroves for Resilience to Climate
Change. 64. IUCN, Gland, Switzerland.
Mehdi, F. S. and Saifullah, S. M. (1992). Mangrove fungi of Karachi, Pakistan. Journal of
Islamic Academy of Sciences, 5(1), 24-27.
220
Mehdi, F. S. and Saifullah, S. M. (2000). Species diversity and seasonal occurrence of fungi
on seedlings of Avicennia marina (Forsk.) Vierh. Pakistan Journal of Biological
Sciences, 3(2), 265-268.
Mendelssohn, I. A. and Morris, J. T. (2002). Eco-physiological controls on the productivity
of Spartina alterniflora Loisel. Concepts and controversies in tidal marsh ecology,
59-80.
Meseguer, I. and Rodriguez-Valera, F. (1985). Production and purification of halocin H4.
FEMS microbiology letters, 28(2), 177-182.
Metting, B. and Pyne, J. W. (1986). Biologically active compounds from microalgae.
Enzyme and Microbial Technology, 8(7), 386-394.
Meyer, B.N., Ferrigni, N.R., Putnam, J.E., Jacobsen, L.B., Nichols, D.J. and McLaughlin,
J.L. (1982). Brine shrimp: a convenient general bioassay for active plant
constituents. Planta medica, 45(05), 31-34.
Miles, H., Lesser, W. and Sears, P. (1992). The economic implications of bioengineered
mastitis control. Journal of dairy science, 75(2), 596-605.
Miller-Way, T. and Twilley, R. (1996). Theory and operation of continuous flow systems
for the study of benthic-pelagic coupling. Marine Ecology Progress Series, 140,
257–269.
Miranda, J., Balachandran, K. K., Ramesh, R. and Wafar, M. (2008). Nitrification in Kochi
backwaters. Estuarine, Coastal and Shelf Science, 78(2), 291-300.
Miyachi, S., Iwasaki, I. and Shiraiwa, Y. (2003). Historical perspective on microalgal and
cyanobacterial acclimation to low-and extremely high-CO2 conditions.
Photosynthesis research, 77(2-3), 139-153.
Miyazono, A., Odate, T. and Maita, Y. (1992). Seasonal fluctuations of cell density of
cyanobacteria and other picophytoplankton in Iwanai Bay, Hokkaido, Japan. Journal
of Oceanography, 48(3), 257-266.
221
Moll, R. (2011). Impact of mangroves and an agriculture-dominated hinterland on the
carbon and nutrient biogeochemistry in the Segara Anakan Lagoon, Java, Indonesia
(Doctoral dissertation). Leibniz-Zentrum für Marine Tropenökologie.
Mollendroff, J. W. (2008). Characterization of Bacteriocins produced by lactic acid
bacteria from fermented beverages and optimization of starter cultures (Master’s
Thesis). Stellenbosch University.
Molnar, N., Marchand, C., Deborde, J., Patrona, D.L. and Meziane, T. (2014). Seasonal
pattern of the biogeochemical properties of mangrove sediments receiving shrimp
farm effluents (New Caledonia). Journal of Aquatic Research and Development,
5(5), 1.
Morell, J. M., and Corredor, J. E. (1993). Sediment nitrogen trapping in a mangrove lagoon.
Estuarine, coastal and shelf science, 37(2), 203-212.
Morgulis, A., Coulouris, G., Raytselis, Y., Madden, T. L., Agarwala, R. and Schäffer, A. A.
(2008). Database indexing for production Mega BLAST searches. Bioinformatics,
24(16), 1757-1764.
Morton, T. and L. Steve. (2008). Modern Uses of Cultivated Alga. Ethnobotanical Leaflets.
Southern Illinois University Carbondale, 12-26.
Motta, A.S., and Brandelli, A. (2002). Characterization of an antibacterial peptide produced
by Brevibacterium linens. Journal of Applied Microbiology, 92(1), 63-70.
Mukhtar, I. and Hannan, A. (2012). Constrains on mangrove forests and conservation
projects in Pakistan. Journal of Coastal Conservation, 16(1), 51-62.
Müller, T. and Höper, H. (2004). Soil organic matter turnover as a function of the soil clay
content: consequences for model applications. Soil Biology and Biochemistry, 36(6),
877-888.
Mundt, S., Kreitlow, S., Nowotny, A. and Effmert, U. (2001). Biochemical and
pharmacological investigations of selected cyanobacteria. International Journal of
Hygiene and Environmental Health. 203(4): 327-334.
222
Mundt, S., Kreitlow, S. and Jansen, R.(2003). Oscillatoria redekei HUB 051. Journal of
Applied Phycology, 15(2-3), 263-267.
Mur, L.R., Skulberg, O.M., and Utkilen, H. (1999). Cyanobacteria in the environment. In:
Toxic cyanobacteria in water, Chorus, I., Bartram, J. E and Spon, F. N. (Eds.).
London, UK, 15-40.
Mushtaq, S. and Mustaquim, J. (2009). The Occurrence and Distribution of stalked
barnacles of the genus Octolasmis on the gills of mud or mangrove crab, genus
Scylla. Crustaceana, 82(1), 53-61.
Mustaquim, J., Imtiaz, R. and Sultana, R. (2001). Population Biology and larval morphology
of the edible crab (Scylla serrata) from Karachi backwaters. Pakistan Journal of
Marine Biology, 7, 299-327.
Mwashote, B. M. and Jumba, I. O. (2002). Quantitative aspects of inorganic nutrient fluxes
in the Gazi Bay (Kenya): implications for coastal ecosystems. Marine pollution
bulletin, 44(11), 1194-1205.
Naeem, M. A. H. R. O. S. H., Ilyas, M., Haider, S., Baig, S. and Saleem, M. (2012).
Isolation characterization and identification of lactic acid bacteria from fruit juices
and their efficacy against antibiotics. Pakistan Journal of Botany, 44, 323-328.
Naes, H., Aarnes, H., Utkilen, H. C., Nilsen, S., and Skulberg, O. M. (1985). Effect of
photon fluence rate and specific growth rate on geosmin production of the
cyanobacterium Oscillatoria brevis (Kütz.) Gom. Applied and Environmental
Microbiology, 49(6), 1538.
Nagarkar, S. (2002). Morphology and ecology of new records of cyanobacteria belonging to
the genus Oscillatoria from Hong Kong rocky shores. Botanica marina, 45(3), 274-
283.
Nagelkerken, I., Blaber, S.J.M., Bouillon, S., Green, P., Haywood, M., Kirton, L.G.,
Meynecke, J.-O., Pawlik, J., Penrose, H.M., Sasekumar, A. and Somerfield, P.J.
(2008). The habitat function of mangroves for terrestrial and marine fauna: A review.
Aquatic Botany, 89, 155–185.
223
Nasira, K. and Shahina, F. (2016). Marine nematode fauna from mangrove areas of Pakistan.
International Journal of Phycology and Phycochemistry (Pakistan), 8(2), 213-218.
Nayak, S. and Prasanna, R. (2007). Soil pH and its role in cyanobacterial abundance and
diversity in rice field soils. Applied Ecology and Environmental Research, 5(2), 103-
113.
Naz, F., Qureshi, N. A. and Saher, N. U. (2014). Temporal variations of mesozooplankton
abundance and biomass in the mangrove creek area along the Karachi coast,
Pakistan. Acta Oceanologica Sinica, 33(12), 222-230.
Naz, S. A. and Rasool, S. A. (2013). Isolation, production and characterization of
bacteriocins produced by strains from indigenous environments. Pakistan Journal of
Botany, 45, 261-267.
Nazim, K., Ahmed, M., Khan, M. U., Khan, N., Wahab, M. and Siddiqui, M. F. (2010). An
assessment of the use of Avicennia marina forsk vierh. to reclaim waterlogged and
saline agricultural land. Pakistan Journal of Botany, 42(4), 2423-2428.
Nazim, K. Ahmed, M. O., Shaukat, S. S., Khan, M. U., Rao, T. A., Ali, Q. M. and Sherwani,
S. K. (2012). Distribution and diversity of airborne microflora under mangrove forest
at Sandspit Area Karachi, Pakistan. Science, Technology and Development, 31(4),
305-311.
Nazim, K., Ahmed, M., Shaukat, S. S. and Khan, M. U. (2013). Seasonal variation of litter
accumulation and putrefaction with reference to decomposers in a mangrove forest in
Karachi, Pakistan. Turkish Journal of Botany, 37(4), 735-743.
Nazim, K., Ahmed, M., Shaukat, S. S., Khan, M. U. and Ali, Q. M. (2013). Age and growth
rate estimation of grey mangrove Avicennia marina (Forsk.) Vierh from Pakistan.
Pakistan Journal of Botany, 45(2), 535-542.
Nedwell, D. B. (1994). Dynamic nature of the turnover of organic carbon, nitrogen and
sulphur in the sediments of a Jamaican mangrove forest. Marine Ecology Progress
Series, 110, 223-231.
224
Nedwell, D. B., Blackburn, T. H. and Wiebe, W. J. (1994). Dynamic nature of the turnover
of organic carbon, nitrogen and sulfur in the sediments of a Jamaican mangrove
forest. Marine Ecology Progress Series, 110, 223–231.
Negri, R. M., Montoya, N. G., Carreto, J. I., Akselman, R., Inza, D., Steidinger, K. A.,
Landsberg, J. H., Tomas, C. R. and Vargo, G. A. (2004). Harmful Algae. Harmful
Algae 2002.
Neue, H.U. (1985). Organic matter dynamics in wetland soils. Wetland soils,
Characterization, classification and utilization. International rice research institute,
Los Banos, Laguna, Philippines, 109-122.
Nielsen, L P., Christensen, P. B., Revsbech, N. P., and Sorensen, J. (1990). Denitrification
and photosynthesis in stream sediment studied with micro sensor and whole-core
techniques. Limnology and Oceanography, 35, 1135-1144.
Nixon, S. W., Oviatt, C. A. and Hale, S. S. (1976). Nitrogen regeneration and the
metabolism of coastal marine bottom communities (269-283). University of Rhode
Island, Sea Grant Marine Advisory Service.
Noaman, N. H., Fattah, A., Khaleafa, M. and Zaky, S. H. (2004). Factors affecting
antimicrobial activity of Synechococcus leopoliensis. Microbiological Research,
159(4), 395-402.
Noffke, N., Knoll, A.H. and Grotzinger, J.P. (2002). Sedimentary controls on the formation
and preservation of microbial mats in siliciclastic deposits: a case study from the
Upper Neoproterozoic Nama Group, Namibia. Palaios, 17, 533–544.
Noffke, N. (2010). Geobiology: Microbial mats in sandy deposits from the Archean Era to
today. Springer Science and Business Media, 194.
Noor, N., Shaukat, S.S. and Naseem, S. (2015). Evaluation of Elemental Composition of
Avicennia marina and Associated Soil, Karachi Coast, Pakistan. Journal of Coastal
Research.
Nunes, B. S., Carvalho, F. D., Guilhermino, L. M. and Van Stappen, G. (2006). Use of the
genus Artemia in ecotoxicity testing. Environmental pollution, 144(2), 453-462.
225
Nunnery, J. K., Mevers, E. and Gerwick, W. H. (2010). Biologically active secondary
metabolites from marine cyanobacteria. Current opinion in biotechnology, 21(6),
787-793
Nuzhat A., Jamil N., Khan O.Y., Yasmeen S., Haq Z., Ahmed V. and Rahman A. (2000).
Comercially important products from marine bacteria: Marine Biotechnology.
Proceedings of national ONR symposium on Arabian Sea as a Resource of
Biological Diversity. University of Karachi, Centre of Excellence in Marine Biology,
104-114.
Odate, T., Yanada, M., Castillo, L. V. and Maita, Y. (1990). Distribution of cyanobacteria
and other picophytoplankton in the western North Pacific Ocean, summer 1989.
Journal of the Oceanographical Society of Japan, 46(4), 184-189.
Ogunbanwo, S. T., Sanni, A. I. and Onilude, A. A. (2003). Characterization of bacteriocin
produced by Lactobacillus plantarum F1 and Lactobacillus brevis OG1. African
Journal of Biotechnology, 2(8), 219-227.
Okogwu, I. O. and Alex, U.O. (2008). Cyanobacteria abundance and its relationship to water
quality in the Mid-Cross River floodplain, Nigeria. Revista de biología tropical,
57(1-2), 33-43.
Oliveira, S. S., Abrantes, J., Cardoso, M., Sordelli, D. and Bastos, M. C. F. (1998).
Staphylococcal strains involved in bovine mastitis are inhibited by Staphylococcus
aureus antimicrobial peptides. Letters in applied microbiology, 27(5), 287-291.
Olsson, M. O. and Falkengren-Grerup, U. (2000). Potential nitrification as an indicator of
preferential uptake of ammonium or nitrate by plants in an oak woodland
understorey. Annals of Botany, 85(3), 299-305.
Oseni, O. A. and Ekperigin, M. M. (2013). Isolation and Activity of Alpha Amylase from
Selected Bacteria Strains In the Forest Soil. Global Journal of Bio-Science and
Bioengineering, 2, 17-20.
Ovalle, A. R. C., Rezende, C. E., Lacerda, L. D. and Silva, C. A. R. (1990). Factors
affecting the hydrochemistry of a mangrove tidal creek, Sepetiba Bay, Brazil.
Estuarine, Coastal and Shelf Science 31, 639–650.
226
Özbay, H. (2011). Composition and abundance of phytoplankton in relation to physical and
chemical variables in The Kars River, Turkey. International Journal of Experimental
Botany, 80, 85-92.
Pajdak-Stós, A., Fiakowska, E. and Fyda, J. (2001). Phormidium autumnale (Cyanobacteria)
defense against three ciliate grazer species. Aquatic Microbial Ecology, 23(3), 237-
244.
Panagoula, B., Panayiota, M. and Iliopoulou-Georgudaki, J. (2002). Acute toxicity of TBT
and IRGAROL in Artemia salina. International Journal of Toxicology, 21, 231–233.
Pansu, M. and Gautheyrou J. (2007). Handbook of soil analysis, mineralogical, organic and
inorganic methods. (2ndEd.) SSBM, NY. USA.
Pattanaik, C., Reddy, C. S., Dhal, N. K. and Das, R. (2008). Utilization of mangrove forests
in Bhitarkanika wildlife sanctuary, Orissa. Indian Journal of Traditional Knowledge,
7(4), 598-603.
Pawar, S. T. and Puranik, P. R. (2008). Screening of terrestrial and freshwater halotolerant
cyanobacteria for antifungal activities. World Journal of Microbiology and
Biotechnology, 24(7), 1019-1025.
Pederson, M.F., Nielson, S.L. and Banta, G.T. (2004). Interactions between vegetation and
nutrient dynamics in coastal marine ecosystems: an introduction. In: Estuarine
nutrient cycling: the influence of primary producers, Nielsen,
S.L., Banta, G.T., Pederson, M.F. (Eds.). Kluwer Academic Publishers, 1-16.
Phang, S.M. and W.L. Chu. (1999). University of Malaya, Algae culture Collection, Cata-
logue of Strains. Institute of Post Graduate Studies and Research, University of
Malaya, Kuala Lumpur, Malaysia, 77.
Piccardi, R., Frosini, A., Tredici, M. R. and Margheri, M. C. (2000). Bioactivity in free-
living and symbiotic cyanobacteria of the genus Nostoc. Journal of applied
phycology, 12(3-5), 543-547.
Pierson, B., Oesterle, A. and Murphy, G. L. (1987). Pigments, light penetration, and
photosynthetic activity in the multi-layered microbial mats of Great Sippewissett Salt
Marsh, Massachusetts. FEMS Microbiology Ecology, 3(6), 365-376.
227
Pinckney, J. and Zingmark, R. G. (1993). Biomass and production of benthic microalgal
communities in estuarine habitats. Estuaries, 16(4), 887-897.
Pirzada, Z.A., Nasir, M. and Rasool, S.A. (2000). Bacteriocins of marine bacteria: Activity
spectrum and biochemical characterization. In: Proceedings of National ONR
Symposium On Arabian Sea as a Resource of Biological Diversity, 166-171.
Platas, G., Meseguer, I. And Amils, R. (2002). Purification and biological characterization
of halocin H1 from Haloferax mediterranei M2a. International Microbiology, 5, 15-
19.
Powell. J.E. (2006). Bacteriocins and Bacteriocin Producers in Kefir and Kefir grains
(Master’s Thesis). Department of food Science, Stellenbosch University.
Prabakaran, M. (2011). In vitro antimicrobial potentials of marine Oscillatoria species.
Asian Journal of Plant Science and Research, 1, 58-64.
Prabu, V. A., Rajkumar, M. and Perumal, P. (2008). Seasonal variations in physico-chemical
characteristics of Pichavaram mangroves, southeast coast of India. Journal of
Environmental Biology, 29(6), 945-950.
Prescott, L. M., Harley, J. P. and Klein, D. A. (1998). Microbiology with Microbes in
Motion. (4th ed) McGraw-Hill, U.S.A.
Puyana, M., Acosta, A., Bernal, -S. K., Velásquez, -R. T. and Ramos, F. (2015). Spatial
scale of cyanobacterial blooms in Old Providence Island, Colombian Caribbean.
Universitas Scientiarum, 20(1), 83-105.
Qasim, R., Barkati, S., Siddique, P. J. A. and Ilyas, M. (1986). Biochemical composition of
the mangrove, Avicennia marina, foliage. Pakistan Journal of Scientific and
Industrial Research (Pakistan).
Qureshi, M.T. (1990). Experimental plantation for Rehabilitation of mangrove forests in
Pakistan. First Report. UNDP/UNESCO Regional Projects for Research and its
application to the management of the Mangroves of Asia and the Pacific
(RAS/86/120). Sind Forest Department. Government of Sind, Karachi, Pakistan.
228
Qureshi, M. T. (1996). Significance of the Mangrove Ecosystem for Coastal People in
Pakistan. In: ISME, Mangrove ecosystems Proceedings number 4, Coastal
Ecosystems Unit, IUCN Pakistan, 85.
Qureshi, N.A. and Sultana, R. (1999). Temporal variations in the abundance distribution
and diversity of meiobenthos from the mangrove ecosystem dynamic on the Indus
delta. Sindh forest and wildlife department government of Sindh and world bank.
132-140.
Qureshi, N.A. and Sultana, R. (2001). Textural composition of mangrove sediment in the
Sandspit back water. Pakistan Journal of marine Biology, 7, 343-355.
Qureshi, N. A. and Saher, N. U. (2012). Burrow morphology of three species of fiddler crab
(Uca) along the coast of Pakistan. Belgian Journal of Zoology, 142(2), 114-126.
Qureshi, N. A., Farah, N. and Saher, N. U. (2015). Spatial and temporal variations in the
community structure of meiobenthos in the mangrove area near the Karachi coast,
Pakistan Intternational Journal of Fauna and Biological Studies, 2(2), 23-29.
Qureshi, N. A., Farah, N. and Saher, N. U. (2016). Variations in distribution and abundance
of meiobenthos communities in mangrove creek areas along the coast of Karachi,
Pakistan. Indian Journal of Geo Marine Sciences, 45(4) 546-555.
Qureshi, R. M., Sajjad, M. I., Mashiatullah, A., Waqar, F., Jan, S., Akram, M., Khan, S. H.
and Siddiqui, S. A. (1997). Isotopic investigations of pollution transport in shallow
marine environments off the Karachi Coast, Pakistan. In: Proceedings of the
International Symposium on Isotope Techniques in the Study of Past and Current
Environmental Changes in the Hydrosphere and the Atmosphere, 14-18, 353–365.
R Development Core Team. (2012). R, A Language and Environment for Statistical
Computing. R Foundation for Statistical Computing, Vienna, Austria.
http,//www.R-project.org/. Accessed, December 2015.
Rabalais, N. N. (2002). Nitrogen in aquatic ecosystems. AMBIO: A Journal of the Human
Environment, 31(2), 102-112.
Rajaram, G., Manivasagan, P., Gunasekaran, U., Ramesh, S., Ashokkumar, S., Thilagavathi,
B., and Saravanakumar, A. (2010). Isolation, identification and characterization of
229
bacteriocin from Lactobacillus lactis and its antimicrobial and cytotoxic properties.
African Journal of Pharmacy and Pharmacology, 4(12), 895-902.
Rajasekar, K.T., Peramal, P. and Santhanam, P. (2005). Phytoplankton diversity in the
Coleroon estuary, southeast coast of India. Journal of the Marine Biological
Association of the United Kingdom, 47, 127-132.
Rajesh,D., S. Karthikeyan, and G. Jayaraman. 2012. Isolation and partial characterization of
a new bacteriocin from Bacillus Pumilus Dr2 isolated from sea water. CIBTech
Journal of Microbiology, 1(2-3): 33-41.
Ram, R.J., VerBerkmoes, N.C., Thelen, M.P., Tyson, G.W., Baker, B.J., Blake, R.C., Shah,
M., Hettich, R.L. and Banfield, J.F. (2005). Community proteomics of a natural
microbial biofilm. Science, 308, 1915–1920.
Ramanathan, A.L. (1997). Sediment characteristics of the Pichavaram mangrove
environment, southeast coast of India. Indian Journal of Marine Sciences, 26, 319-
322.
Rao, C.S.V.R. (1994). Antimicrobial activity of cyanobacteria. International Journal of
Marine Science, 23, 55-56.
Rao, D.L.N. and Burns, R.G. (1990). The effect of surface growth of blue green-algae and
bryophytes on some microbiological, biochemical, and physical soil properties.
Biology and fertility of soils, 9(3), 239-244.
Rasch, M. and Knöchel, S. (1998). Variations in tolerance of Listeria monocytogenes to
nisin, pediocin PA‐1 and bavaricin A. Letters in Applied Microbiology, 27(5), 275-
278.
Rashid, M. and Abbas, S.H. (2011). Spread of Prosopis Juliflora on the coastal wild life
sanctuary, Sandspit/Hawkes bay, Karachi. Pakistan Journal of Weed Science
Research, 30(2), 17.
Rautio, M. and Vincent, W. F. (2006). Benthic and pelagic food resources for zooplankton
in shallow high‐latitude lakes and ponds. Freshwater Biology, 51(6), 1038-1052.
230
Rawat, I., Kumar, R. R., Mutanda, T. and Bux, F. (2011). Dual role of microalgae:
phycoremediation of domestic wastewater and biomass production for sustainable
biofuels production. Applied Energy, 88(10), 3411-3424.
Ray, R., Majumder, N., Das, S., Chowdhury, C. and Jana, T.K. (2014). Biogeochemical
cycle of nitrogen in a tropical mangrove ecosystem, east coast of India. Marine
Chemistry, 167, 33-43.
Reay, W. G., Gallagher, D. L. and Simmons, G. M. Jr. (1992). Groundwater discharge
and its impact on surface water quality in a Chesapeake Bay inlet. Water Resources
Bulletin , 28(6), 1121-1134.
Reddy, K. R. and DeLaune, R. D. (2008). Biogeochemistry of wetlands: science and
applications. Crc Press, 757p.
Redekar P. D. and Wagh, A. B. (2000). Relationship of fouling diatom number and
chlorophyll-a value from Zuari estuary, Goa (West coast of India). Seaweed
Research and Utilization., 22 (1,2), 173-181.
Rehman, Z., Khanum, F. and Kazmi, S. J. H. (2016). Evaluation of Land Cover Changes at
the Coast of Sindh through Successive Landsat Imageries. Journal of Earth Science
and Climatic Change, 7(1), 1-7.
Rejil, T. (2012). Microalgal vegetation in the selected Mangrove Ecosystems of Kerala
(Doctoral dissertation), Cochin University of Science and Technology.
Repka, S., Veen, A. and Vijverberg, J. (1999). Morphological adaptations in filtering
screens of Daphnia galeata to food quantity and food quality. Journal of Plankton
Research, 21(5), 971-989.
Rhoades, J.D. and Chanduvi, F. (1999). Soil salinity assessment, Methods and interpretation
of electrical conductivity measurements. Food and Agriculture Organization, 57.
Richert, L., Golubic, S., Le Guédès, R., Ratiskol, J., Payri, C. and Guezennec, J. (2005).
Characterization of exopolysaccharides produced by cyanobacteria isolated from
Polynesian microbial mats. Current microbiology, 51(6), 379-384.
231
Ricklefs, R. E., Schwarzbach, A. E. and Renner, S. S. (2006). Rate of lineage origin explains
the diversity anomaly in the world’s mangrove vegetation. The American Naturalist,
168(6), 805-810.
Rietz, D. N. and Haynes, R. J. (2003). Effects of irrigation-induced salinity and sodicity on
soil microbial activity. Soil Biology and Biochemistry, 35(6), 845-854.
Rigonato, J., Alvarenga, D. O., Andreote, F. D., Dias, A. C. F., Melo, I. S., Kent, A. and
Fiore, M. F. (2012). Cyanobacterial diversity in the phyllosphere of a mangrove
forest. FEMS microbiology ecology, 80(2), 312-322.
Rippka, R. (1988). Isolation and purification of cyanobacteria. In: Methods in Enzymology,
Packer, L. and Glazer, A. N. (Eds.). Academic Press, UK, 167: 3-27.
Rivera-Monroy, V. H., Day, J. W., Twilley, R. R., Vera-Herrera, F. and Coronado-Molina,
C. (1995). Flux of nitrogen and sediment in a fringe mangrove forest in Terminos
Lagoon, Mexico. Estuarine, Coastal and Shelf Science, 40(2), 139-160.
Rivera-Monroy, V.H., Twilley, R.R., Boustany, R.G., Day, W.J., Vera-Herrera, F., Ramirez,
M.C. (1995). Direct denitrification in mangrove sediments in Términos Lagoon,
Mexico. Marine Ecology Progress Series, 126, 97–109.
Rivera-Monroy, V.H. and Twilley, R.R. (1996). The relative role of denitrification and
immobilization in the fate of inorganic nitrogen in mangrove sediments (Terminos
Lagoon, Mexico). Limnology and Oceanography, 41, 284–296.
Rizvi, M. A. and Shameel, M. (2004). Studies on the bioactivity and elementology of marine
algae from the coast of Karachi, Pakistan. Phytotherapy Research, 18(11), 865-872.
Rizvi, S. H. N., Saleem, M. and Baquer, J. (1988). Steel mill effluents: influence on the
Bakran Creek environment. Marine science of the Arabian sea, 549-569.
Rizvi, S. H. N. (1997). Status of marine pollution in context of coastal zone management in
Pakistan. In: Coastal zone Management imperative for maritime developing nations.
Haq, B. U., Haq, S. A., Kullenberg, G. and Stel, J. H. (Eds.). Kluwer Academic
Publisher, 347- 370.
232
Rizzo, W. M. and Christian, R. R. (1996). Significance of subtidal sediments to
heterotrophically-mediated oxygen and nutrient dynamics in a temperate estuary.
Estuaries, 19(2), 475-487.
Robertson, A.I. and Alongi, D.M. (Eds.). (1992). Tropical mangrove ecosystems. 137-172.
Washington, DC, American Geophysical Union.
Robertson, A.I., Alongi, D.M. and Boto, D.G. (1992). Food Chains and carbon fluxes. In:
Robertson, A.I. and Alongi, D.M. (Eds.) Tropical Mangrove Ecosystems, Coastal
and Estuarine Series 41. American Geophysical Union, Washington, USA.
Roger, P. A., Jimenez, R. and Santiago, -A. S. (1991). Methods for studying blue-green
algae in ricefields: distributional ecology, sampling strategies, and estimation of
abundance. International Rice Research Institute, 150, 3-19.
Rönnbäck, P. (1999). The ecological basis for economic value of seafood production
supported by mangrove ecosystems. Ecological Economics, 29(2), 235-252.
Rueda‐Puente, E., Castellanos, T., Troyo‐Diéguez, E., Díaz de León‐Alvarez, J. L., &
Murillo‐Amador, B. (2003). Effects of a Nitrogen‐Fixing Indigenous Bacterium
(Klebsiella pneumoniae) on the Growth and Development of the Halophyte
Salicornia bigelovii as a New Crop for Saline Environments. Journal of agronomy
and crop science, 189(5), 323-332.
Russow, R., Stange, C. F. and Neue, H. U. (2009). Role of nitrite and nitric oxide in the
processes of nitrification and denitrification in soil: results from 15 N tracer
experiments. Soil Biology and Biochemistry, 41(4), 785-795.
Sablon, E., Contreras, B. and Vandamme, E. (2000). Antimicrobial peptides of lactic acid
bacteria: mode of action, genetics and biosynthesis. In New Products and New Areas
of Bioprocess Engineering, Springer Berlin Heidelberg, 21-60.
Saeed S., Rasool R.J., Ahmed S., Khanum T., Khan M.B., Abbasi A. and Ali S.A. (2006).
New insight in Staphylococcin research: Bacteriocin and/ or BLIS produced by
S.aureus AB188. World Journal of Microbiology and Biotechnology, 22(7), 713-
722.
233
Sahoo, K. and Dhal, N. K. (2009). Potential microbial diversity in mangrove ecosystems: a
review. Indian Journal of Marine Sciences, 38(2), 249.
Saifullah, S.M. and Nizamuddin, M. (1977). Studies of the marine algae from Pakistan,
Ulvales. Botanica Marina, 20(8), 521-536.
Saifullah, S. M. and Elahi, E. (1992). Pneumatophore density and size in mangroves of
Karachi, Pakistan. Pakistan Journal of Botany, 24, 05-10.
Saifullah, S. M. and Chaghtai, F. (1993). Marine benthic diatoms in mangrove habitat of
Sandspit, Karachi. In: Proceeding of National Seminar on Study and Management in
Coastal Zones in Pakistan, Kazmi, Q.B. and Tirmizi, N.M. (Eds.). BCC and T. Press,
Karachi, 239-247.
Saifullah, S. M., Shaukat, S. S. and Shams, S. (1994). Population structure and dispersion
pattern in mangroves of Karachi, Pakistan. Aquatic Botany, 47(3-4), 329-340.
Saifullah, S. M. and Taj, G. (1995). Marine algal epiphytes on pneumatophores of
mangroves of Karachi. The Arabian Sea Living Marine Resources and the
Environment, AIBS, Vangurad Books (PVT) Ltd., Lahore, 407-417.
Saifullah, S.M. (1997). Management of the Indus Delta mangroves. In: Coastal zone
Management Imperative for Maritime Developing Nations, Haq, B.U., Haq, S.M.,
Kullenberg, G. and Stel, J.H. (Eds.). Kluwer-Academic-Publ., Dordrecht-The-
Netherlands. 333-346.
Saifullah, S. M., and Rasool, F. (1998). Notes and news standing crop of macroalgal in
mangrove habitat of Sandspit area, Karachi. Pakistan Journal of Marine Sciences,
7(1), 61-64.
Saifullah, S. M. and Rasool, F. (2002). Mangroves of Miani Hor lagoon on the north
Arabian Sea coast of Pakistan. Pakistan Journal of Botany, 34(3), 303-310.
Saifullah, S. M., Nizamuddin, M. and Gul, S. (2005). A New Species of Vaucheria
Epiphytic on Mangroves. Botanica Marina, 46(6), 531-533.
Saifullah, S. M. and Ahmed, W. (2007). Epiphytic algal biomass on pneumatophores of
mangroves of Karachi, Indus Delta. Pakistan Journal of Botany, 39(6), 2097-2102.
234
Saifullah, S. M., Chaghtai, F. and Akhtar, S. (2007). Dispersal and establishment of
mangrove propagules in an exposed coastal habitat of Indus Delta. Pakistan Journal
of Botany, 39(2), 577.
Saimmai, A., Tani, A., Sobhon, V. and Maneerat, S. (2012). Mangrove sediment, a new
source of potential biosurfactant-producing bacteria. Annals of microbiology, 62(4),
1669-1679.
Sakhia, N., Prajapati, S., Shetty, V., Bhatt, S. and Bhadalkar, A. (2016). Study of Bacterial
Diversity of Mangroves Rhizosphere. Open Journal of Marine Science, 6(01), 23.
Sakthivel, K. and Kathiresan, K. (2012). Antimicrobial activities of marine cyanobacteria
isolated from mangrove environment of south east coast of India. Journal of Natural
Products, 5, 147-156.
Sakthivel, K. and Kathiresan, K. (2013). Cyanobacterial diversity from mangrove sediment
of south east coast of India. Asian Journal of Biodiversity, 4, 190-203.
Saleem, F., Ahmad, S., Yaqoob, Z. and Rasool, S.A. (2009). Comparative study of two
bacteriocins produced by representative indigenous soil bacteria. Pakistan Journal of
Pharmaceutical Sciences, 22(3), 252-258.
Salik, K. M., Jahangir, S., Hasson, -U, S. (2015). Climate change vulnerability and
adaptation options for the coastal communities of Pakistan. Ocean and Coastal
Management, 112, 61-73.
Sánchez, -O., A. C., Luna, -G., A., Campa -C., Á. I., Escamilla,-M., R., del Carmen Flores, -
M., M., and Mazón, -S., J. M. (2015). Isolation and characterization of potential
probiotic bacteria from pustulose ark (Anadara tuberculosa) suitable for shrimp
farming/Aislamiento y caracterización de bacterias de la almeja" pata de
mula"(Anadara tuberculosa) con potencial probiótico para el cultivo de camarón.
Latin American Journal of Aquatic Research, 43(1), 123.
Sánchez-Fortún, S., Sanz, F. and Barahona, M. V. (1996). Acute toxicity of several
organophosphorous insecticides and protection by cholinergic antagonists and 2-
PAM on Artemia salina larvae. Archives of environmental contamination and
toxicology, 31(3), 391-398.
235
Saravanakumar, A., Sesh Serebiah, J., Thivakaran, G.A. and Rajkumar, M. (2008). Benthic
macro faunal assemblage in the arid zone mangroves of gulf of Kachchh – Gujarat.
Journal of Ocean University of China, 6, 33-39.
Sardinha, M., Müller, T., Schmeisky, H. and Joergensen, R. G. (2003). Microbial
performance in soils along a salinity gradient under acidic conditions. Applied Soil
Ecology, 23(3), 237-244.
Sasekumar, A. (1974). Distribution of macrofauna on a Malayan mangrove shore. The
Journal of Animal Ecology, 51-69.
Satpathy, K. K., Mohanty, A. K., Sahu, G., Sarguru, S., Sarkar, S. K. and Natesan, U.
(2011). Spatio-temporal variation in physicochemical properties of coastal waters off
Kalpakkam, southeast coast of India, during summer, pre-monsoon and post-
monsoon period. Environmental monitoring and assessment, 180(1-4), 41-62.
Sattar, N and N. Ahmed. 1988. Convertogenetics Effect of Chemical Pollution on Marine
bacteria and their mutagen testing. In: Marine Sciences of Arabian sea. Thompson,
F.M. and Tirmizi, N.M. (Eds.). American Institute of Biological Sciences.
Washington D.C., 531-538.
Schaeffer, D.J. and Krylov, V.S. (2000) Anti-HIV activity of extracts and compounds from
algae and cyanobacteria. Ecotoxicology and Environmental Safety, 45, 208-227.
Schlegel, I., Doan, N. T., de Chazal, N. and Smith, G. D. (1998). Antibiotic activity of new
cyanobacterial isolates from Australia and Asia against green algae and
cyanobacteria. Journal of Applied Phycology, 10(5), 471-479.
Schmidt, E. L., and Belser, L. W. (1982). Nitrifying bacteria: Methods of soil analysis. Part
2. Chemical and microbiological properties. (2nd Ed.) ASA, SSSA, 1027-1042.
Scholz, B. and Liebezeit, G. (2012). Screening for biological activities and toxicological
effects of 63 phytoplankton species isolated from freshwater, marine and brackish
water habitats. Harmful Algae, 20, 58-70.
Schwartz, R.E., Hirsch, C.F. and Sesin, D.F. (1990). Pharmaceuticals from cultured algae.
Journal of Industrial Microbiology, 5, 113–124.
236
Scopes, R.K. (2013). Protein purification: principles and practice. USA: Springer Science
and Business Media.
Seckbach, J. (2007). Algae and cyanobacteria in extreme environments (Vol. 11). Springer
Science and Business Media
Sen, N. and Naskar, K. (2003). Algal flora of Sundarbans mangals. Daya Books.
Sengupta, A. and Chaudhuri, S. (1990). Halotolerant Rhizobium strains from mangrove
swamps of the Ganges River Delta. Indian Journal of Microbiology, 30, 483–484.
Shafique, S. (2004). Studies on the nutrient and energy flow in the mangrove ecosystem
(Doctoral dissertation). Centre of Excellence in Marine Biology, University of
Karachi, Pakistan.
Shafique, S., Siddiqui, P. J. A., Aziz, R. A., Burhan, Z. and Mansoor, S. N. (2010). Weight
loss and changes in organic, inorganic and chlorophyll contents in three species of
seaweeds during decomposition. Pakistan Journal of Botany, 42(4), 2599-2604.
Shafique, S., Siddiqui, P. J. A., Aziz, R. A., Burhan, Z., Mansoor, S. N. and Nafisa, S.
(2013). Variations in carbon and nitrogen contents during decomposition of three
macroalgae inhabiting Sandspit backwater, Karachi. Pakistan Journal of Botany,
45(3), 1115-1118.
Shafique, S., Siddiqui, P. J. A. and Farooqui, Z. (2015). Distribution and Zonation Patterns
of Cerithideopsilla cingulata (Gmelin 1791) (Gastropoda: Potamididae) in Mangrove
Stands at Sandspit Backwater, Karachi, Pakistan. Pakistan Journal Zoology, 47(6),
1517-1523.
Shah, V., Garg, N. and Madamwar, D. (2001). Record of the marine cyanobacteria from the
rocky shores of Bet-Dwarka and Okha, India. Acta Botanica Malacitana, 26, 188-
194.
Shameel, M. and Tanaka, J. (1992). A preliminary check-list of marine algae from the coast
and inshore waters of Pakistan. In: Cryptogamic flora of Pakistan, Nakaika, T. and
Malik, S. (Eds.). National Science Museum, Tokyo, 1-64.
237
Shameel, M. (2001). Diversity exhibited by marine benthic algae inhabiting the coast of
Balochistan, Pakistan. Pakistan Journal of Marine Sciences, 10(2): 87-103.
Shayesteh, F., Ahmad, A. and Usup, G. (2014). Bacteriocin Production by a Marine Strain
of Bacills sp. Sh10: Isolation, Screening and Optimization of Culture Condition.
Biotechnology, 13(6), 273-281.
Siddiqui, P. J. A., and Qasim, R. (1986). Changes in dry weight, organic and inorganic
content and calorific value in decomposing mangrove, Avicennia marina, foliage. In:
Marine Science of the Arabian Sea. Proceedings of the International Conference,
Karachi, Pakistan, 393-400.
Siddiqui, P. J. A. and Qasim, R. (1990). Litter production and physicochemical conditions in
mangrove swamps at Karachi back waters and Bakran creek. Journal of Islamic
Academic Sciences, 3, 15-21.
Siddiqui, P. J. A. and Qasim, R. (1994). Variation in chemical constituents of mangrove
foliage Avicennia marina (Forsk.) Vierh. (Avicenniaceae). Pakistan Journal of
Scientific and Industrial Research, 37, 137-143.
Siddiqui, P. J. A., Mansoor, S. N., Zaib-un-Nisa, H. S., Shafique, S. and Farooq, S. (2000).
Associated fauna and flora of macro-algal puffs inhabiting mangrove stands at
Sandspit backwaters, Karachi. Pakistan Journal of Marine Biology, 6(1), 43-53.
Siddiqui, P. J. A., Farooq, S., Shafique, S. and Farooqi, Z. (2008). Conservation and
management of biodiversity in Pakistan through the establishment of marine
protected areas. Ocean and Coastal Management, 51(5), 377-382.
Siddiqui, P. J. A., Farooqui, Z., Valeem, E. E., Rasheed, M. Shafique, S. (2009). Studies on
decomposition rates of Avicennia and Rhizophora leaves on tidal mudflats in active
Indus Deltaic area of Pakistan. International Journal of Phycology and
Phycochemistry, 5(1), 93-98.
Siddiqui, S.K. 1990. Biochemical and Genetics Studies on indigenous bacterial Isolates.
M.Sc. Thesis. University, Karachi, Pakistan, l4-32.
238
Silambarasan, G., Ramanathan, T. and Kathiresan, K. (2012). Diversity of marine
cyanobacteria from three mangrove environment in Tamil Nadu Coast, south east
coast of India. Current Research Journal of Biological Sciences, 4(3), 235-238.
Simmons Jr., G.M. (1995). Sediment-water column oxygen and nutrient fluxes in nearshore
environments of the lower Delmarva Peninsula, USA. Marine Ecology Progress
Series, 118, 215-227.
Singh, J. S. and Kashyap, A. K. (2007). Variations in soil N-mineralization and nitrification
in seasonally dry tropical forest and savanna ecosystems in Vindhyan region, India.
Tropical Ecology, 48(1), 27-36
Singh, R., Sivasubramani, K., Jayalakshmi, S., Satheesh K.S. and Selvi C. (2013). Isolation
and production of bacteriocin by marine Lactobacillus fermentum SBS001.
International Journal of Current Microbiology and Applied Sciences, 2(4), 67-73.
Sivonen, K. (1990). Effects of light, temperature, nitrate, orthophosphate and bacteria on the
growth of the hepatotoxin by Oscillatoria agardhii strains. Applied Environmental
Microbiology, 56, 2658-2666.
Šmarda, J. and Taubeneck, U. (1968). Situation of colicin receptors in surface layers of
bacterial cells. Microbiology, 52(2), 161-172.
Smith, T. J., Boto, K. G., Frusher, S. D. and Giddins, R. L. (1991). Keystone species and
mangrove forest dynamics: the influence of burrowing by crabs on soil nutrient
status and forest productivity. Estuarine, coastal and shelf science, 33(5), 419-432.
Snedaker, S. C. (1984). Mangroves: A summary of knowledge with emphasis on Pakistan.
Marine geology and oceanography of Arabian Sea and Coastal Pakistan, 255-262.
Sohail, B. and Solaha, R. (2005). Species Composition and Faunal Diversity at Three Sites
of Sindh Mangroves. Pakistan journal of Zoology, 37(1), 17-31.
Soltani, N., Khavari-Nejad, R. A., Yazdi, M. T., Shokravi, S. and Fernandez-Valiente, E.
(2005). Screening of soil cyanobacteria for antifungal and antibacterial activity.
Pharmaceutical Biology. 43(5): 455–459.
239
Stal, L.J., van Gemerden, H. and Krumbein, W.E. (1985). Structure and development of a
benthic marine microbial mat. FEMS Microbiology Ecology, 31, 111–125.
Stal, L.J. (2000). Cyanobacterial mats and stromatolites. In: The ecology of cyanobacteria,
Their diversity in time and space, Whitton, B.A. and Potts, M. (Eds.). Dordrecht,
Kluwer Academic Publishers, 61-120.
Stanier, R. Y., Kunisawa, R., Mandel, M. and Cohen-Bazire, G. (1971). Purification and
properties of unicellular blue-green algae (order Chroococcales). Bacteriological
Reviews, 35(2), 171.
Steinberg, C. E. and Hartmann, H. M. (1988). Planktonic bloom‐forming Cyanobacteria and
the eutrophication of lakes and rivers. Freshwater Biology, 20(2), 279-287.
Steppe, T. F., Olson, J. B., Paerl, H. W., Litaker, R. W. and Belnap, J. (1996). Consortial N2
fixation: a strategy for meeting nitrogen requirements of marine and terrestrial
cyanobacterial mats. FEMS Microbiology Ecology, 21(3), 149-156.
Stolz, J. F. (1983). Fine structure of the stratified microbial community at Laguna Figueroa,
Baja California, Mexico. I. Methods of in situ study of the laminated sediments.
Precambrian Research, 20(2), 479-492.
Stolz, J.F. (2003). Structure of marine biofilms: flat laminated mats and modern marine
stromatolites. In: Fossil and Recent Biofilms: A NIatural History of the Impact of
Life on the Planet, Krumbein, W.E., Paterson, D.M. and Zavarzin, G. (Eds.), Kluwer
Academic Publishers, Dordrecht, 65–76.
Strickland, J. D. H. and Parsons, T. K. (1972). A practical hand book of seawater analysis.
Bulletion of fisheries research board Canada, 310.
Sudha, S. S. (2009). Marine Environment: A Potential Source for L-Asparaginase Producing
Microorganisms. IUP Journal of Biotechnology, 3(4).
Sugumar, R., Ramanathan, G., Rajarathinam, K., Jeevarathinam, A., Abirami, D. and
Bhoothapandi, M. (2011). Diversity of saltpan marine cyanobacteria from Cape
Comorin coast of Tamilnadu. Journal of Phytology, 3(9).
240
Sullivan, O. L., Ross, R. P. and Hill, C. (2002). Potential of bacteriocin-producing lactic
acid bacteria for improvements in food safety and quality. Biochimie, 84(5), 593-
604.
Sultana, R. and Mustaquim, J. (1993). On the occurrence and seasonal abundance of
juvenile penaeid shrimps from the backwaters of Karachi coast. In: Proceedings
national seminar on study and management in coastal zones in Pakistan, Tirmizi,
N.M. and Kazmi, Q.B. (Eds.), 33-41.
Sultana, R. and Mustaquim, J. (2003). Some physical parameters of the Sandspit
backwaters, Karachi Coast. Pakistan Journal of Science and Industrial Research, 46,
333-343.
Sultana, R. and Mustaquim, J. (2006). Population Structure of the Juvenile Penaeid Shrimps
Occurring in the Sandspit Backwaters of Karachi Coast, Pakistan. Pakistan Journal
of Scientific and Industrial Research, 49(2), 106.
Sundback, K. and McGlathery, K. (2005). Interactions between benthic macroalgal and
microalgal mats. Interactions between macro and microorganisms in marine
sediments. American Geophysical Union, Washington.
SUPARCO. (2006). Space research in Pakistan. 9. National Report to the 36th COSPAR
Scientific assembly Beijing, China.
Swarnakumar, N. S., Thangaradjou, T., Sivakumar, K. and Kannan, L. (2007). Distribution
of total heterotrophic bacteria in the coastal waters of the Great Nicobar with special
reference to human pathogens. National Academy Science Letters, 30(5-6), 129-137.
Taj, R. J., Aref, M. A. and Schreiber, B. C. (2014). The influence of microbial mats on the
formation of sand volcanoes and mounds in the Red Sea coastal plain, south Jeddah,
Saudi Arabia. Sedimentary Geology, 311, 60-74.
Tam, N. F. Y. and Wong, Y. S. (1993). Retention of nutrients and heavy metals in mangrove
sediment receiving wastewater of different strengths. Environmental Technology,
14(8), 719-729.
241
Tam, N. F. Y. and Wong, Y. S. (1998). Variations of soil nutrient and organic matter content
in a subtropical mangrove ecosystem. Water, Air and Soil Pollution, 103(1-4), 245-
261.
Tam, N. F. Y., Wong, A. H. Y., Wong, M. H. and Wong, Y. S. (2009). Mass balance of
nitrogen in constructed mangrove wetlands receiving ammonium-rich wastewater:
effects of tidal regime and carbon supply. Ecological engineering, 35(4), 453-462.
Tan, L. T. (2007). Bioactive natural products from marine cyanobacteria for drug discovery.
Phytochemistry, 68(7), 954-979.
Tan, L. T. (2010). Filamentous tropical marine cyanobacteria: a rich source of natural
products for anticancer drug discovery. Journal of applied phycology, 22(5), 659-
676.
Tariq, M., Dawar, S. and Mehdi, F. S. (2006). Isolation of fungi from Avicennia marina.
Pakistan Journal of Botany, 38(3), 805.
Tariq, M., Dawar, S., Mehdi, F. S. and Zaki, M. J. (2007). Antagonistic activity of bacterial
inoculum multiplied on Rhizophora mucronata Lamk., in the control of root
infecting fungi on mash bean and okra. Pakistan Journal of Botany, 39(6): 2159-
2165.
Tariq, M. and Dawar, S. (2011). Formulation of Avicennia marina pellets and its application
in controlling root diseases in leguminous and non- leguminous plants. Pakistan
Journal of Botany, 43(2), 1411-1415.
Taton, A., Grubisic, S., Ertz, D., Hodgson, D.A., Piccardi, R., Biondi, N., Tredici, M.R.,
Mainini, M., Losi, D., Marinelli, F. and Wilmotte, A. (2006). Polyphasic study of
Antarctic cyanobacterial strains. Journal of Phycology, 42, 1257–1270.
Ten Brink, B., Minekus, M., Van der Vossen, J.M. and Leer, R.J. (1994). Antimicrobial
activity of lactobacilli: preliminary characterization and optimization of production
of acidocin B, a novel bacteriocin produced by Lactobacillus acidophilus M46. The
Journal of applied bacteriology, 77(2), 140-148.
Thajuddin, N. and Subramanian, G. (1992). Survey of cyanobacterial flora of the southern
east coast of India. Botanica marina, 35(4), 305-314.
242
Tiedje, J.M. (1988). Ecology of denitrification and dissimilatory nitrate reduction to
ammonium. In: Biology of anaerobic microorganisms, Zehnder, A.J.B. (Ed.). Wiley,
New York, 179–244.
Todorov, S. D., Vaz-Velho, M. and Gibbs, P. (2004). Comparison of two methods for
purification of plantaricin ST31, a bacteriocin produced by Lactobacillus plantarum
ST31. Brazilian Journal of Microbiology, 35(1-2), 157-160.
Toledo, G., Bashan, Y. and Soeldner, A. (1995). Cyanobacteria and black mangroves in
Northwestern Mexico: colonization, and diurnal and seasonal nitrogen fixation on
aerial roots. Canadian Journal of Microbiology, 41(11), 999-1011.
Tolhurst, T. J. and Chapman, M. G. (2007). Patterns in biogeo-chemical properties of
sediments and benthic animals among different habitats in mangrove forests. Austral
Ecology, 32(7), 775-788.
Tomlinson, P.B. (1986). The Botany of Mangroves. Cambridge University Press.
Tong, L., Nakashima, S., Shibasaka, M., Katsuhara, M., and Kasamo, K. (2002). A novel
histidine-rich CPx-ATPase from the filamentous cyanobacterium Oscillatoria brevis
related to multiple-heavy-metal cotolerance. Journal of bacteriology, 184(18), 5027-
5035.
Turkmen, G. and Kazanci, N. (2010). Applications of various biodiversity indices to benthic
macroinvertebrate assemblages in streams of a national park in Turkey. Review of
Hydrobiology, 3(2), 111-125.
Twilley, R. R. and Kemp, W. M. (1987). Estimates of sediment denitrification and its
influence on the fate of nitrogen in Chesapeake Bay. Chesapeake Bay Liaison Office,
US Environmental Protection Agency.
Untawale, A. G. (1998). An Anthology of Indian Mangroves: Management of mangroves for
energy needs. 52-56. ENVIS Publication.
USDA-NRCS, (1996). Soil Quality Resource Concerns, Compaction. USDA-NRCS Soil
Quality Inst., Ames, IA.
http://www.statlab.iastate.edu/survey/SQI/sqihome.shtml
243
Utkilen, H. A. and Jolme, G.N. (1992). Toxin Production by Microcystis aeruginosa as a
Function of Light in Continuous Cultures and Its Ecological Significance. Applied
Environmental Microbiology, 58, 1321-1325.
Van Cleemput, O. and Samater, A. H. (1995). Nitrite in soils: accumulation and role in the
formation of gaseous N compounds. Fertilizer Research, 45(1), 81-89.
van Schaik, W., Gahan, C. G. and Hill, C. (1999). Acid-adapted Listeria monocytogenes
displays enhanced tolerance against the lantibiotics nisin and lacticin 3147. Journal
of Food Protection, 62(5), 536-540.
Vargo, G.A., Heil, C.A., Ault, D.N., Neely, M.B., Murasko, S., Havens, J., Lester, K.M.,
Dixon, L.K., Merkt, R., Walsh, J. and Weisberg, R. (2004). Harmful algae 2002.
Florida Fish and Wildlife Conservation Commission, Florida Institute of
Oceanography and Intergovernmental Oceanographic Commission of UNESCO, 14-
16.
Venkatesan, V. and Ramamurthy V.D. (1971). Marine microbiological studies of mangrove
swamps of Killai backwaters. Journal of the Oceanographical Society of Japan,
27(2), 51-55.
Verschuere, L., Rombaut, G., Sorgeloos, P. and Verstraete, W. (2000). Probiotic bacteria as
biological control agents in aquaculture. Microbiology and molecular biology
reviews, 64(4), 655-671.
Victor, S., Golbuu, Y., Wolanski, E. and Richmond, R. H. (2004). Fine sediment trapping in
two mangrove-fringed estuaries exposed to contrasting land-use intensity, Palau,
Micronesia. Wetlands Ecology and Management, 12(4), 277-283.
Vidal, M. (1994). Phosphate dynamics tied to sediment disturbances in Alfacs Bay (NW
Mediterranean). Marine Ecology Progress Series, 110, 211-221.
Vijayakumar, S., Thajuddin, N. and Manoharan, C. (2007). Biodiversity of cyanobacteria in
industrial effluents. Acta Botanica Malacitana, 32, 27-34.
Vijayakumar, S. and Manoharan, C. (2012). Treatment of dye industry effluent using free
and immobilized cyanobacteria. Journal of Bioremediation and Biodegradation,
3(10), 165.
244
Visscher, P. T. and Stolz, J. F. (2005). Microbial mats as bioreactors: populations, processes,
and products. Palaeogeography, Palaeoclimatology, Palaeoecology, 219(1), 87-100.
Volk, R.B. and Furkert, F. H. (2006). Antialgal, antibacterial and antifungal activity of two
metabolites produced and excreted by cyanobacteria during growth. Microbiological
Research, 161, 180-186.
Waliullah, T.M., Yeasmin, M.A., Alam, M.A., Islam, M.W. and Hassan, P. (2016). Analysis
of Toxicity Assay of Crude Drug; Clerodendrum infortunatum L. Journal of Drug
Research and Development, 2(2). 2470-1009.
Walters, B.B., Rönnbäck, P., Kovacs, J.M., Crona, B., Hussain, S.A., Badola, R., Primavera,
J.H., Barbier, E. and Dahdouh, -G., F. (2008). Ethnobiology, socio-economics and
management of mangrove forests: A review. Aquatic Botany, 89(2), 220-236.
Weisburg, W.G., Barns, S.M., Pelletier, D.A., and Lane, D.J. (1991). 16S ribosomal DNA
amplification for phylogenetic study. Journal of bacteriology, 173(2), 697-703
Wheeler, P.A. and Kirchman, D.L. (1986). Utilization of inorganic and organic nitrogen by
bacteria in marine systems. Limnology and Oceanography, 31(5), 998‐1009.
Widdows, J., Brinsley, M. D., Bowley, N. and Barrett, C. (1998). A benthic annular flume
for in situ measurement of suspension feeding/bio deposition rates and erosion
potential of intertidal cohesive sediments. Estuarine, Coastal and Shelf Science,
46(1), 27-38.
Wilke, B.M. (2005). Chp.2 Determination of Chemical and Physical Soil Properties. In:
Manual for soil analysis-monitoring and assessing soil bioremediation, Margesin, R.
and Schinner, F. (Eds.). SSBM., 50.
Wilkie, M.L. and Fortuna, S. (2003). Status and trends in mangrove area extent worldwide.
Forest Resources Assessment Working Paper No. 63. Forest Resources Division.
FAO, Rome.
Wong, Y.S., Tam, N.F.Y., Lan, C.Y. (1997). Mangrove wetlands as wastewater treatment
facility, a field trial. Hydrobiologia, 352, 49–59.
245
Wooller, M., Smallwood, B., Jacobson, M., Fogel, M. (2003). Carbon and nitrogen stable
isotopic variation in Laguncularia racemosa (L.) (white mangrove) from Florida and
Belize, implications for trophic level studies. Hydrobiologia, 499, 13-23.
Woulds, C., Schwartz, M. C., Brand, T., Cowie, G. L., Law, G. and Mowbray, S. R. (2009).
Porewater nutrient concentrations and benthic nutrient fluxes across the Pakistan
margin OMZ. Deep Sea Research Part II: Topical Studies in Oceanography, 56(6),
333-346.
Wu, H., Zou, D. and Gao, K. (2008). Impacts of increased atmospheric CO2 concentrat ion
on photosynthesis and growth of micro-and macro-algae. Science in China Series C:
Life Sciences, 51(12), 1144-1150.
WWF. (2005). GIS Remote Sensing Based Assessment of Mangrove Resources of Selected
Project Sites of Indus Delta and Makran Coast. 55. Pakistan.
Yan, D., Wang, Q., Mao, L., Ma, T., Li, Y., Ouyang, C., Guo, M. and Cao, A. (2015).
Interaction between nitrification, denitrification and nitrous oxide production in
fumigated soils. Atmospheric Environment. 103, 82-86.
Yan, L.L., Han, N.N., Zhang, Y.Q., Yu, L.Y., Chen, J., Wei, Y.Z., Li, Q.P., Tao, L., Zheng,
G.H., Yang, S.E. and Jiang, C.X. (2010). Antimycin A18 produced by an endophytic
Streptomyces albidoflavus isolated from a mangrove plant. The Journal of
antibiotics, 63(5), 259-261.
Yasmeen, Z. A., Shafique, S., Zaib-Un-Nisa, B. and Siddique, P.J.A. (2016). Seasonal
abundance of six dominant filamentous cyanobacterial species in microbial mats
from mangrove backwaters in Sandspit, Pakistan. Pakistan Journal of Botany, 48(4),
1715-1722.
Yasmin, H. and Bano, A. (2011). Isolation and characterization of phosphate solubilizing
bacteria from rhizosphere soil of weeds of Khewra salt range and Attock. Pakistan
Journal of Botany, 43(3), 1663-1668.
Yasmin, H., Bano, A. and Samiullah. (2013). Screening of PGPR isolates from semi-arid
region and their implication to alleviate drought stress. Pakistan Journal of Botany,
45, 51-58.
246
Yi, H., Zhang, L., Tuo, Y., Han, X. and Du, M. (2010). A novel method for rapid detection
of class IIa bacteriocin-producing lactic acid bacteria. Food Control, 21(4), 426-430.
Zai, A.S., Ahmad, S. and Rasool, S.A. (2009). Bacteriocin production by indigenous marine
catfish associated Vibrio spp. Pakistan Journal of Pharmaceutical Sciences, 22(2),
162-167.
Zaib-un-Nisa, B., Mansoor S. N. and Siddiqui P. J. A. (2000). Species diversity of
cyanobacteria growing on pneumatophores and in the adjacent surface sediment in
mangrove swamp at Sandspit backwaters Karachi. Pakistan Journal of Marine
Biology, 6(1), 59-68.
Zaid A.P., Nasir M. and Rasool S.A. (2000). Bacteriocins of marine bacteria: activity
spectrum and biochemical characterization. In: Proceedings of national ONR
symposium on Arabian Sea as a Resource of Biological Diversity. University of
Karachi: Centre of Excellence in Marine Biology, 166-171.
Zaigham, N. A. (2004). Unauthorized squatter settlements are one of major sources for
polluting surface and subsurface waters in Karachi. In: Proceedings of the WSSD
workshop on human settlement and environment (Pakistan’s Response to its
Obligations under the WSSD Plan of Implementation). Islamabad, 14-15, 100-112.
Zehr, J.P., Waterbury, J.B., Turner, P.J., Montoya, J.P., Omoregie, E., Steward, G.F.,
Hansen, A. and Karl, D.M. (2001). Unicellular cyanobacteria fix N2 in the
subtropical North Pacific Ocean. Nature, 412(6847), 635-638.
Zhang, Z., Schwartz, S., Wagner, L. and Miller, W. (2000). A greedy algorithm for aligning
DNA sequences. Journal of Computational biology, 7(1-2), 203-214.
Zhongming, Z., Linong, L., Xiaona, Y., Wangqiang, Z., and Wei, L. (2009). Actinomycetes
for Marine Drug Discovery Isolated from Mangrove Soils and Plants in China.
Marine Drugs, 7(4), 495–496.
Zhou, S., Li, L., Wei, J. and Qin, Q. (2013). Genome sequence of Klebsiella pneumoniae
HSL4, a new strain isolated from mangrove sediment for biosynthesis of 1, 3-
propanediol. Genome announcements, 1(3), e00177-13.
247
APPENDIX
248
(I) Modified ASN-III Medium:
NaCl 35.0 g
MgSO4 x 7H2O 3.5 g
MgCl2 x 7H2O 2.0g
CaCl2 x 7H2O 0.5 g
KCL 0.5 g
Citric acid 3.0 mg
Ferric Ammonium Citrate 3.0 mg
EDTA (disodium salt) 0.5 mg
A-5 Trace Metals * 1.0 ml
NaNO3 0.75 g
K2HPO4. 3H2O 0.75 g
Na2CO3 0.02 g
Distilled Water 1000 ml
Agar (For solidified media) 2.3%
pH 7.4, filter and autoclave
*A-5 Trace Metals
H3BO3 2.86 g
MnCl2. 4H2O 1.81 g
ZnSO4. 7H2O 0.222 g
Na2 MoO4. 2H2O 0.039 g
CuSO4. 5H2O 0.079 g
Co(NO3)2. 6H2O 0.049 g
Distilled Water 1000 ml
249
(II) BG-11 Medium:
NaNO3 1.5 g
K2HPO4 0.04 g
MgSO4·7H2O 0.075 g
CaCl2·2H2O 0.036 g
Citric acid 0.006 g
Ferric Ammonium Citrate 0.006 g
EDTA (disodium salt) 0.001 g
Na2CO3 0.02 g
Trace metal mix A5 * 1.0 ml
Agar (for solidified media) 10.0 g
Distilled Water 1000 ml
pH 7.1, filter, autoclave
Trace metal mix-A5*
H3BO3 2.86 g
MnCl2·4H2O 1.81 g
ZnSO4·7H2O 0.222 g
NaMoO4·2H2O 0.39 g
CuSO4·5H2O 0.079 g
Co(NO3)2·6H2O 49.4 mg
Distilled Water 1000 ml
250
251
252
253
254
255
256
257