Welcome

Polymerase Chain ReactionPCR

Subjects to be discussed

– Definition– Targets of PCR– Requirements of PCR – Denaturing of DNA– PCR Primers– Primer annealing– PCR DNA Taq polymerase– PCR Cycles – Application of PCR

DNA Molecule

Adenine

Thymine

Guanine

Cytosine

Polymerase Chain Reaction (PCR)Definition

PCR (Polymerase Chain Reaction)

A rapid and simple method for amplification of very small amounts

of DNA into multiple copies

Which are used for further testing.

e.g. diagnosis of genetic disease

PCR Target

The targets in PCR are:

sequences of DNA which either a complete gene or small sequence.

PCR Targets

The number of bases in the targets can vary.

TTAAGGCTCGA . . . . AATTGGTTAA

The . . . . Represents the middle DNA sequence,

and does not have to be known to replicate it.

PCR Requirements

• Magnesium chloride: 0.5-2.5 mM

• Buffer: pH 8.3-8.8

• dNTPs: 20-200µM

• Primers: 0.1-0.5µM

• DNA Polymerase: 1-2.5 units

• Target DNA: 1 µg

PCR Denaturing

Denaturing is the first step in PCR, in which

the DNA strands are separated by heating to

95°C.

PCR Primers

Primers range from 15 to 30 nucleotides, are

single-stranded, and are used for the complementary building blocks of

the target sequence.

PCR Primers

A primer for each target sequence on the end

of your DNA is needed. This allows both

strands to be copied simultaneously in both

directions.

PCR Primers

TTAACGGCCTTAA . . . TTTAAACCGGTTAATTGCCGGAATT . . . . . . . . . .>

And

<. . . . . . . . . . AAATTTGGCCAA

TTAACGGCCTTAA . . . TTTAAACCGGTT

PCR Primers

The primers are added in excess so they will

bind to the target DNA instead of the two

strands binding back to each other.

PCR Annealing

Annealing is the process of allowing two

sequences of DNA to form hydrogen bonds.

The annealing of the target sequences and

primers is done by cooling the DNA to 55°C.

PCR Taq DNA Polymerase

Taq stands for Thermus aquaticus, which is a

microbe found in 176°F hot springs in Yellow

Stone National Forest.

PCR Taq DNA Polymerase

Taq produces an enzyme called DNA polymerase, that amplifies the DNA

from the primers by the polymerase chain

reaction, inthe presence of Mg.

PCR Cycles

• In PCR, the template DNA to be amplified is first heated to 90-95 °C, to cause strand separation.

• Then cooled to 50-65 ° C in the presence of the two primers to allow annealing of the primers to their respective DNA sequences.

• The reaction temperature is then adjusted to 72oC in the presence of heat-stable Taq polymerase.

• The Taq polymerase leads to a primer-mediated extension of both strands of the template DNA, in the region between the two primers.

The three reactions :

1. Denaturation

2. Primer-annealing

2. Primer-directed extension

Those reactions are repeated, leading to a geometric increase in the DNA between

the two primers

dNTPsPrimersDNA polymerase




Denature at 95ºC


Denature at 95ºC


Denature at 95ºC


Anneal primers


Anneal primers


Anneal primers


Anneal primers


Extend at 72°C


Extend at 72°C


Extend at 72°C


Extend at 72°C


Extend at 72°C


Extend at 72°C


Extend at 72°C


Extend at 72°C





Denature at 95ºC


Denature at 95ºC


Anneal primers

dNTPsPrimers

Extend at 72°C

dNTPsPrimers

Extend at 72°C

dNTPsPrimers

Extend at 72°C

dNTPsPrimers

Extend at 72°C

After several cycles

• The theoretical amplification achieved is

2 n, where (n) is the number of cycles of denaturation-annealing-extension.

• Using this reaction, specific lengths of DNA

can be amplified a million-fold, to an extent that the amplified product can be directly visualized on an agarose gel without the need for a Southern blot to be carried out using a labelled probe.

• The amplified DNA band is visualized on the gel by staining with ethidium bromide.

PCR Cycles Review

• Denaturalization: 94°- 95°C

• Primer Annealing: 55°- 65°C

• Extension of DNA: 72°

• Number of Cycles: 25-40

Applications of PCR

1- DNA fingerprinting in the forensic laboratory

The PCR allows the DNA in a single cell, hair follicle, or sperm to be amplified and analyzed.

2- Detection of infectious agents, especially latent viruses.

It can be used to pick out and amplify DNA sequences that are unique to invading organisms, and enable their identification (e.g. HCV and AIDS).

3- Prenatal genetic diagnosis.

4- Detection of allelic polymorphisms.

5- Providing precise tissue typing for transplants.

6- Study of evolution, using DNA from archeological samples.

7- Production of biologically active compounds (proteins) necessary for humans such as; human insulin, human growth hormone, erythropiotin, clotting factors and many vaccines.

The gene for the protein is isolated and amplified by PCR, then inserted into a suitable vector in which the gene is transcribed and translated to give the human protein.

Documents

Welcome