Upload
lucien
View
35
Download
1
Embed Size (px)
DESCRIPTION
Welcome. Polymerase Chain Reaction PCR. Subjects to be discussed. Definition Targets of PCR Requirements of PCR Denaturing of DNA PCR Primers Primer annealing PCR DNA Taq polymerase PCR Cycles Application of PCR. DNA Molecule. Adenine Thymine Guanine Cytosine. - PowerPoint PPT Presentation
Citation preview
Polymerase Chain ReactionPCR
Subjects to be discussed
– Definition– Targets of PCR– Requirements of PCR – Denaturing of DNA– PCR Primers– Primer annealing– PCR DNA Taq polymerase– PCR Cycles – Application of PCR
DNA Molecule
Adenine
Thymine
Guanine
Cytosine
Polymerase Chain Reaction (PCR)Definition
PCR (Polymerase Chain Reaction)
A rapid and simple method for amplification of very small amounts
of DNA into multiple copies
Which are used for further testing.
e.g. diagnosis of genetic disease
PCR Target
The targets in PCR are:
sequences of DNA which either a complete gene or small sequence.
PCR Targets
The number of bases in the targets can vary.
TTAAGGCTCGA . . . . AATTGGTTAA
The . . . . Represents the middle DNA sequence,
and does not have to be known to replicate it.
PCR Requirements
• Magnesium chloride: 0.5-2.5 mM
• Buffer: pH 8.3-8.8
• dNTPs: 20-200µM
• Primers: 0.1-0.5µM
• DNA Polymerase: 1-2.5 units
• Target DNA: 1 µg
PCR Denaturing
Denaturing is the first step in PCR, in which
the DNA strands are separated by heating to
95°C.
PCR Primers
Primers range from 15 to 30 nucleotides, are
single-stranded, and are used for the complementary building blocks of
the target sequence.
PCR Primers
A primer for each target sequence on the end
of your DNA is needed. This allows both
strands to be copied simultaneously in both
directions.
PCR Primers
TTAACGGCCTTAA . . . TTTAAACCGGTTAATTGCCGGAATT . . . . . . . . . .>
And
<. . . . . . . . . . AAATTTGGCCAA
TTAACGGCCTTAA . . . TTTAAACCGGTT
PCR Primers
The primers are added in excess so they will
bind to the target DNA instead of the two
strands binding back to each other.
PCR Annealing
Annealing is the process of allowing two
sequences of DNA to form hydrogen bonds.
The annealing of the target sequences and
primers is done by cooling the DNA to 55°C.
PCR Taq DNA Polymerase
Taq stands for Thermus aquaticus, which is a
microbe found in 176°F hot springs in Yellow
Stone National Forest.
PCR Taq DNA Polymerase
Taq produces an enzyme called DNA polymerase, that amplifies the DNA
from the primers by the polymerase chain
reaction, inthe presence of Mg.
PCR Cycles
• In PCR, the template DNA to be amplified is first heated to 90-95 °C, to cause strand separation.
• Then cooled to 50-65 ° C in the presence of the two primers to allow annealing of the primers to their respective DNA sequences.
• The reaction temperature is then adjusted to 72oC in the presence of heat-stable Taq polymerase.
• The Taq polymerase leads to a primer-mediated extension of both strands of the template DNA, in the region between the two primers.
The three reactions :
1. Denaturation
2. Primer-annealing
2. Primer-directed extension
Those reactions are repeated, leading to a geometric increase in the DNA between
the two primers
dNTPsPrimersDNA polymerase
dNTPsPrimersDNA polymerase
dNTPsPrimersDNA polymerase
dNTPsPrimersDNA polymerase
Denature at 95ºC
dNTPsPrimersDNA polymerase
Denature at 95ºC
dNTPsPrimersDNA polymerase
Denature at 95ºC
dNTPsPrimersDNA polymerase
Anneal primers
dNTPsPrimersDNA polymerase
Anneal primers
dNTPsPrimersDNA polymerase
Anneal primers
dNTPsPrimersDNA polymerase
Anneal primers
dNTPsPrimersDNA polymerase
Extend at 72°C
dNTPsPrimersDNA polymerase
Extend at 72°C
dNTPsPrimersDNA polymerase
Extend at 72°C
dNTPsPrimersDNA polymerase
Extend at 72°C
dNTPsPrimersDNA polymerase
Extend at 72°C
dNTPsPrimersDNA polymerase
Extend at 72°C
dNTPsPrimersDNA polymerase
Extend at 72°C
dNTPsPrimersDNA polymerase
Extend at 72°C
dNTPsPrimersDNA polymerase
dNTPsPrimersDNA polymerase
dNTPsPrimersDNA polymerase
dNTPsPrimersDNA polymerase
Denature at 95ºC
dNTPsPrimersDNA polymerase
Denature at 95ºC
dNTPsPrimersDNA polymerase
Anneal primers
dNTPsPrimers
Extend at 72°C
dNTPsPrimers
Extend at 72°C
dNTPsPrimers
Extend at 72°C
dNTPsPrimers
Extend at 72°C
After several cycles
• The theoretical amplification achieved is
2 n, where (n) is the number of cycles of denaturation-annealing-extension.
• Using this reaction, specific lengths of DNA
can be amplified a million-fold, to an extent that the amplified product can be directly visualized on an agarose gel without the need for a Southern blot to be carried out using a labelled probe.
• The amplified DNA band is visualized on the gel by staining with ethidium bromide.
PCR Cycles Review
• Denaturalization: 94°- 95°C
• Primer Annealing: 55°- 65°C
• Extension of DNA: 72°
• Number of Cycles: 25-40
Applications of PCR
1- DNA fingerprinting in the forensic laboratory
The PCR allows the DNA in a single cell, hair follicle, or sperm to be amplified and analyzed.
2- Detection of infectious agents, especially latent viruses.
It can be used to pick out and amplify DNA sequences that are unique to invading organisms, and enable their identification (e.g. HCV and AIDS).
3- Prenatal genetic diagnosis.
4- Detection of allelic polymorphisms.
5- Providing precise tissue typing for transplants.
6- Study of evolution, using DNA from archeological samples.
7- Production of biologically active compounds (proteins) necessary for humans such as; human insulin, human growth hormone, erythropiotin, clotting factors and many vaccines.
The gene for the protein is isolated and amplified by PCR, then inserted into a suitable vector in which the gene is transcribed and translated to give the human protein.