BIOL 2020 exam 2 F 15 Sperry NAME_______________________Multiple Choice Questions. Circle the BEST answer on the test AND mark it on the Scantron

1) Which of the following scientists theorized that DNA structure is an antiparallel double helix? A) Chargraff B) Watson & Crick C) Meselson & Stahl D) Hershey & Chase E) none of the above

2) Which of the following is NOT TRUE about chromatin and histone structure? A) In the chromatin of interphase chromosomes, regions of the chromosome that contain genes being expressed are generally less compact, while those that contain inactivated genes are generally more compact. B) Chromatin does not contain histones but fully condensed chromosomes do C) Histone tail modifications establish and maintain the different chromatin structures found in heterochromatin and euchromatin. D) A cell can temporarily decondense its chromatin to allow access to specific DNA sequences for replication, repair, or gene expression

3) What histone protein (considered a “linker” histone) is responsible for packing multiple nucleosomes together into a regular repeating array, resulting in a 30-nm fiber? A) Histone H1 B) Histone H2A C) Histone H2B D) Histone H3 E) Histone H4

4) If DNA from a particular species contains 40% Adenine, how much Cytosine does it contain? (Consider Chargraff’s rules.)

A) 10% B) 15% C) 20% D) 25% E) 30%

5) What would be the complementary DNA strand to 5’ CCGGTTAA 3’?A) 5’ CCTTAAGG 3’B) 5’ TTAACCGG 3’C) 5’ CCUUAAGG 3’D) 5’ GGAATTCC 3’E) 5’ GGAAUUCC 3’

6) TRUE or FALSE Once chromosomes were identified as carrying hereditary information, people immediately realized that DNA is the genetic material. A) TRUE B) FALSE

7) Which of the following statements is TRUE? A) All genes in a genome code for protein. B) Gene expression is the process of duplicating the genetic material during DNA replication. C) Each strand of DNA contains all the information needed to create a new double-stranded DNA molecule. D) Eukaryotic gene sequences correspond exactly to the respective protein sequences produced from them. E) Primase is needed to initiate DNA replication only on the lagging strand.

8) TRUE or FALSE Eukaryotic chromosomes contain a single origin of replication and replication forks proceed from that origin to the ends of the molecule.

A) TRUE B) FALSE

9) TRUE or FALSE: Histones bind DNA in a sequence specific fashion. A) TRUE B) FALSE

10) The core histones are small, basic proteins that have a globular domain at the C-terminus and a long extended conformation at the N-terminus. Which of the following is NOT TRUE of the N terminal “tails” of core histone proteins?

A) They can be covalently modified by acetylation, methylation and phosphorylation.B) They protrude out from the nucleosome core.C) They can be modified by specific enzymes such as HATs and HDACs.D) They assist in the tight packing of some regions of DNA.E) They bind to the DNA in a sequence-specific manner.

11) Which of the following labels the following structures in the figure below (in the order listed):A-T base pair ____, deoxyribose ______ phosphodiester bond ______ pyrmidine base ______

A) A, B, C, DB) A, C, E, BC) F, B, D, ED) F, D, E, CE) A, D, E, B

12) The genome of the bacterium E. coli requires about 20 minutes to replicate itself. However, the genome of the fruit fly Drosophila can be replicated in only 3 minutes. Which of the following correctly explains why? A) The Drosophila genome is smaller than the E. coli genome. B) Eucaryotic DNA polymerase synthesizes DNA at a much faster rate than procaryotic DNA polymerase. C) Drosophila DNA contains more origins of replication than E. coli DNA. D) The tight packing of Drosophila DNA keeps it concentrated in one place in the cell, which increases the rate of polymerization. E) Drosophila have linear chromosomes, which replicate faster than circular DNA.

13) DNA replication is considered semi-conservative because _____. A) after many rounds of DNA replication, the original DNA double helix is still intact. B) each new molecule of DNA consists of two new strands, copied from the parent DNA molecule. C) each replication fork has a leading and lagging strand. D) each new molecule consists of one strand from the original parent DNA and one new strand. E) telomeres are only partially replicated.

14) If DNA Polymerase is replicating DNA and the next nucleotide in the template strand is an Adenine, what is the substrate for the next step?A) Adenine B) ATP C) Thymine D) pyrophosphate E) TTP

15) In DNA replication, which of the following is TRUE regarding the strand of DNA that is being synthesized?

A B C D

E

F

A) The new strand grows in the 5’ to 3’ direction.B) The newly forming strand is the leading strand and the strand being copied is the lagging strand.

C) New nucleotides are always added to the 5’ end of the previously added nucleotide.D) All of the above are true.E) None of the above are TRUE.

16) TRUE or FALSE: RNA polymerase is responsible for both unwinding the DNA helix and catalyzing the formation of the phosphodiester bonds between the RNA nucleotides.

A) TRUE B) FALSE

17) DNA repair enzymes identify which strand to fix when a depurination mutation occurs by looking for ____. A) a nucleotide with no nitrogen base in the strand B) a uracil in the DNA strand C) a nick in the newly synthesized strand D) a thymine dimer in the strand E) none of these

18) You have discovered an “Exo–” mutant form of DNA polymerase in which the 3′-to-5′ exonuclease function has been destroyed but polymerase function of joining nucleotides together is unchanged. Which of the following properties would you expect the mutant polymerase to have?

A) It will polymerize in the 3′-to-5′ direction.B) It will polymerize more slowly than the normal polymerase.

C) It will be more likely to generate mismatched base pairs.D) It won’t require a primer to initiateE) all of the above

19) Which of the following is NOT NECESSARY for translation to occur normally?A) loading of tRNAs by amino acyl tRNA synthetasesB) transcription of rRNA genesC) binding of the small ribosomal subunit to the 5’ end of the mRNA D) binding of a methionine-loaded tRNA complementary to the AUG codon in the P site of the large subunitE) all of the above are NECESSARY

20) Which tRNA binding site is the entry point for loaded tRNAs in the ribosome during elongation?A) the A site B) the P site C) the E site D) the I site E) the RF site

21) RNA differs from DNA in that _______.A) RNA contains the base uracil, which pairs with guanine.B) RNA molecules with incorrect nucleotides get repaired whereas DNA mismatches do not.C) the nucleotides in a strand of RNA are linked together in a different way than those in DNA.D) RNA has multiple cellular functions whereas DNA only functions to store information.E) All of the above are TRUE

22) Which of the following statements about the genetic code is FALSE?A) More than one codon can specify the same amino acid.B) Each codon may specify more than one amino acid.C) The start codon establishes the reading frame for translation.D) Each codon specifies only one amino acid.E) None of the above are False

23) Which of the following DOES NOT occur during eukaryotic mRNA processing?

A) a 5’ methyl guanine cap is added B) several hundred A’s are added to the 3’ end of the mRNAC) introns are removed and degraded, and exons are spliced together into the mature mRNAD) the spliceosome complex may recognize different intron sequences in different cell types depending on the snRNA expressed in each cell typeE) ALL of the above are TRUE of mRNA processing.

24) TRUE or FALSE: Even though the Human Genome has been shown to have less than 25,000 genes, over 100,000 different proteins can be made.

A) TRUE B) FALSE

25) Which of the following is NOT TRUE of the TATA binding protein subunit of the basal transcription factor TFIID in eukaryotes?

A) it is necessary to initiate transcriptionB) it is similar in function to the sigma factor in prokaryotic RNA polymeraseC) it binds to the TATA box in the promoter and helps recruit other basal transcription factorsD) it is sufficient to initiate transcription

26) TRUE or FALSE Even though introns do not contain protein coding information, they still have to be removed precisely during RNA splicing.

A) TRUE B) FALSE

27) Unlike DNA, which typically forms a helical structure, RNA can fold into a variety of three-dimensional shapes. This is largely because _____.A) RNA uses ribose instead of deoxyribose as the sugar in its nucleotides, and because it is single stranded.B) RNA bases cannot form hydrogen bonds with each other. C) RNA nucleotides use a different chemical linkage between nucleotides than DNA.D) RNA is built in a 3’ to 5’ direction while DNA is built 5’ to 3’.E) all of the above

28) Which of the following is most likely to decrease the transcription of just one gene in a bacterial cell?A) a decrease in the amount of sigma factor B) a decrease in the amount of RNA polymeraseC) a mutation that introduced a stop codon upstream of the promoter sequence for the gene D) a mutation that introduced extensive sequence changes into the promoter sequence of an operonE) a mutation that introduced extensive sequence changes into the promoter sequence of a gene that is not part of an operon

29) TRUE or FALSE A single transcription factor, if expressed in the appropriate precursor cell, can trigger the formation of a specialized cell type or even an entire organ.

A) TRUE B) FALSE

30) Which is NOT an example of epigenetic inheritance? A) The inheritance of methylation patterns in DNA B) The inheritance of patterns of heterochromatin formationC) The inheritance of a base pair substitution in a geneD) The inheritance of a regulatory protein that activates its own transcription E) Actually, All of the above are examples of epigenetic inheritance

31) Which amino acid would a tRNA with the anticodon 5′-AUG-3′ carry? (use codon table provided below)A) lysine B) leucine C) tyrosine D) histidine E) methionine

32) Combinatorial Control refers toA) operons that can be turned on or off depending on the needs of the cellB) the fact that the Lac operon has both negative and positive controlC) the fact that bacteria will use glucose BEFORE they use lactoseD) the precise way in which a repressor binds to the operator.E) sets of genes turned on by sets of transcription factors

33) Which of the method(s) of regulating eukaryotic gene expression is NOT used in prokaryotic cells?A) controlling how often a gene is transcribedB) controlling how an RNA transcript is spliced C) controlling which mRNAs are translated into protein by the ribosomesD) controlling how rapidly proteins are destroyed once they are madeE) all of the above are regulatory mechanisms used by both prokaryotes and eukaryotes

34) Which of the following statements about transcription factors is FALSE?A) Transcription factors form hydrogen bonds, ionic bonds, and hydrophobic interactions with specific DNA nucleotide sequences.B) Transcription factors usually bind to nucleotide bases in the major groove of the DNA helix.C) The binding of transcription factors generally does not disrupt the hydrogen bonds that holds the double helix together.D) Transcription factors identify differences in the sugar-phosphate backbone groups of the DNA strand to determine where to bind.E) Transcription factors often contain homeodomain, leucine zipper or zinc finger motifs.

35) TRUE or FALSE In prokaryotes, the operator binds to the operon, to initiate gene transcription.A) TRUE B) FALSE

36) Which of the following statements about differentiated cells is TRUE?A) Cells of different types do not express any of the same transcription factors.B) Once a cell has differentiated, it can no longer change the gene expression of any of its genes.C) Once a cell has differentiated, it will no longer need to transcribe RNA.D) Differentiated cells express sets of genes that give it the unique characteristics of that cell type.E) All of these are true.

37) Which of the following is NOT TRUE of the tryptophan operon?A) it is negatively regulated B) its operator is bound by the tryptophan repressor when the repressor is bound by tryptophanC) it is active when Trp is present in the cellD) it codes for the production of the tryptophan repressorE) actually, all of the above are TRUE

38) Which of the following is NOT a DNA Binding Protein or part of a DNA binding protein?A) a zinc finger B) a leucine zipper C) a repressor D) a helix-turn-helix E) a promoter

39) MyoD is a transcription factor normally found in differentiating muscle cells. It participates in the transcription of genes that produce muscle-specific proteins. Forcing expression of MyoD in fibroblast cells causes these cells to produce muscle cell proteins. Which of the following statements below is the best explanation of why MyoD can cause fibroblasts, which do not normally express muscle-specific genes, to express them? A) Unlike some other cell types, fibroblasts have not had the muscle-specific genes deleted from their genome. B) The presence of MyoD is sufficient to activate the transcription of muscle-specific genes in all cell types. C) During their developmental history, fibroblasts have accumulated some transcriptional regulators in common with differentiating muscle cells, therefore addition of MyoD is sufficient to induce muscle differentiation in fibroblasts. D) All of the above are true

40) Which of the following is TRUE regarding the Lactose operon ?A) It is only on in the absence of lactose.B) The repressor binds to the operator when lactose is present.C) All three genes are turned on and off at the same time.D) It turns on with the binding of transcription factors.E) Lactose is the end product of the pathway this operon regulates

NAME: _________________________________________ Biol 2020 F15 Sperry

Write the word in the space provided that is described by each of the following definitions. 1 pt each.

1 An enzyme that phosphorylates its substrates

2 The complex of proteins and snRNA which splices mRNA

3 A heritable change in the sequence of DNA nucleotides

4Three specific nucleotides on one end of a tRNA molecule that recognize a particular complementary codon on an mRNA molecule

5 an RNA molecule with catalytic activity

6 Monomer building block consisting of a 5 carbon sugar, a nitrogenous base and a phosphate group

7 The number of molecules of DNA per chromosome during G2 of the cell cycle

8Small proteins with a high proportion of positively charged amino acids that bind to the negatively charged DNA and play a key role in its folding into chromatin.

9The enzyme that produces repeating segments of DNA sequence at the ends of chromosomes, to prevent loss of information during replication.

10 The initially unconnected pieces of new DNA produced on the lagging strand during replication

11 Control of gene expression using sets of transcription factors to turn on specific sets of genes in the correct time and place

12 DNA strand of a gene that has the same nucleotide sequence as the mRNA made from that gene

13 The order in which nucleotide triplets are read in a nucleotide sequence (3 are possible but only 1 is correct for each gene)

14 The process in which the information in mRNA is used to make proteins

15 Replication enzyme which joins okazaki fragments ((it seals nicks in the DNA backbone)

SHORT ANSWER QUESTIONS 20 pts Name ____________________________________1) (3 pts) a) Draw a diagram of the central Dogma of Biology, showing all the key elements.

b) How does understanding the central Dogma help us understand how cells regulate gene expression and the complex processes of differentiation?

2) (2 pts) Indicate whether the following statements are True or False. Explain why in each case.a) DNA molecules are directional molecules but proteins are not.

b) Some proteins found in differentiated cells are also found in every cell of a multicellular organism.

c) One gene always codes for the same gene product.

d) All cellular catalysts are enzymes.

3) (2pts) a) Define, Draw and label a nucleosome.

b) Explain why DNA is packaged into chromatin during interphase, but is only fully packaged into chromosomes during M phase.

4) (4 pts) a) Draw a replication fork and label all 5’ and 3’ ends. Identify the lagging and the leading strands of the “new” DNA” and the original “old” DNA strands.

b) In one sentence, explain how the 5’ to 3’ nucleotide polymerase activity of DNA Polymerase results in asymmetrical nature of DNA replication.

c) Explain why RNA polymerase can build an RNA strand from scratch but DNA polymerase cannot.

5) (2 pts) Sometimes gene expression is regulated by ubiquitylating a protein and targeting it for destruction by the proteasome. a) What level of gene regulation is this? (transcriptional, posttranscriptional, translational of post tranaslational?)

b) What is an advantage and a disadvantage of regulating gene expression in this way?

6) (4 pts) a) Draw a diagram of the LAC operon under conditions where Glucose is low and Lactose is unavailable. (show the binding (or lack of binding) of activators and repressors in the correct place.) Also show/explain how each is regulated (explain why it is/isn’t bound). Is transcription of the LAC genes occurring?

CAP binding site operator Lac gene A Lac gene B Lac gene C

___________Promoter___________________|

b) How would mutating the repressor binding site of the trp operon affect the activity of the trp operon? How severe would this mutation be for the cell?

7) (3 pts)

GCCUUAUGCCCGCAAAUGAGUGAGCACGAAA

a) What amino acid is directly attached to the tRNA currently in the P-site in the diagram above?

b) When the ribosome shifts down, what will bind in the A site in the next round of elongation? (circle the correct answer) An empty tRNA a loaded tRNA a release factor

c) Which reading frame is this mRNA being read in? (circle the correct answer)1st 2nd 3rd

d) If a deletion mutation occurred, so the underlined A is removed, how would this affect the final protein?

e) Write the DNA sequence of the coding strand of the gene for this mRNA. (label 5’ and 3’ ends)

Extra Credit: 5 pts NAME: _____________________________________EC1) The figures below show 1- the expression pattern of 5 GAP genes across the syncytial Drosophila embryo and 2- the expression pattern of the 7 stripes of the pair rule gene, Even skipped (Eve). (anterior is to the left and posterior to the right). GAP genes code for transcription factors. Using this information, Diagram which GAP proteins would activate and repress expression of the 6th stripe of Eve.

a) Draw a diagram of the combination of GAP transcription factors that would bind the enhancer regions for Eve stripe 6. Indicate which GAP genes are activating expression of Eve in stripe 6 and which are inhibiting its expression, in order to get the precise placement of stripe 6 as shown.

EVE gene

b) Would you predict the pattern of TF’s binding the enhancer regions for stripe 2 to be the same or different than that for stripe 6?

circle one: SAME DIFFERENT Explain:

EC 2) A mutation in DNA generates a UGA stop codon in the middle of the coding region of an mRNA coding for a particular protein. A second mutation in the cell’s DNA leads to a single nucleotide change in the anticodon region of a tRNA. The second mutation results in the correct translation of the first protein. (that is, the second mutation “suppresses” the effect of the first). The altered tRNA translates the UGA as tryptophan (trp). What consequences would the presence of such a tRNA have on the translation of the normal genes in this cell? Would all normal genes be affected, none or only some. EXPLAIN

↑ ↑

Stripe 2 Stripe 6

EC 3) Fill in the best word or phrase selected from the list below. Use each word or phrase only once.

MicroRNAs are noncoding RNAs that are incorporated into a protein complex called ______________,

which searches the ______________molecules in the cytoplasm for sequence complementary to that

of the miRNA. When such a molecule is found, it is then targeted for _________________. RNAi is

triggered by the presence of foreign __________________________ molecules, which are digested by

the ____________________ enzyme into shorter fragments and destroyed.

tRNA phosphorylation riboswitch RISC destruction acetylation prokaryotic methylation DNA double-stranded RNA mRNA dicer single-stranded RNA rRNA mitochondria

EC 4) The C in the top strand of the DNA segment below undergoes a deamination mutation (forming a U). If the DNA is replicated before this error is fixed. Will one, both or neither of the daughter cells contain a mutation at this site? Circle your choice and Draw a diagram to explain your answer.

TACGGAATGCCT

EC 5) Describe one concept you expected to be tested on in this test, but were not, and explain why this concept is important to understand.