Prof(Dr) Francis XavierHead, CBF Research Station

Kerala Agricultural University

Rapid development and urbanization Constant change in consumption pattern Social behaviour and uncivil attitude

Average daily per capita generation comes to 0.178 kg

0.034 kg for Koothuparamba to 0.707 kg for Thalassery (CESS, 2001; Padmalal & Maya, 2002; Varma &Dileepkumar, 2004).

MSW of 0.5 kg/capita/day in large cities (NEERI, 1996).

MSW generation varies between 0.21-0.35 kg/capita/day in the urban centres

Climate change, from anthropogenic emissions and wastes

Fossil fuel use Agricultural and industrial activities, Deforestation

On farm disposal of Livestock waste in Kerala

Burial (labour intensive, carelessness attract carnivores)

Incineration (need an incinerator ,costly, labour intensive)

Pit disposal (carnivores dig it out, pollute water bodies )

Sanitary land fill (seepage, attract public protest ,carnivores)

Traditional Composting (Existing methods not user friendly)

Farm typeFarm type

Condition of manure (%)Condition of manure (%) Method of disposal (%)Method of disposal (%) OdourOdour Fly problemFly problem

DryDry WetWet Agri useAgri use Bio gasBio gas DisposedDisposed evaluationevaluation Seasonally yes

Dairy shedDairy shed 1010 9090 6565 3030 55 OdourOdourSeasonally

yes

Dry ShedDry Shed 2020 8080 9595 0000 55 OdourOdourSeasonally

yes

Heifer shedHeifer shed 2020 8080 9595 0000 55 odourodourSeasonally

yes

Calf shedCalf shed 1515 8585 9595 0000 55 odourodourSeasonally

yes

OthersOthers mixedmixed Thrown outsideThrown outside At timesAt times YesYes

Based on Oxygen Use:

1. Aerobic

2. Anaerobic

Based on Tem

perature:

1. Mesophillic

2. Thermophillic

Based on Technological Approach:

1. Static pile /Windrow

2. Mechanical /Enclosed

3 TYPES

COMPOSTING

“Composting is the natural process of 'rotting' or decomposition of organic matter by microorganisms under controlled conditions. ”

Thumburmuzhy Model Aerobic Composting for Rural Waste Management

THUMBURMUZHY AEROBIC COMPOST

RURAL TECHNOLOGYDeveloped by CBF Thumburmuzhy

Manure

Fodder waste

Placenta

After birth

Dead calves

Still birth materials

Carcase after post-mortum

Waste generated from Livestock farm

operations

Aerobic Vs. Anaerobic Composting

Aerobic CompostingOxygen present

Low methane emission

No bad smell

High heat generated

Rapid decomposition

Lower salinity

Anaerobic CompostingOxygen absent

High methane emission

Disagreeable odour

Less heat generated

Slow decomposition

Higher salinity.

Aerobic composting Vs Vermi composting

• Less labour needed

• High layer temperature

• Less time required

• Labour intensive

• No temperature rise

• More time for composting

• Worms care and

sustainability a must

Aerobic composting takes place in the presence of ample oxygen.

Temperature rises rapidly in the waste. In this process the temperature rises to 70 to

80° C. This peak temperature kills the pathogens and weed seeds.

Every waste in the farm can be utilized as a raw material for the compost making and

every material are put in the compost with the layers of dung.

By the time the composting is completed the material become dark brown in color.

70 to 75 degrees Celsius

Thumburmuzhy Composting –Aerobic Layering

Select an ideal space. roof in monsoon

3 models were researched for economic feasibility at CBF

Floor can be Ferro cement slabs

Environment friendly

No disagreeable odours

Organic waste converted to a value added product

Improves soil stability and fertility

Less area requirement

Less expensive

Pathogens free

Why Thumburmuzhy Composting?

.

Aerobic composting takes place in the presence of

ample oxygen.

Temperature rises rapidly in the waste. This peak

temperature kills the pathogens and weed seeds

.

Every waste in the farm can be utilized as a raw

material

By the time the composting is completed the

material become dark brown in colour.

Layers of Dung carbon source and organic waste

Cow dung + Carbon source + Organic waste + moisture

C:N ratio = 20:1

Moisture content = 60%

Temperature to be checked fortnightly

.90 days for composting in Thumburmuzhy model at Kerala agro climatic conditions

LOCUS bankit1371318 524 bp DNA linear ENV 12-JUL-2010DEFINITION 16S ribosomal RNA gene, partial sequence.ACCESSION 1371318VERSIONKEYWORDS ENV.SOURCE Uncultured Alistipes spORGANISM Uncultured Alistipes sp Unclassified.REFERENCE 1 (bases 1 to 524)AUTHORS Girija,D., Francis,X., Deepa,K., Sunil,E., Irin,A. and Jisharaj,K.TITLE Molecular diversity of bacteria in cow dungREFERENCE 2 (bases 1 to 524)AUTHORS Girija,D., Francis,X., Deepa,K., Sunil,E., Irin,A. and Jisharaj,K.TITLE Direct SubmissionJOURNAL Submitted (12-JUL-2010) Agricultural Microbiology, Kerala Agricultural University, Vellanikkara, Thrissur, Kerala 680656, India &CBF Thumburmuzhy

FEATURES Location/Qualifiers source 1..524 /organism="Uncultured Alistipes sp" /mol type="genomic DNA" /isolation source="Cow dung" /environmental sample /country="India" /identified by="Dr. D. Girija" /PCR_primers="fwd_seq: caggcctaacacatgcaagtc, rev_seq: gggcggwgtgtacaaggc" /metagenomicBASE COUNT 139 a 119 c 138 g 128 tORIGIN 1 gtttgatcct ggctcaggat gaacgctagc ggcaggctta acacatgcaa gtcgaggggc

The Thumburmuzhy fodder grown organically

No fly menace or odour due to high temperature High temperature retained for about one week Decomposed wastes settle down No seepage Manure can be taken within 12-15 weeks Manure can be priced about Rs. 5 / kg

Thumburmuzhy Model aerobic compost

Harvested compost

A new layering system for Kerala Agro zones

New cost effective construction technique

Suitable for composting the animal waste and carcass

Not labour intensive

Minimum care needed

Less methane and carbon dioxide so Ecofriendly

Three cost effective models developed at CBF Thumburmuzhy ,KAU

byDr Francis Xavier & Team

Professor and Head Mail : fx@jananeethi.org

EXHIBITIONS AND VIP VISITORS viewing the compost

DR FRANCIS XAVIERPROFESSOR & HEAD,CBF THUMBURMUZHY,KONNAKUZHY.P.OCHALKUDY,THRISSURE mail: fx @ jananeethi.orgPhone;0480 2746065Mob;9447131598