Upload
dr-francis-xavier
View
216
Download
1
Tags:
Embed Size (px)
DESCRIPTION
presentation by Dr FX
Citation preview
Prof(Dr) Francis XavierHead, CBF Research Station
Kerala Agricultural University
Rapid development and urbanization Constant change in consumption pattern Social behaviour and uncivil attitude
Average daily per capita generation comes to 0.178 kg
0.034 kg for Koothuparamba to 0.707 kg for Thalassery (CESS, 2001; Padmalal & Maya, 2002; Varma &Dileepkumar, 2004).
MSW of 0.5 kg/capita/day in large cities (NEERI, 1996).
MSW generation varies between 0.21-0.35 kg/capita/day in the urban centres
Climate change, from anthropogenic emissions and wastes
Fossil fuel use Agricultural and industrial activities, Deforestation
On farm disposal of Livestock waste in Kerala
Burial (labour intensive, carelessness attract carnivores)
Incineration (need an incinerator ,costly, labour intensive)
Pit disposal (carnivores dig it out, pollute water bodies )
Sanitary land fill (seepage, attract public protest ,carnivores)
Traditional Composting (Existing methods not user friendly)
Farm typeFarm type
Condition of manure (%)Condition of manure (%) Method of disposal (%)Method of disposal (%) OdourOdour Fly problemFly problem
DryDry WetWet Agri useAgri use Bio gasBio gas DisposedDisposed evaluationevaluation Seasonally yes
Dairy shedDairy shed 1010 9090 6565 3030 55 OdourOdourSeasonally
yes
Dry ShedDry Shed 2020 8080 9595 0000 55 OdourOdourSeasonally
yes
Heifer shedHeifer shed 2020 8080 9595 0000 55 odourodourSeasonally
yes
Calf shedCalf shed 1515 8585 9595 0000 55 odourodourSeasonally
yes
OthersOthers mixedmixed Thrown outsideThrown outside At timesAt times YesYes
Based on Oxygen Use:
1. Aerobic
2. Anaerobic
Based on Tem
perature:
1. Mesophillic
2. Thermophillic
Based on Technological Approach:
1. Static pile /Windrow
2. Mechanical /Enclosed
3 TYPES
COMPOSTING
“Composting is the natural process of 'rotting' or decomposition of organic matter by microorganisms under controlled conditions. ”
Thumburmuzhy Model Aerobic Composting for Rural Waste Management
THUMBURMUZHY AEROBIC COMPOST
RURAL TECHNOLOGYDeveloped by CBF Thumburmuzhy
Manure
Fodder waste
Placenta
After birth
Dead calves
Still birth materials
Carcase after post-mortum
Waste generated from Livestock farm
operations
Aerobic Vs. Anaerobic Composting
Aerobic CompostingOxygen present
Low methane emission
No bad smell
High heat generated
Rapid decomposition
Lower salinity
Anaerobic CompostingOxygen absent
High methane emission
Disagreeable odour
Less heat generated
Slow decomposition
Higher salinity.
Aerobic composting Vs Vermi composting
• Less labour needed
• High layer temperature
• Less time required
• Labour intensive
• No temperature rise
• More time for composting
• Worms care and
sustainability a must
Aerobic composting takes place in the presence of ample oxygen.
Temperature rises rapidly in the waste. In this process the temperature rises to 70 to
80° C. This peak temperature kills the pathogens and weed seeds.
Every waste in the farm can be utilized as a raw material for the compost making and
every material are put in the compost with the layers of dung.
By the time the composting is completed the material become dark brown in color.
70 to 75 degrees Celsius
Thumburmuzhy Composting –Aerobic Layering
Select an ideal space. roof in monsoon
3 models were researched for economic feasibility at CBF
Floor can be Ferro cement slabs
Environment friendly
No disagreeable odours
Organic waste converted to a value added product
Improves soil stability and fertility
Less area requirement
Less expensive
Pathogens free
Why Thumburmuzhy Composting?
.
Aerobic composting takes place in the presence of
ample oxygen.
Temperature rises rapidly in the waste. This peak
temperature kills the pathogens and weed seeds
.
Every waste in the farm can be utilized as a raw
material
By the time the composting is completed the
material become dark brown in colour.
Layers of Dung carbon source and organic waste
Cow dung + Carbon source + Organic waste + moisture
C:N ratio = 20:1
Moisture content = 60%
Temperature to be checked fortnightly
.90 days for composting in Thumburmuzhy model at Kerala agro climatic conditions
LOCUS bankit1371318 524 bp DNA linear ENV 12-JUL-2010DEFINITION 16S ribosomal RNA gene, partial sequence.ACCESSION 1371318VERSIONKEYWORDS ENV.SOURCE Uncultured Alistipes spORGANISM Uncultured Alistipes sp Unclassified.REFERENCE 1 (bases 1 to 524)AUTHORS Girija,D., Francis,X., Deepa,K., Sunil,E., Irin,A. and Jisharaj,K.TITLE Molecular diversity of bacteria in cow dungREFERENCE 2 (bases 1 to 524)AUTHORS Girija,D., Francis,X., Deepa,K., Sunil,E., Irin,A. and Jisharaj,K.TITLE Direct SubmissionJOURNAL Submitted (12-JUL-2010) Agricultural Microbiology, Kerala Agricultural University, Vellanikkara, Thrissur, Kerala 680656, India &CBF Thumburmuzhy
FEATURES Location/Qualifiers source 1..524 /organism="Uncultured Alistipes sp" /mol type="genomic DNA" /isolation source="Cow dung" /environmental sample /country="India" /identified by="Dr. D. Girija" /PCR_primers="fwd_seq: caggcctaacacatgcaagtc, rev_seq: gggcggwgtgtacaaggc" /metagenomicBASE COUNT 139 a 119 c 138 g 128 tORIGIN 1 gtttgatcct ggctcaggat gaacgctagc ggcaggctta acacatgcaa gtcgaggggc
The Thumburmuzhy fodder grown organically
No fly menace or odour due to high temperature High temperature retained for about one week Decomposed wastes settle down No seepage Manure can be taken within 12-15 weeks Manure can be priced about Rs. 5 / kg
Thumburmuzhy Model aerobic compost
Harvested compost
A new layering system for Kerala Agro zones
New cost effective construction technique
Suitable for composting the animal waste and carcass
Not labour intensive
Minimum care needed
Less methane and carbon dioxide so Ecofriendly
Three cost effective models developed at CBF Thumburmuzhy ,KAU
byDr Francis Xavier & Team
Professor and Head Mail : [email protected]
EXHIBITIONS AND VIP VISITORS viewing the compost
DR FRANCIS XAVIERPROFESSOR & HEAD,CBF THUMBURMUZHY,KONNAKUZHY.P.OCHALKUDY,THRISSURE mail: fx @ jananeethi.orgPhone;0480 2746065Mob;9447131598