Volcano Hazards at Fuego and Acatenango, Guatemala · Volcano Hazards at Fuego and Acatenango, Guatemala 7 INTRODUCTION The Fuego-Acatenango massif comprises a string of five or more

Volcano Hazards at Fuego and Acatenango, GuatemalaVolcano Hazards at Fuego and Acatenango, GuatemalaVolcano Hazards at Fuego and Acatenango, GuatemalaVolcano Hazards at Fuego and Acatenango, GuatemalaVolcano Hazards at Fuego and Acatenango, Guatemala 11111

Open-File Report 01–431Open-File Report 01–431Open-File Report 01–431Open-File Report 01–431Open-File Report 01–431

U.S. Department of the InteriorU.S. Department of the InteriorU.S. Department of the InteriorU.S. Department of the InteriorU.S. Department of the InteriorU.S. Geological SurveyU.S. Geological SurveyU.S. Geological SurveyU.S. Geological SurveyU.S. Geological Survey

VVVVVolcano Hazards at Fuego andolcano Hazards at Fuego andolcano Hazards at Fuego andolcano Hazards at Fuego andolcano Hazards at Fuego andAcatenango, GuatemalaAcatenango, GuatemalaAcatenango, GuatemalaAcatenango, GuatemalaAcatenango, Guatemala

22222 Volcano Hazards at Fuego and Acatenango, GuatemalaVolcano Hazards at Fuego and Acatenango, GuatemalaVolcano Hazards at Fuego and Acatenango, GuatemalaVolcano Hazards at Fuego and Acatenango, GuatemalaVolcano Hazards at Fuego and Acatenango, Guatemala

Cover photographCover photographCover photographCover photographCover photograph

Fuego and Acatenango volcanoes viewed from the east. Acatenango is to the right withYepocapa to the far right and Pico Mayor next to it. Fuego is to the far left, and the bare bench justto the right is Meseta. (Photo by J.W. Vallance).



ByByByByBy J.W. Vallance, S.P. Schilling, O. Matías, W.I. Rose, and M.M HowellJ.W. Vallance, S.P. Schilling, O. Matías, W.I. Rose, and M.M HowellJ.W. Vallance, S.P. Schilling, O. Matías, W.I. Rose, and M.M HowellJ.W. Vallance, S.P. Schilling, O. Matías, W.I. Rose, and M.M HowellJ.W. Vallance, S.P. Schilling, O. Matías, W.I. Rose, and M.M Howell

U.S. GEOLOGICAL SURVEYU.S. GEOLOGICAL SURVEYU.S. GEOLOGICAL SURVEYU.S. GEOLOGICAL SURVEYU.S. GEOLOGICAL SURVEYOpen-File Report 01-431Open-File Report 01-431Open-File Report 01-431Open-File Report 01-431Open-File Report 01-431

Vancouver, Washington U.S.A.2001


U.S. DEPARTMENT OF THE INTERIORGale Norton, Secretary

U.S. GEOLOGICAL SURVEYCharles G. Groat, Director

This report is preliminary and has not been reviewed for conformity with U.S. Geological Survey editorial standards. Any use oftrade, product, or firm names is for descriptive purposes only and does not imply endorsement by the U.S. Government.

For additional information write to: Copies of this report can be purchased from:

.S.UegrahC-ni-tsitneicS Geological SurveysecivreS noitamrofnIyevruS lacigoloeG .S.U

68252 xoB .O.P01 .gdlB ,truoC lanidraC ES 003152208 OC ,revneD38689 AW ,revuocnaV

0124-202 )303(0098-399 )063(FAX: (360) 993-8980


CONTENTSCONTENTSCONTENTSCONTENTSCONTENTS

Introduction................................................................................................................................................ 7

Volcanic Phenomena.................................................................................................................................. 11Hazardous phenomena at composite volcanoes ................................................................................... 11

Tephra............................................................................................................................................ 11

Pyroclastic flow and pyroclastic surge ........................................................................................... 12

Lava flows ...................................................................................................................................... 13

Volcanic gases ................................................................................................................................ 13

Debris avalanches, landslides, and lahars ....................................................................................... 13

Past Events at Fuego and Acatenango Volcanoes..................................................................................... 14

Potential Future Activity at Fuego Volcano ............................................................................................... 16

Potential Future Activity at Acatenango Volcano ...................................................................................... 16

Volcano-Hazard-Zonation Maps ................................................................................................................ 17

Proximal lahar-hazard zone .................................................................................................................. 17

Distal lahar-hazard zones ..................................................................................................................... 17Pyroclastic-flow and lava-flow hazard zone ........................................................................................ 18

Tephra-fall hazard zones ...................................................................................................................... 19

Debris-avalanche hazard zone ............................................................................................................. 19

Hazard Forecasts and Warnings ................................................................................................................ 19

Protecting Communities and Citizens from Volcano-Related Hazards ...................................................... 21

References................................................................................................................................................. 22

Additional Suggested Reading................................................................................................................... 23

End Notes .................................................................................................................................................. 23

PLATESPLATESPLATESPLATESPLATES [In pocket]

1. Lahar hazards of Fuego volcano, Guatemala. Proximal and distal hazard zones from lahars at Fuegovolcano.

2. Lahar hazards of Acatenango volcano, Guatemala. Proximal and distal hazard zones from lahars atAcatenango volcano.

3. Volcano hazards of Fuego volcano, Guatemala. Hazard zones that could be affected by lava flows,pyroclastic flows, and pyroclastic surges.

4. Volcano hazards of Acatenango volcano, Guatemala. Hazard zones that could be affected by lavaflows, pyroclastic flows, and pyroclastic surges.


FIGURESFIGURESFIGURESFIGURESFIGURES

1. Location of major cities and significant Quaternary volcanoes in Guatemala showingthe location of Fuego and Acatenango volcanoes ............................................................................. 7

2. Topographic map showing the major vents of the Fuego-Acatenango volcano complex .................. 8

3. Schematic illustration of the Fuego-Acatenango massif showing the 5 individual vents .................. 8

4. Historic activity of Fuego volcano .................................................................................................... 9

5. Composite section and summary of eruptive history of Acatenango volcano .................................. 10

6. Simplified sketch showing hazardous events associated with volcanoes likeFuego and Acatenango ..................................................................................................................... 12

7. Topographic map showing distribution of debris-avalanche deposits from theFuego-Acatenango volcano complex and hazards from future debris avalanches ........................... 15

8. Topographic map showing distribution of pyroclastic flows (denoted glowing avalanches here)and tephra fall thicker than 20 cm from the 1974 eruption of Fuego volcano .................................. 16

9. Map showing population density and tephra-fall hazard zones of 20 centimeters at15 kilometers distance, 10 centimeters at 25 kilometers distance, and 5 centimeters at50 kilometers distance for the Fuego-Acatenango volcano complex ............................................... 20

10. Map showing the probability of wind directions between 10,000 and 50,000 feet forGuatemala.........................................................................................................................................21

TABLETABLETABLETABLETABLE

1. Population that could be affected by tephra falls like those of 1974 from Fuego ............................. 21


INTRODUCTIONINTRODUCTIONINTRODUCTIONINTRODUCTIONINTRODUCTIONThe Fuego-Acatenango massif

comprises a string of five or morevolcanic vents along a north-south trendthat is perpendicular to that of theCentral American arc in Guatemala(figure 1). From north to south knowncenters of volcanism are AncientAcatenango, Yepocapa, Pico Mayor deAcatenango, Meseta, and Fuego (figures2 and 3). Volcanism along the trendstretches back more than 200,000 years.Although many of the centers have beenactive contemporaneously, there is ageneral sequence of younger volcanism,from north to south along the trend.

This massive volcano complextowers more than 3500 meters (m)above the Pacific coastal plain to thesouth and 2000 m above the GuatemalanHighlands to the north. The volcanocomplex comprises remnants of multipleeruptive centers (figures 2 and 3), whichperiodically have collapsed to form hugedebris avalanches. The largest of theseavalanches extended more than


ByByByByBy J.W J.W J.W J.W J.W. V. V. V. V. Vallance, S.Pallance, S.Pallance, S.Pallance, S.Pallance, S.P. Schilling, O. Matías. Schilling, O. Matías. Schilling, O. Matías. Schilling, O. Matías. Schilling, O. Matías11111, W, W, W, W, W.I. Rose.I. Rose.I. Rose.I. Rose.I. Rose22222, and M.M Howell, and M.M Howell, and M.M Howell, and M.M Howell, and M.M Howell

Figure 1. Location of major cities and significant Quaternaryvolcanoes in Guatemala showing the location of Fuego andAcatenango volcanoes. Circles indicate major cities, solid trianglesindicate active volcanoes and open triangles indicate dormantvolcanoes. Atitlán is a large silicic caldera.

ean

92o W.

16o N.

14oN.

90o W.

MEXICO

GUATEMALA

EL

Tecuamburro

Pacaya

Fuego

Tacana

Cerro Quemado

Zunil

Sa

Santa

Coa tal Plain

Guatemalan

Highlands

Lake Atitlan

12

8

4

5

67

1 Guatemala City

EscuintiaSiquinalaLa DemocraciaQuezaltenango

7 El TumbadorChiquimulilia

Active volcanoDormant volcano

hicabalh lCh

1 Instituto sismología, vocanología, meteorología, y hidrología (INSIVUMEH), Guatemala.2 Michigan Technological University, Houghton MI, 49931, USA


Figure 2 Topographic map showing the major vents ofthe Fuego-Acatenango volcano complex (adapted fromChesner and Rose, 1984)

Figure 3. Schematic illustration of the Fuego-Acatenango massif showing the 5 individual vents.(Adapted from Basset, 1996). Plumes indicate ventsactive in historic time.

50 kilometers (km) from its source and coveredmore than 300 km2 [1](numerals in brackets referto end notes in the report). The volcano haspotential to produce huge debris avalanches thatcould inundate large areas of the Pacific coastalplain. In areas around the volcanoes anddownslope toward the coastal plain, more than100,000 people are potentially at risk from theseand other flowage phenomena.

In historical time, Fuego has erupted more than60 times (figure 4). It has spread volcanic ash topopulation centers such as Escuintla(population 75,000+) 20 km to the south, Antiqua(population 25,000) 15 km to the southwest andGuatemala City (population 2.2 million), thecountry’s capital and largest city, 40 km to thesouthwest (figure 1). The volcano commonlyproduces plumes of fine ash up to 10 km high, lavaflows, and hot pyroclastic flows. During periodsof rain, volcaniclastic debris remobilizes to formvolcanic debris flows (also commonly known aslahars). After periods of volcanism, channels are

choked with sediment. As a result, floods spill ontoadjacent interfluves, and periodically river channelschange their course.

The only known historical eruptions ofAcatenango volcano occurred in the 20th century,between 1924 and 1927 from just north of thesummit peak (Pico Mayor) and again in December1972 from the saddle between Yepocapa and PicoMayor (figure 2) [1]. These phreatic explosionsgenerated ballistic bombs that fell near the summitcraters and fine ash that fell up to 25 km away. Inprehistoric time, Acatenango has eruptedexplosively to form widespread fall deposits, hotpyroclastic flows and lava flows. There have beennumerous eruptions during the past 80,000 yearsfrom vents along the massif. The most recentexplosive eruptions of Acatenango occurred 1900years ago (Pico Mayor), 2300 years ago (PicoMayor) and about 5000 years ago (Yepocapa)(figure 5). If such eruptions were to recur, manypeople and costly infrastructure would be at risk.

Volcanic eruptions are not the only events thatpresent a risk to local communities. Anotherconcern is a small- to moderate-sized landslidesthat could occur during periods of no volcanicactivity. Landslides could be triggered onAcatenango and Fuego volcanoes by torrentialrainstorms and earthquakes, and as they movedown slope such landslides can transform intolahars that can inundate downstream areas beyondthe edifice. Fuego demonstrates a more likely

MesetaFuego

Pico Major

Yepocapa

NS

AcatenangoAntiguo


scenario in which torrential rains trigger debrisflows by mobilizing fresh pyroclastic debris in thesteep barrancas of the edifice. The rain-inducedlahars that occurred after the modest eruptions of1999 at Fuego show the destructive power of evensmall events. These debris flows destroyed newlyconstructed highway bridges in at least two placeseast of the volcano.

This report describes the kinds of hazardousevents that occur at volcanoes in general and thekinds of hazardous geologic events that haveoccurred at Acatenango and Fuego in the past.The report also shows, in the accompanyingvolcano-hazards-zonation maps, which areas arelikely to be at risk when hazardous events occuragain.

Figure 4. Historic activity of Fuego volcano. (Modified from Rose et al., 1978).


Figure 5. Composite section and summary of eruptive history of Acatenango volcano, based on Basset (1996).


VOLCANIC PHENOMENAVOLCANIC PHENOMENAVOLCANIC PHENOMENAVOLCANIC PHENOMENAVOLCANIC PHENOMENAVolcanoes pose a variety of geologic hazards—

both during eruptions and in the absence oferuptive activity (figure 6). Many of the hazardousevents depicted in figure 6 have occurred at Fuegoand Acatenango volcanoes in the past and willlikely occur in the future. The eruption of moltenrock, or magma, caused most of these events, butsome, like some landslides and lahars, can occurwithout eruptive activity. The nature of activitydepends in part on the size and type of volcano, thecomposition of the magma, and on interactionsbetween magma and ground water.

The Fuego-Acatenango massif comprises acomplex of five composite volcanoes along anorth-south trend. Composite volcanoes eruptepisodically. In historical time, small pyroclasticeruptions have occurred every few years at Fuegoand relatively larger ones occur about every 30years (figure 4). The older stratigraphic recorddocuments several yet larger eruptions than thesein the past 3000 years. Acatenango and the othercones in the chain have erupted much lessfrequently, but, on the basis of their geologic recordcan produce voluminous pyroclastic eruptions.Episodic volcanism along the massif extends morethan 230,000 years into the past.

Hazardous phenomena at compositeHazardous phenomena at compositeHazardous phenomena at compositeHazardous phenomena at compositeHazardous phenomena at compositevolcanoesvolcanoesvolcanoesvolcanoesvolcanoes

TTTTTephraephraephraephraephraAs magma nears the surface of a volcano, it

releases dissolved gases. Rapidly released gasfragments the solidifying magma into particles. Iffragmenting particles exit the conduit at largevelocities, they are dispersed high into theatmosphere. Volcanologists call such fragments,which range in size from microscopic ash to meter-sized blocks, tephra. Tephra falls from eruptionplumes downwind and deposits broad lobes of ashaway from the volcano. A tephra deposit’sthickness and particle size generally decreaseaway from the vent, but a deposit can cover areastens to hundreds of kilometers from the source.The largest tephra fragments, called ballistic

bombs, fall to the ground within a few kilometersof the vent.

Tephra falls seldom threaten life directly,except within a few kilometers of a vent. Theimpact of large ballistic fragments can cause deathor severe injury. Large projectiles may also be hotwhen they land and can start fires if they fall ontocombustible material. Most injuries and fatalitiesfrom tephra falls occur when the tephraaccumulations are thick, or are wet, and thus areheavy enough to collapse roofs of buildings andhouses. Fine tephra suspended in the air canirritate eyes and lungs, especially among the elderlyand infants.

Indirect effects of tephra falls can be perhapsmore disruptive than the direct effects of tephrafalls. Tephra plumes can create tens of minutes ormore of darkness, even on sunny days, and tephrafalls can reduce visibility. Engines can ingest fineash that, in turn, clogs filters or increases wear.Tephra can short-circuit electric transformers andbreak power lines, especially if it is wet, sticky, andheavy. It can contaminate surface water, plugstorm- and sanitary-sewer systems, and clogirrigation canals. Even thin tephra accumulationsmay ruin crops. Even small, dilute tephra cloudscan damage jet aircraft that fly into them. Ashingested by jet engines abrades them and meltswithin them causing engine malfunction and powerloss.

In historical time, eruptions of Fuego volcanohave repeatedly spread tephra blankets more than100 km downwind and deposited thicknesses of 10to 20 centimeters (cm) to distances of between 15and 25 km downwind [1]. During the eruption of14 September 1971, in the town of Yepocapa,10 km to the ENE of Fuego, tephra darkened skiescaused panic among some residents, and ultimatelycollapsed roofs of some houses. Although manyroofs collapsed, houses of residents who stayedbehind and periodically swept their roofsexperienced little damage. During the 1974eruptions of Fuego, tephra plumes rose as high as7 km above the volcano. These tephras, likeothers, chiefly comprised fine ash. Near source,however, tephra falls included numerous greater-than-1-cm particles of basaltic pumice.


Pyroclastic f low and pyroclastic surgePyroclastic f low and pyroclastic surgePyroclastic f low and pyroclastic surgePyroclastic f low and pyroclastic surgePyroclastic f low and pyroclastic surge

Sometimes the mixture of hot gases andvolcanic rock particles produced by an explosiveeruption is denser than air, and instead of risingabove the vent to produce tephra, this densemixture behaves like a fluid, stays close to theground, and flows down slope as a pyroclasticflow. If the mixture contains large proportions of

particles, then its density will tend to funnel it intotopographically low areas, like barrancas andvalleys. However, sufficiently voluminous flows orsequences of voluminous flows, especially on theslopes of the cone, may fill barrancas and sweepacross fans in between them. Pyroclastic flowscommonly generate dilute mixtures of hot ash andgas, called pyroclastic surges. These flows can

Figure 6. Simplified sketch showing hazardous events associated with volcanoes like Fuego and Acatenango. Eventssuch as lahars and landslides (debris avalanches) can occur even when the volcano is not erupting. Inset box showsclassification of magma types on the basis of silica content. Illustration by Bobbie Meyers, modified from USGS FactSheet 002-97.

Magma

Pyroclastic Flow

Pyroclastic Flow

Eruption Column

Lahar(Debris Flow)

Lava Flow

Prevailing Wind

MagmaReservoir

Dome Collapse

Fumaroles

Eruption Cloud

Ash (Tephra) Fall Acid Rain Bombs

Dome

Conduit

Crack

GroundWater

Magma Silica (SiO2)Types Content Rhyolite >68%Dacite 63-68%Andesite 53-63%Basalt <53%

Landslide(Debris Avalanche)


Lava flows have originated at all the vents ofthe Fuego-Acatenango massif and have moveddown all of its sides. Typically such flows have notmoved more than about 10 km from source. Inhistorical time, lava flows at Fuego have commonlybroken up and formed hot avalanches orpyroclastic flows as they descended the steep east,south and west slopes of the volcano.

VVVVVolcanic gasesolcanic gasesolcanic gasesolcanic gasesolcanic gases

All magmas release gases both during andbetween eruptions. Volcanic gases include steam,carbon dioxide, sulfur dioxide, and small amountsof several other gases. Generally, volcanic gasesdissipate rapidly downwind from the vent, butwithin a few kilometers of a vent they can bedangerous. Gases can injure eyes and lungs. Inclosed depressions, denser-than-air gases (likecarbon dioxide) can accumulate and causesuffocation. The greatest hazards from volcanicgases at Fuego and Acatenango will be within thecentral summit craters.

Debris avalanches, landslides, and laharsDebris avalanches, landslides, and laharsDebris avalanches, landslides, and laharsDebris avalanches, landslides, and laharsDebris avalanches, landslides, and lahars

Slope failure of a volcano can generate arapidly moving landslide called a debrisavalanche. Magma intrusion and volcanigenicearthquakes can cause slope instability and deep-seated failure like the one that occurred in 1980 atMount St. Helens. In prehistoric time, at least twoavalanches of this type have occurred at theFuego-Acatenango massif (figure 5). Tectonicearthquakes, torrential rains, or steam explosionscan also trigger slope failures, which are commonlyorders of magnitude smaller in volume than thosetriggered by magmatic intrusion. Debrisavalanches can attain speeds in excess of 150 kmper hour. Small-volume debris avalanches typicallytravel only a few kilometers from their source, butlarge-volume debris avalanches can travel tens ofkilometers from a volcano. Debris avalanchesdestroy everything in their paths and can leavedeposits of 10 m to more than 100 m thick onvalley floors.

separate from the pyroclastic flow and move ontohigher areas adjacent to or beyond the margins ofpyroclastic flows.

Pyroclastic flows and surges move at speeds of50 to 150 km per hour and people on foot cannotescape from them. Temperatures in pyroclasticflows and surges commonly are several hundreddegrees Celsius or more. Pyroclastic flowscommonly destroy all structures and kill all livingthings in their paths. Although pyroclastic surgesmay be somewhat less destructive, they can affectlarger areas and be lethal. Pyroclastic surgesoften cause severe burns, trauma to the lungs, orsuffocation.

Pyroclastic flows at Fuego are common duringeruptions that occur at Fuego every few years.The most recent of these were in May 1999.Larger pyroclastic eruptions occur at about30-year intervals as in 1974 and 1932. Judging bydistribution of deposits and radiocarbon agedeterminations, even larger eruptions occurredabout 900, 1200, and 3300 years ago. Pyroclasticeruptions have occurred at both Pico Mayor deAcatenango about 2300 years ago and Yepocapa4700 years ago, and similar eruptions extend backto ca 40,000 years ago [1]. Pyroclastic flows atFuego or Acatenanago generally have not movedmore than 12 km from their sources.

Lava flowsLava flowsLava flowsLava flowsLava flows

If magma degasses enough before it reachesEarth’s surface, it may erupt passively to formlava. Lava flows of the type that have formed atAcatenango and Fuego are blocky and reasonablyslow moving. Such lava flows commonly movedown slope as bouldery streams of rock a few totens of meters thick and move at tens of metersper minute to a few tens of meters per hour.Although lava flows can be extremely destructive,they typically are not life threatening. People canwalk out of the path of an advancing flow, but theyshould be aware that these flows are extremelyunstable on the steep slopes of volcanoes likeFuego and could avalanche to form hot pyroclasticavalanches and flows from which there is littlechance of escape.


Lahars, also called mudflows and debris flows,are masses of mud, rock, and water that look muchlike flowing concrete. They occur when watermobilizes large volumes of loose mud, rock, andvolcanic debris. Commonly, landslides andavalanches will incorporate enough water to formlahars. Lahars, like floods, inundate floodplainsand submerge structures in low-lying areas. Theycan travel many tens of kilometers down valley atspeeds of tens of kilometers per hour. Laharsdestroy or damage everything in their pathsthrough burial or impact. They follow river valleysand leave deposits of muddy sand and gravel thatcan range to several meters or more thick. Theyare particularly hazardous because they travelfarther from a volcano than any other hazardousphenomenon except tephra, and they affect streamvalleys where human settlement is usually greatest.In some instances, lahars clog channels or blocktributaries so that water collects behind theblockage. The impounded water can spill over theblockage, quickly cut a channel, catastrophicallydrain the water and generate floods that movedown the valley. Breaching of such blockagesmay occur within hours or months afterimpoundment.

Like floods, lahars range greatly in size. Thesmallest lahars occur most frequently (perhapsevery few years), whereas the largest occur on theorder of centuries to millennia. The amount ofwater and loose volcanic debris determines laharsize. Eruptions can dump millions of cubic metersof sediment into channels that, when mixed withwater during subsequent rains, causes lahars.

Landslides and lahars can cause problems longafter the original eruptions. Once lahars fill streamchannels with sediment, the streams begin to erodenew paths, and the new stream channels can behighly unstable and shift rapidly as sediment iseroded and moved farther down valley. Also,because stream channels are clogged withsediment, they have less ability to convey waterand thus are more susceptible to flooding bysmaller-magnitude floods. Floods and lahars canpersist for years to decades after eruptions.

PAST EVENTS APAST EVENTS APAST EVENTS APAST EVENTS APAST EVENTS AT FUEGO ANDT FUEGO ANDT FUEGO ANDT FUEGO ANDT FUEGO ANDACAACAACAACAACATENANGO VOLCANOESTENANGO VOLCANOESTENANGO VOLCANOESTENANGO VOLCANOESTENANGO VOLCANOES

Volcanism at the Fuego-Acatenango volcanocomplex has occurred intermittently for more than230,000 years [2], and historical observations oferuptions date back nearly 500 years [1]. Fuegohas erupted more than 60 times historically, butAcatenango has erupted only twice in the 20th

century. Most of the information aboutAcatenango’s past behavior and some informationabout Fuego’s behavior comes from studies ofdeposits produced by prehistoric events. Eruptivebehavior has varied from vigorous explosions,accompanied by tephra falls and pyroclastic flows,to effusive lava flows (figure 5). At least twovoluminous debris avalanches occurred in the last80,000 years.

The volcano massif mostly grew in the past84,000 years [1]. About 84,000 years ago the LosChocoyos ash erupted from Lake Atitlán caldera.It comprises an underlying, tephra deposit (unit H)and an overlying ignimbrite. The unit iswidespread and serves as a stratigraphic marker inthe vicinity of Fuego and Acatenango [1]. Afterthe Los Chocoyos ash fell eruptions of AcatenangoAntiguo emplaced numerous lava flows [1].Activity at Acatenango Antiguo culminatedsometime before 43,000 years ago, with a hugedebris avalanche that is now exposed near LaDemocracia (figure 7, plate 1).

Between 43,000 years before present (BP) andabout 5,000 years BP, Yepocapa cone grew at thesite of Ancient Acatenango. Eruptions producedlava flows, pyroclastic flows, and numeroustephra-fall deposits (figure 5). The last knowneruption from Yepocapa was about 5,000 BP, butYepocapa should be considered potentially active.

Beginning by about 20,000 years ago, eruptionsbegan from the Pico Mayor de Acatenango vent.Eruptions have produced widespread tephra layers,lava flows, and pyroclastic flows (figure 5) [1].The last known pyroclastic flows erupted about2,300 years BP. The last widespread tephradeposits erupted about 1,900 years BP. Historicalaccounts suggest an eruption of Acatenango in AD1661. Phreatic eruptions occurred in AD 1924 to1927 and in December 1972.


Volcanism at the approximate location ofMeseta volcano began 230,000 years ago [2].Numerous lava flows were emplaced, but noknown deposits of pyroclastic flows or tephrashave been correlated to Meseta. One of theyoungest lava flows is less than 30,000 years BP[2]. After emplacement of this lava, but beforeabout 8,500 years BP, an enormous edifice collapseoccurred at Meseta. The resulting debrisavalanche deposit now underlies more than300 km2 of the Pacific coastal plane south ofEscuintla and has a volume of more than 9 km3

(figure 7, plate 1) [1]. A magmatic eruptionprobably accompanied the edifice collapse, but, ifso, its deposits have not yet been detected. Nosubsequent volcanism is known at Meseta.

With an historical record of activity thatincludes more than 60 eruptions since AD 1524,

Fuego is one of the most active volcanoes in theworld. These eruptions are typically short-lived(hours to a few days), violent vulcanian eruptionsthat commonly include pyroclastic flows. Thehistorical record shows four 20-to-50-year-longclusters of activity and sporadic intermittentactivity (figure 4). Widespread pyroclastic depositseast of Fuego with 14C ages of 980 ± 50 BP, 1050± 70 BP, two at about 1350 BP (1330± 60, 1375 ±45), and 3530 ± 70 BP suggest that morevoluminous eruptions, which fill barrancas andspread widely, sometimes occur. Extrapolating thehistorical volume rate of eruption suggests that theentire edifice of Fuego volcano could have beenconstructed in 8,500 years [1]. An agedetermination on one of the youngest Meseta lavasconstrains the age of Fuego to be less than 30,000years old.

Figure 7. Topographic map showing distribution of debris-avalanche deposits from the Fuego-Acatenango volcanocomplex and hazards from future debris avalanches. Area encompassed within heavy dark line indicates areas thatmight potentially be at risk if debris avalanches should occur in the future (Modified from Vallance et al., 1995).


Figure 8. Topographic map showing distribution ofpyroclastic flows (denoted glowing avalanches here)and tephra fall thicker than 20 cm from the 1974 eruptionof Fuego volcano. (Adapted from Davies et al., 1978).

The most recent eruption of Fuego occurred inMay 1999, and the most recent large eruptionoccurred in 1974. The 1974 eruptions spread 20cm or more ash more than 50 km to the southwest(figure 8) [1]. Both eruptions produced pyroclasticflows that moved up to 10 km down valleys andtraveled 60 km/hr. Subsequent rains, especiallyduring the summer monsoons, mobilized lahars thattraveled up to 10 km beyond pyroclastic flowtermini (as much as 20 km from the summit). Asignificant volume of loose volcaniclastic debrisremains stored in steep upper reaches of thebarrancas that head on Fuego.

Although there have been few historicaleruptions at Acatenango, heavy rainfall, especiallyduring the rainy season, could trigger landslides anddebris flows on the steep slopes of the volcanoduring quiescent periods. In October 1998 atCasita volano in Nicaragua, torrential rain triggeredan avalanche and debris flow that swept down thevolcano, spread out on the apron of the volcano,

destroyed two towns and killed more than 2,500people. Steep dissected slopes, partly affected byhydrothermal alteration of the rocks, made Casitamore susceptible to such an event than wereyounger more active volcanoes nearby.Acatenango volcano also has steep slopes androcks that have been partly weakened byhydrothermal alteration. It is thus susceptible, inthe event of torrential rain, to an avalanche and adebris flow much like that which occurred atCasita.

POTENTIAL FUTURE ACTIVITY APOTENTIAL FUTURE ACTIVITY APOTENTIAL FUTURE ACTIVITY APOTENTIAL FUTURE ACTIVITY APOTENTIAL FUTURE ACTIVITY ATTTTTFUEGO VOLCANOFUEGO VOLCANOFUEGO VOLCANOFUEGO VOLCANOFUEGO VOLCANO

On the basis of historical accounts, futurevolcanism of Fuego volcano will comprisemoderate to strong eruptions that includepyroclastic flows which move up to 20 km fromsource and tephra falls which blow up to 100 kmdown wind. Less explosive eruptions will formlava flows. Shallow intrusion of magma orexplosions could trigger an edifice collapse anddebris avalanche. A huge debris avalanche couldflow up to 50 km to the south and destroyeverything in its path, but has a very low probabilityof occurring (about one chance in twenty thousandyears). Lahars will probably derive from heavyrains on loose pyroclastic debris. Such lahars aremost probable soon after eruptions and decrease inlikelihood each year thereafter. Such lahars atFuego could easily move 20 to 30 km from thevolcano. Deposition of laharic debris is apt tochoke channels with debris, increase the chancefor overbank flooding during rainy seasons, andperiodically cause channels to shift course. Floodsand aggradation can damage infrastructure andinconvenience people in populated areas 20 to 40km downstream of the volcano.

POTENTIAL FUTURE ACTIVITY APOTENTIAL FUTURE ACTIVITY APOTENTIAL FUTURE ACTIVITY APOTENTIAL FUTURE ACTIVITY APOTENTIAL FUTURE ACTIVITY ATTTTTACAACAACAACAACATENANGO VOLCANOTENANGO VOLCANOTENANGO VOLCANOTENANGO VOLCANOTENANGO VOLCANO

Like Fuego, Acatenango and its satellite vent,Yepocapa, can erupt explosively to producepyroclastic flows and widespread tephra falls,though the lack of historical volcanism of this type


suggests that the probability of explosive eruptionsat Acatenango is less than that at Fuego. Effusivevolcanism is also possible at Acatenango. Morelikely are phreatic eruptions of limited extent. Sucheruptions are apt to spread fine ash within 10 kmof the summit and hurl ballistic bombs up to onekilometer or so. Landslides and debris flows arealso possible during torrential rainstorms. Becausethere is less loose, easily erodible volcaniclasticmaterial on the slopes of Acatenango than onFuego, debris flows having this origin are less likelythan at Fuego. Furthermore, these phenomena areapt to occur only during unusually intense rain.

VOLCANO-HAZARD-ZONAVOLCANO-HAZARD-ZONAVOLCANO-HAZARD-ZONAVOLCANO-HAZARD-ZONAVOLCANO-HAZARD-ZONATIONTIONTIONTIONTIONMAPSMAPSMAPSMAPSMAPS

The accompanying volcano-hazard-zonationmaps (plates 1, 2, 3, and 4) show areas that couldbe affected by future hazardous geologic events ator near Fuego and Acatenango volcanoes.Individual events typically affect only part of ahazard zone. The location and size of an affectedarea will depend on the location of the eruptingvent or landslide, the volume of material involved,and the character of the eruption, especially itsexplosivity.

Potentially hazardous areas around Fuego andAcatenango volcanoes include proximal and distallahar-hazard zones, pyroclastic-flow-and-lava-flowhazard zones, and tephra-fall hazard zones. Somezones are subdivided further on the basis of theirrelative degree of hazard. Hazard-zone boundariesderive from three main factors. First are themagnitudes of each type of event common at thevolcano, as inferred from historical accounts andprehistoric deposits. Second, in the case of lahars,is an empirical model that calibrates lahar-inundation limits on the basis of lahars of knownvolume that occurred at other volcanoes. Finally,we apply our experience and judgment derivedfrom past experience with events of a similarnature at other volcanoes.

Although sharp boundaries delineate eachhazard zone, the limit of the hazard does not endabruptly at the boundaries. Rather, the hazarddecreases gradually as distance from the volcano

increases, and, for lahars, decreases rapidly withincreasing elevation above valley floors. Areasimmediately beyond distal hazard zones are notfree of risk because the hazard limits can belocated only approximately, especially in areas oflow relief. Many uncertainties about the source,size, and mobility of future events preclude preciselocation of the boundaries of hazard zones.

Users of our hazard maps should be aware thatwe have not exhaustively simulated all potentiallyhazardous landslide and lahar areas. The edificeof the Fuego-Acatenango massif is steep, incised,and partly affected by hydrothermal weakening ofthe rock. For this report, we selected prominentchannels directed toward populous areas in orderto define the most significant impacts of inundationfrom lahars of various volumes. Other channelsfor which we have not modeled lahar inundationare not necessarily devoid of lahar hazard.Landslides and lahars from other unmappedchannels could also threaten life and property.

Proximal laharProximal laharProximal laharProximal laharProximal lahar- hazard zones- hazard zones- hazard zones- hazard zones- hazard zones

The proximal lahar-hazard zone includes areasimmediately surrounding Fuego and Acatenangovolcanoes, and extends about 4 to 5 km outwardfrom the summit depending upon local topography(plates 1 and 2) [2]. This zone delineates areaswhere lahars originate. During periods of volcanicunrest or during an eruption, this area should beevacuated because events can occur too quicklyfor humans to escape harm. Avalanches andlahars will originate in the proximal area, anddeposits from small slides and flows may berestricted to this zone. However, large debrisavalanches and lahars will travel away from thevolcano and flow onto adjacent slopes. The extentof inundation from these larger lahars is the basisfor defining distal lahar-hazard zones.

Distal laharDistal laharDistal laharDistal laharDistal lahar-hazard zones-hazard zones-hazard zones-hazard zones-hazard zones

An automated empirical technique calibratedwith data from other volcanoes [3] estimatespotential areas of inundation from lahars of variousvolumes. For each channel analyzed, we definefour to five nested hazard zones that depict


anticipated inundation by hypothetical “design”lahars having different volumes. The largestdesign lahar, reflects our estimate of the largestprobable lahar generated on the steep slopes ofAcatenango or Fuego volcanoes (plates 1 and 2)[3]. The intermediate and smallest design laharsare more typical lahar volumes for each volcano.Lahars of these sizes have occurred historically atFuego and would be likely at Acatenango after aneruption or during severe rainstorms. The leastvoluminous lahars are those most likely to recur.

Large lahars are less likely to occur than smalllahars. Thus, the nested lahar-hazard inundationzones show that the likelihood of lahar inundationdecreases as distance from the volcano andelevation above the valley floors increases. Nolahar as voluminous as 16 million cubic meters hasoccurred historically at Fuego volcano.Nonetheless, after large eruptive episodes likethose of 1974 and 1932, lahars, floods, andaggradation owing to lahars upstream haveaffected areas as far downstream as the distalmargins of the 16-million-cubic-meter zone(plate 1). The annual probability for inundation ofthe most distal area is about equal to the probabilityof larger eruptions, which occur every 30 to 50years at Fuego. Smaller lahars are sure to occurfor several years after each pyroclastic eruption.

Lahars at Acatenango are considerably lesslikely to occur than those at Fuego. Lahars of alldesignated sizes could form on the volcano’s slopesif unusually intense rainstorms occur. The largestdesign lahar is based on the size of the largestlahar to occur during Hurricane Mitch (plate 2).On 30 October 1998, several days of intense rainderived from Hurricane Mitch, triggered a slopefailure on the south side of Casita volcano,Nicaragua. The avalanche, in turn, generated alahar of 2 to 4 million cubic meters that sweptdown the south side of the volcano, spread out onthe aprons of the volcano, destroyed two towns,and killed about 2,500 people. The likelihood of anintense storm, like Hurricane Mitch, being focusedat Acatenango is probably of the order of 1 in 100years. Such a storm would not invariably triggerlahars as large as the one at Casita. Smaller laharsat Acatenango are more likely to occur, and mayoccasionally result from heavy rains that normally

occur each year during the rainy season of May toNovember.

In general, lahar hazard zones extend 15 to25 km from the summit crater, but a few extendfarther (plates 1 and 2). Local topography plays alarge role in controlling lahar distance travelled.Although lahars originate in and flow along steeplyincised drainages on the flanks of the volcano,these channels shallow and the topography flattensalong alluvial fans south of the volcanoes. As aresult, lahars rapidly spill out of channels, spread,and stop. The most distant hazard zones coincidewith the most deeply incised channels, in whichlahars will remain confined. Despite theirrelatively short runout distances, even the smallestlahars can be devastating.

Drainages south of Fuego are so choked withvolcaniclastic sediment from lahars and pyroclasticflows that channels occasionally fill with sedimentand switch course. Until 1974, Río Tanilyafollowed the course of Río Obispo towardSiquinalá; afterward, it switched course and flowedsoutheastward into Río Panteleón. Areas likely tobe affected by continuing sedimentation andchannel shifting are designated in drainages southof Fuego volcano. These areas will only beaffected when sedimentation causes an existingchannel to shift. Hazards in these drainages areless than in neighboring channels that head on thevolcano, but, as in neighboring drainages, decreasewith distance downstream. Channels may changecourse suddenly, and when they do hazards in thenew channel are greatly increased.

Pyroclastic-flow and lava-flow hazardPyroclastic-flow and lava-flow hazardPyroclastic-flow and lava-flow hazardPyroclastic-flow and lava-flow hazardPyroclastic-flow and lava-flow hazardzoneszoneszoneszoneszones

Pyroclastic flows (plate 3) have occurredduring every major and most minor eruptions atFuego. Such flows occur every 10 to 20 years, butcan be more frequent. Pyroclastic flows are likelyto move up to 10 or 12 km from their source at thesummit. Fuego also produces lava flows. Thesecan move 5 to 20 km from source (figure 8,plate 3). Occasionally, parts of lava flows on thevery steep slopes of Fuego will collapse to producepyroclastic flows. During historical time, lava


flows have been less common at Fuego thanpyroclastic flows.

Acatenango most recently produced pyroclasticflows about 2000 years ago. On the basis of itspast record, pyroclastic flows are likely atAcatenango about once every 1000 years. Likethose at Fuego, pyroclastic flows at Acatenangoare likely to move up to 10 or 12 km from theirsource at the summit (plate 4). Lava flows willalso occur at Acatenango during eruptions andcould move up to 10 km down slope (plate 4).Their likelihood is of the order of one in onethousand years.

TTTTTephra-fall hazard zonesephra-fall hazard zonesephra-fall hazard zonesephra-fall hazard zonesephra-fall hazard zones

Tephra fall deposits from Fuego may occur upto 100 km downwind. On the basis of historicaleruptions tephra deposits could be 5 cm thick ormore within 50 km of source, 10 cm thick or morewithin 25 km of source, and 20 cm thick or morewithin 15 km or source (figure 9). Tephra canblow any direction, but will most probably bloweast to east-southeast in the months fromDecember though May and west to west-southwest in the months from June to December(figure 10). Tephra falls of 10 to 20 cm or morecan potentially cause roofs to collapse. Roofcollapse is more likely if rains accompany tephraso that it is wet.

Numerous people live within areas that couldbe affected by tephra from Fuego (table 1).Tephra deposits of the size modelled in figure 9 arelikely to occur about once every 20 to 50 years.Smaller tephra falls will occur more frequently.Tephra falls from Acatenango could be as large asthose from Fuego, but are much less likely (caonce per thousand years). The tephra distributionshown for Fuego (figure 9) is also applicable forAcatenango since the volcanoes are centered innearly the same place.

Debris-avalanche hazard zonesDebris-avalanche hazard zonesDebris-avalanche hazard zonesDebris-avalanche hazard zonesDebris-avalanche hazard zones

Debris avalanches have occurred twice at theFuego-Acatenango volcano complex in the past80,000 years. The largest of these resulted from

the edifice collapse of Meseta circa 10,000 yearsago, flowed past the present site of Escuintla, andspread over more than 300 km2 of the Pacificcoastal plain to a distance of up to 50 km fromsource (figure 7, plate 1). The older oneapparently derived from an edifice collapse ofAcatenango Antiguo very approximately about40,000 years ago. It moved past the present site ofLa Democracia to a distance of more than 40 kmfrom source.

Debris avalanches can occur at Fuego andAcatenango but should be considered as veryremote possibilities, on the order of 1 in 20,000years. Nonetheless, scientists should be aware ofpotential precursors of future possible debrisavalanches. Such precursors might include bulgingof the volcano edifice, formation of major arcuatefractures in the edifice, and signs of shallowintrusion of magma with the upper edifice. On thebasis of past events at the Fuego-Acatenangovolcano complex, debris avalanches could haveheight-to-runout ratios of as little as 0.07 and travelup to 50 km from source (figure 7). The debris-avalanche hazard zone, shown as a heavy dark linein figure 7, derives from the size and mobility ofpast debris avalanches at the volcano complex. Asingle debris avalanche would not cover the entirearea denoted but could cover a significant fractionof that area.

HAZARD FORECASTS ANDHAZARD FORECASTS ANDHAZARD FORECASTS ANDHAZARD FORECASTS ANDHAZARD FORECASTS ANDWARNINGSWARNINGSWARNINGSWARNINGSWARNINGS

Scientists can recognize and monitor indicatorsof impending volcanic eruptions. The movement ofmagma into a volcano prior to an eruption causeschanges that can usually be detected by variousgeophysical instruments and visual observations.Swarms of small earthquakes are generated asrock fractures to make room for rising magma oras heating of fluids increases pressuresunderground. Heat from the magma can increasethe temperature of ground water and raisetemperatures and enhance steaming fromfumaroles; it can also generate small steamexplosions. The composition of gases emitted byfumaroles changes as magma nears the surface,


Figure 9. Map showing population density and tephra-fall hazard zones of 20 cm at 15 km distance, 10cm at 25 km distance, and 5 cm at 50 km distance for the Fuego-Acatenango volcano complex. See textfor discussion.


and injection of magma into the volcano can causeswelling or other types of surface deformation.

Guatemala has one seismometer near Fuego,and a modest regional seismic network, so asignificant increase in volcanigenic earthquakes atFuego volcano would be noticed quickly. Thereare not presently enough seismometers at Fuego tolocate earthquakes, and it would be difficult todistinguish and locate new volcanic earthquakesthat might be associated with Acatenango volcano.

Periods of unrest at volcanoes produce times ofgreat uncertainty. During the past few decades

substantial advances have been made in volcanomonitoring and eruption forecasting, but stillscientists can often make only very generalstatements about the probability, type, and scale ofan impending eruption. Precursory activity can gothrough accelerating and decelerating phases, andsometimes die out without an eruption.Government officials and the public must realizethe limitations in forecasting eruptions and must beprepared to cope with such uncertainty.

Despite advances in volcano monitoring anderuption forecasting, it is still difficult, if notimpossible, to predict the precise occurrence oflandslides triggered by earthquakes or torrentialrains. Therefore, potentially lethal lahars can, andmost likely will, occur again at Fuego andAcatenango volcanoes without warning.Government officials and the public need torecognize the locations of lahar hazard zones andrealize that the events depicted by these hazardzones can occur without warning.

PROTECTING COMMUNITIES ANDPROTECTING COMMUNITIES ANDPROTECTING COMMUNITIES ANDPROTECTING COMMUNITIES ANDPROTECTING COMMUNITIES ANDCITIZENS FROM VOLCANO-RELACITIZENS FROM VOLCANO-RELACITIZENS FROM VOLCANO-RELACITIZENS FROM VOLCANO-RELACITIZENS FROM VOLCANO-RELATEDTEDTEDTEDTEDHAZARDSHAZARDSHAZARDSHAZARDSHAZARDS

Communities, businesses, and citizens need toplan ahead to mitigate the effects of futurevolcanic eruptions, debris avalanches, and laharsfrom Fuego and Acatenango volcanoes. Long-term mitigation efforts must include usinginformation about volcano hazards when makingdecisions about land use and siting of critical

0

5

10

15

20

25

30

SWSW W

NNWNNE E

SSESSW

WNW NENE

ESECalm

WIND DIRECTIONTephra will blow in this direction

PR

OB

AB

ILIT

Y IN

PE

RC

EN

T

FebruaryAugust

Figure 10. Map showing the probability of winddirections between 10,000 and 50,000 feet for Guatemala.February directions are typical of the dry season fromDecember though May and August directions aretypical of wind directions for the rainy season from Juneto December. Note that directions given here are thedirection in which tephra plume will move rather thandirections from which winds move.

Table 1. Population that could be affected by tephra falls like those of 1974 from Fuego.

Maximum Population thatQuadrant Radius thickness could be affected

Western 15 km 20 cm 14,000Eastern 15 km 20 cm 60,000Western 25 km 10 cm 49,000Eastern 25 km 10 cm 429,000Western 40 km 5 cm 364,000Eastern 40 km 5 cm 2,730,000


facilities. Future development should avoid areasjudged to have an unacceptably high risk or beplanned and designed to reduce the level of risk.

When volcanoes erupt or threaten to erupt, awell-coordinated emergency response is needed.Such a response will be most effective if citizensand public officials have a basic understanding ofvolcano hazards and have planned the actionsneeded to protect communities.

Because a volcanic eruption can occur withinweeks to months after the first precursory activityand because some hazardous events, such aslandslides and lahars, can occur without warning,suitable emergency plans should be made inadvance. Because Fuego is continuously active atsome level, public officials need to consider issuessuch as public education, communications, andevacuations as part of a response plan.Emergency plans already developed for floods mayapply to some extent, but may need modificationsfor hazards from lahars. For inhabitants in low-lying areas, a map showing the shortest route tohigh ground will also be helpful for evacuations.

Knowledge and advance planning are the mostimportant items for dealing with volcano hazards.Especially important is a plan of action based onthe knowledge of relatively safe areas aroundhomes, schools, and workplaces. Lahars pose thebiggest threat to people living or recreating alongchannels that drain Fuego and Acatenangovolcanoes. The best strategy for avoiding a laharis to move to the highest possible ground. A safeheight above river channels depends on manyfactors including the size of the lahar, distancefrom the volcano, and shape of the valley.

REFERENCESREFERENCESREFERENCESREFERENCESREFERENCESBasset, T., 1996, Histoire éruptive et évaluations des

aléas du volcan Acatenango Guatemala: PhDthesis, University of Geneva, 240 p.

Bonis, S.B. and Salazar, O, 1973, The 1971 and1973 eruptions of Volcán de Fuego, Guatemala,

and some socio_ecoonomic considerations forthe volcanologist: Bulletin of Volcanology, v. 37,p. 394-400.

Chesner, C.A. and Halsor, S.P, 1997, Geochemicaltrends of sequential laval flows from Mesetavolcano, Guatemala: Journal of Volcanology andGeothermal Research, v. 21, p. 25-41.

Chesner, C.A. and Rose. W.I., 1984, Geochemistryand evolution of Fuego volcano complex,Guatemala: Journal of Volcanology andGeothermal Research, v. 78, p. 221-237.

Davies, D.K., Querry, M.W. and Bonis, S.B., 1978,Glowing avalanches from the 1974 eruption ofthe volcano Fuego, Guatemala: GeologicalSociety of America Bulletin, v.89, p. 369-384.

Iverson, R.M., Schilling, S.P., and Vallance, J.W.,1998, Objective delineation of lahar-hazard zonesdownstream from volcanoes: Geological Societyof America Bulletin, v. 110, p. 972-984.

Muñoz, C., 2001, Analyse et simulation desinstabilités de terrain et lahars sur les volcansAcatenango-Fuego, zonage par systèmed’information géographique: PhD thesis,University of Geneva, 229 p.

Rose, W.I., Anderson, A.T., Woodruff, L.G., andBonis, S.B., 1978, The October 1974 basaltictephra from Fuego volcano: description andhistory of the magma body: Journal ofVolcanology and Geothermal Research, v. 4, p.3-53.

Rose, W.I., Mercado, R., Matías, O. and Girón, J.,1987, Volcanic hazards of Fuego volcano,Guatemala, Preliminary Report: MichiganTechnological University, U.S. GeologicalSurvey, and INSIVUMEH, 30 p.

Vallance, J. W., Siebert, L., Rose, W. I., Girón, J,and Banks, N. G., 1995, Edifice collapse andrelated hazards in Guatemala: J. Volcanol. andGeotherm. Res., v. 66, p. 337-355.

Vessel, R.K. and Davies, D.K., 1981, Nonmarinesedimentation in an active fore ark basin, SEPMSpecial Publication no. 31, p. 31-45.


Additional Suggested ReadingAdditional Suggested ReadingAdditional Suggested ReadingAdditional Suggested ReadingAdditional Suggested Reading

Blong, R.J., 1984, Volcanic hazards: AcademicPress, Orlando, 424 p.

Tilling, R.I., ed., 1989, Volcanic hazards: Shortcourse in geology, v. 1, American GeophysicalUnion, Washington, D.C., 123 p.

Vallance, J.W. 2000, Lahars: in Sigurdsson, H.,Houghton, B., McNutt, S., Rymer, H., and Stix,J., Encyclopedia of Volcanoes, Academic Press,San Diego, p. 601-616.

END NOTESEND NOTESEND NOTESEND NOTESEND NOTES[1] For Acatenango volcano, the geologic data

upon which this report is based come chieflyfrom Basset (1996); for Fuego, geologyderives from Bonis and Salazar (1973), Rose etal. (1978), Davies et al. (1978), Vessel andDavies (1981), Vallance et al. (1995), andMuños (2001).

[2] An 40Ar/39Ar age performed by MarvinLanphere of the U.S. Geological SurveyGeochronology Laboratory shows that one ofthe oldest lavas exposed in the slopes ofMeseta (FL-2, Chesner and Halsor, 1997) is234,000 ± 31,000 years old. Lanphere alsodetermined that one of the youngest lava flows(FL-27, Chesner and Halsor, 1997) has an 40Ar/39Ar age of 18,000 ± 11,000.

[3] The maximum extent of the proximal lahar-hazard zone derives from the formula H/L≈ 0.5, in which H is the elevation differencebetween the summits of Fuego and Acatenangoand the hazard boundary line and L is thehorizontal distance from the center of thesummit crater to the hazard boundary line (see,for example, Iverson et al., 1998). The steepslopes within the proximal zone are the likelysource of future lahars. More gentle slopesoutside the proximal zone are areas wherelahars will funnel into valleys, traveldownstream, and spread out on alluvial fans.

[4] We constructed lahar-hazard zones by chosingdesign-lahar volumes of 500,000; 1,000,000;2,000,000; 4,000,000, cubic meters forAcatenango and 1,000,000; 2,000,000;4,000,000, 8,000,000; and 16,000,000 cubicmeters for Fuego. We then modelled eachvolume using a repeatable empirical model anddigital cartographic technique described inIverson et al. (1998). The model requires thechoice of a reasonable range of volumes foreach volcano. It then uses these volumes tocompute average cross-sectional areas andareas of inundation for each lahar volume. TheGIS based computer program, LAHARZ(Iverson et al., 1998) then calculates the extentof inundation downstream from source area ineach drainage that heads on the volcano.

2424242424 Volcano Hazards at Fuego and Acatenango, GuatemalaVolcano Hazards at Fuego and Acatenango, GuatemalaVolcano Hazards at Fuego and Acatenango, GuatemalaVolcano Hazards at Fuego and Acatenango, GuatemalaVolcano Hazards at Fuego and Acatenango, GuatemalaPrinted on recycled paper

Vallance and others — VO

LCAN

O H

AZA

RDS A

VOLCA

NO

HA

ZARD

S A VO

LCAN

O H

AZA

RDS A

VOLCA

NO

HA

ZARD

S A VO

LCAN

O H

AZA

RDS AT FU

EGO

AN

D A

CAT FU

EGO

AN

D A

CAT FU

EGO

AN

D A

CAT FU

EGO

AN

D A

CAT FU

EGO

AN

D A

CATENA

NG

O, G

UA

TENA

NG

O, G

UA

TENA

NG

O, G

UA

TENA

NG

O, G

UA

TENA

NG

O, G

UATEM

ALA

TEM

ALA

TEM

ALA

TEM

ALA

TEM

ALA

— U.S. Geological Survey —

Open-File Report 01-431

Documents

Volcano Hazards at Fuego and Acatenango, Guatemala · Volcano Hazards at Fuego and Acatenango, Guatemala 7 INTRODUCTION The Fuego-Acatenango massif comprises a string of five or more