ANTISENSE & NUCLEIC ACID DRUG DEVELOPMENT 10:453-461 (2000)Mary Ann Liebert, Inc.

Variations in mRNA Content Have No Effect on thePotency of Antisense Oligonucleotides

LOREN MIRAGLIA, ANDREW T. WATT, MARK J. GRAHAM, and STANLEY T. CROOKE

ABSTRACT

A fundamental question with regard to antisense pharmacology is the extent to which RNA content or tran¬scription rate or both affect the potency of antisense drugs. We have addressed this by controlling RNA contentand transcription rate using either an exogenous gene expressed after transfection or an endogenous gene in¬duced with a cytokine. We have demonstrated that in both A549 and HeLa cells, varying RNA copy numbersfrom < 1 to > 100 copies per cell has no effect on the potency of RNase -active antisense drugs transfected intocells, nor did variation in transcription rate have an effect on potency. We demonstrate that this is because thenumber of oligonucleotide molecules per cell is vastly in excess of the RNA copy number. These data furthersuggest that a significant fraction of cell-associated antisense drug molecules may be unavailable to interactwith the target RNA, an observation that is not surprising, as phosphorothioate oligonucleotides interact withmany cellular proteins. We suggest that these data may extrapolate to in vivo results.

INTRODUCTION

In the past several years, substantial progress has beenmade in advancing antisense oligonucleotides from the labo¬

ratory to the clinic. In 1998, the first antisense drug, Vitra-vene™ (Isis Pharmaceuticals, Carlsbad, CA), was approved bythe FDA for commercialization. Promising activities in clinicaltrials have been shown by several other antisense compounds,including ISIS 2302, ISIS 3521, ISIS 5132, and G-3139, and re¬

ductions in target RNA levels have been reported in humanstreated with ISIS 2302 (colon) (Yacyshyn et al., 1998), ISIS5132 (peripheral blood cells) (O'Dwyer et al., 1998), and G-3139 (peripheral blood cells) (Webb et al., 1997). In addition tothese data, there are many studies of animal models supportingthe activity, specificity, and therapeutic utility of antisensedrugs (for review, see Crooke, 1998).

Although there has been significant progress in understand¬ing the pharmacologie properties of antisense oligonucleotides,a more detailed understanding of the mechanism of action andthe factors that influence both the antisense and nonantisenseactivities of various classes of oligonucleotides is not yet devel¬oped. For example, a number of studies have shown that the po¬tencies of phosphorothioate oligodeoxynucleotides (PS-ODN)vary widely, depending on the site in an RNA species to whichthey bind, even though they have nearly identical theoreticalaffinities for the RNA target sites and similar abilities to induce

degradation of the targeted RNA by serving as substrates forRNase H (Chiang et al., 1991; Dean et al, 1994; Monia et al.,1996a). Despite substantial effort, unifying hypotheses to ex¬

plain these observations are yet to be developed.One useful way of thinking about the mechanisms of action

of antisense oligonucleotides is as inhibitors of the intermediarymetabolism of target RNA species. After binding to target RNA,antisense oligonucleotides may enhance the rate of degradationof the target RNA (e.g., activate RNase H) or disrupt the meta¬bolic processes that result in effective utilization of the matureRNA (for review, see Crooke 1998). In this context, it is clearthat the rates of a number of events may influence the antisensepotencies of oligonucleotides. These include transcription rate,the rate of processing of the pre-mRNA, the translational rateand rate of degradation of the RNA, as well as the various fac¬tors that determine the concentration of drug at the site of ex¬

pression of the target RNA. Substantial debate has focused on

two questions. How is the potency of an antisense drug influ¬enced by the cellular concentration of the target RNA? What ef¬fect does the transcription, rate have on this potency? Answersto these questions could have substantial effect on the design ofantisense drugs and the choice of potential targets. For exam¬

ple, it has been argued that antisense drugs might be more ef¬fective against RNA targets of lower abundance.

For traditional drug-receptor interactions and traditional test¬

ing methods, receptor concentration usually has a profound ef-

Isis Pharmaceuticals, Inc., Carlsbad, CA 92008.

453

454 MIRAGLIA ET AL.

feet on drug action because receptors are usually in excess ofboth drug molecules and signaling processes. Mathematicaltreatments that consider receptors in excess of those necessaryto initiate a full agonist response have led to the term "spare re¬

ceptors" (Takeyasu et al., 1979; Minneman and Abel, 1984).The pharmacologie behavior of antisense drugs may, however,differ substantially from that of traditional drugs when studiedin in vitro cellular assays for two reasons. First, data derived inthe past several years have demonstrated that the majority ofmRNA species are present in a very low number of copies percell (Velculescu et al., 1995, 1997; Gygi et al., 1999). For ex¬

ample, in yeast, the majority of mRNA species have been re¬

ported to be present at 10 or less copies per cell (Gygi et al.,1999). Similarly, in human pancreas, most mRNA species ap¬peared to be present in a low number of copies per cell, and innormal and melanoma lung tissue, mRNA species varied from0 to 301 copies per cell. This is in clear contradistinction to thenumber of copies of proteins encoded by these mRNA species.Again, in yeast, for example, the number of copies of proteinswas typically 103 greater than the number of copies of mRNA(Gygi et al., 1999). Second, to facilitate screening and pharma¬cologie studies, most in vitro experiments involve transfectionof antisense oligonucleotides, potentially resulting in substan¬tially higher concentrations of these drugs at the sites wheretheir receptor RNA species are located than would be achievedby traditional drugs in traditional assays.

In this communication, we provide the first direct evaluationof the impact of variations in receptor RNA content and tran¬scription rate on the potency of antisense drugs in vitro. To an¬swer these questions, we have determined the effects of RNase -active antisense drugs on transcripts that vary in copy num¬

ber by at least 50-fold. Furthermore, we have shown that anti-sense oligonucleotides are in great excess of the target mRNAin both an inducible and endogenous system.

MATERIALS AND METHODS

Cell culture

The human epithelial cervical adenocarcinoma cell lineHeLa and the human epithelial lung carcinoma cell line A549were obtained from the American Type Culture Collection(ATCC, Rockville, MD). Both cell lines were grown in Dul-becco's modified Eagle's medium (DMEM) (GIBCO-BRL,Gaithersburg, MD) supplemented with 10% heat-inactivatedfetal bovine serum (FBS). Caco-2 cells were also obtained fromATCC and grown in Eagle's minimal essential medium(EMEM) with Earle's BSS and 2 mM L-glutamine that wasmodified to contain 1.0 mM sodium pyruvate, 0.1 mMnonessential amino acids, and 1.5 g/L sodium bicarbonate(GIBCO-BRL) and supplemented with 20% FBS.

Construction of plasmidsThe Ha-ras/luciferase fusion plasmid, RA10, was created

from two plasmids, a Ha-ras reporter gene plasmid describedpreviously (Monia et al., 1992) and pMAM/teo-LUC, pur¬chased from Clontech (Palo Alto, CA). The luciferase/Ha-ras

fusion plasmid was restricted with Nhel and Kpnl to release theHa-ras/luciferase fragment. This fragment was cloned into theNhel/Kpnl sites of pMAMneo-LUC, replacing the wild-typeluciferase coding region with the Ha-ras/luciferase fusion.

Synthesis of luciferase oligonucleotidesSynthesis and purification of the luciferase oligonucleotides

were performed as described previously (Monia et al., 1996b).The Ha-ras oligonucleotide ISIS 2503 has been described pre¬viously (Monia et al., 1992).

Transient transfections and oligonucleotide treatment

The plasmid pCMV/3 was purchased from Clontech, and theplasmid REP-6, which expresses the rat glucocorticoid receptorunder the control of the Rous sarcoma virus long terminal re¬

peat (LTR), has been described previously (Miesfeld et al.,1986). Cells were plated 24 hours before transfection at a den¬sity of 1-2 X 105 cells per well in 6-well plates (Falcon 3846)(Falcon, Becton Dickinson Labware, Lincoln Park, NJ) or, forA549 cells, 6 X 103 cells per well in 96-well plates. At the timeof transfection, cells were 60%-80% confluent. Plasmid trans¬fection was achieved by combining 2.25 µg DNA (1.75 µgRA10, 0.25 µg REP-6, and 0.25 µg pCMV/3) with SuperFect(Qiagen, Valencia, CA) at a concentration of 5 µVµg DNA ac¬

cording to the protocol supplied by the manufacturer. The finaltransfection volume was 0.7 ml. After a 2-hour incubation,medium was removed, and cells were washed once with phos¬phate-buffered saline (PBS). Fresh growth medium (DMEMsupplemented with 10% FBS) was then added to the'cells. Cellswere induced 16 hours later with the appropriate amount ofdexamethasone for 5 hours and harvested in lysis buffer accord¬ing to the manufacturer's protocol (Promega, Madison, WI).

For all oligonucleotide treatments, cells were first washedonce with PBS to remove the serum-containing medium.Oligonucleotide was mixed with either OptiMEM or DMEMcontaining the cationic lipid, Lipofectin (GIBCO-BRL), at a

concentration of 3 /¿g/ml Lipofectin per 100 nM oligonu¬cleotide and added to the cells. After 4 hours, the oligonu¬cleotide solution was replaced with DMEM plus 10% FBS or

DMEM plus 10% FBS containing either dexamethasone (lu¬ciferase) or tumor necrosis factor- (TNF- ) (intercellular ad¬hesion molecule-1 [ICAM-1]) for the rest of the experiment.Dexamethasone was obtained from Sigma (St. Louis, MO), andTNF- was purchased from R&D Systems (Minneapolis, MN).

Luciferase and ß-galactosidase assays

Lysates were analyzed for both jß-galactosidase activity(Bio-Rad model 3550 Microplate Reader) (Bio-Rad, Hercules,CA) and luciferase activity (Packard TopCount-NXT Mi¬croplate scintillation counter) (Packard, Downers Grove, IL)according to the basic protocol provided by Promega. Briefly,cells were washed twice with PBS before adding 250 µ lysatebuffer. Cells were then placed on ice and scraped from thewells. Lysates were vortexed and spun in a tabletop microcen¬trifuge for 2 minutes. The supernatant was removed and placedin microcentrifuge tubes that were stored at

—

80°C until analy¬sis. Lysates were thawed to ambient temperature and analyzed.

EFFECTS OF RNA CONTENT ON ANTISENSE POTENCY 455

Screening of luciferase antisense oligonucleotidesSeventeen full phosphorothioate oligonucleotides were de¬

signed that target the cDNA sequence of firefly luciferase.HeLa cells were transfected with pMAMneo-LUC, REP-6, andpCMV/3 as described. Luciferase oligonucleotides were

screened at a concentration of 200 nM by treating the HeLacells from 10 µ stocks for 4 hours and then inducing with 200nM dexamethasone for 5 hours. Cell lysates were analyzed forluciferase and /3-galactosidase enzyme activity.

Northern blot analysis of Ha-ras/luciferase-transfectedand untransfected HeLa cells

Transfected cells were trypsinized and washed in DMEMcontaining 10% FBS. After a 5-minute spin at 1500 rpm, cellswere washed again in PBS chilled to 4°C and transferred to a

sterile 1.5-ml microcentrifuge tube. Cells were either processedby the RNeasy kit (Qiagen) or pelleted, and poly A+ mRNAwas generated using the Micro-FastTrack protocol (Invitrogen,Carlsbad, CA) according to the manufacturer's protocol. Bothtotal and poly A+ mRNA were analyzed on a 1.2% agaroseformaldehyde gel and transferred to a Hybond N+ membrane(Amersham, Arlington Heights, IL) over a 14-hour period.RNA was cross-linked by exposure to UV light in a Stratalinker(Stratagene, La Jolla, CA) and hybridized to a asymmetric PCRprobe generated using a 3' primer, which binds to the 3'-end ofan 817-bp luciferase PCR product. Reaction conditions used1 X PCR buffer and Taq (Perkin-Elmer Cetus, Emeryville,CA), 1.5 µ dNTP mix minus dCTP (1 µ each), 1.25 µ of 20µ stock of 3' luciferase primer (5'-ACAACGGCGGCGG-GAACTTCACCGG-3'), 1 µ dH20, 1 µ (10-20 ng) 818-bpluciferase PCR product (corresponding to bases 724-1541 ofthe luciferase coding region), and 6 µ 32-P dCTP. The 818-bpproduct was generated using the excised luciferase fragmentfrom RA10 as a template with a 5' primer (5'-AGAACTGC-CTGCGTCAGATTCTCGC-3') and the 3' primer describedunder standard PCR conditions according to the manufacturer.The membrane was stripped and reprobed with a PCR-gener-ated Ha-ras probe. This probe was derived from a Ha-ras PCRproduct from bp 1664-2225 of the Ha-ras cDNA. The PCRproduct was amplified by using a 25-mer 5' primer correspond¬ing to bp 1664-1688 (5'-ATGACGGAATATAAGCTGGTG-GTGG-3') and a 3' primer corresponding to bp 2201-2225 (5'-GCACACACTTGCAGCTCATGCAGCC-3') under standardconditions (Perkin-Elmer Cetus). The 3' primer was used togenerate an asymmetric PCR probe using the same conditionsas the luciferase probe. All membranes were visualized andquantitated with a Phosphorlmager (Molecular Dynamics, Sun¬nyvale, CA). Blots were then stripped and reprobed with a 32P-radiolabeled G3PDH probe (Clontech) to normalize loading.

To generate an untreated Ha-ras dose-response curve, HeLacells were transfected with oligonucleotide at 60%-80% con-

fluency. At 9 hours after transfection, cells were either har¬vested in guanidinium isothiocyanate and processed as de¬scribed previously (Dean et al., 1994) or processed withRNeasy according to the provided protocol. Northern blotswere probed with the Ha-ras PCR probe and normalized with a

random prime-generated G3PDH (Clontech) probe accordingto the protocol provided by the manufacturer (Promega).

Estimation of mRNA copy number

For determination of the copy number of Ha-ras mRNA percell in HeLa cells, Caco-2 cells of a known Ha-ras copy num¬

ber* were grown to 80% confluency, counted, and then har¬vested in guanidinium isothiocyanate and processed as de¬scribed previously (Dean et al., 1994). This mRNA was thenseparated on a 1.2% formaldehyde/agarose gel at different dilu¬tions alongside HeLa mRNA obtained from a known number ofcells. The Northern blot was probed with the Ha-ras PCR probeand normalized with the G3PDH probe.

Luciferase mRNA copy number was estimated by comparingHa-ras/luciferase mRNA levels from transfected HeLa cells toa dilution series of T7-generated Ha-ras/luciferase RNA byNorthern blot analysis. A T7 Ha-ras/luciferase construct was

generated by subcloning the Nhel/BamHI fragment of RA10containing Ha-ras/luciferase and the SV40 polyadenylation sig¬nal into the Xbal/BamHI site of pBSKS (Stratagene). Thisplasmid, pBS-T7-Ha-ras/luciferase, was then restricted withBamHl. ICAM-1 copy number was estimated using a full-length ICAM-1 cDNA cloned in front of a T7 promoter. BothHa-ras/luciferase and ICAM-1 mRNA were generated usingthe RiboMAX Large Scale RNA Production System-T7 ac¬

cording to the manufacturer's protocol (Promega).

RT-PCR analysis of TNF-a-induced ICAM-1expression in ISIS 2302-treated A549 cells

For determination of ICAM-1 levels in A549 cells, afteroligonucleotide treatment and TNF- induction, mRNA was

harvested using RNeasy, and the resulting purified mRNA was

subjected to RT-PCR using Moloney murine leukemia virus(MoMuLV) reverse transcriptase (RT) (GIBCO-BRL) and Taqpolymerase (Perkin-Elmer Cetus).

Determination of cell-associatedoligonucleotide molecules

To characterize cell-associated oligonucleotide, HeLa cellsgrown in 6-well plates were transfected with the appropriateplasmids (RA10, REP-6, and CMV/3) as described. After 16hours, cells were transfected with oligonucleotide using stan¬dard protocols with either 50 or 200 nM of ISIS 2503 or ISIS22717. Cells were harvested 4 hours later with trypsin.Trypsinization was stopped with the addition to each well of 1ml DMEM containing 10% FBS. Cells from two plates were

*The copy number for Ha-ras was determined from serial analysis ofgene expression (SAGE) information available on the SAGE map web¬site home page (http://www.ncbi.nlm.nih.gov/SAGE/). The available li¬braries were screened for the Ha-ras tag using the Unigene identifier Hs{Homo sapiens) 37003 located from the LocusLink website(http:/fyvww.ncbi.nlm.nih.govlLoc\isL\n]iL) by searching for Harvey ras.

This resulted in a match to the Caco-2 cell line for 3 tags out of a totalof 26,669 tags. Based on the assumption of 300,000 copies of mRNAper human cell, the conversion to copy number is calculated by dividingthe observed number of tags for a given transcript by the total numberof tags obtained and multiplying by 300,000 or 3/26,669 X 300,000equals 33.7 copies per cell.

456 MIRAGLIA ET AL.

pooled together and centrifuged 10 minutes at 1000 rpm. Cellcounts were also performed to determine total number of cellsper sample. After resuspension in PBS, cells were centrifugedagain at 1000 rpm for 10 minutes. Supernatant was removed,and samples were frozen at -80°C. Samples were thawed andprocessed by cellular digestion with proteinase K, organic ex¬

traction, and solid-phase extraction to purify samples beforecapillary gel electrophoresis (CGE) analysis (Graham et al.,1998).

The number of oligonucleotide molecules per cell was deter¬mined by comparing the peak heights and migration times ofthe samples versus those of an internal standard (T27 at 30pmol). Thus, the number of molecules per cell could be readilydetermined by applying Avogadro's number (6.02 X 1023 mol¬ecules per mol) to the concentration and dividing by the numberof cells (~1 X 106) present in each sample.

RESULTS

Construction ofHa-ras/luciferase reporter systemTo evaluate the effects of variations in mRNA copy number

and transcription rate on the potency of antisense drugs, we

constructed a plasmid that contained an inducible promoter, a

well-characterized antisense oligonucleotide target sequencecontained within 118 nt of the 5'-UTR and coding region of Ha¬ras, and a luciferase fusion gene. Figure 1A shows the reporterplasmid with the binding sites of both ISIS 2503, which bindsto the AUG site in endogenous Ha-ras RNA and the identicalsite in the plasmid-derived sequence, and ISIS 22717, the lu¬ciferase RNA-specific antisense inhibitor. This Ha-ras/lu¬ciferase fusion plasmid was chosen in part because the lu¬ciferase assay is precise enough to support quantitative

A Nhel

j -53 2503

cccctgaggagcgATGacgga+65

luciferase

Kpnl

IggtaccJ

Poly-An

gccagtcaagtaacacccgc]22717

M 0.2

rrnrralyl

.]I

? 0.5 1.5 2 * 12 IS

! '

Time (h)

3

3

E£L

Time (h)

200 !oo 750 1O00 1500 2000

Dex Concentration (nM)

FIG. 1. Construction and expression of the Ha-ras luciferase reporter gene. (A) Ha-ras/luciferase reporter construct. A Nhel/Kpnl fragment fromnucleotide -53 to +65 of the Ha-ras 5'-UTR and coding region, including the target sequence of ISIS 2503 fused in-frame to the coding sequenceof firefly luciferase (P. pyralis), was inserted into the plasmid pMAMneo-LUC as described in Materials and Methods. The start codon of the fu¬sion gene is capitalized. Amino acids 1-24 of Ha-ras are present in this fusion construct. The target sequence of the most active antiluciferaseoligonucleotide, ISIS 22717, is also shown. (B) Dexamethasone-induced expression of Ha-ras luciferase over 15 hours. Cell extracts were pre¬pared, and enzyme activity was quantitated as described in Materials and Methods. (C) Short time course of dexamethasone-induced Ha-ras/lu¬ciferase expression. (D) Dexamethasone induction of Ha-ras/luciferase. Treatment and analysis were performed as described in Materials andMethods. The effects of varying doses were assayed after a 5-hour treatment with dexamethasone.

EFFECTS OF RNA CONTENT ON ANTISENSE POTENCY 457

comparisons between dose-response curves. The oligonu¬cleotide target sequence for the human gene, Ha-ras, containedin the fusion construct, is also expressed endogenously in HeLacells. We have studied both the sites using the luciferase re¬

porter system and the endogenous RNA from HeLa cells with a

variety of antisense oligonucleotides, including ISIS 2503 (Mo¬nia et al., 1992). The mouse mammary tumor virus (MMTV)promoter supports manipulation of transcription rate andmRNA copy number by administration of the glucocorticoiddexamethasone.

The time course of induction of luciferase in HeLa cellstransfected with the luciferase plasmid and treated with 200 nMdexamethasone over a 15-hour period demonstrates that maxi¬mal induction of luciferase activity occurred between 4 and 12hours after addition of dexamethasone. A more detailed timecourse over a 5-hour period demonstrated an increase in lu¬ciferase activities between 2 and 5 hours. Based on the timecourses, a 5-hour postdexamethasone treatment was selected toevaluate the effects of various dexamethasone concentrations.Induction of luciferase activity was dependent on the concen¬

tration of dexamethasone added to cells, with maximal re¬

sponses occurring at 200 nM. A concentration of 10 nM dex¬amethasone induced approximately a 10-fold increase inluciferase activity, whereas 500 nM dexamethasone treatmentinduced a 20-fold increase in luciferase activity. No additionalincrease in luciferase activity was observed at higher dexa¬methasone concentrations. Consequently, the potencies of anti-sense agents were determined at 0, 10, and 500 nM dexametha¬sone.

Effects of dexamethasone induction of reporter genetranscription on the potency of a luciferase-specificantisense oligonucleotide

To identify an optimal binding site in the luciferase mRNA,17 PS-ODN, 20 nt in length, were designed to bind to differentsites of the luciferase fusion gene. The initial screen identified a

number of active oligonucleotides, with ISIS 22717 (Fig. 1A)being the most active (data not shown). A nucleotide controloligo, ISIS 25971 (5'-TTGGCGTTGTCAGTCAGTCG-3'),had no effect on dexamethasone-induced luciferase activity(data not shown). The IC50 and maximum dose (200 nM) valuesfor ISIS 22717 inhibition of luciferase activity after havingbeen induced with either 10 nM or 500 nM dexamethasone are

shown in Table 1. Clearly, there was no difference between themaximum effects or IC50 values observed after induction witheither dose of dexamethasone. As the luciferase mRNA was un-

detectable by Northern blot analysis at all concentrations ofdexamethasone studied, T7-generated Ha-ras/luciferase mRNAwas serially diluted and probed to determine the lower range ofdetection for the luciferase mRNA (Fig. 2A). Calculationsbased on this luciferase mRNA analysis yielded less than 1copy per cell for both a 10-nM and a 500-nM induction. Thus,increasing transcription rate as has been reported to occur afterdexamethasone induction had no effect on antisense potency,and any change in copy number associated with the increase intranscription rate was undetectable using current assays butclearly had no effect on the potency of the antisense inhibitor.

Effects of dexamethasone induction on reporter genetranscription on the potency of an oligonucleotidewith multiple target sites

To determine if copy number of RNA might affect the po¬tency of antisense drugs, we compared the antisense effects ofISIS 2503 with those of ISIS 22717. ISIS 2503 is a well-charac¬terized RNase -active antisense inhibitor of Ha-ras mRNA ex¬

pression (Monia et al, 1992). Ha-ras mRNA is detectable byNorthern blot analyses of HeLa cell mRNA. The copy numberof Ha-ras was calculated by comparing the Ha-ras mRNA levelin HeLa cells to that of a cell line characterized by serial analy¬sis of gene expression (SAGE), the colorectal carcinoma cellline, Caco-2 (Fig. 2B). Based on this study, we conclude that thenumber of copies of Ha-ras mRNA per HeLa cell is 23. Table 1shows the IC50 and the effects of ISIS 2503 on luciferase activityat 200 nM after induction with 10 nM or 500 nM dexametha¬sone. As is seen with the dose-response curves for ISIS 22717,there were no differences between the ISIS 2503 dose-responsecurves after either 10 nM or 500 nM dexamethasone induction(data not shown), nor did the IC50 or maximum dose values forISIS 22717 differ from those for ISIS 2503 (Table 1). As thenumber of binding sites for ISIS 2503 contributed by the Ha-ras/luciferase fusion gene (<1) represents <5% of the totalnumber of ISIS 2503 sites in these cells, the total number of ISIS2503 sites is more than 23-fold greater than the sites available toISIS 22717. Table 1 shows the estimated number of copies ofmRNA binding sites for both ISIS 22717 and ISIS 2503, and theIC50 and maximum dose values derived from the dose-response

Table 1. IC50 and Effects of 200 nm Doses and Corresponding mRNA Copy NumberGenerated from Dose-Response Curves of Oligodeoxynucleotides"

Treatment Target Oligonucleotide Copy number IC50 (nMf% Control at

200 nM

Untransfected Ha-ras10 nM dexamethasone Luciferase500 nM dexamethasone Luciferase10 nM dexamethasone Luciferase500 nM dexamethasone Luciferase

25032271722717

25032503

23<1<1<1<1

4238232130

18 ± 1.14 ± 0.3

2.8 ± 0.61 ± 0.1

4.1 ± 2.9

aIC50 values were compiled from dose-response data using the program WinNonLin.standard edition 1.5. 1984—1987, ScientificConsulting Inc. (Cary, NC), Pharsight.

bIC50 values were generated from dose-response curves of 10, 25, 50, 100, and 200 nM oligonucleotide (either ISIS 22717 orISIS 2503) for both transfected and untransfected HeLa cells.

458 MURAGLIA ET AL.

copy number

10 5 1

transfected HeLa cells

nodex 10 nM 500nM

lue

ß-gal1 2 3 4 5 6 7 8 9 10 11 12 13 14 15

Caco-2 HeLa

IOio cs " °. "

µg mRNA - «- - r- v> im 12 3 4 5 6 sample #™^ llilgj «¡gÉ I II. rae,^ na-ras

HH. j^i ^^m^v ^ ' e^w 3 G3PDH

12 3 4 5 6 7 8 9 10 11 12

FIG. 2. Analysis of Ha-ras/luciferase and Ha-ras mRNA copy number in HeLa cells. (A) Ha-ras/luciferase mRNA was initially undetected us¬

ing both total and polyA+ mRNA from plasmid/transfected HeLa cells. To obtain greater concentrations of mRNA, cells from three wells were

pooled for each sample. Ha-ras/luciferase mRNA was generated from the plasmid pBS-T7-Ha-ras/luciferase. After determination of mRNA con¬

centration, the mRNA was serially diluted into untransfected HeLa total RNA to represent Ha-ras/luciferase copy numbers of 10, 5, and 1 per250,000 cells (lanes 1 and 2, 10 copies per cell; lanes 3 and 4, 5 copies per cell; lanes 5 and 6, 1 copy per cell) and analyzed by Northern blot along¬side mRNA harvested from RA10 transfected, uninduced in triplicate (lanes 7-9), and induced in triplicate HeLa cells (lanes 10-12, 10 nM dex¬amethasone induction, and lanes 13-15, 500 nM dexamethasone induction in triplicate). The blot was stripped and reprobed with a/3-galactosidaseprobe to show equal transfection efficiencies among all plasmid transfected samples. (B) Caco-2 cells were grown to near confluency. Cells were

counted, and total RNA was harvested. Based on the SAGE analysis, Caco-2 cells contain 34 copies of Ha-ras per cell. To approximate Ha-ras lev¬els in HeLa cells, Caco-2 total mRNA from 15 to 2.5 µg (increments of 2.5 µg) was analyzed by Northern blot next to six different samples con¬

taining 7.5 µg total HeLa mRNA. Caco-2 Ha-ras levels were normalized to G3PDH, and HeLa luciferase copy numbers were estimated based on

the mean expression level of the six samples compared with the Caco-2 standards.

curves do not differ. The slight differences between the effectsobserved for ISIS 2503 versus ISIS 22717 at 200 nM are proba¬bly due to the difficulty of measuring differences between treat¬

ments at doses that cause >80% inhibition.

Determination of cell-associated oligonucleotidecontent for ISIS 22717 and ISIS 2503

To assess the total cell-associated oligonucleotide, plasmid-transfected HeLa cells were treated with either ISIS 22717 or ISIS2503 for 4 hours and evaluated as previously described (Crooke et

al., 1996; Graham et al., 1998). A typical electropherogram ofoligonucleotides isolated from HeLa cells after treatment withISIS 22717 or ISIS 2503 is shown in Figure 3. (Crooke et al.,1996; Graham et al., 1998). Based on this method, we estimatethat after 4 hours of a 200 nM oligonucleotide treatment, therewere approximately 5.2 X 107 molecules of ISIS 22717 and 1 X

107 molecules of ISIS 2503 per cell. These values are similar to

those reported earlier using radioactivity-labeled oligonucleotides(Bennett et al., 1992). The cell-associated oligonucleotide concen¬

trations of a 50 nM treatment of ISIS 22717 and ISIS 2503 were

approximately 3-5-fold lower than the 200 nM treatment (datanot shown). This corresponds to the increase in activity of 3-5-fold from 50 nM treatment to 100 nM treatment when analyzingantisense activities of these'two oligonucleotides.

Effects ofTNF-a induction of ICAM-1 transcriptionon the potency of an oligonucleotide with a uniquetarget site

To determine whether the observations made in the Ha-ras/luciferase system can be extrapolated to RNA targets in a

normal cellular context and to examine the effects of higherRNA copy numbers, we used TNF- induction of ICAM-1 and

EFFECTS OF RNA CONTENT ON ANTISENSE POTENCY 459

FIG. 3. Electropherogram of cell-associated oligonucleotide in transfected HeLa cells. Plasmid-transfected HeLa cells were treated for 4 hourswith 200 nM of either ISIS 22717 or ISIS 2503 after solid-phase extraction lysates were analyzed by CGE. The peaks represent full-length ISIS22717 and the internal standard on oligothymidylate 27 nt in length. Treatment, extraction, and CGE were performed as described in Materials andMethods and in Graham et al., 1998.

studied the effects of ISIS 2302. Both the ICAM-1 induction inA549 cells and the activity of ISIS 2302 have been well charac¬terized (Chiang et al., 1991). Examination of copy number ofICAM-1 in A549 cells yielded a range of <1 in uninduced cellsto 86 copies per cell with a dose of 5 ng/ml TNF- (Table 2).Dose-response curves of ISIS 2302 throughout a TNF- doserange (0-5 ng/ml) showed that, as seen with luciferase and Ha¬ras, copy number had no effect on potency. The IC50 valuesranged from 41 nM to 65 nM, and inhibitions at the maximumdose of 200 nM were from 16% to 30% of control, with no sig¬nificant change as a function of RNA copy number. Further,these results were consistent with observations of IC50 and max¬

imal dose values seen in the Ha-ras/luciferase system.

DISCUSSION

For every drug-receptor interaction, the key determinants ofactivity are the concentrations of both receptor and drug at cel¬

lular sites at which binding of the drug to receptor occurs, theaffinity of the drug for the receptor, and the events that transpireafter drug binding. As the receptors for which antisense drugsare designed are mRNA species, the potential effects of varyinglevels of pre-mRNA or mRNA species have been the subject ofconsiderable speculation. The number of copies of any mRNAspecies is a function of transcription, processing, and degrada¬tion rates of the RNA, and all appear to be highly regulated.

To address the potential impact of variations in receptorRNA content on antisense effects, it is essential to evaluatethoroughly dose-response curves to determine the potency ofspecific antisense drugs in the presence of varying numbers ofcopies of receptor RNA. To provide the precision to supportsuch a quantitative comparison at low RNA copy number percell, we have constructed a luciferase reporter plasmid. Mea¬surements of luciferase activity are facile, quantitative, andhighly reproducible. Table 1 shows that changes in the copynumber of luciferase RNA have no effect on the IC50 of ISIS22717 (luciferase-specific antisense inhibitor) or the Ha-ras in-

Table 2. IC50 and Effects of 200 nm Doses and Corresponding mRNACopy Number Generated from Dose-Response Curves of 2302"

Treatment Target Oligonucleotide Copy number IC50 (nM)b% Control at

200 nM

Uninduced0.1 ng/ml0.5 ng/ml1.0 ng/ml5.0 ng/ml

ICAM-1ICAM-1ICAM-1ICAM-1ICAM-1

23022302230223022302

119344686

6541575444

19 ± 2.330 ± 8.019 ± 5.0

3.94.5

1919

aIC50 values were compiled from dose-response data using the program WinNonLin,standard edition 1.5. 1984-1987, ScientificConsulting Inc. (Cary, NC), Pharsight.

bIC30 values were derived from ISIS 2302 dose-response curves on TNF-a-induced ICAM-1 in A549 cells. Cells were trans¬fected with doses of 1, 10, 50, 75, and 200 nM ISIS 2302. Five hours later, cells were induced with TNF- for 2 hours, after whichRNA was extracted and analyzed for ICAM-1 expression.

460 MIRAGLIA ET AL.

hibitor ISIS 2503. Although the effects observed at 200 nM forboth ISIS 22717 and ISIS 2503 appeared to be slightly greaterthan in an induced system, we believe this is likely due to diffi¬culties in measuring differences between treatments when inhi¬bition is >80%. Additional data supporting this conclusion are

shown in Table 2. In these experiments, we studied the effectsof ISIS 2302 on an inducible endogenous gene, ICAM-1, in a

different cell line. Again, increasing copy number (in this case

to 86 copies per cell) had no effect on IC50, nor did copy num¬

ber alter the effects observed at 200 nM.The key point is that for an endogenous gene and an exoge¬

nous plasmid-encoded gene, increasing the copy number of theRNA had no effect on the IC^.

If one considers the basic equation to define drug action:

{D} + {R} ^ {DR} -» effect

Where {D} is the effective concentration of drug at the site atwhich receptor binding occurs, and {R} is the receptor concen¬

tration, drug effect of course is initiated by the formation of thedrug receptor complex {DR} (Ross, 1990). If receptor concen¬tration within the range studied has no effect on potency, drugconcentration must be in such excess that receptor concentra¬tion can be eliminated from the equation. Measurement of cell-associated antisense drug concentrations suggests that aftertransfection, the number of drug molecules is greatly in excess

of the target RNA molecules. Obviously, we cannot commenton the effective drug concentration at the receptor site, butclearly, the data support the conclusion that this concentrationis in excess of the target RNA in HeLa cells. These data suggestthat a significant fraction of the cell-associated drug is unavail¬able to interact with the target RNA. This is not surprising, as itis known that PS-ODN bind to many cellular proteins. Impor¬tantly, we have not identified the target RNA concentration atwhich potency is affected by the target RNA level. Thus, we

cannot comment on how much in excess of required are thedrug concentrations we observed in this report.

The implications of these observations are that for in vitroexperiments in which transfection is used to deliver antisensedrugs and target RNA are present in the range of 1-100 copiesper cell, potency should be unaffected by RNA content butshould be affected by the affinity of the oligonucleotide for itstarget RNA. An example of this can be found in the studies byMonia et al. (1992). An increase in length of an oligonucleotidefrom 13 to 19 nt against a mutant Ha-ras/luciferase reporterconstruct resulted in a proportional decrease in the IC50.

Equally clearly, in many experiments (Crooke, 1998), no-ef¬fect doses have been observed. Again these observations mustderive from complex interactions between the drugs and cells.For example, cellular uptake is variable, and a significant frac¬tion of the cell-associated drug is likely to be unavailable forhybridization to the target RNA. Finally, substantial excess

drug available for hybridization may be required to drive thehybridization to the target RNA.

This is the first publication of which we are aware to system¬atically evaluate changes in cellular content of an exogenousand an endogenous gene, to systematically determine the cellu¬lar content of antisense drugs, and to evaluate the influence ofRNA content on antisense drug potency. It answers a basicquestion about antisense drugs that has not been addressed and

provides an explanation for such observations. Furthermore, itprovides a clear direction with regard to improving the potencyof antisense drugs, that is, to enhance affinity or the efficiencywith which cell-associated antisense drugs can interact withtheir targets and induce RNase H degradation of their targetRNase.

It is difficult to speculate about how these data with regard toantisense drugs relate to the pharmacologie effects of more tra¬ditional drugs or the efficiency of the antisense mechanism. Tomake appropriate comparisons, one would like to know thenumber of drug molecules per cell of a series of extensively pro¬tein-bound drugs and the number of their intracellular proteintargets. We are unaware of studies that have addressed thesequestions but believe they are fundamental pharmacologie ques¬tions for which methods are now available to find answers.

These observations raise important questions with regard to

extrapolation of in vitro data to in vivo expectations. In vitrotesting is of substantial value in identifying potential optimalsites in RNA species for binding of antisense drugs. However,in vivo experiments demonstrate that the number of oligonu¬cleotide molecules in cells varies as a function of the tissues andtime after dosing (for review, see Crooke, 1998). We haveshown that PS-ODN designed to bind to a number of targets ex¬

pressed in the liver can reduce hepatic target RNA (for review,see Crooke, 1998). The doses at which these effects have beenobserved range from 10 to 30 mg/kg i.v. We have also shownthat at 4 and 24 hours after an i.v. dose of 10 mg/kg in the rat,2 X 108 and 3.5 X 10* molecules per cell, respectively, of ISIS1082, a typical PS-ODN, can be detected in liver cells (Grahamet al, 1998). Thus, in this organ, assuming that levçls of mostRNA species are <300 copies per cell at pharmacologically ef¬fective doses, the drug concentration again is likely to be insubstantial excess of the RNA copy number, suggesting thatRNA copy number and transcription rate may have little influ¬ence on the potency of antisense drugs in vivo. Definitive ex¬

periments are necessary in which RNA copy numbers are deter¬mined in the various cells within the liver and compared to thenumber of drug molecules present per cell. And, correlating an¬

tisense potencies with these results before conclusions that re¬

late to in vivo effects are supported. Further, the effects in mul¬tiple organs must be studied as well.

ACKNOWLEDGMENTS

We thank Dr. Richard Geary and Rosie Yu for the statisticalanalysis. We also thank Dr. Frank Bennett for critical review ofthe manuscript.

REFERENCES

BENNETT, CF., CHIANG, M.Y., CHAN, H., SHOEMAKER, J.E.E.,and MIRABELLI, C.K. (1992). Cationic lipids enhance cellular up¬take and activity of phosphorothioate antisense oligonucleotides.Mol. Pharmacol. 41, 1023-1033.

CHIANG, M.Y., CHAN, H„ ZOUNES, M.A., FREIER, S.M., LIMA,W.F., and BENNETT, CF. (1991). Antisense oligonucleotides in¬hibit intercellular adhesion molecule 1 expression by two distinctmechanisms. J. Biol. Chem. 266, 18162-18171.

EFFECTS OF RNA CONTENT ON ANTISENSE POTENCY 461

CROOKE, ST., ed. (1998). Antisense Research and Application.Handbook of Experimental Pharmacology. (Springer-Verlag, BerlinHeidelberg).

CROOKE, ST. (1998). An overview of progress in antisense therapeu¬tics. Antisense Nucleic Acid Drug Dev. 8, 115-122.

CROOKE, ST., GRAHAM, M.J., ZUCKERMAN, J.E., BROOKS, D.,CONKLIN, B.S., CUMMINS, L.L., GREIG, M.J., GUINOSSO,C.J., KORNBURST, D., MANOHARAN, M., SASMOR, H.M.,SCHLEICH, T., TrVEL, K.L., and GRIFFEY, R.H. (1996). Pharma¬cokinetic properties of several novel oligonucleotide analogs in mice.J. Pharmacol. Exp. Ther. 277,923-937.

DEAN, N.M., McKAY, R„ CONDON, T.P., and BENNETT, CF.(1994). Inhibition of protein kinase C-alpha. expression in humanA549 cells by antisense oligonucleotides inhibits induction of inter¬cellular adhesion molecule 1 (ICAM-1 ) mRNA by phorbol esters. J.Biol. Chem. 269, 16416-16424.

GRAHAM, M.J., CROOKE, ST., , D.K., COOPER, S.R.,LEMONIDIS, K.M., STECKER, K.K., MARTIN, M.J., andCROOKE, R.M. (1998). In vivo distribution and metabolism of a

phosphorothioate oligonucleotide within rat liver after intravenousadministration. J. Pharmacol. Exp. Ther. 286, 447-458.

GYGI, S.P., ROCHON, Y., FRANZA, B.R., and AEBERSOLD, R.(1999). Correlation between protein and mRNA abundance in yeast.Mol. Cell. Biol. 19, 1720-1730.

MŒSFELD, R., RUSCONI, S., GODOWSKI, P.J., MALER, B.A.,OKRET, S., WIKSTROM, A.-C, GUSTAFSSON, J.-A., andYMAMOTO, K.R. (1986). Genetic complementation of a glucocor-ticoid receptor deficiency by expression of cloned receptor cDNA.Cell 46, 389-399.

MINNEMAN, K.P., and ABEL, P.W. (1984). "Spare" alpha,-adrener-gic receptors and the potency of agonists in rat vas deferens. Mol.Pharmacol. 25, 34-46.

MONIA, B.P., JOHNSTON, J.F., ECKER, D.J., ZOUNES, M.A.,LIMA, W.F., and FREIER, S.M. (1992). Selective inhibition of mu¬

tant Ha-ras mRNA expression by antisense oligonucleotides. J. Biol.Chem. 267,19954-19962.

MONIA, B.P., JOHNSTON, J.F., GEIGER, T., MULLER, M., andFABBRO, D. (1996a). Antitumor activity of a phosphorothioate an¬tisense oligodeoxynucleotide targeted against C-raf kinase. NatureMed. 2, 668-675.

MONIA, B.P., JOHNSTON, J.F., SASMOR, H., and CUMMINS, L.L.(1996b). Nuclease resistance and antisense activity of modified

oligonucleotides targeted to Ha-ras. J. Biol. Chem. 271,14533-14540.

O'DWYER, P.J., STEVENSON, J.P., GALLAGHER, M.,MITCHELL, E., FRIEDLAND, D., ROSE, L., CASSELLA, .,HOLMLUND, J., DEAN, N., DORR, ., GEARY, J., and YAO, K.-S. (1998). Phase I/pharmacokinetic/pharmacodynamic trial of ra/-lantisense ODN (ISIS 5132), CGP 69846A). 34th Annual Meeting ofthe American Society of Clinical Oncology, Los Angeles, CA.

ROSS, E.M. (1990). Pharmacodynamics: Mechanisms of drug actionand the relationship between drug concentration and effect. In:Goodman and Gilman's The Pharmacological Basis of Therapeu¬tics. A.G. Gilman, T.W. Rail, A.S. Nies, and P. Taylor, eds. (Perga-mon Press, Elmsford, NY), pp. 33-48.

TAKEYASU, K., UCHIDA, S., WADA, ., MARUNO, M., LAI,T.T., HATA, F., and YOSHIDA, H. (1979). Experimental evidenceand dynamic aspects of spare receptor. J. Life Sci. 25, 1761-1772.

VELCULESCU, V.E., ZHANG, L., VOGELSTEIN, ., and -LER, K.W. (1995). Serial analysis of gene expression [see Com¬ments]. Science 270,484-487.

VELCULESCU, V.E., ZHANG, L., ZHOU, W., VOGELSTEIN, J.,BASRAI, M.A., BASSETT, D.E., Jr., HIETER, P., VOGELSTEIN, ., and KINZLER, K.W. (1997). Characterization of the yeast tran-

scriptome. Cell 88,243-251.WEBB, ., CUNNINGHAM, D., COTTER, F., CLARKE, P.A., DI

STEFANO, F., ROSS, P., CORBO, M., and DZŒWANOWSKA, .(1997). BCL-2 antisense therapy in patients with non-Hodgkin lym-phoma. Lancet 349, 1137-1141.

YACYSHYN, B.R., BOWEN-YACYSHYN, M.B., JEWELL, L.,TAMI, J.A., BENNETT, CF., KISNER, D.L., and SHANAHAN,W.R., Jr. (1998). A placebo-controlled trial of ICAM-1 antisenseoligonucleotide in the treatment of Crohn's disease. Gastroenterol-ogy 114, 1133-1142.

Address reprint requests to:Dr. Stanley T. Crooke

Isis Pharmaceuticals, Inc.2292 Faraday Avenue

Carlsbad, CA 92008

Received July 10, 2000; accepted in revised form September21, 2000.