UvA-DARE is a service provided by the library of the University of Amsterdam (httpdareuvanl)

UvA-DARE (Digital Academic Repository)

The role of abca1 in atherosclerosis lessons from in vitro and in vivo models

Singaraja RR

Link to publication

Citation for published version (APA)Singaraja R R (2003) The role of abca1 in atherosclerosis lessons from in vitro and in vivo models

General rightsIt is not permitted to download or to forwarddistribute the text or part of it without the consent of the author(s) andor copyright holder(s)other than for strictly personal individual use unless the work is under an open content license (like Creative Commons)

DisclaimerComplaints regulationsIf you believe that digital publication of certain material infringes any of your rights or (privacy) interests please let the Library know statingyour reasons In case of a legitimate complaint the Library will make the material inaccessible andor remove it from the website Please Askthe Library httpsubauvanlencontact or a letter to Library of the University of Amsterdam Secretariat Singel 425 1012 WP AmsterdamThe Netherlands You will be contacted as soon as possible

Download date 15 Dec 2020

Chapter r

Identificationn and Functional Analysis of a Naturally Occurringg E89K Mutation in the ABCA1 Gene of the

WHAMM chicken

Alann D Attie1 Yannick Hamon2 Angela R Brooks-Wilson3 Markk P Gray-Keller1 Marcia LE MacDonald3 Veronique Rigot2

Angiee Tebon1 Lin-Hua Zhang3 Jacob D Mulligan1 Roshni R Singaraja6 J James Bitgood4 Mark E Cook4 John JP Kastelein5 Giovanna Chimini2 and

Michaell R Hayden6

Departmentss of Biochemistry University of Wisconsin-Madison Madison Wl 53706 USA 22 Department of Biochemistry Centre dlmmunologie de Marseille Luminy 13288 CEDEX 09

France e Xenon Genetics Inc Vancouver BC V5G 4W8 Canada

cc Department of Animal Sciences University of Wisconsin-Madison Madison Wl 53706 USA 55 Department of Vascular Medicine Academic Medical Centre Amsterdam The Netherlands

Department of Medical Genetics Centre for Molecular Medicine and Therapeutics and Departmentt of Medical Genetics Childrens and Womens Hospital University of British

9 9

Journall of Lipid Research (accepted for publication)

Chapterr 9

Abstrac t t Thee Wisconsin Hypoalpha Mutant (WHAM) chicken has a gt90 reduction in plasma HDL due

too hypercatabolism by the kidney of lipid-poor apo-AI The WHAM chickens have a recessive

whitee skin phenotype caused by a single-gene mutation that maps to the chicken Z-chromosome

Thiss corresponds to human 9q311 a chromosomal segment that contains the ABCA1 gene

whichh is mutated in Tangier Disease and familial hypoaiphalipoproteinemia Complete sequencing

off the WHAM ABCA1 cDNA identified a missense mutation near the N-terminus of the protein

(E89K) The substitution of this evolutionary conserved glutamate residue for lysine in the

mousee ABCA1 transporter leads to complete loss of function resulting principally from defective

intracellularr trafficking and very little ABCA1 reaching the plasma membrane The WHAM

chickenn is a naturally occurring animal model for Tangier Disease

188 8

AA Naturally Occurring Mutation in ABCA1 in the WHAM Chicken

Introductio n n Thee Wisconsin Hypoalpha Mutant (WHAM) chicken was discovered in 1981 in a flock of

chickenss maintained at the University of Wisconsin-Madison since 1948 (1) In contrast to

normall chickens the WHAM chickens luve white jkin dud white beaks due to a deficiency of

carotenoids such as xanthophyll The white skin phenotype is inherited as a recessive sex-

linkedd mutation (originally designated y for recessive yellow) on the Z-chromosome (1)

AA decade later Poernama et a discovered that the WHAM chickens have a severe deficiency of

highh density lipoprotein (HDL) (2) Unlike conditions leading to defective VLDL production

however this syndrome involves normal synthesis and secretion of apolipoproteins Most notably

thee rate of synthesis of apo-A1 the principal protein of HDL is normal (3) Moreover the apo-A1

genee locus is excluded as a candidate gene for this mutant phenotype because the WHAM

mutationn is sex-linked in the chicken (1) whereas apo-A1 is autosomal in chickens (3) as it is in

mammalss (45) Since HDL production is drastically reduced while apo-A1 synthesis is normal

thiss animal model exposed a post-secretory step that is rate-limiting for HDL production (3)

Metabolicc studies in WHAM chickens provided the key to understanding their defect in HDL

metabolism When 1-l-labeled HDL particles were injected into WHAM chickens their

disappearancee from the circulation was only moderately increased relative to normal chickens

However when lipid-free l2Jl-apo-A1 was injected it was removed by the kidneys from the

circulationn four-fold more rapidly in WHAM than in normal chickens (3) Because apo-A1

synthesiss and secretion are normal in WHAM chickens we reasoned that another factor affecting

thee stability of apo-A1 was limiting Further analysis of serum lipids revealed a 70 reduction

inn phospholipids implying that the primary defect is in phospholipid efflux (3) The dissociation

betweenn the metabolism of v l - labeled HDL compared to the rapid catabolism of 1-rl-apo-A1

togetherr with the defect in efflux suggested that the primary defect in the WHAM chicken

relatess to lipidation of the lipid-depleted apo-A1 particle

Tangierr Disease and familial hypoalphalipoproteinemia (FHA) are HDL deficiency disorders that

aree also characterized by hypercatabolism of apo-A1 (6) Studies in fibroblasts from Tangier

Diseasee and FHA patients reveal defects in phospholipid and cholesterol efflux (7-9) Consequently

Tangierr Disease manifests as a cholesterol ester storage disorder (1011) Mutations in the ATP-

bindingg cassette protein-1 (ABCA1) gene are responsible for both Tangier Disease and FHA (12-

15) implying that this protein functions as a phospholipid andor cholesterol transporter

Thee phenotypes of WHAM chickens and of Tangier Disease patients share key common features

First in both instances apo-A1 was ruled out as a candidate gene Second apo-A1 synthesis is

normal Finally the in vitro studies in Tangier fibroblasts suggested a defect in lipid efflux (12-

16) analogous to the in vivo findings in the WHAM chicken (3) Mapping of the Tangier

Diseasee mutation to human chromosome 9 and its synteny with the region of the chicken Z-

chromosomee harboring the WHAM mutation provided genetic evidence that individuals with

189 9

Chapterr 9

Tangierr Disease and WHAM chickens may have mutations in the same gene We have cloned

andd sequenced the chicken ABCA1 gene and show that a single missense mutation (E89K) in

thee amino terminus of ABCA1 results in altered trafficking of ABCA1 with its retention in the

endoplasmicc reticulum and loss of function at the plasma membrane The WHAM chicken thus

representss a naturally occurring animal model for Tangier disease

Materia ll and Method s Measuremen tt of carotenoid s in plasm a

1-mii aliquots of plasma from normal and WHAM chickens were used to determine the absorption

spectraa utilizing a Cary 50 Bio UV-Visible spectrophotometer Water was used as the blank For

thee xanthophyll absorption spectrum 02 mg of xanthophyll Sigma No X-6250) was dissolved

inn 1 ml chloroform for the spectrum shown Chloroform was used as the blank

Phospholipi dd analysi s

Plasmaa lipoproteins were fractionated on a Superose 6HR 1030 FPLC column (Pharmacia) The

equivalentt of 100 |J of plasma was injected onto the column 500-pl fractions were collected

andd used for total cholesterol measurements (Sigma kit 352-50) Values represent total cholesterol

masss per fraction The identities of the lipoproteins have been confirmed by utilizing anti-apoB

immunoreactivityy for LDL and anti-apoA1 immunoreactivity for HDL (not shown) Triglyceride

profiless were used to identify VLDL Lipids were extracted from a 200 pi aliquot of whole plasma

Lipidss were extracted (17) dried down under nitrogen resuspended in 35 pi of CHCI and

spottedd onto an activated TLC plate (Silica Gel 60 Aldrich No Z29297-4) developed in the first

dimensionn consisting of CHCI MeOH28 NH (65255) allowed to dry overnight and then

developedd in the second dimension consisting of CHCIacetoneMeOHglacial acetateH 0 (6

8221) To visualize lipids plates were sprayed with 5 sulfuric acid 5 glacial acetate and

055 mgml FeCL followed by baking at 100C for 30 minutes

DNAA sequencing RT-PCR amplificatio n and sequenc e analysi s

Totall RNA was isolated from control and WHAM chicken liver and reverse transcribed with

oiigo-(dT)188 primer using Superscript II reverse transcriptase (Life Technologies) cDNA was

amplifiedd using Taq DNA polymerase and primers derived from the published human and

mousee ABCA1 cDNA sequences (1518) and primers derived from initial chicken sequence

Fifteenn sets of primer pairs were used to amplify WHAM and control chicken cDNA samples

generatingg 15 overlapping DNA fragments covering 6773 bp To determine the 5 untranslated

portionn of the mRNA we performed 5 RACE using the Marathon cDNA amplification kit

(Clontech) DNA sequencing was performed directly on PCR products using an ABI 373

automatedd DNA sequencer (Applied Biosystems)

190 0

AA Naturally Occurring Mutation in ABCA1 in the WHAM Chicken

Detectio nn of th e W H A M mutatio n

Thee G265A mutation was detected by comparison of the cDNA sequence of normal and

WHAMM male chickens Genotypmg of the variant in normal and WHAM White Leghorn and

nnrma RhnHp Island R^d rhir|ron r|Pfwry)ltr ONA vac performed hy PrP amplification ith

pr imerss in exon 4 (Forward 5-GTCACTTCCCAAACAAAGCTA-3 Reverse 5-

ATGGACGCATTGAAGTTTCC-3) PCR product (15mL) was incubated with Hinf (10U) in total

volumee (25fiL) for 1h at 37 C and products separated on 2 agarose gels The presence of

thee G265A mutation destroys a Hinf site in the PCR product

Sequenc ee Alignmen t

Clustall W 18 with modifications accessed through the Baylor College of Medicine (BCM)

searchh launcher (httpdotimgenbcmtmcedu9331multi-alignOptionsclustalwhtml) was

usedd for multiple sequence alignments with Boxshade for graphical enhancement (http

wwwwww ch embnet orgsoftwareBOX_formhtml)

Generatio nn and analysi s of ABCA 1 harbourin g th e W H A M mutatio n

Thee E to K mutation at position 89 corresponding to an A to G shift of nucleotide 348 in GB

X75926 was introduced on the mouse ABCA1 backbone by fusion PCR with the following

oligonucleotidess (a- TATAAGCAGAGAGCTCGTTTA corresponding to the sequence at bp 94 -

1188 in pBI vector d- GATGCTTGATCTGCCGTA- bp 478-495 of GB X75926) b and c -

TCCCGGCAAGGCTCCCC and GGGAGCCTTGCCGGGA complementary ol igonucleot ides

spanningg the mutated nucleotide ) The amplified fragment was reinserted into the ABCA1

EGFPP backbone in pBI vector (19) by restriction digestion with NotlBsrGI Introduction of the

pointt mutation was confirmed by sequencing with the Dynamic ET terminator Cycle sequencing

kitt (Amersham Pharmacia Biotech Uppsala Sweden)

HeLaa cells were transiently transfected for 16 h with EXGEN 500 (Euromedex Mundolsheim

France)) accordingly to manufacturers instruction and immediately seeded for immunofluorescence

biochemicall and functional analysis

Transfectionn efficiency assessed by flow cytometric evaluation of GFP RFI ( relative fluorescence

intensity)) in the whole cell population was consistently higher than 30 Intracellular trafficking

wass monitored by both immunofluorescence analysis and surface biotinilation at GOh after

transfection

mmunofluorescencee was carried out by standard protocols on slides seeded with 3-5 x 10

cellss and analysed in X-Y dimensions by a Leica TS100 confocal microscope

Surfacee biotynilation was carried out on 3-5 x 10 ceils with 1 mgml NHS-LC-biotin (Pierce) in

icee cold PBS for 30 min followed by lysis in RIPA buffer (50mM Tris-HCI pH8 150mM NaCI

I m MM EDTA and 1 Triton X-100) for 30 mm at 4C Similar amounts of ABCA1 normalised

withh respect to both protein concentration in the samples and transfection efficiency were

191 1

Chapterr 9

Abstrac t t Thee Wisconsin Hypoalpha Mutant (WHAM) chicken has a gt90 reduction in plasma HDL due

too hypercatabolism by the kidney of lipid-poor apo-AI The WHAM chickens have a recessive

whitee skin phenotype caused by a single-gene mutation that maps to the chicken Z-chromosome

Thiss corresponds to human 9q311 a chromosomal segment that contains the ABCA1 gene

whichh is mutated in Tangier Disease and familial hypoaiphalipoproteinemia Complete sequencing

off the WHAM ABCA1 cDNA identified a missense mutation near the N-terminus of the protein

(E89K) The substitution of this evolutionary conserved glutamate residue for lysine in the

mousee ABCA1 transporter leads to complete loss of function resulting principally from defective

intracellularr trafficking and very little ABCA1 reaching the plasma membrane The WHAM

chickenn is a naturally occurring animal model for Tangier Disease

188 8

AA Naturally Occurring Mutation in ABCA1 in the WHAM Chicken

Introductio n n Thee Wisconsin Hypoalpha Mutant (WHAM) chicken was discovered in 1981 in a flock of

chickenss maintained at the University of Wisconsin-Madison since 1948 (1) In contrast to

normall chickens the WHAM chickens luve white jkin dud white beaks due to a deficiency of

carotenoids such as xanthophyll The white skin phenotype is inherited as a recessive sex-

linkedd mutation (originally designated y for recessive yellow) on the Z-chromosome (1)

AA decade later Poernama et a discovered that the WHAM chickens have a severe deficiency of

highh density lipoprotein (HDL) (2) Unlike conditions leading to defective VLDL production

however this syndrome involves normal synthesis and secretion of apolipoproteins Most notably

thee rate of synthesis of apo-A1 the principal protein of HDL is normal (3) Moreover the apo-A1

genee locus is excluded as a candidate gene for this mutant phenotype because the WHAM

mutationn is sex-linked in the chicken (1) whereas apo-A1 is autosomal in chickens (3) as it is in

mammalss (45) Since HDL production is drastically reduced while apo-A1 synthesis is normal

thiss animal model exposed a post-secretory step that is rate-limiting for HDL production (3)

Metabolicc studies in WHAM chickens provided the key to understanding their defect in HDL

metabolism When 1-l-labeled HDL particles were injected into WHAM chickens their

disappearancee from the circulation was only moderately increased relative to normal chickens

However when lipid-free l2Jl-apo-A1 was injected it was removed by the kidneys from the

circulationn four-fold more rapidly in WHAM than in normal chickens (3) Because apo-A1

synthesiss and secretion are normal in WHAM chickens we reasoned that another factor affecting

thee stability of apo-A1 was limiting Further analysis of serum lipids revealed a 70 reduction

inn phospholipids implying that the primary defect is in phospholipid efflux (3) The dissociation

betweenn the metabolism of v l - labeled HDL compared to the rapid catabolism of 1-rl-apo-A1

togetherr with the defect in efflux suggested that the primary defect in the WHAM chicken

relatess to lipidation of the lipid-depleted apo-A1 particle

Tangierr Disease and familial hypoalphalipoproteinemia (FHA) are HDL deficiency disorders that

aree also characterized by hypercatabolism of apo-A1 (6) Studies in fibroblasts from Tangier

Diseasee and FHA patients reveal defects in phospholipid and cholesterol efflux (7-9) Consequently

Tangierr Disease manifests as a cholesterol ester storage disorder (1011) Mutations in the ATP-

bindingg cassette protein-1 (ABCA1) gene are responsible for both Tangier Disease and FHA (12-

15) implying that this protein functions as a phospholipid andor cholesterol transporter

Thee phenotypes of WHAM chickens and of Tangier Disease patients share key common features

First in both instances apo-A1 was ruled out as a candidate gene Second apo-A1 synthesis is

normal Finally the in vitro studies in Tangier fibroblasts suggested a defect in lipid efflux (12-

16) analogous to the in vivo findings in the WHAM chicken (3) Mapping of the Tangier

Diseasee mutation to human chromosome 9 and its synteny with the region of the chicken Z-

chromosomee harboring the WHAM mutation provided genetic evidence that individuals with

189 9

Chapterr 9

Tangierr Disease and WHAM chickens may have mutations in the same gene We have cloned

andd sequenced the chicken ABCA1 gene and show that a single missense mutation (E89K) in

thee amino terminus of ABCA1 results in altered trafficking of ABCA1 with its retention in the

endoplasmicc reticulum and loss of function at the plasma membrane The WHAM chicken thus

representss a naturally occurring animal model for Tangier disease

Materia ll and Method s Measuremen tt of carotenoid s in plasm a

1-mii aliquots of plasma from normal and WHAM chickens were used to determine the absorption

spectraa utilizing a Cary 50 Bio UV-Visible spectrophotometer Water was used as the blank For

thee xanthophyll absorption spectrum 02 mg of xanthophyll Sigma No X-6250) was dissolved

inn 1 ml chloroform for the spectrum shown Chloroform was used as the blank

Phospholipi dd analysi s

Plasmaa lipoproteins were fractionated on a Superose 6HR 1030 FPLC column (Pharmacia) The

equivalentt of 100 |J of plasma was injected onto the column 500-pl fractions were collected

andd used for total cholesterol measurements (Sigma kit 352-50) Values represent total cholesterol

masss per fraction The identities of the lipoproteins have been confirmed by utilizing anti-apoB

immunoreactivityy for LDL and anti-apoA1 immunoreactivity for HDL (not shown) Triglyceride

profiless were used to identify VLDL Lipids were extracted from a 200 pi aliquot of whole plasma

Lipidss were extracted (17) dried down under nitrogen resuspended in 35 pi of CHCI and

spottedd onto an activated TLC plate (Silica Gel 60 Aldrich No Z29297-4) developed in the first

dimensionn consisting of CHCI MeOH28 NH (65255) allowed to dry overnight and then

developedd in the second dimension consisting of CHCIacetoneMeOHglacial acetateH 0 (6

8221) To visualize lipids plates were sprayed with 5 sulfuric acid 5 glacial acetate and

055 mgml FeCL followed by baking at 100C for 30 minutes

DNAA sequencing RT-PCR amplificatio n and sequenc e analysi s

Totall RNA was isolated from control and WHAM chicken liver and reverse transcribed with

oiigo-(dT)188 primer using Superscript II reverse transcriptase (Life Technologies) cDNA was

amplifiedd using Taq DNA polymerase and primers derived from the published human and

mousee ABCA1 cDNA sequences (1518) and primers derived from initial chicken sequence

Fifteenn sets of primer pairs were used to amplify WHAM and control chicken cDNA samples

generatingg 15 overlapping DNA fragments covering 6773 bp To determine the 5 untranslated

portionn of the mRNA we performed 5 RACE using the Marathon cDNA amplification kit

(Clontech) DNA sequencing was performed directly on PCR products using an ABI 373

automatedd DNA sequencer (Applied Biosystems)

190 0

AA Naturally Occurring Mutation in ABCA1 in the WHAM Chicken

Detectio nn of th e W H A M mutatio n

Thee G265A mutation was detected by comparison of the cDNA sequence of normal and

WHAMM male chickens Genotypmg of the variant in normal and WHAM White Leghorn and

nnrma RhnHp Island R^d rhir|ron r|Pfwry)ltr ONA vac performed hy PrP amplification ith

pr imerss in exon 4 (Forward 5-GTCACTTCCCAAACAAAGCTA-3 Reverse 5-

ATGGACGCATTGAAGTTTCC-3) PCR product (15mL) was incubated with Hinf (10U) in total

volumee (25fiL) for 1h at 37 C and products separated on 2 agarose gels The presence of

thee G265A mutation destroys a Hinf site in the PCR product

Sequenc ee Alignmen t

Clustall W 18 with modifications accessed through the Baylor College of Medicine (BCM)

searchh launcher (httpdotimgenbcmtmcedu9331multi-alignOptionsclustalwhtml) was

usedd for multiple sequence alignments with Boxshade for graphical enhancement (http

wwwwww ch embnet orgsoftwareBOX_formhtml)

Generatio nn and analysi s of ABCA 1 harbourin g th e W H A M mutatio n

Thee E to K mutation at position 89 corresponding to an A to G shift of nucleotide 348 in GB

X75926 was introduced on the mouse ABCA1 backbone by fusion PCR with the following

oligonucleotidess (a- TATAAGCAGAGAGCTCGTTTA corresponding to the sequence at bp 94 -

1188 in pBI vector d- GATGCTTGATCTGCCGTA- bp 478-495 of GB X75926) b and c -

TCCCGGCAAGGCTCCCC and GGGAGCCTTGCCGGGA complementary ol igonucleot ides

spanningg the mutated nucleotide ) The amplified fragment was reinserted into the ABCA1

EGFPP backbone in pBI vector (19) by restriction digestion with NotlBsrGI Introduction of the

pointt mutation was confirmed by sequencing with the Dynamic ET terminator Cycle sequencing

kitt (Amersham Pharmacia Biotech Uppsala Sweden)

HeLaa cells were transiently transfected for 16 h with EXGEN 500 (Euromedex Mundolsheim

France)) accordingly to manufacturers instruction and immediately seeded for immunofluorescence

biochemicall and functional analysis

Transfectionn efficiency assessed by flow cytometric evaluation of GFP RFI ( relative fluorescence

intensity)) in the whole cell population was consistently higher than 30 Intracellular trafficking

wass monitored by both immunofluorescence analysis and surface biotinilation at GOh after

transfection

mmunofluorescencee was carried out by standard protocols on slides seeded with 3-5 x 10

cellss and analysed in X-Y dimensions by a Leica TS100 confocal microscope

Surfacee biotynilation was carried out on 3-5 x 10 ceils with 1 mgml NHS-LC-biotin (Pierce) in

icee cold PBS for 30 min followed by lysis in RIPA buffer (50mM Tris-HCI pH8 150mM NaCI

I m MM EDTA and 1 Triton X-100) for 30 mm at 4C Similar amounts of ABCA1 normalised

withh respect to both protein concentration in the samples and transfection efficiency were

191 1

AA Naturally Occurring Mutation in ABCA1 in the WHAM Chicken

Introductio n n Thee Wisconsin Hypoalpha Mutant (WHAM) chicken was discovered in 1981 in a flock of

chickenss maintained at the University of Wisconsin-Madison since 1948 (1) In contrast to

normall chickens the WHAM chickens luve white jkin dud white beaks due to a deficiency of

carotenoids such as xanthophyll The white skin phenotype is inherited as a recessive sex-

linkedd mutation (originally designated y for recessive yellow) on the Z-chromosome (1)

AA decade later Poernama et a discovered that the WHAM chickens have a severe deficiency of

highh density lipoprotein (HDL) (2) Unlike conditions leading to defective VLDL production

however this syndrome involves normal synthesis and secretion of apolipoproteins Most notably

thee rate of synthesis of apo-A1 the principal protein of HDL is normal (3) Moreover the apo-A1

genee locus is excluded as a candidate gene for this mutant phenotype because the WHAM

mutationn is sex-linked in the chicken (1) whereas apo-A1 is autosomal in chickens (3) as it is in

mammalss (45) Since HDL production is drastically reduced while apo-A1 synthesis is normal

thiss animal model exposed a post-secretory step that is rate-limiting for HDL production (3)

Metabolicc studies in WHAM chickens provided the key to understanding their defect in HDL

metabolism When 1-l-labeled HDL particles were injected into WHAM chickens their

disappearancee from the circulation was only moderately increased relative to normal chickens

However when lipid-free l2Jl-apo-A1 was injected it was removed by the kidneys from the

circulationn four-fold more rapidly in WHAM than in normal chickens (3) Because apo-A1

synthesiss and secretion are normal in WHAM chickens we reasoned that another factor affecting

thee stability of apo-A1 was limiting Further analysis of serum lipids revealed a 70 reduction

inn phospholipids implying that the primary defect is in phospholipid efflux (3) The dissociation

betweenn the metabolism of v l - labeled HDL compared to the rapid catabolism of 1-rl-apo-A1

togetherr with the defect in efflux suggested that the primary defect in the WHAM chicken

relatess to lipidation of the lipid-depleted apo-A1 particle

Tangierr Disease and familial hypoalphalipoproteinemia (FHA) are HDL deficiency disorders that

aree also characterized by hypercatabolism of apo-A1 (6) Studies in fibroblasts from Tangier

Diseasee and FHA patients reveal defects in phospholipid and cholesterol efflux (7-9) Consequently

Tangierr Disease manifests as a cholesterol ester storage disorder (1011) Mutations in the ATP-

bindingg cassette protein-1 (ABCA1) gene are responsible for both Tangier Disease and FHA (12-

15) implying that this protein functions as a phospholipid andor cholesterol transporter

Thee phenotypes of WHAM chickens and of Tangier Disease patients share key common features

First in both instances apo-A1 was ruled out as a candidate gene Second apo-A1 synthesis is

normal Finally the in vitro studies in Tangier fibroblasts suggested a defect in lipid efflux (12-

16) analogous to the in vivo findings in the WHAM chicken (3) Mapping of the Tangier

Diseasee mutation to human chromosome 9 and its synteny with the region of the chicken Z-

chromosomee harboring the WHAM mutation provided genetic evidence that individuals with

189 9

Chapterr 9

Tangierr Disease and WHAM chickens may have mutations in the same gene We have cloned

andd sequenced the chicken ABCA1 gene and show that a single missense mutation (E89K) in

thee amino terminus of ABCA1 results in altered trafficking of ABCA1 with its retention in the

endoplasmicc reticulum and loss of function at the plasma membrane The WHAM chicken thus

representss a naturally occurring animal model for Tangier disease

Materia ll and Method s Measuremen tt of carotenoid s in plasm a

1-mii aliquots of plasma from normal and WHAM chickens were used to determine the absorption

spectraa utilizing a Cary 50 Bio UV-Visible spectrophotometer Water was used as the blank For

thee xanthophyll absorption spectrum 02 mg of xanthophyll Sigma No X-6250) was dissolved

inn 1 ml chloroform for the spectrum shown Chloroform was used as the blank

Phospholipi dd analysi s

Plasmaa lipoproteins were fractionated on a Superose 6HR 1030 FPLC column (Pharmacia) The

equivalentt of 100 |J of plasma was injected onto the column 500-pl fractions were collected

andd used for total cholesterol measurements (Sigma kit 352-50) Values represent total cholesterol

masss per fraction The identities of the lipoproteins have been confirmed by utilizing anti-apoB

immunoreactivityy for LDL and anti-apoA1 immunoreactivity for HDL (not shown) Triglyceride

profiless were used to identify VLDL Lipids were extracted from a 200 pi aliquot of whole plasma

Lipidss were extracted (17) dried down under nitrogen resuspended in 35 pi of CHCI and

spottedd onto an activated TLC plate (Silica Gel 60 Aldrich No Z29297-4) developed in the first

dimensionn consisting of CHCI MeOH28 NH (65255) allowed to dry overnight and then

developedd in the second dimension consisting of CHCIacetoneMeOHglacial acetateH 0 (6

8221) To visualize lipids plates were sprayed with 5 sulfuric acid 5 glacial acetate and

055 mgml FeCL followed by baking at 100C for 30 minutes

DNAA sequencing RT-PCR amplificatio n and sequenc e analysi s

Totall RNA was isolated from control and WHAM chicken liver and reverse transcribed with

oiigo-(dT)188 primer using Superscript II reverse transcriptase (Life Technologies) cDNA was

amplifiedd using Taq DNA polymerase and primers derived from the published human and

mousee ABCA1 cDNA sequences (1518) and primers derived from initial chicken sequence

Fifteenn sets of primer pairs were used to amplify WHAM and control chicken cDNA samples

generatingg 15 overlapping DNA fragments covering 6773 bp To determine the 5 untranslated

portionn of the mRNA we performed 5 RACE using the Marathon cDNA amplification kit

(Clontech) DNA sequencing was performed directly on PCR products using an ABI 373

automatedd DNA sequencer (Applied Biosystems)

190 0

AA Naturally Occurring Mutation in ABCA1 in the WHAM Chicken

Detectio nn of th e W H A M mutatio n

Thee G265A mutation was detected by comparison of the cDNA sequence of normal and

WHAMM male chickens Genotypmg of the variant in normal and WHAM White Leghorn and

nnrma RhnHp Island R^d rhir|ron r|Pfwry)ltr ONA vac performed hy PrP amplification ith

pr imerss in exon 4 (Forward 5-GTCACTTCCCAAACAAAGCTA-3 Reverse 5-

ATGGACGCATTGAAGTTTCC-3) PCR product (15mL) was incubated with Hinf (10U) in total

volumee (25fiL) for 1h at 37 C and products separated on 2 agarose gels The presence of

thee G265A mutation destroys a Hinf site in the PCR product

Sequenc ee Alignmen t

Clustall W 18 with modifications accessed through the Baylor College of Medicine (BCM)

searchh launcher (httpdotimgenbcmtmcedu9331multi-alignOptionsclustalwhtml) was

usedd for multiple sequence alignments with Boxshade for graphical enhancement (http

wwwwww ch embnet orgsoftwareBOX_formhtml)

Generatio nn and analysi s of ABCA 1 harbourin g th e W H A M mutatio n

Thee E to K mutation at position 89 corresponding to an A to G shift of nucleotide 348 in GB

X75926 was introduced on the mouse ABCA1 backbone by fusion PCR with the following

oligonucleotidess (a- TATAAGCAGAGAGCTCGTTTA corresponding to the sequence at bp 94 -

1188 in pBI vector d- GATGCTTGATCTGCCGTA- bp 478-495 of GB X75926) b and c -

TCCCGGCAAGGCTCCCC and GGGAGCCTTGCCGGGA complementary ol igonucleot ides

spanningg the mutated nucleotide ) The amplified fragment was reinserted into the ABCA1

EGFPP backbone in pBI vector (19) by restriction digestion with NotlBsrGI Introduction of the

pointt mutation was confirmed by sequencing with the Dynamic ET terminator Cycle sequencing

kitt (Amersham Pharmacia Biotech Uppsala Sweden)

HeLaa cells were transiently transfected for 16 h with EXGEN 500 (Euromedex Mundolsheim

France)) accordingly to manufacturers instruction and immediately seeded for immunofluorescence

biochemicall and functional analysis

Transfectionn efficiency assessed by flow cytometric evaluation of GFP RFI ( relative fluorescence

intensity)) in the whole cell population was consistently higher than 30 Intracellular trafficking

wass monitored by both immunofluorescence analysis and surface biotinilation at GOh after

transfection

mmunofluorescencee was carried out by standard protocols on slides seeded with 3-5 x 10

cellss and analysed in X-Y dimensions by a Leica TS100 confocal microscope

Surfacee biotynilation was carried out on 3-5 x 10 ceils with 1 mgml NHS-LC-biotin (Pierce) in

icee cold PBS for 30 min followed by lysis in RIPA buffer (50mM Tris-HCI pH8 150mM NaCI

I m MM EDTA and 1 Triton X-100) for 30 mm at 4C Similar amounts of ABCA1 normalised

withh respect to both protein concentration in the samples and transfection efficiency were

191 1

Chapterr 9

Tangierr Disease and WHAM chickens may have mutations in the same gene We have cloned

andd sequenced the chicken ABCA1 gene and show that a single missense mutation (E89K) in

thee amino terminus of ABCA1 results in altered trafficking of ABCA1 with its retention in the

endoplasmicc reticulum and loss of function at the plasma membrane The WHAM chicken thus

representss a naturally occurring animal model for Tangier disease

Materia ll and Method s Measuremen tt of carotenoid s in plasm a

1-mii aliquots of plasma from normal and WHAM chickens were used to determine the absorption

spectraa utilizing a Cary 50 Bio UV-Visible spectrophotometer Water was used as the blank For

thee xanthophyll absorption spectrum 02 mg of xanthophyll Sigma No X-6250) was dissolved

inn 1 ml chloroform for the spectrum shown Chloroform was used as the blank

Phospholipi dd analysi s

Plasmaa lipoproteins were fractionated on a Superose 6HR 1030 FPLC column (Pharmacia) The

equivalentt of 100 |J of plasma was injected onto the column 500-pl fractions were collected

andd used for total cholesterol measurements (Sigma kit 352-50) Values represent total cholesterol

masss per fraction The identities of the lipoproteins have been confirmed by utilizing anti-apoB

immunoreactivityy for LDL and anti-apoA1 immunoreactivity for HDL (not shown) Triglyceride

profiless were used to identify VLDL Lipids were extracted from a 200 pi aliquot of whole plasma

Lipidss were extracted (17) dried down under nitrogen resuspended in 35 pi of CHCI and

spottedd onto an activated TLC plate (Silica Gel 60 Aldrich No Z29297-4) developed in the first

dimensionn consisting of CHCI MeOH28 NH (65255) allowed to dry overnight and then

developedd in the second dimension consisting of CHCIacetoneMeOHglacial acetateH 0 (6

8221) To visualize lipids plates were sprayed with 5 sulfuric acid 5 glacial acetate and

055 mgml FeCL followed by baking at 100C for 30 minutes

DNAA sequencing RT-PCR amplificatio n and sequenc e analysi s

Totall RNA was isolated from control and WHAM chicken liver and reverse transcribed with

oiigo-(dT)188 primer using Superscript II reverse transcriptase (Life Technologies) cDNA was

amplifiedd using Taq DNA polymerase and primers derived from the published human and

mousee ABCA1 cDNA sequences (1518) and primers derived from initial chicken sequence

Fifteenn sets of primer pairs were used to amplify WHAM and control chicken cDNA samples

generatingg 15 overlapping DNA fragments covering 6773 bp To determine the 5 untranslated

portionn of the mRNA we performed 5 RACE using the Marathon cDNA amplification kit

(Clontech) DNA sequencing was performed directly on PCR products using an ABI 373

automatedd DNA sequencer (Applied Biosystems)

190 0

AA Naturally Occurring Mutation in ABCA1 in the WHAM Chicken

Detectio nn of th e W H A M mutatio n

Thee G265A mutation was detected by comparison of the cDNA sequence of normal and

WHAMM male chickens Genotypmg of the variant in normal and WHAM White Leghorn and

nnrma RhnHp Island R^d rhir|ron r|Pfwry)ltr ONA vac performed hy PrP amplification ith

pr imerss in exon 4 (Forward 5-GTCACTTCCCAAACAAAGCTA-3 Reverse 5-

ATGGACGCATTGAAGTTTCC-3) PCR product (15mL) was incubated with Hinf (10U) in total

volumee (25fiL) for 1h at 37 C and products separated on 2 agarose gels The presence of

thee G265A mutation destroys a Hinf site in the PCR product

Sequenc ee Alignmen t

Clustall W 18 with modifications accessed through the Baylor College of Medicine (BCM)

searchh launcher (httpdotimgenbcmtmcedu9331multi-alignOptionsclustalwhtml) was

usedd for multiple sequence alignments with Boxshade for graphical enhancement (http

wwwwww ch embnet orgsoftwareBOX_formhtml)

Generatio nn and analysi s of ABCA 1 harbourin g th e W H A M mutatio n

Thee E to K mutation at position 89 corresponding to an A to G shift of nucleotide 348 in GB

X75926 was introduced on the mouse ABCA1 backbone by fusion PCR with the following

oligonucleotidess (a- TATAAGCAGAGAGCTCGTTTA corresponding to the sequence at bp 94 -

1188 in pBI vector d- GATGCTTGATCTGCCGTA- bp 478-495 of GB X75926) b and c -

TCCCGGCAAGGCTCCCC and GGGAGCCTTGCCGGGA complementary ol igonucleot ides

spanningg the mutated nucleotide ) The amplified fragment was reinserted into the ABCA1

EGFPP backbone in pBI vector (19) by restriction digestion with NotlBsrGI Introduction of the

pointt mutation was confirmed by sequencing with the Dynamic ET terminator Cycle sequencing

kitt (Amersham Pharmacia Biotech Uppsala Sweden)

HeLaa cells were transiently transfected for 16 h with EXGEN 500 (Euromedex Mundolsheim

France)) accordingly to manufacturers instruction and immediately seeded for immunofluorescence

biochemicall and functional analysis

Transfectionn efficiency assessed by flow cytometric evaluation of GFP RFI ( relative fluorescence

intensity)) in the whole cell population was consistently higher than 30 Intracellular trafficking

wass monitored by both immunofluorescence analysis and surface biotinilation at GOh after

transfection

mmunofluorescencee was carried out by standard protocols on slides seeded with 3-5 x 10

cellss and analysed in X-Y dimensions by a Leica TS100 confocal microscope

Surfacee biotynilation was carried out on 3-5 x 10 ceils with 1 mgml NHS-LC-biotin (Pierce) in

icee cold PBS for 30 min followed by lysis in RIPA buffer (50mM Tris-HCI pH8 150mM NaCI

I m MM EDTA and 1 Triton X-100) for 30 mm at 4C Similar amounts of ABCA1 normalised

withh respect to both protein concentration in the samples and transfection efficiency were

191 1

AA Naturally Occurring Mutation in ABCA1 in the WHAM Chicken

Detectio nn of th e W H A M mutatio n

Thee G265A mutation was detected by comparison of the cDNA sequence of normal and

WHAMM male chickens Genotypmg of the variant in normal and WHAM White Leghorn and

nnrma RhnHp Island R^d rhir|ron r|Pfwry)ltr ONA vac performed hy PrP amplification ith

pr imerss in exon 4 (Forward 5-GTCACTTCCCAAACAAAGCTA-3 Reverse 5-

ATGGACGCATTGAAGTTTCC-3) PCR product (15mL) was incubated with Hinf (10U) in total

volumee (25fiL) for 1h at 37 C and products separated on 2 agarose gels The presence of

thee G265A mutation destroys a Hinf site in the PCR product

Sequenc ee Alignmen t

Clustall W 18 with modifications accessed through the Baylor College of Medicine (BCM)

searchh launcher (httpdotimgenbcmtmcedu9331multi-alignOptionsclustalwhtml) was

usedd for multiple sequence alignments with Boxshade for graphical enhancement (http

wwwwww ch embnet orgsoftwareBOX_formhtml)

Generatio nn and analysi s of ABCA 1 harbourin g th e W H A M mutatio n

Thee E to K mutation at position 89 corresponding to an A to G shift of nucleotide 348 in GB

X75926 was introduced on the mouse ABCA1 backbone by fusion PCR with the following

oligonucleotidess (a- TATAAGCAGAGAGCTCGTTTA corresponding to the sequence at bp 94 -

1188 in pBI vector d- GATGCTTGATCTGCCGTA- bp 478-495 of GB X75926) b and c -

TCCCGGCAAGGCTCCCC and GGGAGCCTTGCCGGGA complementary ol igonucleot ides

spanningg the mutated nucleotide ) The amplified fragment was reinserted into the ABCA1

EGFPP backbone in pBI vector (19) by restriction digestion with NotlBsrGI Introduction of the

pointt mutation was confirmed by sequencing with the Dynamic ET terminator Cycle sequencing

kitt (Amersham Pharmacia Biotech Uppsala Sweden)

HeLaa cells were transiently transfected for 16 h with EXGEN 500 (Euromedex Mundolsheim

France)) accordingly to manufacturers instruction and immediately seeded for immunofluorescence

biochemicall and functional analysis

Transfectionn efficiency assessed by flow cytometric evaluation of GFP RFI ( relative fluorescence

intensity)) in the whole cell population was consistently higher than 30 Intracellular trafficking

wass monitored by both immunofluorescence analysis and surface biotinilation at GOh after

transfection

mmunofluorescencee was carried out by standard protocols on slides seeded with 3-5 x 10

cellss and analysed in X-Y dimensions by a Leica TS100 confocal microscope

Surfacee biotynilation was carried out on 3-5 x 10 ceils with 1 mgml NHS-LC-biotin (Pierce) in

icee cold PBS for 30 min followed by lysis in RIPA buffer (50mM Tris-HCI pH8 150mM NaCI

I m MM EDTA and 1 Triton X-100) for 30 mm at 4C Similar amounts of ABCA1 normalised

withh respect to both protein concentration in the samples and transfection efficiency were

191 1

Chapterr 9

immunoprecipitatedd with an anti GFP antibody (clone71131 Boehringer Indianapolis USA)

accordinglyy to standard protocols The immunoprecipitated samples were fractionated by SDS

PAGEE and blotted for 20h onto nitrocellulose paper (Schleicher ampSchuell Dassel Germany)

Thee biotinilated protein was then revealed by ECL (Amersham Pharmacia Biotech Uppsala

Sweden)) after hybridization to streptavidm HRP (Amersham Pharmacia Biotech Uppsala Sweden)

Forr functional analysis fluorescence based assays for surface binding of cyanilated apoA-l or

annexinn V were carried out as described (20) at 60 hours after transfection on 05-1 x 10 cells

Results averaged from a minimum of 4 individual experiments are expressed as percent of the

bindingg elicited by wild type ABCA1EGFP chimera transfected in parallel

Results s Carotenoid ss in seru m

Unlikee normal chickens the WHAM chickens have colorless rather than yellow fasting serum

(Fig 1A) A major contributor to the yellow color of chicken serum is dietary carotenoids many

off which are derived from corn The difference spectrum of WHAM vs normal serum closely

matchess that of the common corn-derived carotenoid xanthophyll indicating that the lack of

colorr is due to the absence of carotenoids in the serum (Fig 1B)

Figur ee 1A Blood plasma from a WHAM chicken has greatlyy reduced levels of carotene Photograph of whole plasmaa revealing the absence of yellow coloration in WHAMM chickens Figur e 1B Absorbance spectra of whole plasmaa from normal and WHAM chickens The difference spectrumm (black in the inset graph) was determined by subtractingg the WHAM spectrum from the normal spectrumm in B This is compared to the absorbance spectrumm for 5 ugml of xanthophyll a naturally occurringg carotenoid alcohol in CHCL The superposition off the difference and the xanthophyll spectra indicate thatt WHAM chickens lack carotenoids in their plasma

WHAMM v ] ^ raquo ^

4033 500

Wavelengthh inmi

A A l l

B B

c c - - p p

a a lt lt

- -

AA Naturally Occurring Mutat ion In ABCA1 in the W H A M Chicken

Plasm aa lipoprotei n and phospholipi d phenotype s

Thee lipoprotein profiles of WHAM and Tangier plasma both show a similarly pronounced loss

off HDL (Fig 2A) In addition the low HDL phenotype in the WHAM chicken is accompanied by

aa 40 50 reduction m I HI cholesterol similar to that seen in Tangier patients Prioi work on

thee WHAM chicken suggested that phospholipids are limiting for HDL production (3) Plasma

fromm WHAM chickens shows a substantial decrease in plasma phospholipid levels (Fig 2B)

identicall to that seen in Tangier Disease Two-dimensional thin-layer chromatography shows

thatt in both the Tangier plasma and in the WHAM plasma the most pronounced phospholipid

deficiencyy is in phosphatidylcholine (PC) and sphingomyelin (SM Fig 2B)

Human n Chicken n

AA 3C |

B B PE E

normal l

PI I

PC C

SM M

LPC

WHAM M

laquolaquo (2) CAMHAcH20

Figur ee 2 The lipoprotein and phospholipid phenotypes of the WHAM chicken closely resembles that of a human patientt with Tangier Disease (A) Plasma lipoprotein cholesterol profiles for human (left) and chicken (right) contrastingg normal vs mutant profiles The chickens have undetectable levels of cholesterol in VLDL (B) Two-dimensionall phospholipid TLC analysis of egual aliguots of plasma from human (left) and chicken (right) comparing normall vs mutant PE phosphatidylethanolamme PC phosphatidylcholine PI phosphatidylinositol SM sphingomyelin LPC ^phosphatidylcholine 0 origin

193 3

Chapterr 9

Identificatio nn of th e W H A M mutatio n

Thee mutation in the WHAM chicken maps approximately 55 cM and 40 cM proximal to the

chickenn B and ID loci respectively (2122) (Fig 3a) This region contains the ALDOB (aldolase B)

andd MUSK genes which map to chromosome Zql 5-16 in chicken and is syntenic to 9q223-

q322 in human (2324) The WHAM locus maps near these genes (2122) and is close to the map

locationn of the ABCA1 gene on human chromosome 9 (12-15) Despite 300 million years of

vertebratee evolution between chicken and human the organization of the human genome is

closerr to that of the chicken than the mouse a more closely-related species (25)

Inn view of the metabolic similarities between the WHAM chicken and patients with Tangier

1600

1 7 0 --

ISO--

lt30--

2COO

2111

2300 -

ALDG 88 3 j 1 S A U ) C e 9 q 2 2 gt q 3 1 i

raquoraquo M gt i i n

M U 5 MUSKK (Zql 5 10

1GTB2 2 -- U (Zql

REBI I

i ll

S4GAII r C 9 p 2 H

lt

a

ff D N A f l i Hi

lt j f c antn gt V A A A T i I i C A _ pound j $ C G C A A I C T i C

GG C G G C C A T i G G G e I C I T I

WHA MM WHA M

G G G A A A 1 i G A A A 1 c r ( -- s

Dpoundpound --

mnftdlgsfl l

ff T lt lt e S ^c gt ^ gt

^^ cP -i ecirc $ lt bf

ii 10

I I

[- EVD raquo T - i i

Sexx chromosome 22 w WZ

ftflftfl IAWII

Hin ll i

M A N

gtgt amp

AMA WW Ctllt raquo

i i

Y P T P amp E A P G V V Y P T P G E A P G V V

T I G 1 T P C C

raquoraquo t i

Figur ee 3 (A ) The WHAM mutation maps to a Z chromosomee region syntenic to the 9q311 location of humann ABCA1 To the left is the chicken Z chromosome combinedd genetic and cytogenetic map To the right is aa combined human genetic and cytogenetic map Positionss of markers mapped genetically or physically aree indicated by dashed arrows Genes mapped only cytogeneticallyy are positioned relative to other markers withh the cytogenetic location in brackets WHAM was geneticallyy mapped relative to ID and B (the relative distancess and the calculated WHAM-B distance are indicated)) (2122) (B) The WHAM chicken ABCA1 gene hass a single amino acid substitution (E89K) relative to normall White Leghorn chicken Total liver RNA from WHAMM and normal male chickens was subjected to standardd RT-PCR and sequencing methods (left panel) usingg primers corresponding to the cDNA sequences mostt conserved between human and mouse ABCA1 (nott shown) The open reading frame (corresponding too amino acids 27 to 2261) was sequenced revealed a singlee homozygous G to A transition in WHAM cDNA at positionn 265 (Numbering of nucleotides and amino acidss is according to the new longer open reading framee of human ABCA1 (30) The same alteration was observedd in PCR product of chicken genomic DNA (right panel) (C) RFLP analysis confirms the presence of the WHAMM mutation in genomic DNA The WHAM alteration destroyss a Hinfl site resulting in a 142 bp uncut fragment ratherr than the 106 bp and 36 bp fragments of normal chickens The chicken sex chromosomes of each bird testedd are indicated below the photo male chickens are ZZ female chickens are ZW Genbank Accession number AF3623777 (D) The glutamate residue at the position of thee non-conservative E89K substitution is conserved betweenn human (CAA10005) mouse (CAA53530) Takifuguu rubripes (fugu) and chicken The WHAM mutationn is thus predicted to have a deleterious effect onn activity of the ABCA1 protein The fugu ammo acid sequencee was predicted from nucleotide sequence of a cosmidd containing the fugu ABCA1 gene (data not published) )

194 4

AA Naturally Occurring Mutation in ABCA1 in the WHAM Chicken

Diseasee and the syntenic localization of the WHAM mutation and the human ABCA1 gene we

hypothesizedd that the chicken ABCA1 gene may be responsible for the WHAM phenotype To

investigatee this hypothesis we sequenced the coding region of ABCA1 from both WHAM and

normall chicken [he humai j n J dm_kui AECA1 itqutnees die 76 identical at the nucleotide

levell and 85 identical and show 92 homology) at the amino acid level The chicken gene is

lesss similar to the human gene than is the mouse gene which has 88 nucleotide identity and

95 ammo acid identity (97 homology) to the human gene (Genbank Submission AF362377)

Thee sequences of the normal and mutant chickens were identical with the exception of a G to A

transitionn in WHAM DNA at nucleotide 265 corresponding to a glutamic acid to lysine substitution

att amino acid 89 (E89K Fig 3B) The G265A mutation eliminates a Hinft restriction site present

inn the normal chicken sequence and facilitated development of a PCR-based Hinfi RFLP assay to

confirmm the mutation in chicken genomic DNA (Fig 3C) This alteration is a non-conservative

aminoo acid substitution at a residue that is conserved in the ABCA1 gene between human

mouse chicken and Takifugu rubripes (fugu) (Fig 3D) The mutation segregates with the

phenotypee of HDL deficiency in the WHAM chickens and is not seen in wild type White Leghorn

chickenss or in another strain of chicken that was investigated New Hampshire (not shown)

Functiona ll analysi s of th e E89K mutatio n in th e ABCA 1 gen e

Inn order to establish the impact of the WHAM mutation on the function of the ABCA1 transporter

wee engineered a construct harbouring the E89K mutation on a murine ABCA1EGFP chimeric

backbone The effects of this mutation on the intracellular trafficking and function of the

transporterr were then analysed in transiently transfected HeLa cells Morphological analysis

highlightedd a dramatic retention of the protein in the endoplasmic reticulum at 48h and 60h

afterr transfection (Fig 4A and B) At these time points the wild type product is predominantly

locatedd at the plasma membrane (fig 4A) This mistargeting was further supported by the

virtuall absence of transporter accessible to cell surface biotinylation (Fig 4C) A minor amount

off WHAM ABCA1 however does reach the plasma membrane but does not exceed 10-20

off the wild type ABCA1 detected in similar conditions

Althoughh the inability to reach the membrane provides in itself an explanation for the lack of

ABCA11 associated functions we tested whether the WHAM ABCA1 transporter when present at

thee plasma membrane was able to specifically bind to ApoA-l or to annexin V These assays address

twoo functions associated with the expression of the ABCA1 transporter namely the exposure of a

specificc binding site for apolipoproteins on the cell surface and the lipid transport activity

Inn both assays flow cytometric evaluation of the GFP expressing transfected cell failed to

detectt any significant binding (fig 4D) (values expressed as percent of the binding elicited by

wildd type ABCA1 EGFP are 138 n=6 for annexin V and 20 1 1 for ApoA-l n= 4) The

WHAMM mutant therefore acts as an essentially complete-loss-of-function mutation

195 5

Chapterr 9

Figur ee 4 The loss of ABCA1 function in WHAM mutations originates from a defect in intracellular trafficking (A)) Confocal microscopic analysis of wild-type ABCA1GFP chimera transfected HeLa cells shows that ABCA1 in its naturall state accumulates mainly at the plasma membrane in discrete vesicles in the cytoplasm (B) Confocal microscopicc analysis of HeLa cells transfected with the WHAMEGFP chimera show massive retention in the endoplasmicc reticulum The mistargeting of the mutated transporter is confirmed by the virtual absence of protein accessiblee to surface biotinylation (C) The migration of the 250kD protein corresponding to the ABCA1EGFP chimericc product (WT) is indicated The expression of WHAMEGFP in transfected cells fails to reconstitute the ABCA1-- elicited ( WT) surface binding of annexin-V ( Ann V Cy1) and ApoA-l ( ApoA-l Cy ) (D) A representative FACS profilee is shown RFI relative flourescence intensity Thick and thin lines correspond to cells gated positive or negativee for GFP fluorescence Values of WHAM elicited binding (expressed as percent of wild type ABCA1 EGFP) aree 138 ( n=6) for annexin V and 20 1 for ApoA-l (n= 4)

Discussion n Inn this study we present the first animal model with a naturally-occurring mutation in the

ABCA11 gene Our prior studies of the metabolic abnormalities in the WHAM chicken indicated

thatt there is a normal rate of apoA1 secretion yet there is hypercatabolism of apoA1 We

proposedd that the defect is in the availability of phospholipid for HDL production in the bloodstream

(23) The similarity of the metabolic phenotypes between Tangier patients and WHAM chickens

togetherr with the synteny between the Z-linked region where the WHAM mutation maps and

thatt of ABCA1 suggested that the WHAM mutation resides in the ABCA1 gene

Comparativee gene sequencing is an effective tool for the study of the functional importance of

specificc amino acid residues The functional conservation of glutamic acid-89 over 400 million

yearss in the ABCA1 gene of the fugu chicken mouse and human genomes provides evidence

forr this glutamic acid to lysine change having significant effects on ABCA1 function in the

chicken The dramatically reduced HDL levels in the WHAM chicken provides further compelling

evidencee for the rate-limiting role of ABCA1 gene in HDL synthesis and conclusively demonstrates

thatt ABCA1 is absolutely required for maintenance of HDL levels in different species

Thee non-conservative E89K mutation described here makes a strong case that this is indeed the

WHAMM mutation The mutation is in an N-terminal segment of ABCA1 whose topology has

beenn controversial The original descriptions of ABCA1 proposed that the first 640 amino acids

aree cytoplasmic and precede the first transmembrane domain However recent studies of

Fitzgeraldd et al (26) have shown that several of the N-gycosylation sites within this segment

aree in fact glycosylated indicating that this segment had to be translocated across the ER and

196 6

AA Naturally Occurring Mutation in ABCA1 in the WHAM Chicken

mustt therefore have an exofacial orientation Thus it is proposed that the first transmembrane

domainn is in a type 2 orientation followed by ammo acids 44-640 The WHAM mutation

wouldd therefore be exposed to the ER lumen and be in a position to disrupt the folding of the

piutc-mm It is alsu iinpuitdiit tu nute that this segment also includes a bU-amino acid N-terminal

regionn that was initially excluded from the presumed open reading frame of ABCA1 and was

subsequentlyy shown to be essential to its function (26)

Thee strict conservation of this glutamate (E89) residue (from fugu to chicken) suggests a

functionall importance which we have confirmed by the in vitro analysis of the WHAM transporter

inn transfected cells The presence of the WHAM mutation impairs physiological intracellular

traffickingg since most of the transporter appears to be retained in the endoplasmic reticulum

Naturallyy occurring mutations in the ABC transporters also have been shown to affect intracellular

trafficking Indeed the most frequent mutation causa for cystic fibrosis (the DF508 mutation)

leadss to a temperature sensitive defect in protein folding and impaired trafficking along the

secretoryy pathway (27)

Ass a result of the WHAM mutation only limited amounts of ABCA1 reach the plasma membrane

andd fail to elicit the functional effects associated with the expression of wild type ABCA1 In

particular the complete absence of ApoAl binding upon expression of WHAM transporter is

sufficientt to impair cellular release of PL to lipid poor HDL particles

Thee serum from WHAM chickens is colorless a consequence of greatly reduced levels of

carotenoids Tangier serum has the same carotenoid content as normal human serum In the

WHAMM chicken carotenoids are absorbed normally (unpublished observations) and are cleared

fromm the circulation Unlike the human patients the WHAM chicken is deficient in virtually all

lipoproteins thus the reduced carrying capacity for carotenoids is the likely explanation for the

colorlesss serum

Thee phenotype of Tangier Disease and of WHAM chickens establishes a critical role for ABCA1

inn the supply of lipids to the lipid-poor HDL particle A large body of literature proposes a role

forr HDL in transport of cholesterol from extrahepatic tissues to the liver a process termed

reversee cholesterol transport Implicit in this model is that the bulk of the lipids that end up

inn HDL particles originate in extraheptic tissues The drastic effect that the ABCA1 mutation has

onn HDL levels in Tangier Disease and in the WHAM chickens supports a major role for ABCA1

inn the supply of lipids for HDL The fact that ABCA1 functions to export lipids from cells is

consistentt with HDL assembly as an extracellular event in which the first step is the binding of

apoA11 to phospholipids Indeed apo-Al spontaneously forms HDL precursor particles when

exposedd to phospholipids (28)

Thee WHAM chicken supplied the first genetic evidence that vertebrates like invertebrates

havee an extracellular lipoprotein assembly pathway The key observation was that despite

normall apo-A1 synthesis and secretion the chickens are unable to produce stable HDL particles

197 7

Chapterr 9

Thee mutant chickens have a deficiency in plasma phospholipid which suggested that the

dearthh of phospholipid in the bloodstream was likely the primary defect responsible for the

HDLL deficiency syndrome (3) Subsequent studies in Tangier fibroblasts established that a lipid

transportt defect underlies this dtsease (7-9) It remains to be established which tissue makes

thee largest contribution to HDL lipids in an ABCA1-dependent fashion Recent studies by

Haghpassandd et al (29) show that macrophages despite being highly enriched in ABCA1 do

nott make a significant contribution to HDL lipids In the WHAM chicken there is substantial

cholesteroll ester accumulation in the liver and intestine (unpublished observations) suggesting

thatt ABCA1 is most active in lipid transport out of these tissues If this is the case then it will be

importantt to make a distinction between the role of ABCA1 in the contribution of lipids to HDL

andd the role of ABCA1 in macrophages relative to atherosclerosis susceptibility If these are

indeedd two separate roles then the traditional view of reverse cholesterol transport would still be

validd vis-a-vis atherosclerosis but not necessarily be relevant to the bulk of HDL lipid transport

Acknowledgement s s Wee thank Susan Pope and Widya Paramita for their excellent assistance in the maintenance of

thee chickens Albert Lee and Agripma Saurez have provided superb technical support This

workk was funded by Xenon Genetics Inc of Vancouver BC Canada and by grants from the

Heartt amp Stroke Foundation of Canada (MRH) the Canadian Network of Centers of Excellence

(NCEE Genetics MRH) Canadian Institute for Health Research (MRH)

Reference s s 1 McGibbon WH 1981 White skin a Z-linked recessive mutation in the fowl J Heredity 72139-140

2 Poernama F Schreyer SA Bitgood JJ Cook ME and Attie AD 1990 Spontaneous high density lipoproteinn deficiency syndrome associated with aZ-lmked mutation in chickens J Lipid Res 31955-963

3 Schreyer SA Hart L K and Attie AD 1994 Hypercatabolismof lipoprotein-freeapolipoprotein A-1 in HDL-defioentt mutant chickens Artenosd SThromb 14 2053 2059

44 Lusis AJ Taylor BA Wangenstein RWand LeBoeuf RL 1983 Genetic control of lipid transportin mice II Genes controlling structure of high density lipoproteins J Biol Chem 2585071-5078

5 Sparkes RS Winokur S Lusis AJ and Klisak I 1987 Regional Assignment of the Apolipoprotein-A-I Gene byy In situ Hybridization to Human-Chromosome 11q23-Qter Cytogenet Cell Genet 46697-697

6 Schaefer EJ Blum CB Levy RI Jenkins LL Alaupovic P Foster DM and Brewer HB 1978 Metabolismm of high-density lipoprotein apolipoproteins in Tangier Disease N Engl J Med 299905-910

77 Francis G A Knopp RH and Oram JF 1995 Defective removal of cellular cholesterol and phospholipids byy apolipoprotem A-l in Tangier disease J Clin Invest 9678-87

198 8

AA Naturally Occurring Mutat ion in ABCA1 in the W H A M Chicken

8 Rogier G Trumbach B Klima B Lackner K ) and Schmitz G 1995 HDL-Mediated Efflux of Intracellular

Cholesteroll Is Impaired in Fibroblasts from Tangier Disease Patients Arteriosder Thromb Vase Biol 15683-690

9 von Eckardstem A Cbirazi A Schuler-Luttmann S Walter Mr Kastelein JJP Geisel J Real JT Miccoli

RR Noseda G Hobbel G et a 1998 Plasma and fibroblasts of Tanqier disease patient- arp distirhpd in

transferringg phospholipids onto apolipoprotein A- IJ Lipid Res 39987-998

11 0 Assmann G von Eckardstein A and Brewer HB 1995 Familial high density liporpteom deficiency Tangier Disease In The Metabolic and Molecular Basis of Inherited Disease CR Scirever AL Beaudet WS Sly and D Valle editors New York McGraw-Hill 2053-2072

11 Ferrans VJ and Fredrickson D S 1975 The pathology of Tangier Disease A light and electron microscopic

study Am J Pathol 78101-1 58

12 Bodzioch M Orso E Klucken J Langmann T Bottcher A Diedench W Drobnik W Barlage S

Buchler C Porsch-Ozcurumez M et al 1999 The gene encoding ATP-binding cassette transporter 1 is

mutatedd in Tangier disease Nat Genet22336-345

11 3 Brooks-Wilson A Marcil M Clee SM Zhang LH Roomp K van Dam M Yu L Brewer C Collins J A Molhuizen HO et al 1999 Mutations in ABC1 in Tangier disease and familial high-density lipoprotein deficiencyy [seecomments] Nature Genet 22336-345

14 Lawn RM Wade DP Garvin MR Wang XB Schwartz K Porter JG Seilhamer JJ Vaughan AM

andd Oram JF 1999 The Tangier disease gene product ABC1 controls the cellular apolipoprotein-mediated

lipidd removal pathway Clin Invest 104R25-R31

11 5 Rust S Rosier M Funke H Real J Amoura Z Piette JC Deleuze JF Brewer HB Duverger N

Denefle P et al 1999 Tangier disease is caused by mutations in the gene encoding ATP-binding cassette

transporterr 1 Nature Genet 22352-355

16 Francis GA Knopp RH and Oram JF 1995 Defective Removal of Cellular Cholesterol and Phospholipids byy Apolipoprotein-a-l in Tangier Disease Clin Invest 9678-87

11 7 Bligh EG and Dyer WJ 1959 A rapid method of total lipid extraction and purification Can J Biochem

PhysiolPhysiol 37911-917

18 Luciani MF Denizot F Savary S Mattel MGandChimini G 1994 Cloning of two novel ABC transporters mappingg on human chromosome 9 Genomics 211 50-1 54

19 Harmon Y Broccardo C Chambenoit 0 Luciani MF Toti F Chaslm S Freyssinet JM Devaux PF

McNeish J Marguet D et al 2000 ABC1 promotes engulfment of apoptotic cells and transbilayer

redistributionn of phosphatidylserine Nat Cell Biol Biol 2 399-406

20 Charnbenoit O Harnon Y Maiyuei D Riyneauit H Rosseneu ivi and Chimin G 2UumlU l Specific clocking off apolipoprotein A l at the cell surface requires a functional ABCA1 transporter J Biol Chem 2769955-9960

21 Bitgood JJ 1985 Additional linkage relationships within the Z chromosome of the chicken Poultry Sci 642234-2238

22 Bitgood JJ 1988 Linear relationship of the loci for barring dermal melanin inhibitor and recessive white skin onn the chicken Z chromosome Poultry 5c 67530-533

199 9

Chapterr 9

233 Fridolfsson AK Cheng H Copeland NGJenkins NA Liu HC RaudseppT Woodage T Chowdhary

B Halverson J and Ellegren H 1998 Evolution of the avian sex chromosomes from an ancestral pair of

autosomes Proc Natl Acad So USA 958147-81 52

24 Nanda I Shan Z Schart M Burt DW Koehler M Nothwang H Grutzner F Paton LR Windsor D

Dunn I eta l 1999 300 million years of conserved synteny between chicken Zand human chromosome 9

NatNat Genet 21258-259

25 Burt DW Bruley C Dunn ICJones CT Ramage A Law AS Morrice DR Paton IR Smith J

Windsor D et al 1999 The dynamics of chromosome evolution in birds and mammals Nature 402411413

26 Fitzgerald M l Mendez AJ Moore KJ Andersson LP Panjeton H A and Freeman MW 2001 ATP-

bindingg cassette transporter A1 contains an NH2-termmal signal anchor sequence that translocates the

proteinss first hydrophilic domain to the exoplasmic space J BiolChem 2761 5137-1 5145

27 French PJ Doorninck JH Peters RH Verbeek E Ameen N A Marino C R Jonge HR Bijman J and

Scholte BJ 1996 A delta F508 mutation in mouse cystic fibrosis transmembrane conductance regulator

resultss in a temperature-sensitive processing defect in vivo J Clin Invest 981304-1312

28 Jonas A 1986 Reconst i tute of high-density lipoproteins Methods Enzymol 128553-582

29 Haghpassand M Bourassa PA Francone OL and Aiello RJ 2001 Monocytemacrophage expression of

ABCA11 has minimal contribution to plasma HDL levels J Clin Invest 1081315-1320

30 Pullinger CR Hakamata H Duchateau PN Eng C Aouizerat BE Cho MH Fielding CJ and Kane JP

2000 Analysis of hABG gene 5 end additional peptide sequence promoter region and four polymorphisms

BiochemBiochem Biophys Res Commun 271451455

200 0

AA Naturally Occurring Mutat ion In ABCA1 in the W H A M Chicken

Plasm aa lipoprotei n and phospholipi d phenotype s

Thee lipoprotein profiles of WHAM and Tangier plasma both show a similarly pronounced loss

off HDL (Fig 2A) In addition the low HDL phenotype in the WHAM chicken is accompanied by

aa 40 50 reduction m I HI cholesterol similar to that seen in Tangier patients Prioi work on

thee WHAM chicken suggested that phospholipids are limiting for HDL production (3) Plasma

fromm WHAM chickens shows a substantial decrease in plasma phospholipid levels (Fig 2B)

identicall to that seen in Tangier Disease Two-dimensional thin-layer chromatography shows

thatt in both the Tangier plasma and in the WHAM plasma the most pronounced phospholipid

deficiencyy is in phosphatidylcholine (PC) and sphingomyelin (SM Fig 2B)

Human n Chicken n

AA 3C |

B B PE E

normal l

PI I

PC C

SM M

LPC

WHAM M

laquolaquo (2) CAMHAcH20

Figur ee 2 The lipoprotein and phospholipid phenotypes of the WHAM chicken closely resembles that of a human patientt with Tangier Disease (A) Plasma lipoprotein cholesterol profiles for human (left) and chicken (right) contrastingg normal vs mutant profiles The chickens have undetectable levels of cholesterol in VLDL (B) Two-dimensionall phospholipid TLC analysis of egual aliguots of plasma from human (left) and chicken (right) comparing normall vs mutant PE phosphatidylethanolamme PC phosphatidylcholine PI phosphatidylinositol SM sphingomyelin LPC ^phosphatidylcholine 0 origin

193 3

Chapterr 9

Identificatio nn of th e W H A M mutatio n

Thee mutation in the WHAM chicken maps approximately 55 cM and 40 cM proximal to the

chickenn B and ID loci respectively (2122) (Fig 3a) This region contains the ALDOB (aldolase B)

andd MUSK genes which map to chromosome Zql 5-16 in chicken and is syntenic to 9q223-

q322 in human (2324) The WHAM locus maps near these genes (2122) and is close to the map

locationn of the ABCA1 gene on human chromosome 9 (12-15) Despite 300 million years of

vertebratee evolution between chicken and human the organization of the human genome is

closerr to that of the chicken than the mouse a more closely-related species (25)

Inn view of the metabolic similarities between the WHAM chicken and patients with Tangier

1600

1 7 0 --

ISO--

lt30--

2COO

2111

2300 -

ALDG 88 3 j 1 S A U ) C e 9 q 2 2 gt q 3 1 i

raquoraquo M gt i i n

M U 5 MUSKK (Zql 5 10

1GTB2 2 -- U (Zql

REBI I

i ll

S4GAII r C 9 p 2 H

lt

a

ff D N A f l i Hi

lt j f c antn gt V A A A T i I i C A _ pound j $ C G C A A I C T i C

GG C G G C C A T i G G G e I C I T I

WHA MM WHA M

G G G A A A 1 i G A A A 1 c r ( -- s

Dpoundpound --

mnftdlgsfl l

ff T lt lt e S ^c gt ^ gt

^^ cP -i ecirc $ lt bf

ii 10

I I

[- EVD raquo T - i i

Sexx chromosome 22 w WZ

ftflftfl IAWII

Hin ll i

M A N

gtgt amp

AMA WW Ctllt raquo

i i

Y P T P amp E A P G V V Y P T P G E A P G V V

T I G 1 T P C C

raquoraquo t i

Figur ee 3 (A ) The WHAM mutation maps to a Z chromosomee region syntenic to the 9q311 location of humann ABCA1 To the left is the chicken Z chromosome combinedd genetic and cytogenetic map To the right is aa combined human genetic and cytogenetic map Positionss of markers mapped genetically or physically aree indicated by dashed arrows Genes mapped only cytogeneticallyy are positioned relative to other markers withh the cytogenetic location in brackets WHAM was geneticallyy mapped relative to ID and B (the relative distancess and the calculated WHAM-B distance are indicated)) (2122) (B) The WHAM chicken ABCA1 gene hass a single amino acid substitution (E89K) relative to normall White Leghorn chicken Total liver RNA from WHAMM and normal male chickens was subjected to standardd RT-PCR and sequencing methods (left panel) usingg primers corresponding to the cDNA sequences mostt conserved between human and mouse ABCA1 (nott shown) The open reading frame (corresponding too amino acids 27 to 2261) was sequenced revealed a singlee homozygous G to A transition in WHAM cDNA at positionn 265 (Numbering of nucleotides and amino acidss is according to the new longer open reading framee of human ABCA1 (30) The same alteration was observedd in PCR product of chicken genomic DNA (right panel) (C) RFLP analysis confirms the presence of the WHAMM mutation in genomic DNA The WHAM alteration destroyss a Hinfl site resulting in a 142 bp uncut fragment ratherr than the 106 bp and 36 bp fragments of normal chickens The chicken sex chromosomes of each bird testedd are indicated below the photo male chickens are ZZ female chickens are ZW Genbank Accession number AF3623777 (D) The glutamate residue at the position of thee non-conservative E89K substitution is conserved betweenn human (CAA10005) mouse (CAA53530) Takifuguu rubripes (fugu) and chicken The WHAM mutationn is thus predicted to have a deleterious effect onn activity of the ABCA1 protein The fugu ammo acid sequencee was predicted from nucleotide sequence of a cosmidd containing the fugu ABCA1 gene (data not published) )

194 4

AA Naturally Occurring Mutation in ABCA1 in the WHAM Chicken

Diseasee and the syntenic localization of the WHAM mutation and the human ABCA1 gene we

hypothesizedd that the chicken ABCA1 gene may be responsible for the WHAM phenotype To

investigatee this hypothesis we sequenced the coding region of ABCA1 from both WHAM and

normall chicken [he humai j n J dm_kui AECA1 itqutnees die 76 identical at the nucleotide

levell and 85 identical and show 92 homology) at the amino acid level The chicken gene is

lesss similar to the human gene than is the mouse gene which has 88 nucleotide identity and

95 ammo acid identity (97 homology) to the human gene (Genbank Submission AF362377)

Thee sequences of the normal and mutant chickens were identical with the exception of a G to A

transitionn in WHAM DNA at nucleotide 265 corresponding to a glutamic acid to lysine substitution

att amino acid 89 (E89K Fig 3B) The G265A mutation eliminates a Hinft restriction site present

inn the normal chicken sequence and facilitated development of a PCR-based Hinfi RFLP assay to

confirmm the mutation in chicken genomic DNA (Fig 3C) This alteration is a non-conservative

aminoo acid substitution at a residue that is conserved in the ABCA1 gene between human

mouse chicken and Takifugu rubripes (fugu) (Fig 3D) The mutation segregates with the

phenotypee of HDL deficiency in the WHAM chickens and is not seen in wild type White Leghorn

chickenss or in another strain of chicken that was investigated New Hampshire (not shown)

Functiona ll analysi s of th e E89K mutatio n in th e ABCA 1 gen e

Inn order to establish the impact of the WHAM mutation on the function of the ABCA1 transporter

wee engineered a construct harbouring the E89K mutation on a murine ABCA1EGFP chimeric

backbone The effects of this mutation on the intracellular trafficking and function of the

transporterr were then analysed in transiently transfected HeLa cells Morphological analysis

highlightedd a dramatic retention of the protein in the endoplasmic reticulum at 48h and 60h

afterr transfection (Fig 4A and B) At these time points the wild type product is predominantly

locatedd at the plasma membrane (fig 4A) This mistargeting was further supported by the

virtuall absence of transporter accessible to cell surface biotinylation (Fig 4C) A minor amount

off WHAM ABCA1 however does reach the plasma membrane but does not exceed 10-20

off the wild type ABCA1 detected in similar conditions

Althoughh the inability to reach the membrane provides in itself an explanation for the lack of

ABCA11 associated functions we tested whether the WHAM ABCA1 transporter when present at

thee plasma membrane was able to specifically bind to ApoA-l or to annexin V These assays address

twoo functions associated with the expression of the ABCA1 transporter namely the exposure of a

specificc binding site for apolipoproteins on the cell surface and the lipid transport activity

Inn both assays flow cytometric evaluation of the GFP expressing transfected cell failed to

detectt any significant binding (fig 4D) (values expressed as percent of the binding elicited by

wildd type ABCA1 EGFP are 138 n=6 for annexin V and 20 1 1 for ApoA-l n= 4) The

WHAMM mutant therefore acts as an essentially complete-loss-of-function mutation

195 5

Chapterr 9

Figur ee 4 The loss of ABCA1 function in WHAM mutations originates from a defect in intracellular trafficking (A)) Confocal microscopic analysis of wild-type ABCA1GFP chimera transfected HeLa cells shows that ABCA1 in its naturall state accumulates mainly at the plasma membrane in discrete vesicles in the cytoplasm (B) Confocal microscopicc analysis of HeLa cells transfected with the WHAMEGFP chimera show massive retention in the endoplasmicc reticulum The mistargeting of the mutated transporter is confirmed by the virtual absence of protein accessiblee to surface biotinylation (C) The migration of the 250kD protein corresponding to the ABCA1EGFP chimericc product (WT) is indicated The expression of WHAMEGFP in transfected cells fails to reconstitute the ABCA1-- elicited ( WT) surface binding of annexin-V ( Ann V Cy1) and ApoA-l ( ApoA-l Cy ) (D) A representative FACS profilee is shown RFI relative flourescence intensity Thick and thin lines correspond to cells gated positive or negativee for GFP fluorescence Values of WHAM elicited binding (expressed as percent of wild type ABCA1 EGFP) aree 138 ( n=6) for annexin V and 20 1 for ApoA-l (n= 4)

Discussion n Inn this study we present the first animal model with a naturally-occurring mutation in the

ABCA11 gene Our prior studies of the metabolic abnormalities in the WHAM chicken indicated

thatt there is a normal rate of apoA1 secretion yet there is hypercatabolism of apoA1 We

proposedd that the defect is in the availability of phospholipid for HDL production in the bloodstream

(23) The similarity of the metabolic phenotypes between Tangier patients and WHAM chickens

togetherr with the synteny between the Z-linked region where the WHAM mutation maps and

thatt of ABCA1 suggested that the WHAM mutation resides in the ABCA1 gene

Comparativee gene sequencing is an effective tool for the study of the functional importance of

specificc amino acid residues The functional conservation of glutamic acid-89 over 400 million

yearss in the ABCA1 gene of the fugu chicken mouse and human genomes provides evidence

forr this glutamic acid to lysine change having significant effects on ABCA1 function in the

chicken The dramatically reduced HDL levels in the WHAM chicken provides further compelling

evidencee for the rate-limiting role of ABCA1 gene in HDL synthesis and conclusively demonstrates

thatt ABCA1 is absolutely required for maintenance of HDL levels in different species

Thee non-conservative E89K mutation described here makes a strong case that this is indeed the

WHAMM mutation The mutation is in an N-terminal segment of ABCA1 whose topology has

beenn controversial The original descriptions of ABCA1 proposed that the first 640 amino acids

aree cytoplasmic and precede the first transmembrane domain However recent studies of

Fitzgeraldd et al (26) have shown that several of the N-gycosylation sites within this segment

aree in fact glycosylated indicating that this segment had to be translocated across the ER and

196 6

AA Naturally Occurring Mutation in ABCA1 in the WHAM Chicken

mustt therefore have an exofacial orientation Thus it is proposed that the first transmembrane

domainn is in a type 2 orientation followed by ammo acids 44-640 The WHAM mutation

wouldd therefore be exposed to the ER lumen and be in a position to disrupt the folding of the

piutc-mm It is alsu iinpuitdiit tu nute that this segment also includes a bU-amino acid N-terminal

regionn that was initially excluded from the presumed open reading frame of ABCA1 and was

subsequentlyy shown to be essential to its function (26)

Thee strict conservation of this glutamate (E89) residue (from fugu to chicken) suggests a

functionall importance which we have confirmed by the in vitro analysis of the WHAM transporter

inn transfected cells The presence of the WHAM mutation impairs physiological intracellular

traffickingg since most of the transporter appears to be retained in the endoplasmic reticulum

Naturallyy occurring mutations in the ABC transporters also have been shown to affect intracellular

trafficking Indeed the most frequent mutation causa for cystic fibrosis (the DF508 mutation)

leadss to a temperature sensitive defect in protein folding and impaired trafficking along the

secretoryy pathway (27)

Ass a result of the WHAM mutation only limited amounts of ABCA1 reach the plasma membrane

andd fail to elicit the functional effects associated with the expression of wild type ABCA1 In

particular the complete absence of ApoAl binding upon expression of WHAM transporter is

sufficientt to impair cellular release of PL to lipid poor HDL particles

Thee serum from WHAM chickens is colorless a consequence of greatly reduced levels of

carotenoids Tangier serum has the same carotenoid content as normal human serum In the

WHAMM chicken carotenoids are absorbed normally (unpublished observations) and are cleared

fromm the circulation Unlike the human patients the WHAM chicken is deficient in virtually all

lipoproteins thus the reduced carrying capacity for carotenoids is the likely explanation for the

colorlesss serum

Thee phenotype of Tangier Disease and of WHAM chickens establishes a critical role for ABCA1

inn the supply of lipids to the lipid-poor HDL particle A large body of literature proposes a role

forr HDL in transport of cholesterol from extrahepatic tissues to the liver a process termed

reversee cholesterol transport Implicit in this model is that the bulk of the lipids that end up

inn HDL particles originate in extraheptic tissues The drastic effect that the ABCA1 mutation has

onn HDL levels in Tangier Disease and in the WHAM chickens supports a major role for ABCA1

inn the supply of lipids for HDL The fact that ABCA1 functions to export lipids from cells is

consistentt with HDL assembly as an extracellular event in which the first step is the binding of

apoA11 to phospholipids Indeed apo-Al spontaneously forms HDL precursor particles when

exposedd to phospholipids (28)

Thee WHAM chicken supplied the first genetic evidence that vertebrates like invertebrates

havee an extracellular lipoprotein assembly pathway The key observation was that despite

normall apo-A1 synthesis and secretion the chickens are unable to produce stable HDL particles

197 7

Chapterr 9

Thee mutant chickens have a deficiency in plasma phospholipid which suggested that the

dearthh of phospholipid in the bloodstream was likely the primary defect responsible for the

HDLL deficiency syndrome (3) Subsequent studies in Tangier fibroblasts established that a lipid

transportt defect underlies this dtsease (7-9) It remains to be established which tissue makes

thee largest contribution to HDL lipids in an ABCA1-dependent fashion Recent studies by

Haghpassandd et al (29) show that macrophages despite being highly enriched in ABCA1 do

nott make a significant contribution to HDL lipids In the WHAM chicken there is substantial

cholesteroll ester accumulation in the liver and intestine (unpublished observations) suggesting

thatt ABCA1 is most active in lipid transport out of these tissues If this is the case then it will be

importantt to make a distinction between the role of ABCA1 in the contribution of lipids to HDL

andd the role of ABCA1 in macrophages relative to atherosclerosis susceptibility If these are

indeedd two separate roles then the traditional view of reverse cholesterol transport would still be

validd vis-a-vis atherosclerosis but not necessarily be relevant to the bulk of HDL lipid transport

Acknowledgement s s Wee thank Susan Pope and Widya Paramita for their excellent assistance in the maintenance of

thee chickens Albert Lee and Agripma Saurez have provided superb technical support This

workk was funded by Xenon Genetics Inc of Vancouver BC Canada and by grants from the

Heartt amp Stroke Foundation of Canada (MRH) the Canadian Network of Centers of Excellence

(NCEE Genetics MRH) Canadian Institute for Health Research (MRH)

Reference s s 1 McGibbon WH 1981 White skin a Z-linked recessive mutation in the fowl J Heredity 72139-140

2 Poernama F Schreyer SA Bitgood JJ Cook ME and Attie AD 1990 Spontaneous high density lipoproteinn deficiency syndrome associated with aZ-lmked mutation in chickens J Lipid Res 31955-963

3 Schreyer SA Hart L K and Attie AD 1994 Hypercatabolismof lipoprotein-freeapolipoprotein A-1 in HDL-defioentt mutant chickens Artenosd SThromb 14 2053 2059

44 Lusis AJ Taylor BA Wangenstein RWand LeBoeuf RL 1983 Genetic control of lipid transportin mice II Genes controlling structure of high density lipoproteins J Biol Chem 2585071-5078

5 Sparkes RS Winokur S Lusis AJ and Klisak I 1987 Regional Assignment of the Apolipoprotein-A-I Gene byy In situ Hybridization to Human-Chromosome 11q23-Qter Cytogenet Cell Genet 46697-697

6 Schaefer EJ Blum CB Levy RI Jenkins LL Alaupovic P Foster DM and Brewer HB 1978 Metabolismm of high-density lipoprotein apolipoproteins in Tangier Disease N Engl J Med 299905-910

77 Francis G A Knopp RH and Oram JF 1995 Defective removal of cellular cholesterol and phospholipids byy apolipoprotem A-l in Tangier disease J Clin Invest 9678-87

198 8

AA Naturally Occurring Mutat ion in ABCA1 in the W H A M Chicken

8 Rogier G Trumbach B Klima B Lackner K ) and Schmitz G 1995 HDL-Mediated Efflux of Intracellular

Cholesteroll Is Impaired in Fibroblasts from Tangier Disease Patients Arteriosder Thromb Vase Biol 15683-690

9 von Eckardstem A Cbirazi A Schuler-Luttmann S Walter Mr Kastelein JJP Geisel J Real JT Miccoli

RR Noseda G Hobbel G et a 1998 Plasma and fibroblasts of Tanqier disease patient- arp distirhpd in

transferringg phospholipids onto apolipoprotein A- IJ Lipid Res 39987-998

11 0 Assmann G von Eckardstein A and Brewer HB 1995 Familial high density liporpteom deficiency Tangier Disease In The Metabolic and Molecular Basis of Inherited Disease CR Scirever AL Beaudet WS Sly and D Valle editors New York McGraw-Hill 2053-2072

11 Ferrans VJ and Fredrickson D S 1975 The pathology of Tangier Disease A light and electron microscopic

study Am J Pathol 78101-1 58

12 Bodzioch M Orso E Klucken J Langmann T Bottcher A Diedench W Drobnik W Barlage S

Buchler C Porsch-Ozcurumez M et al 1999 The gene encoding ATP-binding cassette transporter 1 is

mutatedd in Tangier disease Nat Genet22336-345

11 3 Brooks-Wilson A Marcil M Clee SM Zhang LH Roomp K van Dam M Yu L Brewer C Collins J A Molhuizen HO et al 1999 Mutations in ABC1 in Tangier disease and familial high-density lipoprotein deficiencyy [seecomments] Nature Genet 22336-345

14 Lawn RM Wade DP Garvin MR Wang XB Schwartz K Porter JG Seilhamer JJ Vaughan AM

andd Oram JF 1999 The Tangier disease gene product ABC1 controls the cellular apolipoprotein-mediated

lipidd removal pathway Clin Invest 104R25-R31

11 5 Rust S Rosier M Funke H Real J Amoura Z Piette JC Deleuze JF Brewer HB Duverger N

Denefle P et al 1999 Tangier disease is caused by mutations in the gene encoding ATP-binding cassette

transporterr 1 Nature Genet 22352-355

16 Francis GA Knopp RH and Oram JF 1995 Defective Removal of Cellular Cholesterol and Phospholipids byy Apolipoprotein-a-l in Tangier Disease Clin Invest 9678-87

11 7 Bligh EG and Dyer WJ 1959 A rapid method of total lipid extraction and purification Can J Biochem

PhysiolPhysiol 37911-917

18 Luciani MF Denizot F Savary S Mattel MGandChimini G 1994 Cloning of two novel ABC transporters mappingg on human chromosome 9 Genomics 211 50-1 54

19 Harmon Y Broccardo C Chambenoit 0 Luciani MF Toti F Chaslm S Freyssinet JM Devaux PF

McNeish J Marguet D et al 2000 ABC1 promotes engulfment of apoptotic cells and transbilayer

redistributionn of phosphatidylserine Nat Cell Biol Biol 2 399-406

20 Charnbenoit O Harnon Y Maiyuei D Riyneauit H Rosseneu ivi and Chimin G 2UumlU l Specific clocking off apolipoprotein A l at the cell surface requires a functional ABCA1 transporter J Biol Chem 2769955-9960

21 Bitgood JJ 1985 Additional linkage relationships within the Z chromosome of the chicken Poultry Sci 642234-2238

22 Bitgood JJ 1988 Linear relationship of the loci for barring dermal melanin inhibitor and recessive white skin onn the chicken Z chromosome Poultry 5c 67530-533

199 9

Chapterr 9

233 Fridolfsson AK Cheng H Copeland NGJenkins NA Liu HC RaudseppT Woodage T Chowdhary

B Halverson J and Ellegren H 1998 Evolution of the avian sex chromosomes from an ancestral pair of

autosomes Proc Natl Acad So USA 958147-81 52

24 Nanda I Shan Z Schart M Burt DW Koehler M Nothwang H Grutzner F Paton LR Windsor D

Dunn I eta l 1999 300 million years of conserved synteny between chicken Zand human chromosome 9

NatNat Genet 21258-259

25 Burt DW Bruley C Dunn ICJones CT Ramage A Law AS Morrice DR Paton IR Smith J

Windsor D et al 1999 The dynamics of chromosome evolution in birds and mammals Nature 402411413

26 Fitzgerald M l Mendez AJ Moore KJ Andersson LP Panjeton H A and Freeman MW 2001 ATP-

bindingg cassette transporter A1 contains an NH2-termmal signal anchor sequence that translocates the

proteinss first hydrophilic domain to the exoplasmic space J BiolChem 2761 5137-1 5145

27 French PJ Doorninck JH Peters RH Verbeek E Ameen N A Marino C R Jonge HR Bijman J and

Scholte BJ 1996 A delta F508 mutation in mouse cystic fibrosis transmembrane conductance regulator

resultss in a temperature-sensitive processing defect in vivo J Clin Invest 981304-1312

28 Jonas A 1986 Reconst i tute of high-density lipoproteins Methods Enzymol 128553-582

29 Haghpassand M Bourassa PA Francone OL and Aiello RJ 2001 Monocytemacrophage expression of

ABCA11 has minimal contribution to plasma HDL levels J Clin Invest 1081315-1320

30 Pullinger CR Hakamata H Duchateau PN Eng C Aouizerat BE Cho MH Fielding CJ and Kane JP

2000 Analysis of hABG gene 5 end additional peptide sequence promoter region and four polymorphisms

BiochemBiochem Biophys Res Commun 271451455

200 0

Chapterr 9

Identificatio nn of th e W H A M mutatio n

Thee mutation in the WHAM chicken maps approximately 55 cM and 40 cM proximal to the

chickenn B and ID loci respectively (2122) (Fig 3a) This region contains the ALDOB (aldolase B)

andd MUSK genes which map to chromosome Zql 5-16 in chicken and is syntenic to 9q223-

q322 in human (2324) The WHAM locus maps near these genes (2122) and is close to the map

locationn of the ABCA1 gene on human chromosome 9 (12-15) Despite 300 million years of

vertebratee evolution between chicken and human the organization of the human genome is

closerr to that of the chicken than the mouse a more closely-related species (25)

Inn view of the metabolic similarities between the WHAM chicken and patients with Tangier

1600

1 7 0 --

ISO--

lt30--

2COO

2111

2300 -

ALDG 88 3 j 1 S A U ) C e 9 q 2 2 gt q 3 1 i

raquoraquo M gt i i n

M U 5 MUSKK (Zql 5 10

1GTB2 2 -- U (Zql

REBI I

i ll

S4GAII r C 9 p 2 H

lt

a

ff D N A f l i Hi

lt j f c antn gt V A A A T i I i C A _ pound j $ C G C A A I C T i C

GG C G G C C A T i G G G e I C I T I

WHA MM WHA M

G G G A A A 1 i G A A A 1 c r ( -- s

Dpoundpound --

mnftdlgsfl l

ff T lt lt e S ^c gt ^ gt

^^ cP -i ecirc $ lt bf

ii 10

I I

[- EVD raquo T - i i

Sexx chromosome 22 w WZ

ftflftfl IAWII

Hin ll i

M A N

gtgt amp

AMA WW Ctllt raquo

i i

Y P T P amp E A P G V V Y P T P G E A P G V V

T I G 1 T P C C

raquoraquo t i

Figur ee 3 (A ) The WHAM mutation maps to a Z chromosomee region syntenic to the 9q311 location of humann ABCA1 To the left is the chicken Z chromosome combinedd genetic and cytogenetic map To the right is aa combined human genetic and cytogenetic map Positionss of markers mapped genetically or physically aree indicated by dashed arrows Genes mapped only cytogeneticallyy are positioned relative to other markers withh the cytogenetic location in brackets WHAM was geneticallyy mapped relative to ID and B (the relative distancess and the calculated WHAM-B distance are indicated)) (2122) (B) The WHAM chicken ABCA1 gene hass a single amino acid substitution (E89K) relative to normall White Leghorn chicken Total liver RNA from WHAMM and normal male chickens was subjected to standardd RT-PCR and sequencing methods (left panel) usingg primers corresponding to the cDNA sequences mostt conserved between human and mouse ABCA1 (nott shown) The open reading frame (corresponding too amino acids 27 to 2261) was sequenced revealed a singlee homozygous G to A transition in WHAM cDNA at positionn 265 (Numbering of nucleotides and amino acidss is according to the new longer open reading framee of human ABCA1 (30) The same alteration was observedd in PCR product of chicken genomic DNA (right panel) (C) RFLP analysis confirms the presence of the WHAMM mutation in genomic DNA The WHAM alteration destroyss a Hinfl site resulting in a 142 bp uncut fragment ratherr than the 106 bp and 36 bp fragments of normal chickens The chicken sex chromosomes of each bird testedd are indicated below the photo male chickens are ZZ female chickens are ZW Genbank Accession number AF3623777 (D) The glutamate residue at the position of thee non-conservative E89K substitution is conserved betweenn human (CAA10005) mouse (CAA53530) Takifuguu rubripes (fugu) and chicken The WHAM mutationn is thus predicted to have a deleterious effect onn activity of the ABCA1 protein The fugu ammo acid sequencee was predicted from nucleotide sequence of a cosmidd containing the fugu ABCA1 gene (data not published) )

194 4

AA Naturally Occurring Mutation in ABCA1 in the WHAM Chicken

Diseasee and the syntenic localization of the WHAM mutation and the human ABCA1 gene we

hypothesizedd that the chicken ABCA1 gene may be responsible for the WHAM phenotype To

investigatee this hypothesis we sequenced the coding region of ABCA1 from both WHAM and

normall chicken [he humai j n J dm_kui AECA1 itqutnees die 76 identical at the nucleotide

levell and 85 identical and show 92 homology) at the amino acid level The chicken gene is

lesss similar to the human gene than is the mouse gene which has 88 nucleotide identity and

95 ammo acid identity (97 homology) to the human gene (Genbank Submission AF362377)

Thee sequences of the normal and mutant chickens were identical with the exception of a G to A

transitionn in WHAM DNA at nucleotide 265 corresponding to a glutamic acid to lysine substitution

att amino acid 89 (E89K Fig 3B) The G265A mutation eliminates a Hinft restriction site present

inn the normal chicken sequence and facilitated development of a PCR-based Hinfi RFLP assay to

confirmm the mutation in chicken genomic DNA (Fig 3C) This alteration is a non-conservative

aminoo acid substitution at a residue that is conserved in the ABCA1 gene between human

mouse chicken and Takifugu rubripes (fugu) (Fig 3D) The mutation segregates with the

phenotypee of HDL deficiency in the WHAM chickens and is not seen in wild type White Leghorn

chickenss or in another strain of chicken that was investigated New Hampshire (not shown)

Functiona ll analysi s of th e E89K mutatio n in th e ABCA 1 gen e

Inn order to establish the impact of the WHAM mutation on the function of the ABCA1 transporter

wee engineered a construct harbouring the E89K mutation on a murine ABCA1EGFP chimeric

backbone The effects of this mutation on the intracellular trafficking and function of the

transporterr were then analysed in transiently transfected HeLa cells Morphological analysis

highlightedd a dramatic retention of the protein in the endoplasmic reticulum at 48h and 60h

afterr transfection (Fig 4A and B) At these time points the wild type product is predominantly

locatedd at the plasma membrane (fig 4A) This mistargeting was further supported by the

virtuall absence of transporter accessible to cell surface biotinylation (Fig 4C) A minor amount

off WHAM ABCA1 however does reach the plasma membrane but does not exceed 10-20

off the wild type ABCA1 detected in similar conditions

Althoughh the inability to reach the membrane provides in itself an explanation for the lack of

ABCA11 associated functions we tested whether the WHAM ABCA1 transporter when present at

thee plasma membrane was able to specifically bind to ApoA-l or to annexin V These assays address

twoo functions associated with the expression of the ABCA1 transporter namely the exposure of a

specificc binding site for apolipoproteins on the cell surface and the lipid transport activity

Inn both assays flow cytometric evaluation of the GFP expressing transfected cell failed to

detectt any significant binding (fig 4D) (values expressed as percent of the binding elicited by

wildd type ABCA1 EGFP are 138 n=6 for annexin V and 20 1 1 for ApoA-l n= 4) The

WHAMM mutant therefore acts as an essentially complete-loss-of-function mutation

195 5

Chapterr 9

Figur ee 4 The loss of ABCA1 function in WHAM mutations originates from a defect in intracellular trafficking (A)) Confocal microscopic analysis of wild-type ABCA1GFP chimera transfected HeLa cells shows that ABCA1 in its naturall state accumulates mainly at the plasma membrane in discrete vesicles in the cytoplasm (B) Confocal microscopicc analysis of HeLa cells transfected with the WHAMEGFP chimera show massive retention in the endoplasmicc reticulum The mistargeting of the mutated transporter is confirmed by the virtual absence of protein accessiblee to surface biotinylation (C) The migration of the 250kD protein corresponding to the ABCA1EGFP chimericc product (WT) is indicated The expression of WHAMEGFP in transfected cells fails to reconstitute the ABCA1-- elicited ( WT) surface binding of annexin-V ( Ann V Cy1) and ApoA-l ( ApoA-l Cy ) (D) A representative FACS profilee is shown RFI relative flourescence intensity Thick and thin lines correspond to cells gated positive or negativee for GFP fluorescence Values of WHAM elicited binding (expressed as percent of wild type ABCA1 EGFP) aree 138 ( n=6) for annexin V and 20 1 for ApoA-l (n= 4)

Discussion n Inn this study we present the first animal model with a naturally-occurring mutation in the

ABCA11 gene Our prior studies of the metabolic abnormalities in the WHAM chicken indicated

thatt there is a normal rate of apoA1 secretion yet there is hypercatabolism of apoA1 We

proposedd that the defect is in the availability of phospholipid for HDL production in the bloodstream

(23) The similarity of the metabolic phenotypes between Tangier patients and WHAM chickens

togetherr with the synteny between the Z-linked region where the WHAM mutation maps and

thatt of ABCA1 suggested that the WHAM mutation resides in the ABCA1 gene

Comparativee gene sequencing is an effective tool for the study of the functional importance of

specificc amino acid residues The functional conservation of glutamic acid-89 over 400 million

yearss in the ABCA1 gene of the fugu chicken mouse and human genomes provides evidence

forr this glutamic acid to lysine change having significant effects on ABCA1 function in the

chicken The dramatically reduced HDL levels in the WHAM chicken provides further compelling

evidencee for the rate-limiting role of ABCA1 gene in HDL synthesis and conclusively demonstrates

thatt ABCA1 is absolutely required for maintenance of HDL levels in different species

Thee non-conservative E89K mutation described here makes a strong case that this is indeed the

WHAMM mutation The mutation is in an N-terminal segment of ABCA1 whose topology has

beenn controversial The original descriptions of ABCA1 proposed that the first 640 amino acids

aree cytoplasmic and precede the first transmembrane domain However recent studies of

Fitzgeraldd et al (26) have shown that several of the N-gycosylation sites within this segment

aree in fact glycosylated indicating that this segment had to be translocated across the ER and

196 6

AA Naturally Occurring Mutation in ABCA1 in the WHAM Chicken

mustt therefore have an exofacial orientation Thus it is proposed that the first transmembrane

domainn is in a type 2 orientation followed by ammo acids 44-640 The WHAM mutation

wouldd therefore be exposed to the ER lumen and be in a position to disrupt the folding of the

piutc-mm It is alsu iinpuitdiit tu nute that this segment also includes a bU-amino acid N-terminal

regionn that was initially excluded from the presumed open reading frame of ABCA1 and was

subsequentlyy shown to be essential to its function (26)

Thee strict conservation of this glutamate (E89) residue (from fugu to chicken) suggests a

functionall importance which we have confirmed by the in vitro analysis of the WHAM transporter

inn transfected cells The presence of the WHAM mutation impairs physiological intracellular

traffickingg since most of the transporter appears to be retained in the endoplasmic reticulum

Naturallyy occurring mutations in the ABC transporters also have been shown to affect intracellular

trafficking Indeed the most frequent mutation causa for cystic fibrosis (the DF508 mutation)

leadss to a temperature sensitive defect in protein folding and impaired trafficking along the

secretoryy pathway (27)

Ass a result of the WHAM mutation only limited amounts of ABCA1 reach the plasma membrane

andd fail to elicit the functional effects associated with the expression of wild type ABCA1 In

particular the complete absence of ApoAl binding upon expression of WHAM transporter is

sufficientt to impair cellular release of PL to lipid poor HDL particles

Thee serum from WHAM chickens is colorless a consequence of greatly reduced levels of

carotenoids Tangier serum has the same carotenoid content as normal human serum In the

WHAMM chicken carotenoids are absorbed normally (unpublished observations) and are cleared

fromm the circulation Unlike the human patients the WHAM chicken is deficient in virtually all

lipoproteins thus the reduced carrying capacity for carotenoids is the likely explanation for the

colorlesss serum

Thee phenotype of Tangier Disease and of WHAM chickens establishes a critical role for ABCA1

inn the supply of lipids to the lipid-poor HDL particle A large body of literature proposes a role

forr HDL in transport of cholesterol from extrahepatic tissues to the liver a process termed

reversee cholesterol transport Implicit in this model is that the bulk of the lipids that end up

inn HDL particles originate in extraheptic tissues The drastic effect that the ABCA1 mutation has

onn HDL levels in Tangier Disease and in the WHAM chickens supports a major role for ABCA1

inn the supply of lipids for HDL The fact that ABCA1 functions to export lipids from cells is

consistentt with HDL assembly as an extracellular event in which the first step is the binding of

apoA11 to phospholipids Indeed apo-Al spontaneously forms HDL precursor particles when

exposedd to phospholipids (28)

Thee WHAM chicken supplied the first genetic evidence that vertebrates like invertebrates

havee an extracellular lipoprotein assembly pathway The key observation was that despite

normall apo-A1 synthesis and secretion the chickens are unable to produce stable HDL particles

197 7

Chapterr 9

Thee mutant chickens have a deficiency in plasma phospholipid which suggested that the

dearthh of phospholipid in the bloodstream was likely the primary defect responsible for the

HDLL deficiency syndrome (3) Subsequent studies in Tangier fibroblasts established that a lipid

transportt defect underlies this dtsease (7-9) It remains to be established which tissue makes

thee largest contribution to HDL lipids in an ABCA1-dependent fashion Recent studies by

Haghpassandd et al (29) show that macrophages despite being highly enriched in ABCA1 do

nott make a significant contribution to HDL lipids In the WHAM chicken there is substantial

cholesteroll ester accumulation in the liver and intestine (unpublished observations) suggesting

thatt ABCA1 is most active in lipid transport out of these tissues If this is the case then it will be

importantt to make a distinction between the role of ABCA1 in the contribution of lipids to HDL

andd the role of ABCA1 in macrophages relative to atherosclerosis susceptibility If these are

indeedd two separate roles then the traditional view of reverse cholesterol transport would still be

validd vis-a-vis atherosclerosis but not necessarily be relevant to the bulk of HDL lipid transport

Acknowledgement s s Wee thank Susan Pope and Widya Paramita for their excellent assistance in the maintenance of

thee chickens Albert Lee and Agripma Saurez have provided superb technical support This

workk was funded by Xenon Genetics Inc of Vancouver BC Canada and by grants from the

Heartt amp Stroke Foundation of Canada (MRH) the Canadian Network of Centers of Excellence

(NCEE Genetics MRH) Canadian Institute for Health Research (MRH)

Reference s s 1 McGibbon WH 1981 White skin a Z-linked recessive mutation in the fowl J Heredity 72139-140

2 Poernama F Schreyer SA Bitgood JJ Cook ME and Attie AD 1990 Spontaneous high density lipoproteinn deficiency syndrome associated with aZ-lmked mutation in chickens J Lipid Res 31955-963

3 Schreyer SA Hart L K and Attie AD 1994 Hypercatabolismof lipoprotein-freeapolipoprotein A-1 in HDL-defioentt mutant chickens Artenosd SThromb 14 2053 2059

44 Lusis AJ Taylor BA Wangenstein RWand LeBoeuf RL 1983 Genetic control of lipid transportin mice II Genes controlling structure of high density lipoproteins J Biol Chem 2585071-5078

5 Sparkes RS Winokur S Lusis AJ and Klisak I 1987 Regional Assignment of the Apolipoprotein-A-I Gene byy In situ Hybridization to Human-Chromosome 11q23-Qter Cytogenet Cell Genet 46697-697

6 Schaefer EJ Blum CB Levy RI Jenkins LL Alaupovic P Foster DM and Brewer HB 1978 Metabolismm of high-density lipoprotein apolipoproteins in Tangier Disease N Engl J Med 299905-910

77 Francis G A Knopp RH and Oram JF 1995 Defective removal of cellular cholesterol and phospholipids byy apolipoprotem A-l in Tangier disease J Clin Invest 9678-87

198 8

AA Naturally Occurring Mutat ion in ABCA1 in the W H A M Chicken

8 Rogier G Trumbach B Klima B Lackner K ) and Schmitz G 1995 HDL-Mediated Efflux of Intracellular

Cholesteroll Is Impaired in Fibroblasts from Tangier Disease Patients Arteriosder Thromb Vase Biol 15683-690

9 von Eckardstem A Cbirazi A Schuler-Luttmann S Walter Mr Kastelein JJP Geisel J Real JT Miccoli

RR Noseda G Hobbel G et a 1998 Plasma and fibroblasts of Tanqier disease patient- arp distirhpd in

transferringg phospholipids onto apolipoprotein A- IJ Lipid Res 39987-998

11 0 Assmann G von Eckardstein A and Brewer HB 1995 Familial high density liporpteom deficiency Tangier Disease In The Metabolic and Molecular Basis of Inherited Disease CR Scirever AL Beaudet WS Sly and D Valle editors New York McGraw-Hill 2053-2072

11 Ferrans VJ and Fredrickson D S 1975 The pathology of Tangier Disease A light and electron microscopic

study Am J Pathol 78101-1 58

12 Bodzioch M Orso E Klucken J Langmann T Bottcher A Diedench W Drobnik W Barlage S

Buchler C Porsch-Ozcurumez M et al 1999 The gene encoding ATP-binding cassette transporter 1 is

mutatedd in Tangier disease Nat Genet22336-345

11 3 Brooks-Wilson A Marcil M Clee SM Zhang LH Roomp K van Dam M Yu L Brewer C Collins J A Molhuizen HO et al 1999 Mutations in ABC1 in Tangier disease and familial high-density lipoprotein deficiencyy [seecomments] Nature Genet 22336-345

14 Lawn RM Wade DP Garvin MR Wang XB Schwartz K Porter JG Seilhamer JJ Vaughan AM

andd Oram JF 1999 The Tangier disease gene product ABC1 controls the cellular apolipoprotein-mediated

lipidd removal pathway Clin Invest 104R25-R31

11 5 Rust S Rosier M Funke H Real J Amoura Z Piette JC Deleuze JF Brewer HB Duverger N

Denefle P et al 1999 Tangier disease is caused by mutations in the gene encoding ATP-binding cassette

transporterr 1 Nature Genet 22352-355

16 Francis GA Knopp RH and Oram JF 1995 Defective Removal of Cellular Cholesterol and Phospholipids byy Apolipoprotein-a-l in Tangier Disease Clin Invest 9678-87

11 7 Bligh EG and Dyer WJ 1959 A rapid method of total lipid extraction and purification Can J Biochem

PhysiolPhysiol 37911-917

18 Luciani MF Denizot F Savary S Mattel MGandChimini G 1994 Cloning of two novel ABC transporters mappingg on human chromosome 9 Genomics 211 50-1 54

19 Harmon Y Broccardo C Chambenoit 0 Luciani MF Toti F Chaslm S Freyssinet JM Devaux PF

McNeish J Marguet D et al 2000 ABC1 promotes engulfment of apoptotic cells and transbilayer

redistributionn of phosphatidylserine Nat Cell Biol Biol 2 399-406

20 Charnbenoit O Harnon Y Maiyuei D Riyneauit H Rosseneu ivi and Chimin G 2UumlU l Specific clocking off apolipoprotein A l at the cell surface requires a functional ABCA1 transporter J Biol Chem 2769955-9960

21 Bitgood JJ 1985 Additional linkage relationships within the Z chromosome of the chicken Poultry Sci 642234-2238

22 Bitgood JJ 1988 Linear relationship of the loci for barring dermal melanin inhibitor and recessive white skin onn the chicken Z chromosome Poultry 5c 67530-533

199 9

Chapterr 9

233 Fridolfsson AK Cheng H Copeland NGJenkins NA Liu HC RaudseppT Woodage T Chowdhary

B Halverson J and Ellegren H 1998 Evolution of the avian sex chromosomes from an ancestral pair of

autosomes Proc Natl Acad So USA 958147-81 52

24 Nanda I Shan Z Schart M Burt DW Koehler M Nothwang H Grutzner F Paton LR Windsor D

Dunn I eta l 1999 300 million years of conserved synteny between chicken Zand human chromosome 9

NatNat Genet 21258-259

25 Burt DW Bruley C Dunn ICJones CT Ramage A Law AS Morrice DR Paton IR Smith J

Windsor D et al 1999 The dynamics of chromosome evolution in birds and mammals Nature 402411413

26 Fitzgerald M l Mendez AJ Moore KJ Andersson LP Panjeton H A and Freeman MW 2001 ATP-

bindingg cassette transporter A1 contains an NH2-termmal signal anchor sequence that translocates the

proteinss first hydrophilic domain to the exoplasmic space J BiolChem 2761 5137-1 5145

27 French PJ Doorninck JH Peters RH Verbeek E Ameen N A Marino C R Jonge HR Bijman J and

Scholte BJ 1996 A delta F508 mutation in mouse cystic fibrosis transmembrane conductance regulator

resultss in a temperature-sensitive processing defect in vivo J Clin Invest 981304-1312

28 Jonas A 1986 Reconst i tute of high-density lipoproteins Methods Enzymol 128553-582

29 Haghpassand M Bourassa PA Francone OL and Aiello RJ 2001 Monocytemacrophage expression of

ABCA11 has minimal contribution to plasma HDL levels J Clin Invest 1081315-1320

30 Pullinger CR Hakamata H Duchateau PN Eng C Aouizerat BE Cho MH Fielding CJ and Kane JP

2000 Analysis of hABG gene 5 end additional peptide sequence promoter region and four polymorphisms

BiochemBiochem Biophys Res Commun 271451455

200 0

AA Naturally Occurring Mutation in ABCA1 in the WHAM Chicken

Diseasee and the syntenic localization of the WHAM mutation and the human ABCA1 gene we

hypothesizedd that the chicken ABCA1 gene may be responsible for the WHAM phenotype To

investigatee this hypothesis we sequenced the coding region of ABCA1 from both WHAM and

normall chicken [he humai j n J dm_kui AECA1 itqutnees die 76 identical at the nucleotide

levell and 85 identical and show 92 homology) at the amino acid level The chicken gene is

lesss similar to the human gene than is the mouse gene which has 88 nucleotide identity and

95 ammo acid identity (97 homology) to the human gene (Genbank Submission AF362377)

Thee sequences of the normal and mutant chickens were identical with the exception of a G to A

transitionn in WHAM DNA at nucleotide 265 corresponding to a glutamic acid to lysine substitution

att amino acid 89 (E89K Fig 3B) The G265A mutation eliminates a Hinft restriction site present

inn the normal chicken sequence and facilitated development of a PCR-based Hinfi RFLP assay to

confirmm the mutation in chicken genomic DNA (Fig 3C) This alteration is a non-conservative

aminoo acid substitution at a residue that is conserved in the ABCA1 gene between human

mouse chicken and Takifugu rubripes (fugu) (Fig 3D) The mutation segregates with the

phenotypee of HDL deficiency in the WHAM chickens and is not seen in wild type White Leghorn

chickenss or in another strain of chicken that was investigated New Hampshire (not shown)

Functiona ll analysi s of th e E89K mutatio n in th e ABCA 1 gen e

Inn order to establish the impact of the WHAM mutation on the function of the ABCA1 transporter

wee engineered a construct harbouring the E89K mutation on a murine ABCA1EGFP chimeric

backbone The effects of this mutation on the intracellular trafficking and function of the

transporterr were then analysed in transiently transfected HeLa cells Morphological analysis

highlightedd a dramatic retention of the protein in the endoplasmic reticulum at 48h and 60h

afterr transfection (Fig 4A and B) At these time points the wild type product is predominantly

locatedd at the plasma membrane (fig 4A) This mistargeting was further supported by the

virtuall absence of transporter accessible to cell surface biotinylation (Fig 4C) A minor amount

off WHAM ABCA1 however does reach the plasma membrane but does not exceed 10-20

off the wild type ABCA1 detected in similar conditions

Althoughh the inability to reach the membrane provides in itself an explanation for the lack of

ABCA11 associated functions we tested whether the WHAM ABCA1 transporter when present at

thee plasma membrane was able to specifically bind to ApoA-l or to annexin V These assays address

twoo functions associated with the expression of the ABCA1 transporter namely the exposure of a

specificc binding site for apolipoproteins on the cell surface and the lipid transport activity

Inn both assays flow cytometric evaluation of the GFP expressing transfected cell failed to

detectt any significant binding (fig 4D) (values expressed as percent of the binding elicited by

wildd type ABCA1 EGFP are 138 n=6 for annexin V and 20 1 1 for ApoA-l n= 4) The

WHAMM mutant therefore acts as an essentially complete-loss-of-function mutation

195 5

Chapterr 9

Figur ee 4 The loss of ABCA1 function in WHAM mutations originates from a defect in intracellular trafficking (A)) Confocal microscopic analysis of wild-type ABCA1GFP chimera transfected HeLa cells shows that ABCA1 in its naturall state accumulates mainly at the plasma membrane in discrete vesicles in the cytoplasm (B) Confocal microscopicc analysis of HeLa cells transfected with the WHAMEGFP chimera show massive retention in the endoplasmicc reticulum The mistargeting of the mutated transporter is confirmed by the virtual absence of protein accessiblee to surface biotinylation (C) The migration of the 250kD protein corresponding to the ABCA1EGFP chimericc product (WT) is indicated The expression of WHAMEGFP in transfected cells fails to reconstitute the ABCA1-- elicited ( WT) surface binding of annexin-V ( Ann V Cy1) and ApoA-l ( ApoA-l Cy ) (D) A representative FACS profilee is shown RFI relative flourescence intensity Thick and thin lines correspond to cells gated positive or negativee for GFP fluorescence Values of WHAM elicited binding (expressed as percent of wild type ABCA1 EGFP) aree 138 ( n=6) for annexin V and 20 1 for ApoA-l (n= 4)

Discussion n Inn this study we present the first animal model with a naturally-occurring mutation in the

ABCA11 gene Our prior studies of the metabolic abnormalities in the WHAM chicken indicated

thatt there is a normal rate of apoA1 secretion yet there is hypercatabolism of apoA1 We

proposedd that the defect is in the availability of phospholipid for HDL production in the bloodstream

(23) The similarity of the metabolic phenotypes between Tangier patients and WHAM chickens

togetherr with the synteny between the Z-linked region where the WHAM mutation maps and

thatt of ABCA1 suggested that the WHAM mutation resides in the ABCA1 gene

Comparativee gene sequencing is an effective tool for the study of the functional importance of

specificc amino acid residues The functional conservation of glutamic acid-89 over 400 million

yearss in the ABCA1 gene of the fugu chicken mouse and human genomes provides evidence

forr this glutamic acid to lysine change having significant effects on ABCA1 function in the

chicken The dramatically reduced HDL levels in the WHAM chicken provides further compelling

evidencee for the rate-limiting role of ABCA1 gene in HDL synthesis and conclusively demonstrates

thatt ABCA1 is absolutely required for maintenance of HDL levels in different species

Thee non-conservative E89K mutation described here makes a strong case that this is indeed the

WHAMM mutation The mutation is in an N-terminal segment of ABCA1 whose topology has

beenn controversial The original descriptions of ABCA1 proposed that the first 640 amino acids

aree cytoplasmic and precede the first transmembrane domain However recent studies of

Fitzgeraldd et al (26) have shown that several of the N-gycosylation sites within this segment

aree in fact glycosylated indicating that this segment had to be translocated across the ER and

196 6

AA Naturally Occurring Mutation in ABCA1 in the WHAM Chicken

mustt therefore have an exofacial orientation Thus it is proposed that the first transmembrane

domainn is in a type 2 orientation followed by ammo acids 44-640 The WHAM mutation

wouldd therefore be exposed to the ER lumen and be in a position to disrupt the folding of the

piutc-mm It is alsu iinpuitdiit tu nute that this segment also includes a bU-amino acid N-terminal

regionn that was initially excluded from the presumed open reading frame of ABCA1 and was

subsequentlyy shown to be essential to its function (26)

Thee strict conservation of this glutamate (E89) residue (from fugu to chicken) suggests a

functionall importance which we have confirmed by the in vitro analysis of the WHAM transporter

inn transfected cells The presence of the WHAM mutation impairs physiological intracellular

traffickingg since most of the transporter appears to be retained in the endoplasmic reticulum

Naturallyy occurring mutations in the ABC transporters also have been shown to affect intracellular

trafficking Indeed the most frequent mutation causa for cystic fibrosis (the DF508 mutation)

leadss to a temperature sensitive defect in protein folding and impaired trafficking along the

secretoryy pathway (27)

Ass a result of the WHAM mutation only limited amounts of ABCA1 reach the plasma membrane

andd fail to elicit the functional effects associated with the expression of wild type ABCA1 In

particular the complete absence of ApoAl binding upon expression of WHAM transporter is

sufficientt to impair cellular release of PL to lipid poor HDL particles

Thee serum from WHAM chickens is colorless a consequence of greatly reduced levels of

carotenoids Tangier serum has the same carotenoid content as normal human serum In the

WHAMM chicken carotenoids are absorbed normally (unpublished observations) and are cleared

fromm the circulation Unlike the human patients the WHAM chicken is deficient in virtually all

lipoproteins thus the reduced carrying capacity for carotenoids is the likely explanation for the

colorlesss serum

Thee phenotype of Tangier Disease and of WHAM chickens establishes a critical role for ABCA1

inn the supply of lipids to the lipid-poor HDL particle A large body of literature proposes a role

forr HDL in transport of cholesterol from extrahepatic tissues to the liver a process termed

reversee cholesterol transport Implicit in this model is that the bulk of the lipids that end up

inn HDL particles originate in extraheptic tissues The drastic effect that the ABCA1 mutation has

onn HDL levels in Tangier Disease and in the WHAM chickens supports a major role for ABCA1

inn the supply of lipids for HDL The fact that ABCA1 functions to export lipids from cells is

consistentt with HDL assembly as an extracellular event in which the first step is the binding of

apoA11 to phospholipids Indeed apo-Al spontaneously forms HDL precursor particles when

exposedd to phospholipids (28)

Thee WHAM chicken supplied the first genetic evidence that vertebrates like invertebrates

havee an extracellular lipoprotein assembly pathway The key observation was that despite

normall apo-A1 synthesis and secretion the chickens are unable to produce stable HDL particles

197 7

Chapterr 9

Thee mutant chickens have a deficiency in plasma phospholipid which suggested that the

dearthh of phospholipid in the bloodstream was likely the primary defect responsible for the

HDLL deficiency syndrome (3) Subsequent studies in Tangier fibroblasts established that a lipid

transportt defect underlies this dtsease (7-9) It remains to be established which tissue makes

thee largest contribution to HDL lipids in an ABCA1-dependent fashion Recent studies by

Haghpassandd et al (29) show that macrophages despite being highly enriched in ABCA1 do

nott make a significant contribution to HDL lipids In the WHAM chicken there is substantial

cholesteroll ester accumulation in the liver and intestine (unpublished observations) suggesting

thatt ABCA1 is most active in lipid transport out of these tissues If this is the case then it will be

importantt to make a distinction between the role of ABCA1 in the contribution of lipids to HDL

andd the role of ABCA1 in macrophages relative to atherosclerosis susceptibility If these are

indeedd two separate roles then the traditional view of reverse cholesterol transport would still be

validd vis-a-vis atherosclerosis but not necessarily be relevant to the bulk of HDL lipid transport

Acknowledgement s s Wee thank Susan Pope and Widya Paramita for their excellent assistance in the maintenance of

thee chickens Albert Lee and Agripma Saurez have provided superb technical support This

workk was funded by Xenon Genetics Inc of Vancouver BC Canada and by grants from the

Heartt amp Stroke Foundation of Canada (MRH) the Canadian Network of Centers of Excellence

(NCEE Genetics MRH) Canadian Institute for Health Research (MRH)

Reference s s 1 McGibbon WH 1981 White skin a Z-linked recessive mutation in the fowl J Heredity 72139-140

2 Poernama F Schreyer SA Bitgood JJ Cook ME and Attie AD 1990 Spontaneous high density lipoproteinn deficiency syndrome associated with aZ-lmked mutation in chickens J Lipid Res 31955-963

3 Schreyer SA Hart L K and Attie AD 1994 Hypercatabolismof lipoprotein-freeapolipoprotein A-1 in HDL-defioentt mutant chickens Artenosd SThromb 14 2053 2059

44 Lusis AJ Taylor BA Wangenstein RWand LeBoeuf RL 1983 Genetic control of lipid transportin mice II Genes controlling structure of high density lipoproteins J Biol Chem 2585071-5078

5 Sparkes RS Winokur S Lusis AJ and Klisak I 1987 Regional Assignment of the Apolipoprotein-A-I Gene byy In situ Hybridization to Human-Chromosome 11q23-Qter Cytogenet Cell Genet 46697-697

6 Schaefer EJ Blum CB Levy RI Jenkins LL Alaupovic P Foster DM and Brewer HB 1978 Metabolismm of high-density lipoprotein apolipoproteins in Tangier Disease N Engl J Med 299905-910

77 Francis G A Knopp RH and Oram JF 1995 Defective removal of cellular cholesterol and phospholipids byy apolipoprotem A-l in Tangier disease J Clin Invest 9678-87

198 8

AA Naturally Occurring Mutat ion in ABCA1 in the W H A M Chicken

8 Rogier G Trumbach B Klima B Lackner K ) and Schmitz G 1995 HDL-Mediated Efflux of Intracellular

Cholesteroll Is Impaired in Fibroblasts from Tangier Disease Patients Arteriosder Thromb Vase Biol 15683-690

9 von Eckardstem A Cbirazi A Schuler-Luttmann S Walter Mr Kastelein JJP Geisel J Real JT Miccoli

RR Noseda G Hobbel G et a 1998 Plasma and fibroblasts of Tanqier disease patient- arp distirhpd in

transferringg phospholipids onto apolipoprotein A- IJ Lipid Res 39987-998

11 0 Assmann G von Eckardstein A and Brewer HB 1995 Familial high density liporpteom deficiency Tangier Disease In The Metabolic and Molecular Basis of Inherited Disease CR Scirever AL Beaudet WS Sly and D Valle editors New York McGraw-Hill 2053-2072

11 Ferrans VJ and Fredrickson D S 1975 The pathology of Tangier Disease A light and electron microscopic

study Am J Pathol 78101-1 58

12 Bodzioch M Orso E Klucken J Langmann T Bottcher A Diedench W Drobnik W Barlage S

Buchler C Porsch-Ozcurumez M et al 1999 The gene encoding ATP-binding cassette transporter 1 is

mutatedd in Tangier disease Nat Genet22336-345

11 3 Brooks-Wilson A Marcil M Clee SM Zhang LH Roomp K van Dam M Yu L Brewer C Collins J A Molhuizen HO et al 1999 Mutations in ABC1 in Tangier disease and familial high-density lipoprotein deficiencyy [seecomments] Nature Genet 22336-345

14 Lawn RM Wade DP Garvin MR Wang XB Schwartz K Porter JG Seilhamer JJ Vaughan AM

andd Oram JF 1999 The Tangier disease gene product ABC1 controls the cellular apolipoprotein-mediated

lipidd removal pathway Clin Invest 104R25-R31

11 5 Rust S Rosier M Funke H Real J Amoura Z Piette JC Deleuze JF Brewer HB Duverger N

Denefle P et al 1999 Tangier disease is caused by mutations in the gene encoding ATP-binding cassette

transporterr 1 Nature Genet 22352-355

16 Francis GA Knopp RH and Oram JF 1995 Defective Removal of Cellular Cholesterol and Phospholipids byy Apolipoprotein-a-l in Tangier Disease Clin Invest 9678-87

11 7 Bligh EG and Dyer WJ 1959 A rapid method of total lipid extraction and purification Can J Biochem

PhysiolPhysiol 37911-917

18 Luciani MF Denizot F Savary S Mattel MGandChimini G 1994 Cloning of two novel ABC transporters mappingg on human chromosome 9 Genomics 211 50-1 54

19 Harmon Y Broccardo C Chambenoit 0 Luciani MF Toti F Chaslm S Freyssinet JM Devaux PF

McNeish J Marguet D et al 2000 ABC1 promotes engulfment of apoptotic cells and transbilayer

redistributionn of phosphatidylserine Nat Cell Biol Biol 2 399-406

20 Charnbenoit O Harnon Y Maiyuei D Riyneauit H Rosseneu ivi and Chimin G 2UumlU l Specific clocking off apolipoprotein A l at the cell surface requires a functional ABCA1 transporter J Biol Chem 2769955-9960

21 Bitgood JJ 1985 Additional linkage relationships within the Z chromosome of the chicken Poultry Sci 642234-2238

22 Bitgood JJ 1988 Linear relationship of the loci for barring dermal melanin inhibitor and recessive white skin onn the chicken Z chromosome Poultry 5c 67530-533

199 9

Chapterr 9

233 Fridolfsson AK Cheng H Copeland NGJenkins NA Liu HC RaudseppT Woodage T Chowdhary

B Halverson J and Ellegren H 1998 Evolution of the avian sex chromosomes from an ancestral pair of

autosomes Proc Natl Acad So USA 958147-81 52

24 Nanda I Shan Z Schart M Burt DW Koehler M Nothwang H Grutzner F Paton LR Windsor D

Dunn I eta l 1999 300 million years of conserved synteny between chicken Zand human chromosome 9

NatNat Genet 21258-259

25 Burt DW Bruley C Dunn ICJones CT Ramage A Law AS Morrice DR Paton IR Smith J

Windsor D et al 1999 The dynamics of chromosome evolution in birds and mammals Nature 402411413

26 Fitzgerald M l Mendez AJ Moore KJ Andersson LP Panjeton H A and Freeman MW 2001 ATP-

bindingg cassette transporter A1 contains an NH2-termmal signal anchor sequence that translocates the

proteinss first hydrophilic domain to the exoplasmic space J BiolChem 2761 5137-1 5145

27 French PJ Doorninck JH Peters RH Verbeek E Ameen N A Marino C R Jonge HR Bijman J and

Scholte BJ 1996 A delta F508 mutation in mouse cystic fibrosis transmembrane conductance regulator

resultss in a temperature-sensitive processing defect in vivo J Clin Invest 981304-1312

28 Jonas A 1986 Reconst i tute of high-density lipoproteins Methods Enzymol 128553-582

29 Haghpassand M Bourassa PA Francone OL and Aiello RJ 2001 Monocytemacrophage expression of

ABCA11 has minimal contribution to plasma HDL levels J Clin Invest 1081315-1320

30 Pullinger CR Hakamata H Duchateau PN Eng C Aouizerat BE Cho MH Fielding CJ and Kane JP

2000 Analysis of hABG gene 5 end additional peptide sequence promoter region and four polymorphisms

BiochemBiochem Biophys Res Commun 271451455

200 0

Chapterr 9

Figur ee 4 The loss of ABCA1 function in WHAM mutations originates from a defect in intracellular trafficking (A)) Confocal microscopic analysis of wild-type ABCA1GFP chimera transfected HeLa cells shows that ABCA1 in its naturall state accumulates mainly at the plasma membrane in discrete vesicles in the cytoplasm (B) Confocal microscopicc analysis of HeLa cells transfected with the WHAMEGFP chimera show massive retention in the endoplasmicc reticulum The mistargeting of the mutated transporter is confirmed by the virtual absence of protein accessiblee to surface biotinylation (C) The migration of the 250kD protein corresponding to the ABCA1EGFP chimericc product (WT) is indicated The expression of WHAMEGFP in transfected cells fails to reconstitute the ABCA1-- elicited ( WT) surface binding of annexin-V ( Ann V Cy1) and ApoA-l ( ApoA-l Cy ) (D) A representative FACS profilee is shown RFI relative flourescence intensity Thick and thin lines correspond to cells gated positive or negativee for GFP fluorescence Values of WHAM elicited binding (expressed as percent of wild type ABCA1 EGFP) aree 138 ( n=6) for annexin V and 20 1 for ApoA-l (n= 4)

Discussion n Inn this study we present the first animal model with a naturally-occurring mutation in the

ABCA11 gene Our prior studies of the metabolic abnormalities in the WHAM chicken indicated

thatt there is a normal rate of apoA1 secretion yet there is hypercatabolism of apoA1 We

proposedd that the defect is in the availability of phospholipid for HDL production in the bloodstream

(23) The similarity of the metabolic phenotypes between Tangier patients and WHAM chickens

togetherr with the synteny between the Z-linked region where the WHAM mutation maps and

thatt of ABCA1 suggested that the WHAM mutation resides in the ABCA1 gene

Comparativee gene sequencing is an effective tool for the study of the functional importance of

specificc amino acid residues The functional conservation of glutamic acid-89 over 400 million

yearss in the ABCA1 gene of the fugu chicken mouse and human genomes provides evidence

forr this glutamic acid to lysine change having significant effects on ABCA1 function in the

chicken The dramatically reduced HDL levels in the WHAM chicken provides further compelling

evidencee for the rate-limiting role of ABCA1 gene in HDL synthesis and conclusively demonstrates

thatt ABCA1 is absolutely required for maintenance of HDL levels in different species

Thee non-conservative E89K mutation described here makes a strong case that this is indeed the

WHAMM mutation The mutation is in an N-terminal segment of ABCA1 whose topology has

beenn controversial The original descriptions of ABCA1 proposed that the first 640 amino acids

aree cytoplasmic and precede the first transmembrane domain However recent studies of

Fitzgeraldd et al (26) have shown that several of the N-gycosylation sites within this segment

aree in fact glycosylated indicating that this segment had to be translocated across the ER and

196 6

AA Naturally Occurring Mutation in ABCA1 in the WHAM Chicken

mustt therefore have an exofacial orientation Thus it is proposed that the first transmembrane

domainn is in a type 2 orientation followed by ammo acids 44-640 The WHAM mutation

wouldd therefore be exposed to the ER lumen and be in a position to disrupt the folding of the

piutc-mm It is alsu iinpuitdiit tu nute that this segment also includes a bU-amino acid N-terminal

regionn that was initially excluded from the presumed open reading frame of ABCA1 and was

subsequentlyy shown to be essential to its function (26)

Thee strict conservation of this glutamate (E89) residue (from fugu to chicken) suggests a

functionall importance which we have confirmed by the in vitro analysis of the WHAM transporter

inn transfected cells The presence of the WHAM mutation impairs physiological intracellular

traffickingg since most of the transporter appears to be retained in the endoplasmic reticulum

Naturallyy occurring mutations in the ABC transporters also have been shown to affect intracellular

trafficking Indeed the most frequent mutation causa for cystic fibrosis (the DF508 mutation)

leadss to a temperature sensitive defect in protein folding and impaired trafficking along the

secretoryy pathway (27)

Ass a result of the WHAM mutation only limited amounts of ABCA1 reach the plasma membrane

andd fail to elicit the functional effects associated with the expression of wild type ABCA1 In

particular the complete absence of ApoAl binding upon expression of WHAM transporter is

sufficientt to impair cellular release of PL to lipid poor HDL particles

Thee serum from WHAM chickens is colorless a consequence of greatly reduced levels of

carotenoids Tangier serum has the same carotenoid content as normal human serum In the

WHAMM chicken carotenoids are absorbed normally (unpublished observations) and are cleared

fromm the circulation Unlike the human patients the WHAM chicken is deficient in virtually all

lipoproteins thus the reduced carrying capacity for carotenoids is the likely explanation for the

colorlesss serum

Thee phenotype of Tangier Disease and of WHAM chickens establishes a critical role for ABCA1

inn the supply of lipids to the lipid-poor HDL particle A large body of literature proposes a role

forr HDL in transport of cholesterol from extrahepatic tissues to the liver a process termed

reversee cholesterol transport Implicit in this model is that the bulk of the lipids that end up

inn HDL particles originate in extraheptic tissues The drastic effect that the ABCA1 mutation has

onn HDL levels in Tangier Disease and in the WHAM chickens supports a major role for ABCA1

inn the supply of lipids for HDL The fact that ABCA1 functions to export lipids from cells is

consistentt with HDL assembly as an extracellular event in which the first step is the binding of

apoA11 to phospholipids Indeed apo-Al spontaneously forms HDL precursor particles when

exposedd to phospholipids (28)

Thee WHAM chicken supplied the first genetic evidence that vertebrates like invertebrates

havee an extracellular lipoprotein assembly pathway The key observation was that despite

normall apo-A1 synthesis and secretion the chickens are unable to produce stable HDL particles

197 7

Chapterr 9

Thee mutant chickens have a deficiency in plasma phospholipid which suggested that the

dearthh of phospholipid in the bloodstream was likely the primary defect responsible for the

HDLL deficiency syndrome (3) Subsequent studies in Tangier fibroblasts established that a lipid

transportt defect underlies this dtsease (7-9) It remains to be established which tissue makes

thee largest contribution to HDL lipids in an ABCA1-dependent fashion Recent studies by

Haghpassandd et al (29) show that macrophages despite being highly enriched in ABCA1 do

nott make a significant contribution to HDL lipids In the WHAM chicken there is substantial

cholesteroll ester accumulation in the liver and intestine (unpublished observations) suggesting

thatt ABCA1 is most active in lipid transport out of these tissues If this is the case then it will be

importantt to make a distinction between the role of ABCA1 in the contribution of lipids to HDL

andd the role of ABCA1 in macrophages relative to atherosclerosis susceptibility If these are

indeedd two separate roles then the traditional view of reverse cholesterol transport would still be

validd vis-a-vis atherosclerosis but not necessarily be relevant to the bulk of HDL lipid transport

Acknowledgement s s Wee thank Susan Pope and Widya Paramita for their excellent assistance in the maintenance of

thee chickens Albert Lee and Agripma Saurez have provided superb technical support This

workk was funded by Xenon Genetics Inc of Vancouver BC Canada and by grants from the

Heartt amp Stroke Foundation of Canada (MRH) the Canadian Network of Centers of Excellence

(NCEE Genetics MRH) Canadian Institute for Health Research (MRH)

Reference s s 1 McGibbon WH 1981 White skin a Z-linked recessive mutation in the fowl J Heredity 72139-140

2 Poernama F Schreyer SA Bitgood JJ Cook ME and Attie AD 1990 Spontaneous high density lipoproteinn deficiency syndrome associated with aZ-lmked mutation in chickens J Lipid Res 31955-963

3 Schreyer SA Hart L K and Attie AD 1994 Hypercatabolismof lipoprotein-freeapolipoprotein A-1 in HDL-defioentt mutant chickens Artenosd SThromb 14 2053 2059

44 Lusis AJ Taylor BA Wangenstein RWand LeBoeuf RL 1983 Genetic control of lipid transportin mice II Genes controlling structure of high density lipoproteins J Biol Chem 2585071-5078

5 Sparkes RS Winokur S Lusis AJ and Klisak I 1987 Regional Assignment of the Apolipoprotein-A-I Gene byy In situ Hybridization to Human-Chromosome 11q23-Qter Cytogenet Cell Genet 46697-697

6 Schaefer EJ Blum CB Levy RI Jenkins LL Alaupovic P Foster DM and Brewer HB 1978 Metabolismm of high-density lipoprotein apolipoproteins in Tangier Disease N Engl J Med 299905-910

77 Francis G A Knopp RH and Oram JF 1995 Defective removal of cellular cholesterol and phospholipids byy apolipoprotem A-l in Tangier disease J Clin Invest 9678-87

198 8

AA Naturally Occurring Mutat ion in ABCA1 in the W H A M Chicken

8 Rogier G Trumbach B Klima B Lackner K ) and Schmitz G 1995 HDL-Mediated Efflux of Intracellular

Cholesteroll Is Impaired in Fibroblasts from Tangier Disease Patients Arteriosder Thromb Vase Biol 15683-690

9 von Eckardstem A Cbirazi A Schuler-Luttmann S Walter Mr Kastelein JJP Geisel J Real JT Miccoli

RR Noseda G Hobbel G et a 1998 Plasma and fibroblasts of Tanqier disease patient- arp distirhpd in

transferringg phospholipids onto apolipoprotein A- IJ Lipid Res 39987-998

11 0 Assmann G von Eckardstein A and Brewer HB 1995 Familial high density liporpteom deficiency Tangier Disease In The Metabolic and Molecular Basis of Inherited Disease CR Scirever AL Beaudet WS Sly and D Valle editors New York McGraw-Hill 2053-2072

11 Ferrans VJ and Fredrickson D S 1975 The pathology of Tangier Disease A light and electron microscopic

study Am J Pathol 78101-1 58

12 Bodzioch M Orso E Klucken J Langmann T Bottcher A Diedench W Drobnik W Barlage S

Buchler C Porsch-Ozcurumez M et al 1999 The gene encoding ATP-binding cassette transporter 1 is

mutatedd in Tangier disease Nat Genet22336-345

11 3 Brooks-Wilson A Marcil M Clee SM Zhang LH Roomp K van Dam M Yu L Brewer C Collins J A Molhuizen HO et al 1999 Mutations in ABC1 in Tangier disease and familial high-density lipoprotein deficiencyy [seecomments] Nature Genet 22336-345

14 Lawn RM Wade DP Garvin MR Wang XB Schwartz K Porter JG Seilhamer JJ Vaughan AM

andd Oram JF 1999 The Tangier disease gene product ABC1 controls the cellular apolipoprotein-mediated

lipidd removal pathway Clin Invest 104R25-R31

11 5 Rust S Rosier M Funke H Real J Amoura Z Piette JC Deleuze JF Brewer HB Duverger N

Denefle P et al 1999 Tangier disease is caused by mutations in the gene encoding ATP-binding cassette

transporterr 1 Nature Genet 22352-355

16 Francis GA Knopp RH and Oram JF 1995 Defective Removal of Cellular Cholesterol and Phospholipids byy Apolipoprotein-a-l in Tangier Disease Clin Invest 9678-87

11 7 Bligh EG and Dyer WJ 1959 A rapid method of total lipid extraction and purification Can J Biochem

PhysiolPhysiol 37911-917

18 Luciani MF Denizot F Savary S Mattel MGandChimini G 1994 Cloning of two novel ABC transporters mappingg on human chromosome 9 Genomics 211 50-1 54

19 Harmon Y Broccardo C Chambenoit 0 Luciani MF Toti F Chaslm S Freyssinet JM Devaux PF

McNeish J Marguet D et al 2000 ABC1 promotes engulfment of apoptotic cells and transbilayer

redistributionn of phosphatidylserine Nat Cell Biol Biol 2 399-406

20 Charnbenoit O Harnon Y Maiyuei D Riyneauit H Rosseneu ivi and Chimin G 2UumlU l Specific clocking off apolipoprotein A l at the cell surface requires a functional ABCA1 transporter J Biol Chem 2769955-9960

21 Bitgood JJ 1985 Additional linkage relationships within the Z chromosome of the chicken Poultry Sci 642234-2238

22 Bitgood JJ 1988 Linear relationship of the loci for barring dermal melanin inhibitor and recessive white skin onn the chicken Z chromosome Poultry 5c 67530-533

199 9

Chapterr 9

233 Fridolfsson AK Cheng H Copeland NGJenkins NA Liu HC RaudseppT Woodage T Chowdhary

B Halverson J and Ellegren H 1998 Evolution of the avian sex chromosomes from an ancestral pair of

autosomes Proc Natl Acad So USA 958147-81 52

24 Nanda I Shan Z Schart M Burt DW Koehler M Nothwang H Grutzner F Paton LR Windsor D

Dunn I eta l 1999 300 million years of conserved synteny between chicken Zand human chromosome 9

NatNat Genet 21258-259

25 Burt DW Bruley C Dunn ICJones CT Ramage A Law AS Morrice DR Paton IR Smith J

Windsor D et al 1999 The dynamics of chromosome evolution in birds and mammals Nature 402411413

26 Fitzgerald M l Mendez AJ Moore KJ Andersson LP Panjeton H A and Freeman MW 2001 ATP-

bindingg cassette transporter A1 contains an NH2-termmal signal anchor sequence that translocates the

proteinss first hydrophilic domain to the exoplasmic space J BiolChem 2761 5137-1 5145

27 French PJ Doorninck JH Peters RH Verbeek E Ameen N A Marino C R Jonge HR Bijman J and

Scholte BJ 1996 A delta F508 mutation in mouse cystic fibrosis transmembrane conductance regulator

resultss in a temperature-sensitive processing defect in vivo J Clin Invest 981304-1312

28 Jonas A 1986 Reconst i tute of high-density lipoproteins Methods Enzymol 128553-582

29 Haghpassand M Bourassa PA Francone OL and Aiello RJ 2001 Monocytemacrophage expression of

ABCA11 has minimal contribution to plasma HDL levels J Clin Invest 1081315-1320

30 Pullinger CR Hakamata H Duchateau PN Eng C Aouizerat BE Cho MH Fielding CJ and Kane JP

2000 Analysis of hABG gene 5 end additional peptide sequence promoter region and four polymorphisms

BiochemBiochem Biophys Res Commun 271451455

200 0

AA Naturally Occurring Mutation in ABCA1 in the WHAM Chicken

mustt therefore have an exofacial orientation Thus it is proposed that the first transmembrane

domainn is in a type 2 orientation followed by ammo acids 44-640 The WHAM mutation

wouldd therefore be exposed to the ER lumen and be in a position to disrupt the folding of the

piutc-mm It is alsu iinpuitdiit tu nute that this segment also includes a bU-amino acid N-terminal

regionn that was initially excluded from the presumed open reading frame of ABCA1 and was

subsequentlyy shown to be essential to its function (26)

Thee strict conservation of this glutamate (E89) residue (from fugu to chicken) suggests a

functionall importance which we have confirmed by the in vitro analysis of the WHAM transporter

inn transfected cells The presence of the WHAM mutation impairs physiological intracellular

traffickingg since most of the transporter appears to be retained in the endoplasmic reticulum

Naturallyy occurring mutations in the ABC transporters also have been shown to affect intracellular

trafficking Indeed the most frequent mutation causa for cystic fibrosis (the DF508 mutation)

leadss to a temperature sensitive defect in protein folding and impaired trafficking along the

secretoryy pathway (27)

Ass a result of the WHAM mutation only limited amounts of ABCA1 reach the plasma membrane

andd fail to elicit the functional effects associated with the expression of wild type ABCA1 In

particular the complete absence of ApoAl binding upon expression of WHAM transporter is

sufficientt to impair cellular release of PL to lipid poor HDL particles

Thee serum from WHAM chickens is colorless a consequence of greatly reduced levels of

carotenoids Tangier serum has the same carotenoid content as normal human serum In the

WHAMM chicken carotenoids are absorbed normally (unpublished observations) and are cleared

fromm the circulation Unlike the human patients the WHAM chicken is deficient in virtually all

lipoproteins thus the reduced carrying capacity for carotenoids is the likely explanation for the

colorlesss serum

Thee phenotype of Tangier Disease and of WHAM chickens establishes a critical role for ABCA1

inn the supply of lipids to the lipid-poor HDL particle A large body of literature proposes a role

forr HDL in transport of cholesterol from extrahepatic tissues to the liver a process termed

reversee cholesterol transport Implicit in this model is that the bulk of the lipids that end up

inn HDL particles originate in extraheptic tissues The drastic effect that the ABCA1 mutation has

onn HDL levels in Tangier Disease and in the WHAM chickens supports a major role for ABCA1

inn the supply of lipids for HDL The fact that ABCA1 functions to export lipids from cells is

consistentt with HDL assembly as an extracellular event in which the first step is the binding of

apoA11 to phospholipids Indeed apo-Al spontaneously forms HDL precursor particles when

exposedd to phospholipids (28)

Thee WHAM chicken supplied the first genetic evidence that vertebrates like invertebrates

havee an extracellular lipoprotein assembly pathway The key observation was that despite

normall apo-A1 synthesis and secretion the chickens are unable to produce stable HDL particles

197 7

Chapterr 9

Thee mutant chickens have a deficiency in plasma phospholipid which suggested that the

dearthh of phospholipid in the bloodstream was likely the primary defect responsible for the

HDLL deficiency syndrome (3) Subsequent studies in Tangier fibroblasts established that a lipid

transportt defect underlies this dtsease (7-9) It remains to be established which tissue makes

thee largest contribution to HDL lipids in an ABCA1-dependent fashion Recent studies by

Haghpassandd et al (29) show that macrophages despite being highly enriched in ABCA1 do

nott make a significant contribution to HDL lipids In the WHAM chicken there is substantial

cholesteroll ester accumulation in the liver and intestine (unpublished observations) suggesting

thatt ABCA1 is most active in lipid transport out of these tissues If this is the case then it will be

importantt to make a distinction between the role of ABCA1 in the contribution of lipids to HDL

andd the role of ABCA1 in macrophages relative to atherosclerosis susceptibility If these are

indeedd two separate roles then the traditional view of reverse cholesterol transport would still be

validd vis-a-vis atherosclerosis but not necessarily be relevant to the bulk of HDL lipid transport

Acknowledgement s s Wee thank Susan Pope and Widya Paramita for their excellent assistance in the maintenance of

thee chickens Albert Lee and Agripma Saurez have provided superb technical support This

workk was funded by Xenon Genetics Inc of Vancouver BC Canada and by grants from the

Heartt amp Stroke Foundation of Canada (MRH) the Canadian Network of Centers of Excellence

(NCEE Genetics MRH) Canadian Institute for Health Research (MRH)

Reference s s 1 McGibbon WH 1981 White skin a Z-linked recessive mutation in the fowl J Heredity 72139-140

2 Poernama F Schreyer SA Bitgood JJ Cook ME and Attie AD 1990 Spontaneous high density lipoproteinn deficiency syndrome associated with aZ-lmked mutation in chickens J Lipid Res 31955-963

3 Schreyer SA Hart L K and Attie AD 1994 Hypercatabolismof lipoprotein-freeapolipoprotein A-1 in HDL-defioentt mutant chickens Artenosd SThromb 14 2053 2059

44 Lusis AJ Taylor BA Wangenstein RWand LeBoeuf RL 1983 Genetic control of lipid transportin mice II Genes controlling structure of high density lipoproteins J Biol Chem 2585071-5078

5 Sparkes RS Winokur S Lusis AJ and Klisak I 1987 Regional Assignment of the Apolipoprotein-A-I Gene byy In situ Hybridization to Human-Chromosome 11q23-Qter Cytogenet Cell Genet 46697-697

6 Schaefer EJ Blum CB Levy RI Jenkins LL Alaupovic P Foster DM and Brewer HB 1978 Metabolismm of high-density lipoprotein apolipoproteins in Tangier Disease N Engl J Med 299905-910

77 Francis G A Knopp RH and Oram JF 1995 Defective removal of cellular cholesterol and phospholipids byy apolipoprotem A-l in Tangier disease J Clin Invest 9678-87

198 8

AA Naturally Occurring Mutat ion in ABCA1 in the W H A M Chicken

8 Rogier G Trumbach B Klima B Lackner K ) and Schmitz G 1995 HDL-Mediated Efflux of Intracellular

Cholesteroll Is Impaired in Fibroblasts from Tangier Disease Patients Arteriosder Thromb Vase Biol 15683-690

9 von Eckardstem A Cbirazi A Schuler-Luttmann S Walter Mr Kastelein JJP Geisel J Real JT Miccoli

RR Noseda G Hobbel G et a 1998 Plasma and fibroblasts of Tanqier disease patient- arp distirhpd in

transferringg phospholipids onto apolipoprotein A- IJ Lipid Res 39987-998

11 0 Assmann G von Eckardstein A and Brewer HB 1995 Familial high density liporpteom deficiency Tangier Disease In The Metabolic and Molecular Basis of Inherited Disease CR Scirever AL Beaudet WS Sly and D Valle editors New York McGraw-Hill 2053-2072

11 Ferrans VJ and Fredrickson D S 1975 The pathology of Tangier Disease A light and electron microscopic

study Am J Pathol 78101-1 58

12 Bodzioch M Orso E Klucken J Langmann T Bottcher A Diedench W Drobnik W Barlage S

Buchler C Porsch-Ozcurumez M et al 1999 The gene encoding ATP-binding cassette transporter 1 is

mutatedd in Tangier disease Nat Genet22336-345

11 3 Brooks-Wilson A Marcil M Clee SM Zhang LH Roomp K van Dam M Yu L Brewer C Collins J A Molhuizen HO et al 1999 Mutations in ABC1 in Tangier disease and familial high-density lipoprotein deficiencyy [seecomments] Nature Genet 22336-345

14 Lawn RM Wade DP Garvin MR Wang XB Schwartz K Porter JG Seilhamer JJ Vaughan AM

andd Oram JF 1999 The Tangier disease gene product ABC1 controls the cellular apolipoprotein-mediated

lipidd removal pathway Clin Invest 104R25-R31

11 5 Rust S Rosier M Funke H Real J Amoura Z Piette JC Deleuze JF Brewer HB Duverger N

Denefle P et al 1999 Tangier disease is caused by mutations in the gene encoding ATP-binding cassette

transporterr 1 Nature Genet 22352-355

16 Francis GA Knopp RH and Oram JF 1995 Defective Removal of Cellular Cholesterol and Phospholipids byy Apolipoprotein-a-l in Tangier Disease Clin Invest 9678-87

11 7 Bligh EG and Dyer WJ 1959 A rapid method of total lipid extraction and purification Can J Biochem

PhysiolPhysiol 37911-917

18 Luciani MF Denizot F Savary S Mattel MGandChimini G 1994 Cloning of two novel ABC transporters mappingg on human chromosome 9 Genomics 211 50-1 54

19 Harmon Y Broccardo C Chambenoit 0 Luciani MF Toti F Chaslm S Freyssinet JM Devaux PF

McNeish J Marguet D et al 2000 ABC1 promotes engulfment of apoptotic cells and transbilayer

redistributionn of phosphatidylserine Nat Cell Biol Biol 2 399-406

20 Charnbenoit O Harnon Y Maiyuei D Riyneauit H Rosseneu ivi and Chimin G 2UumlU l Specific clocking off apolipoprotein A l at the cell surface requires a functional ABCA1 transporter J Biol Chem 2769955-9960

21 Bitgood JJ 1985 Additional linkage relationships within the Z chromosome of the chicken Poultry Sci 642234-2238

22 Bitgood JJ 1988 Linear relationship of the loci for barring dermal melanin inhibitor and recessive white skin onn the chicken Z chromosome Poultry 5c 67530-533

199 9

Chapterr 9

233 Fridolfsson AK Cheng H Copeland NGJenkins NA Liu HC RaudseppT Woodage T Chowdhary

B Halverson J and Ellegren H 1998 Evolution of the avian sex chromosomes from an ancestral pair of

autosomes Proc Natl Acad So USA 958147-81 52

24 Nanda I Shan Z Schart M Burt DW Koehler M Nothwang H Grutzner F Paton LR Windsor D

Dunn I eta l 1999 300 million years of conserved synteny between chicken Zand human chromosome 9

NatNat Genet 21258-259

25 Burt DW Bruley C Dunn ICJones CT Ramage A Law AS Morrice DR Paton IR Smith J

Windsor D et al 1999 The dynamics of chromosome evolution in birds and mammals Nature 402411413

26 Fitzgerald M l Mendez AJ Moore KJ Andersson LP Panjeton H A and Freeman MW 2001 ATP-

bindingg cassette transporter A1 contains an NH2-termmal signal anchor sequence that translocates the

proteinss first hydrophilic domain to the exoplasmic space J BiolChem 2761 5137-1 5145

27 French PJ Doorninck JH Peters RH Verbeek E Ameen N A Marino C R Jonge HR Bijman J and

Scholte BJ 1996 A delta F508 mutation in mouse cystic fibrosis transmembrane conductance regulator

resultss in a temperature-sensitive processing defect in vivo J Clin Invest 981304-1312

28 Jonas A 1986 Reconst i tute of high-density lipoproteins Methods Enzymol 128553-582

29 Haghpassand M Bourassa PA Francone OL and Aiello RJ 2001 Monocytemacrophage expression of

ABCA11 has minimal contribution to plasma HDL levels J Clin Invest 1081315-1320

30 Pullinger CR Hakamata H Duchateau PN Eng C Aouizerat BE Cho MH Fielding CJ and Kane JP

2000 Analysis of hABG gene 5 end additional peptide sequence promoter region and four polymorphisms

BiochemBiochem Biophys Res Commun 271451455

200 0

Chapterr 9

Thee mutant chickens have a deficiency in plasma phospholipid which suggested that the

dearthh of phospholipid in the bloodstream was likely the primary defect responsible for the

HDLL deficiency syndrome (3) Subsequent studies in Tangier fibroblasts established that a lipid

transportt defect underlies this dtsease (7-9) It remains to be established which tissue makes

thee largest contribution to HDL lipids in an ABCA1-dependent fashion Recent studies by

Haghpassandd et al (29) show that macrophages despite being highly enriched in ABCA1 do

nott make a significant contribution to HDL lipids In the WHAM chicken there is substantial

cholesteroll ester accumulation in the liver and intestine (unpublished observations) suggesting

thatt ABCA1 is most active in lipid transport out of these tissues If this is the case then it will be

importantt to make a distinction between the role of ABCA1 in the contribution of lipids to HDL

andd the role of ABCA1 in macrophages relative to atherosclerosis susceptibility If these are

indeedd two separate roles then the traditional view of reverse cholesterol transport would still be

validd vis-a-vis atherosclerosis but not necessarily be relevant to the bulk of HDL lipid transport

Acknowledgement s s Wee thank Susan Pope and Widya Paramita for their excellent assistance in the maintenance of

thee chickens Albert Lee and Agripma Saurez have provided superb technical support This

workk was funded by Xenon Genetics Inc of Vancouver BC Canada and by grants from the

Heartt amp Stroke Foundation of Canada (MRH) the Canadian Network of Centers of Excellence

(NCEE Genetics MRH) Canadian Institute for Health Research (MRH)

Reference s s 1 McGibbon WH 1981 White skin a Z-linked recessive mutation in the fowl J Heredity 72139-140

2 Poernama F Schreyer SA Bitgood JJ Cook ME and Attie AD 1990 Spontaneous high density lipoproteinn deficiency syndrome associated with aZ-lmked mutation in chickens J Lipid Res 31955-963

3 Schreyer SA Hart L K and Attie AD 1994 Hypercatabolismof lipoprotein-freeapolipoprotein A-1 in HDL-defioentt mutant chickens Artenosd SThromb 14 2053 2059

44 Lusis AJ Taylor BA Wangenstein RWand LeBoeuf RL 1983 Genetic control of lipid transportin mice II Genes controlling structure of high density lipoproteins J Biol Chem 2585071-5078

5 Sparkes RS Winokur S Lusis AJ and Klisak I 1987 Regional Assignment of the Apolipoprotein-A-I Gene byy In situ Hybridization to Human-Chromosome 11q23-Qter Cytogenet Cell Genet 46697-697

6 Schaefer EJ Blum CB Levy RI Jenkins LL Alaupovic P Foster DM and Brewer HB 1978 Metabolismm of high-density lipoprotein apolipoproteins in Tangier Disease N Engl J Med 299905-910

77 Francis G A Knopp RH and Oram JF 1995 Defective removal of cellular cholesterol and phospholipids byy apolipoprotem A-l in Tangier disease J Clin Invest 9678-87

198 8

AA Naturally Occurring Mutat ion in ABCA1 in the W H A M Chicken

8 Rogier G Trumbach B Klima B Lackner K ) and Schmitz G 1995 HDL-Mediated Efflux of Intracellular

Cholesteroll Is Impaired in Fibroblasts from Tangier Disease Patients Arteriosder Thromb Vase Biol 15683-690

9 von Eckardstem A Cbirazi A Schuler-Luttmann S Walter Mr Kastelein JJP Geisel J Real JT Miccoli

RR Noseda G Hobbel G et a 1998 Plasma and fibroblasts of Tanqier disease patient- arp distirhpd in

transferringg phospholipids onto apolipoprotein A- IJ Lipid Res 39987-998

11 0 Assmann G von Eckardstein A and Brewer HB 1995 Familial high density liporpteom deficiency Tangier Disease In The Metabolic and Molecular Basis of Inherited Disease CR Scirever AL Beaudet WS Sly and D Valle editors New York McGraw-Hill 2053-2072

11 Ferrans VJ and Fredrickson D S 1975 The pathology of Tangier Disease A light and electron microscopic

study Am J Pathol 78101-1 58

12 Bodzioch M Orso E Klucken J Langmann T Bottcher A Diedench W Drobnik W Barlage S

Buchler C Porsch-Ozcurumez M et al 1999 The gene encoding ATP-binding cassette transporter 1 is

mutatedd in Tangier disease Nat Genet22336-345

11 3 Brooks-Wilson A Marcil M Clee SM Zhang LH Roomp K van Dam M Yu L Brewer C Collins J A Molhuizen HO et al 1999 Mutations in ABC1 in Tangier disease and familial high-density lipoprotein deficiencyy [seecomments] Nature Genet 22336-345

14 Lawn RM Wade DP Garvin MR Wang XB Schwartz K Porter JG Seilhamer JJ Vaughan AM

andd Oram JF 1999 The Tangier disease gene product ABC1 controls the cellular apolipoprotein-mediated

lipidd removal pathway Clin Invest 104R25-R31

11 5 Rust S Rosier M Funke H Real J Amoura Z Piette JC Deleuze JF Brewer HB Duverger N

Denefle P et al 1999 Tangier disease is caused by mutations in the gene encoding ATP-binding cassette

transporterr 1 Nature Genet 22352-355

16 Francis GA Knopp RH and Oram JF 1995 Defective Removal of Cellular Cholesterol and Phospholipids byy Apolipoprotein-a-l in Tangier Disease Clin Invest 9678-87

11 7 Bligh EG and Dyer WJ 1959 A rapid method of total lipid extraction and purification Can J Biochem

PhysiolPhysiol 37911-917

18 Luciani MF Denizot F Savary S Mattel MGandChimini G 1994 Cloning of two novel ABC transporters mappingg on human chromosome 9 Genomics 211 50-1 54

19 Harmon Y Broccardo C Chambenoit 0 Luciani MF Toti F Chaslm S Freyssinet JM Devaux PF

McNeish J Marguet D et al 2000 ABC1 promotes engulfment of apoptotic cells and transbilayer

redistributionn of phosphatidylserine Nat Cell Biol Biol 2 399-406

20 Charnbenoit O Harnon Y Maiyuei D Riyneauit H Rosseneu ivi and Chimin G 2UumlU l Specific clocking off apolipoprotein A l at the cell surface requires a functional ABCA1 transporter J Biol Chem 2769955-9960

21 Bitgood JJ 1985 Additional linkage relationships within the Z chromosome of the chicken Poultry Sci 642234-2238

22 Bitgood JJ 1988 Linear relationship of the loci for barring dermal melanin inhibitor and recessive white skin onn the chicken Z chromosome Poultry 5c 67530-533

199 9

Chapterr 9

233 Fridolfsson AK Cheng H Copeland NGJenkins NA Liu HC RaudseppT Woodage T Chowdhary

B Halverson J and Ellegren H 1998 Evolution of the avian sex chromosomes from an ancestral pair of

autosomes Proc Natl Acad So USA 958147-81 52

24 Nanda I Shan Z Schart M Burt DW Koehler M Nothwang H Grutzner F Paton LR Windsor D

Dunn I eta l 1999 300 million years of conserved synteny between chicken Zand human chromosome 9

NatNat Genet 21258-259

25 Burt DW Bruley C Dunn ICJones CT Ramage A Law AS Morrice DR Paton IR Smith J

Windsor D et al 1999 The dynamics of chromosome evolution in birds and mammals Nature 402411413

26 Fitzgerald M l Mendez AJ Moore KJ Andersson LP Panjeton H A and Freeman MW 2001 ATP-

bindingg cassette transporter A1 contains an NH2-termmal signal anchor sequence that translocates the

proteinss first hydrophilic domain to the exoplasmic space J BiolChem 2761 5137-1 5145

27 French PJ Doorninck JH Peters RH Verbeek E Ameen N A Marino C R Jonge HR Bijman J and

Scholte BJ 1996 A delta F508 mutation in mouse cystic fibrosis transmembrane conductance regulator

resultss in a temperature-sensitive processing defect in vivo J Clin Invest 981304-1312

28 Jonas A 1986 Reconst i tute of high-density lipoproteins Methods Enzymol 128553-582

29 Haghpassand M Bourassa PA Francone OL and Aiello RJ 2001 Monocytemacrophage expression of

ABCA11 has minimal contribution to plasma HDL levels J Clin Invest 1081315-1320

30 Pullinger CR Hakamata H Duchateau PN Eng C Aouizerat BE Cho MH Fielding CJ and Kane JP

2000 Analysis of hABG gene 5 end additional peptide sequence promoter region and four polymorphisms

BiochemBiochem Biophys Res Commun 271451455

200 0

AA Naturally Occurring Mutat ion in ABCA1 in the W H A M Chicken

8 Rogier G Trumbach B Klima B Lackner K ) and Schmitz G 1995 HDL-Mediated Efflux of Intracellular

Cholesteroll Is Impaired in Fibroblasts from Tangier Disease Patients Arteriosder Thromb Vase Biol 15683-690

9 von Eckardstem A Cbirazi A Schuler-Luttmann S Walter Mr Kastelein JJP Geisel J Real JT Miccoli

RR Noseda G Hobbel G et a 1998 Plasma and fibroblasts of Tanqier disease patient- arp distirhpd in

transferringg phospholipids onto apolipoprotein A- IJ Lipid Res 39987-998

11 0 Assmann G von Eckardstein A and Brewer HB 1995 Familial high density liporpteom deficiency Tangier Disease In The Metabolic and Molecular Basis of Inherited Disease CR Scirever AL Beaudet WS Sly and D Valle editors New York McGraw-Hill 2053-2072

11 Ferrans VJ and Fredrickson D S 1975 The pathology of Tangier Disease A light and electron microscopic

study Am J Pathol 78101-1 58

12 Bodzioch M Orso E Klucken J Langmann T Bottcher A Diedench W Drobnik W Barlage S

Buchler C Porsch-Ozcurumez M et al 1999 The gene encoding ATP-binding cassette transporter 1 is

mutatedd in Tangier disease Nat Genet22336-345

11 3 Brooks-Wilson A Marcil M Clee SM Zhang LH Roomp K van Dam M Yu L Brewer C Collins J A Molhuizen HO et al 1999 Mutations in ABC1 in Tangier disease and familial high-density lipoprotein deficiencyy [seecomments] Nature Genet 22336-345

14 Lawn RM Wade DP Garvin MR Wang XB Schwartz K Porter JG Seilhamer JJ Vaughan AM

andd Oram JF 1999 The Tangier disease gene product ABC1 controls the cellular apolipoprotein-mediated

lipidd removal pathway Clin Invest 104R25-R31

11 5 Rust S Rosier M Funke H Real J Amoura Z Piette JC Deleuze JF Brewer HB Duverger N

Denefle P et al 1999 Tangier disease is caused by mutations in the gene encoding ATP-binding cassette

transporterr 1 Nature Genet 22352-355

16 Francis GA Knopp RH and Oram JF 1995 Defective Removal of Cellular Cholesterol and Phospholipids byy Apolipoprotein-a-l in Tangier Disease Clin Invest 9678-87

11 7 Bligh EG and Dyer WJ 1959 A rapid method of total lipid extraction and purification Can J Biochem

PhysiolPhysiol 37911-917

18 Luciani MF Denizot F Savary S Mattel MGandChimini G 1994 Cloning of two novel ABC transporters mappingg on human chromosome 9 Genomics 211 50-1 54

19 Harmon Y Broccardo C Chambenoit 0 Luciani MF Toti F Chaslm S Freyssinet JM Devaux PF

McNeish J Marguet D et al 2000 ABC1 promotes engulfment of apoptotic cells and transbilayer

redistributionn of phosphatidylserine Nat Cell Biol Biol 2 399-406

20 Charnbenoit O Harnon Y Maiyuei D Riyneauit H Rosseneu ivi and Chimin G 2UumlU l Specific clocking off apolipoprotein A l at the cell surface requires a functional ABCA1 transporter J Biol Chem 2769955-9960

21 Bitgood JJ 1985 Additional linkage relationships within the Z chromosome of the chicken Poultry Sci 642234-2238

22 Bitgood JJ 1988 Linear relationship of the loci for barring dermal melanin inhibitor and recessive white skin onn the chicken Z chromosome Poultry 5c 67530-533

199 9

Chapterr 9

233 Fridolfsson AK Cheng H Copeland NGJenkins NA Liu HC RaudseppT Woodage T Chowdhary

B Halverson J and Ellegren H 1998 Evolution of the avian sex chromosomes from an ancestral pair of

autosomes Proc Natl Acad So USA 958147-81 52

24 Nanda I Shan Z Schart M Burt DW Koehler M Nothwang H Grutzner F Paton LR Windsor D

Dunn I eta l 1999 300 million years of conserved synteny between chicken Zand human chromosome 9

NatNat Genet 21258-259

25 Burt DW Bruley C Dunn ICJones CT Ramage A Law AS Morrice DR Paton IR Smith J

Windsor D et al 1999 The dynamics of chromosome evolution in birds and mammals Nature 402411413

26 Fitzgerald M l Mendez AJ Moore KJ Andersson LP Panjeton H A and Freeman MW 2001 ATP-

bindingg cassette transporter A1 contains an NH2-termmal signal anchor sequence that translocates the

proteinss first hydrophilic domain to the exoplasmic space J BiolChem 2761 5137-1 5145

27 French PJ Doorninck JH Peters RH Verbeek E Ameen N A Marino C R Jonge HR Bijman J and

Scholte BJ 1996 A delta F508 mutation in mouse cystic fibrosis transmembrane conductance regulator

resultss in a temperature-sensitive processing defect in vivo J Clin Invest 981304-1312

28 Jonas A 1986 Reconst i tute of high-density lipoproteins Methods Enzymol 128553-582

29 Haghpassand M Bourassa PA Francone OL and Aiello RJ 2001 Monocytemacrophage expression of

ABCA11 has minimal contribution to plasma HDL levels J Clin Invest 1081315-1320

30 Pullinger CR Hakamata H Duchateau PN Eng C Aouizerat BE Cho MH Fielding CJ and Kane JP

2000 Analysis of hABG gene 5 end additional peptide sequence promoter region and four polymorphisms

BiochemBiochem Biophys Res Commun 271451455

200 0

Chapterr 9

233 Fridolfsson AK Cheng H Copeland NGJenkins NA Liu HC RaudseppT Woodage T Chowdhary

B Halverson J and Ellegren H 1998 Evolution of the avian sex chromosomes from an ancestral pair of

autosomes Proc Natl Acad So USA 958147-81 52

24 Nanda I Shan Z Schart M Burt DW Koehler M Nothwang H Grutzner F Paton LR Windsor D

Dunn I eta l 1999 300 million years of conserved synteny between chicken Zand human chromosome 9

NatNat Genet 21258-259

25 Burt DW Bruley C Dunn ICJones CT Ramage A Law AS Morrice DR Paton IR Smith J

Windsor D et al 1999 The dynamics of chromosome evolution in birds and mammals Nature 402411413

26 Fitzgerald M l Mendez AJ Moore KJ Andersson LP Panjeton H A and Freeman MW 2001 ATP-

bindingg cassette transporter A1 contains an NH2-termmal signal anchor sequence that translocates the

proteinss first hydrophilic domain to the exoplasmic space J BiolChem 2761 5137-1 5145

27 French PJ Doorninck JH Peters RH Verbeek E Ameen N A Marino C R Jonge HR Bijman J and

Scholte BJ 1996 A delta F508 mutation in mouse cystic fibrosis transmembrane conductance regulator

resultss in a temperature-sensitive processing defect in vivo J Clin Invest 981304-1312

28 Jonas A 1986 Reconst i tute of high-density lipoproteins Methods Enzymol 128553-582

29 Haghpassand M Bourassa PA Francone OL and Aiello RJ 2001 Monocytemacrophage expression of

ABCA11 has minimal contribution to plasma HDL levels J Clin Invest 1081315-1320

30 Pullinger CR Hakamata H Duchateau PN Eng C Aouizerat BE Cho MH Fielding CJ and Kane JP

2000 Analysis of hABG gene 5 end additional peptide sequence promoter region and four polymorphisms

BiochemBiochem Biophys Res Commun 271451455

200 0