UvA-DARE is a service provided by the library of the University of Amsterdam (http://dare.uva.nl)

UvA-DARE (Digital Academic Repository)

Gene expression in chromosomal Ridge domains : influence on transcription, mRNA stability,codon usage, and evolution

Gierman, H.J.

Link to publication

Citation for published version (APA):Gierman, H. J. (2010). Gene expression in chromosomal Ridge domains : influence on transcription, mRNAstability, codon usage, and evolution.

General rightsIt is not permitted to download or to forward/distribute the text or part of it without the consent of the author(s) and/or copyright holder(s),other than for strictly personal, individual use, unless the work is under an open content license (like Creative Commons).

Disclaimer/Complaints regulationsIf you believe that digital publication of certain material infringes any of your rights or (privacy) interests, please let the Library know, statingyour reasons. In case of a legitimate complaint, the Library will make the material inaccessible and/or remove it from the website. Please Askthe Library: https://uba.uva.nl/en/contact, or a letter to: Library of the University of Amsterdam, Secretariat, Singel 425, 1012 WP Amsterdam,The Netherlands. You will be contacted as soon as possible.

Download date: 12 Jul 2020

5EZH2 Overexpression Associated With Gain of

Chromosome arm 7q is Essential for Neuroblastoma Cell Cycle Progression and a Marker of

Poor Prognosis

102

5

EZH2 Overexpression Associated With Gain of Chromosome arm 7q is Essential for Neuroblastoma Cell Cycle Progression and a Marker of Poor Prognosis

Hinco J. Gierman1, Mireille H.G. Indemans1, Jan Koster1, Jan J. Molenaar1, Chrisoula Efstathiadou1, Peter van Sluis1, Richard Volckmann1, Dirk Geerts1, Kathleen de Preter2, Ingrid Øra3, Frank Speleman2, and Rogier Versteeg1

1Department of Human Genetics, Academic Medical Center, University of Amsterdam, Amsterdam, the Netherlands, 2Center for Medical Genetics, Ghent University Hospital, Ghent, Belgium, 3Department of Pediatric Oncology and Hematology, Lund University Hospital, Lund, Sweden.

Submitted.

ABSTRACT

Neuroblastoma is an often aggressive childhood cancer. Few genetic aberrations at the gene level have been identified, but several large chromosomal regions show recurrent gains or losses (Maris 2007). Neuroblastomas frequently have gain of chromosome 7q, but candidate genes promoting neuroblastoma pathogenesis have been identified on 7q. The Polycomb group protein Enhancer of Zeste Homolog 2 (EZH2) is located at chromosome 7q36, and we identified a neuroblastoma with a small regional gain encompassing EZH2 and concomitant overexpresssion. Here we show with array-CGH that chromosome arm 7q is gained in 57% of neuroblastomas and EZH2 expression is increases in these cases. In a series of 88 neuroblastomas analyzed by mRNA profiling, high EZH2 expression significantly correlated with advanced tumor stages, undifferentiated histology and a poor overall and progression-free prognosis, independent of MYCN amplification. Also, EZH2 expression strongly correlated with high expression of cell cycle and DNA replication genes. To test for a functional role of EZH2 in neuroblastoma, we silenced EZH2 expression in several neuroblastoma cell lines. This resulted in growth retardation, G1 arrest and neurite outgrowth. Microarray profiling of a time-series after EZH2 silencing revealed down-regulation of cell cycle and DNA replication genes. Analysis of transcription factor binding sites of the down-regulated genes demonstrated a strong enrichment for E2F binding sites. Pharmacological inhibition of EZH2 in neuroblastoma cell lines with DZnep impaired proliferation and recapitulated the differentiated phenotype. These findings implicate high EZH2 expression in cell cycle progression of neuroblastoma, possibly by a pRb/E2F mediated pathway.

103

EZH2 regulates neuroblastoma cell cycle

5

INTRODUCTION

Neuroblastomas are pediatric tumors that originate from neural crest-derived progenitor cells. Current treatment options for neuroblastoma cure around 60% of patients (Spix 2006), which urges the search for targets for therapeutic intervention. Only few genes with genetic aberrations were thus far identified in neuroblastoma. The MYCN oncogene is amplified in 20% of neuroblastoma patients (Look 1991) and the ALK gene is mutated in about 7% of patients (Mossé 2008). Other oncogenes with genetic aberrations occur in only a few percent of neuroblastomas, such as PHOX2B (van Limpt 2004), CCND1 (Molenaar 2003; Michels 2007), and AURKA (Zhou 1998).

In contrast to the sporadic nature of amplifications and mutations, gains and loss of heterozygosity (LOH) of large chromosomal regions are frequently detected in neuroblastoma. Most frequently gained are chromosome 17q and 7q, which occurs in 70–90% and 40–60% of neuroblastomas, respectively (Lastowska 1997; Bown 1999; Vandesompele 2001; Stallings 2003). Gain of chromosome 17q is a risk factor for poor outcome (Lastowska 1997; Bown 1999). Several studies have identified candidate genes for an oncogenic role on 17q, such as NME1 and NME2 (Godfried 2002; Valentijn 2005), BIRC5 (Islam 2000), and PPM1D (Saito-Ohara 2003). However, to our knowledge no candidate oncogenes on chromosome 7 have been identified that may provide a rationale for the frequent gain of this chromosome in neuroblastoma (see also Stallings 2003).

EZH2 maps on chromosomal band 7q36. The EZH2 protein belongs to the Polycomb group of proteins and functions as a histone methyltransferase. Together with EED and SUZ12, it forms the Polycomb repressive complex-2 (PRC2) which silences genes by trimethylation of histone 3 on lysine 27 (H3K27me3) (Cao 2002). EZH2 was recently found to be mutated in 20% of diffuse large B-cell lymphomas (Morin 2010). The mutations centered on a single amino acid in the catalytic domain, indicating that they impair the methyltransferase function of the protein (Morin 2010).

Here we describe an investigation of the role of EZH2 in neuroblastoma. We detected a neuroblastoma with gain of a small fragment of chromosome 7, encompassing the EZH2 locus. In a series of 88 neuroblastomas, high EZH2 expression correlated with poor outcome and advanced tumor stage. Silencing of EZH2 expression by shRNA or the drug DZnep impaired proliferation and induced a G1 arrest. Microarray analysis implicates cell cycle genes in the downstream pathway of EZH2. Our data suggest that EZH2 is a potential oncogene in neuroblastoma and is required for proliferation and cell cycle progression of neuroblastoma cells, possibly by a pRB/E2F mediated pathway.

104

5

RESULTS

Chromosome 7 Gains in Neuroblastomas Correlate With EZH2 Overexpresssion We performed a CGH array analysis of DNA from 87 neuroblastomas collected at the AMC. The patients and tumors had a distribution over age and stage representative for neuroblastoma and the tumors included 18 cases with MYCN amplification. Figure 1A shows a frequency distribution of all chromosomal gains and losses of the 87 samples. In agreement with published data, we found that chromosomes 17 and 7 are the most frequently gained chromosomes in neuroblastoma.

Detailed analysis of the CGH profiles identified one tumor without extra chromosome 7 copies, but with a gain of a 785 kb region harboring 10 genes on chromosome 7q36 (Figure 1B). One of these genes was EZH2. RNA isolated from the same tumor series was analyzed by mRNA microarray profiling. The expression data showed that the EZH2 mRNA levels of the tumor with the small 7q36 gain was the highest of all tumors in the dataset, suggesting that the gain resulted in overexpresssion of EZH2 (Figure 1C). EZH2 has been implicated in several tumor types (see Discussion), but a role for EZH2 in neuroblastoma has not been investigated. We therefore asked whether high expression of EZH2 contributes to neuroblastoma pathogenesis.

We analyzed how EZH2 levels in neuroblastoma compare to expression levels in other cancers and normal tissues. We retrieved publicly available expression data from the Gene Expression Omnibus database comprising 2,772 different tumor samples and 366 normal tissue samples, including adrenal gland. All samples were analyzed by the same platform also used by us (Affymetrix HG-U133 Plus 2.0) and were MAS5.0 normalized prior to analysis (see Methods). Figure 1D shows that EZH2 is overexpresssed in various cancer types (blue bars) compared to normal tissues (green bars). EZH2 expression is highest in the pediatric tumors medulloblastoma, neuroblastoma and acute lymphoblastic leukemia. The average level of EZH2 in neuroblastoma is 2-fold higher than in e.g. breast cancer, and 4-fold higher compared to prostate cancer, two tumor types in which EZH2 is implicated as oncogene (Kleer 2003; Pieterssen 2008; Varambally 2002).

We analyzed whether the high EZH2 expression in neuroblastoma relates to the frequent gains of chromosome 7 in this tumor. Chromosome 7 was found to be gained in 57% of all tumors in our series of 87 patients (Figure 1A, black arrow including the sample with the small 7q36 gain, see black arrow Figure 1A). Figure 1E shows that EZH2 expression levels are significantly higher in tumors with gain of chromosome 7 than in tumors without gain (P = 3.9*10-3). These analyses show that EZH2 is overexpresssed in neuroblastoma compared to other tumor types and normal tissue, and that the frequent gain of chromosome 7 contributes to overexpresssion.

EZH2 Expression Correlates With Tumor Stage and Survival, Independent of MYCN AmplificationTo establish a possible clinical relevance of EZH2 in neuroblastoma, we analyzed whether EZH2 expression relates to tumor stage, differentiation and prognosis

105

EZH2 regulates neuroblastoma cell cycle

5

in the series of 87 neuroblastomas. Figure 2A shows that EZH2 expression is significantly higher in stage 3 and 4 neuroblastoma compared to stage 1 or 2 tumors (P = 8.5*10-3). Kaplan-Meier analysis of overall survival showed that high EZH2 expression is associated with a poor prognosis (P = 4.2*10-4; Figure 2B). Amplification of MYCN is the strongest known clinically used prognostic factor in neuroblastoma (Brodeur 1984). However, high EZH2 expression is also associated with poor prognosis in neuroblastoma without MYCN amplification (P = 1.3*10-4; Figure 2C).

Figure 1. CGH and expression analysis on neuroblastoma tumors. (A) CGH overview of 87 neuroblastoma tumors (vertical) showing gain (red) and loss (green) per chromosome (horizontal). The y-axis shows the overall gain or loss per region. Black arrow indicates the chromosomal position of EZH2 on 7q36. (B) Blow-up of individual tumor with local gain of the EZH2 locus. Above; a cytogenetic map of chromosome 7 is shown with a blue box indication the shown region. CGH log-fold ratios are shown per probe (gray; no significant gain or loss; black significant gain or loss). The red line indicates the moving average over 5 probes. Below; chromosomal position in Mb and cytogenetic map. The blue circle indicates the gained region of 785 kb encompassing EZH2. (C) Overview of EZH2 mRNA levels in 88 neuroblastoma tumors, ranked by EZH2 expression (y-axis). The x-axis shows annotation of 17q gain, LOH1p, and MYCN amplification (red, yes; green, no; gray, not informative), and INSS stage (light green, 1; dark green, 2; orange, 3; red, 4; blue, 4s). (D) Average EZH2 expression levels in 14 tumor datasets (blue), 2 neuroblastoma datasets (red) and normal tissues (green) divided in adrenal gland, central nervous system (CNS) tissues and non-CNS tissues. (E) EZH2 expression levels in 87 neuroblastoma tumors (y-axis). Tumors were grouped according to CGH data for chromosome 7 as normal (no gain; green), 7q gain only (red), or gain of the entire chromosome 7 (yellow). Arrow indicates tumor with local 7q36 gain of EZH2 locus.

106

5

107

EZH2 regulates neuroblastoma cell cycle

5

EZH2 expression also significantly correlated with progression free survival for the entire set of patients, as well as for the subset without MYCN amplification (P < 10-3; Supplementary Figure S1). EZH2 expression was also significantly higher in undifferentiated tumors versus differentiated tumors, as classified by histopathological examination (Figure 2D, P = 2.0*10-5).

Silencing of CDK2, CDK4 or CCND1 in Neuroblastoma Cell Lines Inhibits E2F Activity and EZH2 ExpressionWhile EZH2 strongly correlates to gain of chromosome 7, also neuroblastomas without gain show a substantial expression level of EZH2. Gain of chromosome 7 therefore seems to multiply the expression levels established by transcription of the EZH2 locus. EZH2 transcription was previously reported to be induced by E2F1–3

Figure 2. EZH2 is associated with a poor prognosis in neuroblastoma. (A) Average EZH2 expression in 88 neuroblastoma tumors according their INSS stage. (B,C) Kaplan-Meier analysis for ovrall survival of neuroblastoma patients divided into high and low EZH2 expression groups for all neuroblastoma patients (B; N = 88) or all neuroblastoma patients without MYCN amplification (C, N = 72). (D) EZH2 expression levels in 88 neuroblastoma tumors according neuroblastic differentiation status. Tumors were scored as neuroblastoma differentiated (left), neuroblastoma poorly differentiated (center), or neuroblastoma undifferentiated (right).

108

5

in human fibroblasts (Bracken 2003). The E2F transcription factors play an essential role in the G1/S transition of the cell cycle and are activated after RB phosphorylation by cyclin-CDK complexes. We previously showed that CyclinD1 (CCND1) is highly overexpresssed and sometimes amplified in neuroblastoma (Molenaar 2003). siRNA mediated silencing of Cyclin D1 or CDK4 resulted in growth arrest and differentiation of neuroblastoma cell lines (Molenaar 2008), while silencing of CDK2 resulted in apoptosis of MYCN-amplified cell lines (Molenaar 2009). Silencing of Cyclin D1, CDK4 and CDK2 resulted in strongly decreased activity of an E2F reporter construct (Molenaar 2008). We therefore asked whether the G1/S cell cycle genes Cyclin D1, CDK4 and CDK2 also control EZH2 expression levels. When we analyzed the expression profiles of neuroblastoma cell lines after silencing of these genes, we observed that doxycycline-inducible shRNA mediated silencing of CDK2 in neuroblastoma cell line IMR32 resulted in down-regulation of EZH2 expression (P < 10-4; Figure 3A). This was also observed after silencing of CDK4 and Cyclin D1 in neuroblastoma cell line SKNBE (P < 10-4; Figure 3B). In addition, we observed strong correlations in the neuroblastoma tumor set between EZH2 expression and E2F1–3 expression levels (E2F1, R = 0.63; E2F2, R = 0.73; E2F3, R = 0.66, P < 10-

11; Figure 3C). These data suggest that EZH2 mRNA expression in neuroblastoma is closely linked to progression of the cell cycle by the Cyclin D1, CDK4 and CDK2 and the resulting activation of E2F.

EZH2 mRNA Levels in Neuroblastoma Correlate With Protein LevelsTo investigate the downstream effects of EZH2 overexpresssion in neuroblastoma, we first investigated whether the high EZH2 mRNA levels result in increased EZH2 protein levels. We therefore analyzed a series of neuroblastoma cell lines and tumors. Microarray expression profiling data that we generated for a series of 24 neuroblastoma cell lines were analyzed for EZH2 expression levels. The range of EZH2 expression levels in the cell lines was comparable to the range observed in the tumor series (Supplementary Figure S2A, see also Figure 1C). We selected neuroblastoma cell lines IMR32, SJNB8, SKNSH, SKNFI and SKNBE, which have moderate to high EZH2 expression, for Western blot analysis of EZH2 protein levels (see also Supplementary Table S1). Densitometric quantification of the EZH2 band, using beta-tubulin (TUBB) levels for normalization showed a clear correlation between mRNA and protein levels (R2 = 0.86, P = 2.1*10-2 ; Supplementary Figure S2B). High EZH2 mRNA levels as related to gain of chromosome 7, therefore result in high EZH2 protein levels, which may play a functional role in neuroblastoma.

EZH2 is Required for Cellular Proliferation and G1 to S-phase Transition in Neuroblastoma Cells To investigate the functional role of EZH2 in neuroblastoma, we silenced EZH2 expression in neuroblastoma cell lines SJNB8, IMR32 (both with MYCN amplification) and SKNSH (no MYCN amplification) by lentiviral mediated shRNA. As controls, we transduced the same cell lines with a non-targeting shRNA (see Methods). Western blot analysis of cell lysates prepared 0 and 72 hours after transduction show a strong decrease of EZH2 protein levels compared to controls (P < 4.2*10-2; Figure 3A). Silencing of EZH2 strongly inhibited the proliferation of all three cell lines, as evident

109

EZH2 regulates neuroblastoma cell cycle

5

from diminished cell counts at 72 hours after EZH2 silencing (Figure 3B). In addition, the cells obtained a differentiated morphology with neurite outgrowth (Figure 3C).

Lentiviral transduction of shRNA can trigger off-target effects which may be specific for the actual shRNA sequence. We therefore validated the rapid decline of proliferation after shEZH2 treatment with a second shRNA for EZH2 and another vector system. An shRNA for EZH2 (Varambally 2002) was cloned in a doxycycline-inducible shRNA vector and stably transfected into IMR32 and SJNB8. For both cell lines we isolated clones with doxycycline-inducible EZH2 down-regulation (see Methods). Lysates of a time series after induction were analyzed by Western blot. EZH2 expression was strongly down-regulated in clones of both cell lines (Figure 4D,E). Compared

Figure 3. Regulation and expression of EZH2 in relation to cell cycle genes. (A) Time course of down-regulation of EZH2 expression after knockdown of CDK2 in neuroblastoma IMR32 cells (0 to 72 hours). Experiment was performed in triplicate in cells. (B) Down-regulation of EZH2 expression 48 hours after knockdown of CCND1 (left) or CDK4 (center) in neuroblastoma IMR32 cells. As a control cells treated with GFP siRNA are shown (right). For details, see Molenaar et al. (Molenaar 2008; Molenaar 2009). (C) Expression of EZH2 (y-axis, left) and E2F1–3 transcription factors in 88 neuroblastoma tumors. In each panel, tumors are ranked according the expression of the E2F gene: From left to right E2F1, E2F2, and E2F3. The x-axis shows annotation of 17q gain, LOH1p, and MYCN amplification (red, yes; green, no; gray, not informative), and INSS stage (light green 1, dark green 2, orange 3, red 4, blue 4s).

110

5

to the same non-doxycycline induced clones, silencing of EZH2 for 6 and 8 days strongly reduced cell numbers of IMR32 and SJNB8 as measured in a modified 3T3 assay (P < 7.2*10-3 ; Figure 4F,G). Also in these cells, silencing of EZH2 resulted in differentiation and strong neurite extensions, which became especially pronounced 4 to 6 days after knockdown (data not shown).

To investigate the mechanism of shEZH2-induced retardation of proliferation, we performed a FACS analysis of the cell cycle distribution of both cell lines after lentiviral induced EZH2 silencing. Compared to IMR32 cells treated with control virus (Figure 5A), lentiviral knockdown of EZH2 caused a G1-arrest (Figure 5B). At 72 hours after transduction, G1 fractions were significantly increased with a concomitant decrease of the S- and G2/M-phase (P < 5.8*10-3; Figure 5C). EZH2 knockdown also produced a G1-arrest in SJNB8 cells (P = 1.1*10-3; data not shown). Expression of EZH2 is therefore essential for cell cycle progression of neuroblastoma cells and silencing causes a rapid decline in the proliferation rate.

111

EZH2 regulates neuroblastoma cell cycle

5

EZH2 is Required for Expression of Genes that Control DNA Replication and Cell CycleTo investigate how EZH2 affects proliferation and G1 progression, we performed microarray analysis of time series of neuroblastoma cells after shRNA mediated silencing of EZH2. We used the same experimental design for the microarray analyses as with the proliferation assays. IMR32 and SJNB8 cells with doxycycline-induced

Figure 4. EZH2 knockdown by lentiviral shRNA induces impairment of cellular proliferation a differentiated phenotype. (A) Western blot analysis showing knockdown of EZH2 in neuroblastoma cell lines IMR32, SJNB8 and SKNSH 72 hours after transduction with a lentivirus containing a EZH2 or control siRNA. TUBB as a loading control. (B) Proliferation assay cells transduced with control siRNA (black) or EZH2 siRNA (gray). The y-axis shows cell count per ml. (C) Photographs of neuroblastoma cells 72 hours after transduction with EZH2 siRNA (upper panels) or control siRNA (lower panels). (D,E) Western blot analysis of a time series (0 to 6 days) showing EZH2 knockdown after addition of doxycycline in IMR32 (D) and SJNB8 (E) cells containing a doxycycline-inducible construct with a EZH2 siRNA. Ponceau-S staining was used as loading control (not shown). (F,G) Proliferation assay of IMR32 (F) and SJNB8 (G) cells containing a doxycycline-inducible construct with an EZH2 siRNA. Cells were either incubated with doxycycline (gray) or nor (black; control). The y-axis shows cell count per ml.

112

5

shEZH2 expression as well as IMR32 cells transduced with the lentiviral transduced shEZH2 (2x) or control shRNA were analyzed. The obtained expression profiles of the lentiviral-mediated and the doxycycline-induced EZH2 silencing experiments were analyzed for significant changes in gene expression at 72 hours after silencing (P < 0.0025, see Methods).

The list of regulated genes was first globally analyzed for enrichment of 11 major gene Gene Ontology (GO) categories (apoptosis, cell cycle, development, differentiation, DNA repair, membrane associated, signal transduction, transcription factors, transcription regulator activity, transcriptional repressor activity; see Methods). In each of the EZH2 silencing experiments, the category ‘cell cycle‘ showed the highest enrichment (P < 10-15). Many of the cell cycle genes were down-regulated. To further investigate the down-regulation of genes by EZH2, we analyzed the 183 pathways annotated in the KEGG database for enrichment of down-regulated genes (see Methods). ‘Cell cycle’ and ‘DNA replication’ were the most significantly regulated categories in all experiments (P < 10-11; see Supplementary Table S2). No significant regulation of ‘cell cycle’ and ‘DNA replication’ pathways was detected in cells treated

Figure 5. EZH2 knockdown induces G1-arrest in neuroblastoma cells. (A,B) FACS analysis of IMR32 cells 72 hours after transduction with control siRNA (A) or EZH2 siRNA (B). The y-axis shows the cell count (side scatter channel) versus the mean fluorescence (Cy5 channel; x-axis). (B) Distribution of cell cycle phases in IMR32 cells 72 hours after transduction with control siRNA (black) or EZH2 siRNA (gray).

113

EZH2 regulates neuroblastoma cell cycle

5

with control shRNA (see Supplementary Table S3). Examples of key-genes for DNA replication regulated by EZH2 are the MCM2 to 7 genes, which are major constituents of the mini-chromosome maintenance complex (MCM) that initiates DNA replication. We conclude that EZH2 expression is essential to maintain expression of cell cycle genes in neuroblastoma and that silencing of EZH2 results in a strong decrease of proliferation.

Expression of EZH2 and Cell Cycle and DNA Replication Genes Correlate in Neuroblastoma TumorsAs we observed that EZH2 supports expression of cell cycle genes in neuroblastoma cell lines, we investigated whether tumor data support such a role for EZH2 in neuroblastoma in vivo. We analyzed the expression profiles in our cohort of 88 neuroblastomas for major GO categories correlating to EZH2 expression. ‘Cell cycle’ was the most significantly enriched category (P = 1.2*10-67). A similar analysis for pathways defined in the KEGG database showed that 86% of genes annotated in the ‘DNA replication’ pathway and 59% genes of the ‘cell cycle’ pathway significantly correlate with EZH2 expression in vivo (P < 10-15; see Supplementary Table S4). We conclude that EZH2 expression is required for cell cycle gene expression in neuroblastoma cell lines. Both in cell lines and in neuroblastoma tumors, EZH2 expression strongly correlated to expression of these genes.

No Consistent Regulation of the p16/INK4A, p14/ARF and p15/INK4B loci by EZH2EZH2 is a major component of the Polycomb repressive complex-2 (PRC2), which silences genes by trimethylation of H3K27 (Cao 2002). An important target of silencing by PRC2 is formed by the adjacent chromosome 9 loci of p16/INK4a-p14/ARF (CDKN2A) and p15/INK4B (CDKN2B) (Jacobs 1999; Bracken 2007; Kotake 2007; Chen 2009), which are negative regulators of the cell cycle. Silencing of EZH2 could therefore result in de-repression of these genes and down-regulation of the cell cycle (Jacobs 1999; see also Bracken 2007). We therefore analyzed the expression levels of these genes in the neuroblastoma tumor series and in the EZH2 silencing experiments. The expression of p16/INK4A and p15/INK4B in the tumor series is low and showed respectively no correlation and a weak but significant inverse correlation with EZH2 expression (R = -0.28, P = 7.5*10-3; Supplementary Figure S3). However, expression of both p16/INK4A and p15/INK4B expression were not up-regulated after silencing of EZH2 in any of the cell line experiments (Supplementary Figure S3). Also p14/ARF expression in the tumor series is low, and did not correlate to EZH2 expression (P = 0.31; Supplementary Figure S3). Expression of p14/ARF was 2-fold up-regulated after doxycycline-induced EZH2 knockdown in IMR32, but not in either of the lentiviral knockdowns of EZH2 in IMR32 (Supplementary Figure S3). Also doxycycline-induced silencing of EZH2 in cell line SJNB8 did not result in up-regulation of p14/ARF. Taken together, these data do not suggest a major role for p16/INK4a-p14/ARF or p15/INK4B in the regulation of the downstream pathway of EZH2.

114

5

Genes Down-regulated After EZH2 Silencing are Enriched for E2F Binding SitesTo get a first insight in mechanisms that do mediate the effect of EZH2 on downstream genes, we analyzed the 2 KB region around the transcription start sites of genes down-regulated after EZH2 silencing for known transcription factor binging sites using Gene set enrichment analysis (Subramanian 2005). E2F binding sites appeared to have the highest enrichment in all four experiments. The same analysis performed for all genes with a significant positive correlation with EZH2 in the neuroblastoma

Figure 6. Pharmacological inhibition of EZH2 with DZnep induces impairment of cellular proliferation and a differentiated phenotype. (A) Western blot analysis showing EZH2 knockdown of IMR32 cells after 72 hours of incubation with 0.5 μM DZnep (control is DMSO). (B,C) Proliferation assay of IMR32 (B) and SJNB8 (C) cells after 72 hours of incubation with DZnep (black; 5 or 0.5 μM) or DMSO (control). (D) Photographs of neuroblastoma cells 72 hours after incubation with 0.5 μM DZnep (upper panels) or DMSO (control; lower panels) for IMR32 and SJNB8 cell lines.

115

EZH2 regulates neuroblastoma cell cycle

5

tumor dataset also showed the highest enrichment for E2F binding sites (P < 10-

13; Supplementary Table S5). These results show that genes down-regulated after EZH2 knockdown as well as genes correlating with EZH2 expression in vivo, are highly enriched for E2F binding sites. Interestingly, EZH2 was found to have, besides its function in the PRC2 complex, an independent role as an interacting protein of pRB2. EZH2 can interfere with the inhibitory effect of pRB2 on E2F proteins, resulting in E2F-driven transcription of target genes (Tonini 2004; see also Discussion).

Pharmacological Inhibition of EZH2 with DZnepAs we found that shRNA-mediated silencing of EZH2 strongly inhibited cell cycle progression of neuroblastoma cells, we asked whether pharmacological inhibition of EZH2 activity could be applied to achieve the same effect. EZH2 protein levels can be strongly diminished by treatment of cells with the drug 3-Deazaneplanocin A (DZnep) (Tan 2007; Fiskus 2009). DZnep inhibits S-adenosylhomocysteine hydrolase, and leads to accumulation of S-adenosylhomocysteine and inhibition of methyltransferases (Chiang 1979; Liu 1996). This leads to depletion of EZH2 proteins, probably through induction of proteasomal degradation (Tan 2007). We therefore analyzed the effect of DZnep in neuroblastoma cells. The neuroblastoma cell line SJNB8 was treated for 72 hours with 5μ M or 500 nM DZnep and analyzed for EZH2 protein expression levels (effective concentration was first determined over a range of 5nm to 50μM, see Supplementary Figure S4). Figure 6A shows that incubation with DZnep strongly reduced EZH2 levels compared to the DMSO control. Next, we performed proliferation assays in IMR32 and SJNB8 that showed that DZnep indeed impairs proliferation in both cell lines (P < 10-4, Figure 6B,C). Similarly, we observed outgrowth of neurites and a differentiated phenotype similar to the phenotype observed after EZH2 knockdown with siRNAs (Figure 6D and see also Figure 4C). Pharmacological inhibition of EZH2 in neuroblastoma cells induces proliferation arrest and a differentiated phenotype and thus recapitulates the effects of shRNA-mediated EZH2 silencing.

DISCUSSION

Here we show that EZH2 is highly expressed in neuroblastoma. High EZH2 expression is associated with poorly differentiated neuroblastoma, high stage disease and a poor prognosis. High EZH2 correlated with gain of extra copies of chromosome 7, which we observed in 57% of the tumors in our series of neuroblastoma. One neuroblastoma showed a gain of a very small region on chromosome band 7q36 encompassing the EZH2 locus and also had the highest EZH2 expression of all tumors in the series. These data suggest that gain of chromosome 7 and the EZH2 locus strongly contributes to the overexpresssion of this gene. In addition, we show that EZH2 expression is reduced after silencing of Cyclin D1, CDK4 or CDK2. As we previously showed that inhibition of each of these three cell cycle genes reduced responsiveness of a reporter with a canonical E2F binding site, these data are fully in line with previous reports that EZH2 is a transcriptional target of E2F (Bracken 2003). Overexpresssion of EZH2 therefore probably results from high Cyclin D1/

116

5

CDK4/CDK2 activity in neuroblastoma in combination with copy number gain of the EZH2 locus on chromosome 7. Silencing of EZH2 resulted in cell cycle arrest, proliferation arrest and differentiation in both tested neuroblastoma cell lines. The EZH2 protein is best known for its function in the PRC2 complex, which mediates H3K27 trimethylation and gene silencing. Polycomb group genes were first associated with oncogenesis in mammals almost two decades ago (van Lohuizen 1991; Haupt 1991; Satijn 1997; Satijn 1999). Various Polycomb group genes have since been implicated in cellular proliferation and oncogenesis (Jacobs 2002). Deregulation of EZH2 has been associated with a wide range of cancers, including melanoma, lymphoma, salivary gland, breast and prostate cancers (Bracken 2003; Kleer 2003; Pieterssen 2008; Varambally 2002; Visser 2001; Vékony 2008). Silencing of EZH2 by RNA interference resulted in growth arrest in multiple myeloma cells (Croonquist 2005), while overexpresssion of EZH2 in various cell lines such as prostate and breast cancer cells, promoted cell proliferation and invasion in vitro (Bracken 2003; Kleer 2003; Varambally 2002) and tumorigenesis in mouse xenograft models (Croonquist 2005). EZH2 was shown to mediate oncogenesis by silencing of tumor suppressor genes at the p16/INK4A, p14/ARF and p15/INK4B (Jacobs 1999; Bracken 2007). In contrast to the strong up-regulation of these suppressor genes after inactivation of the Polycomb complex reported by others (Jacobs 1999), we did not observe regulation of p16 or p15, nor consistent regulation of p14 after silencing of EZH2 in neuroblastoma cells. Our data therefore do not support a role for the three tumor suppressor genes in mediating the proliferation arrest after silencing of EZH2 in neuroblastoma cells.

An alternative explanation for our results might be provided by the findings of Tonini et al., who showed that EZH2 can bind to the retinoblastoma protein pRb2/p130 (RBL2) (Tonini 2004; Tonini 2008). Inactivation of pRb2/p130 was associated with disease progression and high tumor grade in breast, hepatic, ovarian, and prostate cancers (Yeung 1993; Claudio 2002). Retinoblastoma proteins bind E2F transcription factors and prevent E2F targets from being transcribed by recruiting histone deacetylase 1 (HDAC1) to their promoters (Harris 2005; Sun 2007). By interacting with the HDAC1 binding domain of pRb2/p130, EZH2 prevents recruitment of HDAC1 to the promoters of E2F targets (Tonini 2004). E2F-regulated genes are thus relieved from repression by pRb2/p130 and can become up-regulated (Tonini 2008).

All three members of the retinoblastoma protein family pRb (RB1), pRb1/p107 (RBL1), and pRb2/p130 (RBL2), are expressed in neuroblastoma (data not shown). In addition, we observed a strong enrichment for E2F binding site in the promoters of genes in the EZH2 downstream pathway. These observations open the possibility that the phenotypes observed after EZH2 silencing in neuroblastoma cell lines might be mediated by the role of EZH2 in cell cycle regulation. Our finding that genes down-regulated after EZH2 knockdown are enriched for E2F binding sites, are in agreement with such a hypothesis. Together with our finding that EZH2 is up-regulated after Cyclin D1, CDK4 or CDK2 silencing and the identification of EZH2 as a target of E2F (Bracken 2003). These results suggest an interesting positive feedback function of EZH2 in G1/S phase progression in neuroblastoma. EZH2

117

EZH2 regulates neuroblastoma cell cycle

5

expression is up-regulated by E2F, while the EZH2 protein would block HDAC1 binding to pRB2 resulting in continued transcription of E2F target genes (see also Harris 2005; Sun 2007). Our data therefore identify EZH2 as a potential regulator of cell cycle progression in neuroblastoma and validate further functional analyses of the here postulated mechanism.

Here we have shown that EZH2 is required for proliferation and cell cycle progression in neuroblastoma. The mini-chromosome maintenance complex (MCM) was shown to be consistently regulated. The MCM2-7 proteins form the helicase that unwinds DNA prior to replication, and are essential for initiation of replication and progression into S-phase (MacNeill 2010). We have recently found that all members of the MCM complex are also directly regulated by MYCN (Koppen 2007). Taken together our data show that EZH2 is an important regulator of cell cycle progression and proliferation in neuroblastoma. Many genes essential for G1 to S-phase transition are dependent on EZH2 for their expression in neuroblastoma cells. The high levels of EZH2 in neuroblastoma thus seem to contribute to deregulation of the G1 entry checkpoint in neuroblastoma.

METHODS

Cell culture and lentiviral transduction. Neuroblastoma cells were grown at 37 °C at 5% CO2 in DMEM (Invitrogen) supplemented with 10% heat-inactivated fetal calf serum (Gibco). For primary references of the cell lines, see Cheng et al. (Cheng 1996). For the generation of dox-inducible cell lines the T-Rex system (Invitrogen) was used. IMR32 and SJNB8 cells were transfected with the pcDNA6/TR vector (Invitrogen V1025-20) encoding the tetracycline repressor. A previously used short hairpin siRNAs (Varambally 2002) was cloned into pcDNA4/TO (Invitrogen V1030-20) behind a tetracycline/doxycycline-inducible CMV promoter). Expression of the shRNA was induced with 100ng/ml final concentration doxycycline (ICN 195044). Lentiviral shRNAs were obtained from Sigma (MISSION shRNA Lentiviral Transduction Particles). For EZH2, 5 constructs were tested of which the construct with best knockdown was used (TRCN0000040074; target sequence: GCTAGGTTAATTGGGACCAAA). As a control, a shRNA with a random non-homologous sequence was used (SHC002; CAACAAGATGAAGAGCACCAA). Cells were transduced at a multiplicity of infection of 3, and virus titer were determined using a p24 ELISA. Photographs were taken with a Leica camera.

Proliferation assay, FACS analysis and Western blotting. Proliferation analysis was performed using a Z1 Coulter Counter (Beckman Coulter). Cells were seeded at equal density and grown for 3 to 8 days and counted. Cells were collected by trypsinization and diluted in 1 ml of medium. Samples of 100 μl of this medium were diluted in 100 μl of Triton X-100/sapponine and 10 ml isotone II. All experiments were done in triplicate or more. Differences in cell counts were determined using a two-tailed student’s t-test assuming equal distribution. Fluorescence-activated

118

5

cell sorter (FACS) analysis was performed on a FACSAria (BD Biosciences). At the indicated time-point after siRNA induction, cells were lysed with a 3.4 mM Tri-sodiumcitrate, 0.1% Triton X-100 solution containing 50 μg/μl of propidium iodide. After 1 h of incubation, the DNA content of the nuclei was analyzed using FACS. A minimum of 30,000 nuclei per sample were counted. Cell cycle distribution was determined using FlowJo software and differences in cell counts were determined using a two-tailed student’s t-test assuming equal distribution. For western blot analysis cells were harvested on ice and washed twice with PBS. Cells were lysed in a 20% glycerol, 4% SDS, 100 mM Tris·HCl, pH 6.8, buffer. Protein was quantified with RC-DC protein assay (Bio-Rad). Loading was controlled by Ponceau-S staining and/or a loading control protein. Lysates were separated on a 10% SDS/PAGE gel and electro-blotted on a transfer membrane (Millipore). As primary antibodies were used for EZH2 (AC22; Cell Signaling), and TUBB (MAB3408; Chemicon). Membranes were incubated for 1 h at room temperature (RT) or overnight at 4 °C with primary antiserum following incubation with a horseradish peroxidase conjugated secondary antibody for 1 h at RT and developed using enhanced chemiluminescence (ECL; GE Healthcare).

Patient samples and RNA isolation88 primary neuroblastoma samples were obtained from untreated patients during surgery and immediately frozen in liquid nitrogen. Informed consent was obtained from all patients before this study. MYCN amplifications and 1p deletions were determined using Southern blot. Clinical history of each patient was monitored with a median follow-up of 5.8 years (range 0–16 years). Stage was classified according to the International Neuroblastoma Staging System (INSS) (Brodeur 1993). Treatment response was determined according to the revised criteria of the International Neuroblastoma Response Criteria (INRC) (Brodeur 1993). Total RNA of neuroblastoma tumors was extracted using Trizol reagent (Invitrogen) according to the manufacturer’s protocol. RNA concentration was determined using the NanoDrop ND-1000, and quality was determined using the RNA 6000 Nano assay on the Agilent 2100 Bioanalyzer (Agilent Technologies).

Patient samples, DNA and RNA isolation and CGH analysisHigh molecular weight DNA was extracted from tumor tissue using standard procedures. Labeling and hybridisation was performed as described previously by Michels et al. (Michels 2007). We used a custom 44K Agilent aCGH chip (http://www.agilent.com), enriched for critical regions of loss/gain for neuroblastoma (10 kb resolution), miRNAs/T-UCRs (5 oligos/gene) and cancer gene census genes (5 oligos/gene). Data was analyzed using the R2 web application (http://R2.humangenetics-amc.nl/). Circular binary segmentation was used for scoring the regions of gain, amplification and deletion.

Microarray analysis of data for Kaplan-Meier, Gene ontology, KEGG Pathway and transcription factor binding sites. Fragmentation of cRNA, hybridization to HG-U133 Plus 2.0 microarrays (Affymetrix) and scanning was carried out according to the manufacturer’s protocol (Affymetrix)

119

EZH2 regulates neuroblastoma cell cycle

5

at the Microarray Department of the University of Amsterdam (MAD, Amsterdam The Netherlands). Intensity values and P-values for determining significant regulation (P < 0.0025) were assigned with GCOS software (Affymetrix) and normalized to an average intensity of 100 using the MASS5.0 algorithm (Affymetrix). Microarray data have been deposited at the GEO database at the NCBI website under number [to be disclosed]. Publicly available Affymetrix expression data was obtained from the National Cancer Institute (NCI) Gene Expression Omnibus database (http://www.ncbi.nlm.nih.gov/geo/). We developed Perl scripts that linked Affymetrix probesets to RefSeq genesymbols using the annotation provide by Affymetrix (www.affymetrix.com). Kaplan-Meier analysis and all other analyses described below, were performed using the R2 web application (http://R2.humangenetics-amc.nl/).

For Gene ontology (GO) analysis, relevant gene ontology subgroups were grouped into one of 11 categories: apoptosis, cell cycle, development, differentiation, DNA repair, membrane associated, signal transduction, transcription factors, transcription regulator activity, and transcriptional repressor activity (Ashburner 2000). Gene ontology annotation was obtained from the GO website (http://www.geneontology.org/). Significant enrichment for regulated or correlated genes within each category was determined with a chi-square goodness-of-fit-test.

For KEGG Pathway analysis, annotation was downloaded from the KEGG website (http://www.genome.jp/kegg/) (Kanehisa 2000; Kanehisa 2006; Kanehisa 2010). Each KEGG pathway was tested for significant enrichment for regulated or correlated genes using a 2x2 contingency table chi-square test with continuity correction (P < 0.05). Correlations were determined using Pearson’s. In order to normalize distributions, expression values were 2log-transformed for calculations gene expression profile correlations for GO and KEGG pathway analysis. All observed correlations are also significant and yield the same results when using non-transformed data.

Transcription factor binding sites were obtained from the Molecular Signatures Database at the Broad institute (http://www.broadinstitute.org/gsea/msigdb/) (Xie 2005). Significant enrichment for motifs within regulated or correlated genes was determined with a 2x2 contingency table chi-square test with continuity correction (P < 0.05).

AcknowledgmentsThis research was supported by grants from The Stichting Kindergeneeskundig Kankeronderzoek (SKK), and the BioRange program of the Netherlands Bioinformatics Center (NBIC). We would like to thank D. Huberts, B. Hooijbrink, D. Markusovich, H.N. Caron, S. Heynen, E. Westerhout, H. Bras, D. Geerts, J. Seppen, W. Zandbergen, J. Celli, M. Kool, A. Lakeman, M. Hamdi, E. Santo, F. Lamers, G. Schaafsma, F. Haneveld, M. Ebus, T.J. van Groningen, and L.J. Valentijn at the AMC, and the Microarray Department of the University of Amsterdam for their advice and support, and the Developmental Therapeutics Program NCI/NIH for providing DZnep.

120

5

Supplemantary informationSupplementary figures S1−S4, supplementary tables S1−S5.

Conflict of interestThe authors declare no conflict of interest.

121

EZH2 regulates neuroblastoma cell cycle

5

References

Ashburner M, Ball CA, Blake JA, Botstein D, Butler H, Cherry JM, Davis AP, Dolinski K, Dwight SS, Eppig JT, et al. Gene ontology: tool for the unification of biology. The Gene Ontology Consortium. Nat Genet. 2000 May;25(1):25-9.

Bown N, Cotterill S, Lastowska M, O’Neill S, Pearson AD, Plantaz D, Meddeb M, Danglot G, Brinkschmidt C, Christiansen H, Laureys G, Speleman F, Nicholson J, Bernheim A, Betts DR, Vandesompele J, Van Roy N. Gain of chromosome arm 17q and adverse outcome in patients with neuroblastoma. N Engl J Med. 1999 Jun 24;340(25):1954-61.

Bracken AP, Kleine-Kohlbrecher D, Dietrich N, Pasini D, Gargiulo G, Beekman C, Theilgaard-Mönch K, Minucci S, Porse BT, Marine JC, Hansen KH, Helin K. The Polycomb group proteins bind throughout the INK4A-ARF locus and are disassociated in senescent cells. Genes Dev. 2007 Mar 1;21(5):525-30.

Bracken AP, Pasini D, Capra M, Prosperini E, Colli E, Helin K. EZH2 is downstream of the pRB-E2F pathway, essential for proliferation and amplified in cancer. EMBO J. 2003 Oct 15;22(20):5323-35.

Brodeur GM, Pritchard J, Berthold F, Carlsen NL, Castel V, Castelberry RP, De Bernardi B, Evans AE, Favrot M, Hedborg F, et al. Revisions of the international criteria for neuroblastoma diagnosis, staging, and response to treatment. J Clin Oncol. 1993 Aug;11(8):1466-77.

Brodeur GM, Seeger RC, Schwab M, Varmus HE, Bishop JM. Amplification of N-myc in untreated human neuroblastomas correlates with advanced disease stage. Science. 1984 Jun 8;224(4653):1121-4.

Cao R, Wang L, Wang H, Xia L, Erdjument-Bromage H, Tempst P, Jones RS, Zhang Y. Role of histone H3 lysine 27 methylation in Polycomb-group silencing. Science. 2002 Nov 1;298(5595):1039-43.

Chen H, Gu X, Su IH, Bottino R, Contreras JL, Tarakhovsky A, Kim SK. Polycomb protein Ezh2 regulates pancreatic beta-cell Ink4a/Arf expression and regeneration in diabetes mellitus. Genes Dev. 2009 Apr 15;23(8):975-85.

Cheng NC, Beitsma M, Chan A, Op den Camp I, Westerveld A, Pronk J, Versteeg R. Lack of class I HLA expression in neuroblastoma is associated with high N-myc expression and hypomethylation due to loss of the MEMO-1 locus. Oncogene. 1996 Oct 17;13(8):1737-44.

Chiang PK, Cantoni GL. Perturbation of biochemical transmethylations by 3-deazaadenosine in vivo. Biochem Pharmacol. 1979 Jun 15;28(12):1897-902.

Claudio PP, Tonini T, Giordano A. The retinoblastoma family: twins or distant cousins? Genome Biol. 2002 Aug 28;3(9):reviews3012.

Croonquist PA, Van Ness B. The polycomb group protein enhancer of zeste homolog 2 (EZH 2) is an oncogene that influences myeloma cell growth and the mutant ras phenotype. Oncogene. 2005 Sep 15;24(41):6269-80.

Fiskus W, Wang Y, Sreekumar A, Buckley KM, Shi H, Jillella A, Ustun C, Rao R, Fernandez P, Chen J, Balusu R, Koul S, Atadja P, Marquez VE, Bhalla KN. Combined epigenetic therapy with the histone methyltransferase EZH2 inhibitor 3-deazaneplanocin A and the histone deacetylase inhibitor panobinostat against human AML cells. Blood. 2009 Sep 24;114(13):2733-43.

Godfried MB, Veenstra M, v Sluis P, Boon K, v Asperen R, Hermus MC, v Schaik BD, Voûte TP, Schwab M, Versteeg R, et al. The N-myc and c-myc downstream pathways include the chromosome 17q genes nm23-H1 and nm23-H2. Oncogene. 2002 Mar 27;21(13):2097-101.

Harris SL, Levine AJ. The p53 pathway: positive and negative feedback loops. Oncogene. 2005 Apr 18;24(17):2899-908.

Haupt Y, Alexander WS, Barri G, Klinken SP, Adams JM. Novel zinc finger gene implicated as myc collaborator by retrovirally accelerated lymphomagenesis in E mu-myc transgenic mice. Cell. 1991 May 31;65(5):753-63.

Islam A, Kageyama H, Takada N, Kawamoto T, Takayasu H, Isogai E, Ohira M, Hashizume K, Kobayashi H, Kaneko Y, Nakagawara A. High expression of Survivin, mapped to 17q25, is significantly associated with poor prognostic factors and promotes cell survival in human neuroblastoma. Oncogene. 2000 Feb 3;19(5):617-23.

Jacobs JJ, Kieboom K, Marino S, DePinho RA, van Lohuizen M. The oncogene and Polycomb-group gene bmi-1 regulates cell proliferation and senescence through the ink4a locus. Nature. 1999 Jan 14;397(6715):164-8.

122

5

Jacobs JJ, van Lohuizen M. Polycomb repression: from cellular memory to cellular proliferation and cancer. Biochim Biophys Acta. 2002 Jun 21;1602(2):151-61.

Kanehisa M, Goto S, Furumichi M, Tanabe M, Hirakawa M. KEGG for representation and analysis of molecular networks involving diseases and drugs. Nucleic Acids Res. 2010 Jan;38(Database issue):D355-60.

Kanehisa M, Goto S, Hattori M, Aoki-Kinoshita KF, Itoh M, Kawashima S, Katayama T, Araki M, Hirakawa M. From genomics to chemical genomics: new developments in KEGG. Nucleic Acids Res. 2006 Jan 1;34(Database issue):D354-7.

Kanehisa M, Goto S. KEGG: kyoto encyclopedia of genes and genomes. Nucleic Acids Res. 2000 Jan 1;28(1):27-30.

Kleer CG, Cao Q, Varambally S, Shen R, Ota I, Tomlins SA, Ghosh D, Sewalt RG, Otte AP, et al. EZH2 is a marker of aggressive breast cancer and promotes neoplastic transformation of breast epithelial cells. Proc Natl Acad Sci U S A. 2003 Sep 30;100(20):11606-11.

Koppen A, Ait-Aissa R, Koster J, van Sluis PG, Ora I, Caron HN, Volckmann R, Versteeg R, Valentijn LJ. Direct regulation of the minichromosome maintenance complex by MYCN in neuroblastoma. Eur J Cancer. 2007 Nov;43(16):2413-22.

Kotake Y, Cao R, Viatour P, Sage J, Zhang Y, Xiong Y. pRB family proteins are required for H3K27 trimethylation and Polycomb repression complexes binding to and silencing p16INK4alpha tumor suppressor gene. Genes Dev. 2007 Jan 1;21(1):49-54.

Lastowska M, Cotterill S, Pearson AD, Roberts P, McGuckin A, Lewis I, Bown N. Gain of chromosome arm 17q predicts unfavourable outcome in neuroblastoma patients. U.K. Children’s Cancer Study Group and the U.K. Cancer Cytogenetics Group. Eur J Cancer. 1997 Sep;33(10):1627-33.

Liu S, Yuan CS, Borchardt RT. Aristeromycin-5’-carboxaldehyde: a potent inhibitor of S-adenosyl-L-homocysteine hydrolase. J Med Chem. 1996 Jun 7;39(12):2347-53.

Look AT, Hayes FA, Shuster JJ, Douglass EC, Castleberry RP, Bowman LC, Smith EI, Brodeur GM. Clinical relevance of tumor cell ploidy and N-myc gene amplification in childhood neuroblastoma: a Pediatric Oncology Group study. J Clin Oncol. 1991 Apr;9(4):581-91.

MacNeill SA. Structure and function of the GINS complex, a key component of the eukaryotic replisome. Biochem J. 2010 Jan 15;425(3):489-500.

Maris JM, Hogarty MD, Bagatell R, Cohn SL. Neuroblastoma. Lancet. 2007 Jun 23;369(9579):2106-20.Michels E, Vandesompele J, De Preter K, Hoebeeck J, Vermeulen J, Schramm A, Molenaar JJ, Menten

B, Marques B, Stallings RL, et al. ArrayCGH-based classification of neuroblastoma into genomic subgroups. Genes Chromosomes Cancer. 2007 Dec;46(12):1098-108.

Molenaar JJ, Ebus ME, Geerts D, Koster J, Lamers F, Valentijn LJ, Westerhout EM, Versteeg R, Caron HN. Inactivation of CDK2 is synthetically lethal to MYCN overexpresssing cancer cells. Proc Natl Acad Sci U S A. 2009 Aug 4;106(31):12968-73.

Molenaar JJ, Ebus ME, Koster J, van Sluis P, van Noesel CJ, Versteeg R, Caron HN. Cyclin D1 and CDK4 activity contribute to the undifferentiated phenotype in neuroblastoma. Cancer Res. 2008 Apr 15;68(8):2599-609.

Molenaar JJ, van Sluis P, Boon K, Versteeg R, Caron HN. Rearrangements and increased expression of cyclin D1 (CCND1) in neuroblastoma. Genes Chromosomes Cancer. 2003 Mar;36(3):242-9.

Morin RD, Johnson NA, Severson TM, Mungall AJ, An J, Goya R, Paul JE, Boyle M, Woolcock BW, Kuchenbauer F, Yap D, Humphries RK, et al. Somatic mutations altering EZH2 (Tyr641) in follicular and diffuse large B-cell lymphomas of germinal-center origin. Nat Genet. 2010 Jan 17.

Mossé YP, Laudenslager M, Longo L, Cole KA, Wood A, Attiyeh EF, Laquaglia MJ, Sennett R, Lynch JE, Perri P, Laureys G, Speleman F, Kim C, Hou C, Hakonarson H, Torkamani A, Schork NJ, Brodeur GM, Tonini GP, Rappaport E, Devoto M, Maris JM. Identification of ALK as a major familial neuroblastoma predisposition gene. Nature. 2008 Oct 16;455(7215):930-5.

Pietersen AM, Horlings HM, Hauptmann M, Langerød A, Ajouaou A, Cornelissen-Steijger P, Wessels LF, Jonkers J, van de Vijver MJ, van Lohuizen M. EZH2 and BMI1 inversely correlate with prognosis and TP53 mutation in breast cancer. Breast Cancer Res. 2008;10(6):R109.

Saito-Ohara F, Imoto I, Inoue J, Hosoi H, Nakagawara A, Sugimoto T, Inazawa J. PPM1D is a potential target for 17q gain in neuroblastoma. Cancer Res. 2003 Apr 15;63(8):1876-83.

Satijn DP, Olson DJ, van der Vlag J, Hamer KM, Lambrechts C, Masselink H, Gunster MJ, Sewalt RG, van Driel R, Otte AP. Interference with the expression of a novel human polycomb protein, hPc2,

123

EZH2 regulates neuroblastoma cell cycle

5

results in cellular transformation and apoptosis. Mol Cell Biol. 1997 Oct;17(10):6076-86.Satijn DP, Otte AP. RING1 interacts with multiple Polycomb-group proteins and displays tumorigenic

activity. Mol Cell Biol. 1999 Jan;19(1):57-68.Spix C, Pastore G, Sankila R, Stiller CA, Steliarova-Foucher E. Neuroblastoma incidence and survival in

European children (1978-1997): report from the Automated Childhood Cancer Information System project. Eur J Cancer. 2006 Sep;42(13):2081-91.

Stallings RL, Howard J, Dunlop A, Mullarkey M, McDermott M, Breatnach F, O’Meara A. Are gains of chromosomal regions 7q and 11p important abnormalities in neuroblastoma? Cancer Genet Cytogenet. 2003 Jan 15;140(2):133-7.

Subramanian A, Tamayo P, Mootha VK, Mukherjee S, Ebert BL, Gillette MA, Paulovich A, Pomeroy SL, Golub TR, Lander ES, et al. Gene set enrichment analysis: a knowledge-based approach for interpreting genome-wide expression profiles. Proc Natl Acad Sci U S A. 2005 Oct 25;102(43):15545-50.

Sun A, Bagella L, Tutton S, Romano G, Giordano A. From G0 to S phase: a view of the roles played by the retinoblastoma (Rb) family members in the Rb-E2F pathway. J Cell Biochem. 2007 Dec 15;102(6):1400-4.

Tan J, Yang X, Zhuang L, Jiang X, Chen W, Lee PL, Karuturi RK, Tan PB, Liu ET, Yu Q. Pharmacologic disruption of Polycomb-repressive complex 2-mediated gene repression selectively induces apoptosis in cancer cells. Genes Dev. 2007 May 1;21(9):1050-63.

Tonini T, Bagella L, D’Andrilli G, Claudio PP, Giordano A. Ezh2 reduces the ability of HDAC1-dependent pRb2/p130 transcriptional repression of cyclin A. Oncogene. 2004 Jun 17;23(28):4930-7.

Tonini T, D’Andrilli G, Fucito A, Gaspa L, Bagella L. Importance of Ezh2 polycomb protein in tumorigenesis process interfering with the pathway of growth suppressive key elements. J Cell Physiol. 2008 Feb;214(2):295-300.

Valentijn LJ, Koppen A, van Asperen R, Root HA, Haneveld F, Versteeg R. Inhibition of a new differentiation pathway in neuroblastoma by copy number defects of N-myc, Cdc42, and nm23 genes. Cancer Res. 2005 Apr 15;65(8):3136-45.

van Limpt V, Schramm A, van Lakeman A, Sluis P, Chan A, van Noesel M, Baas F, Caron H, Eggert A, Versteeg R. The Phox2B homeobox gene is mutated in sporadic neuroblastomas. Oncogene. 2004 Dec 9;23(57):9280-8

van Lohuizen M, Verbeek S, Scheijen B, Wientjens E, van der Gulden H, Berns A. Identification of cooperating oncogenes in E mu-myc transgenic mice by provirus tagging. Cell. 1991 May 31;65(5):737-52.

Vandesompele J, Speleman F, Van Roy N, Laureys G, Brinskchmidt C, Christiansen H, Lampert F, Lastowska M, Bown N, Pearson A, et al. Multicentre analysis of patterns of DNA gains and losses in 204 neuroblastoma tumors: how many genetic subgroups are there? Med Pediatr Oncol. 2001 Jan;36(1):5-10.

Varambally S, Dhanasekaran SM, Zhou M, Barrette TR, Kumar-Sinha C, Sanda MG, Ghosh D, Pienta KJ, Sewalt RG, Otte AP et al. The polycomb group protein EZH2 is involved in progression of prostate cancer. Nature. 2002 Oct 10;419(6907):624-9.

Vékony H, Raaphorst FM, Otte AP, van Lohuizen M, Leemans CR, van der Waal I, Bloemena E. High expression of Polycomb group protein EZH2 predicts poor survival in salivary gland adenoid cystic carcinoma. J Clin Pathol. 2008 Jun;61(6):744-9.

Visser HP, Gunster MJ, Kluin-Nelemans HC, Manders EM, Raaphorst FM, Meijer CJ, Willemze R, Otte AP. The Polycomb group protein EZH2 is upregulated in proliferating, cultured human mantle cell lymphoma. Br J Haematol. 2001 Mar;112(4):950-8.

Xie X, Lu J, Kulbokas EJ, Golub TR, Mootha V, Lindblad-Toh K, Lander ES, Kellis M. Systematic discovery of regulatory motifs in human promoters and 3’ UTRs by comparison of several mammals. Nature. 2005 Mar 17;434(7031):338-45.

Yeung RS, Bell DW, Testa JR, Mayol X, Baldi A, Graña X, Klinga-Levan K, Knudson AG, Giordano A. The retinoblastoma-related gene, RB2, maps to human chromosome 16q12 and rat chromosome 19. Oncogene. 1993 Dec;8(12):3465-8.

Zhou H, Kuang J, Zhong L, Kuo WL, Gray JW, Sahin A, Brinkley BR, Sen S. Tumour amplified kinase STK15/BTAK induces centrosome amplification, aneuploidy and transformation. Nat Genet. 1998 Oct;20(2):189-93.

124

5

SUPPLEMENTARY INFORMATION

Supplementary figuresFigure S1Figure S2Figure S3Figure S4

Supplementary tablesTable S1Table S2Table S3Table S4Table S5

125

EZH2 regulates neuroblastoma cell cycle

5

Supplementary Figure S1. EZH2 expression correlates with progression-free survival independent of MYCN amplification. Kaplan-Meier analysis for progression-free survival of neuroblastoma patients di-vided into high and low EZH2 expression groups for all neuroblastoma patients (A; N = 88) or all neuro-blastoma patients without MYCN amplification (B, N = 72).

Supplementary Figure S2. EZH2 expression in neuroblastoma cell lines. A, EZH2 mRNA levels in 24 neuroblastoma cell lines ranked by height of expression (y-axis). The x-axis shows annotation of 17q gain, LOH1p and MYCN amplification (black, yes; dark gray, no; gray, not determined). B, EZH2 mRNA versus protein levels (R2 = 0.87, P = 2.1*10-2). Protein levels were determined by Western blotting and normalized to TUBB loading control. Quantification was done by densitometry with AIDA software. mRNA levels were determined by Affymetrix microarray analysis and MAS5.0 normalized.

126

5

Supplementary Figure S3. Expression of the p16/INK4A, p14/ARF and p15/INK4B locus in vivo and in experiments. Each panel shows the expression of p16 (A), p14 (B) and p15 (C) in vivo in 88 neuroblas-toma tumors. Expression of p14-p16 is in blue dots, and tumors are ranked according to EZH2 expression (red dots) (y-axis). The x-axis shows annotation of 17q gain, LOH1p, and MYCN amplification (red, yes; green, no; gray, not informative), and INSS stage (light green, 1; dark green, 2; orange, 3; red, 4; blue, 4s). Regulation of p14-p16 expression (y-axis) is shown in the panels at medium (IMR32 lentiviral ex-periments; in red both EZH2 knockdowns; green control virus) and low height (doxycycline experiments; IMR32, blue; SJNB8, red) (see also methods). The x-axis shows the time points from 0 to 72 hours.

127

EZH2 regulates neuroblastoma cell cycle

5Supplementary Figure S4. Determination of effective DZnep concentration in IMR32. Cells were count-ed (y-axis) after 72 hours of incubation with varying concentrations of DZnep (5nM to 50 μM; x-axis) or DMSO. For the control (DMSO), the same volume of solvent (DMSO) was used as for the cells incubated with DZnep.