Upload
others
View
3
Download
0
Embed Size (px)
Citation preview
2018 SKYHAWK BASEBALL 1
UT MARTIN SKYHAWKS
2018 BASEBALL
2018 UT MARTIN BASEBALL2
2018 UT MARTIN SKYHAWK BASEBALL2018 UT MARTIN SKYHAWK BASEBALL
#1 Billy Edwards#1 Billy EdwardsIF • 5-8 • 165 • Fr.IF • 5-8 • 165 • Fr.Lakeland, Tenn.Lakeland, Tenn.
#3 Ben Aslett#3 Ben AslettIF • 5-11 • 180 • Sr.IF • 5-11 • 180 • Sr.
Melbourne, AustraliaMelbourne, Australia
#4 Blake Davis#4 Blake DavisC • 6-0 • 195 • Fr.C • 6-0 • 195 • Fr.
Crandall, Ga.Crandall, Ga.
#6 Tyler Albright#6 Tyler AlbrightIF • 5-11 • 185 • SR.IF • 5-11 • 185 • SR.
Algonquin, Ill.Algonquin, Ill.
#7 Creighton Eldridge#7 Creighton EldridgeOF • 6-0 • 175 • Sr.OF • 6-0 • 175 • Sr.Mansfield, texasMansfield, texas
#8 David Hussey#8 David HusseyRHP• 6-2 • 180 • So.RHP• 6-2 • 180 • So.
Minter, Ala.Minter, Ala.
#9 Jacob Jones#9 Jacob JonesRHP • 6-2 • 190 • Fr.RHP • 6-2 • 190 • Fr.
Bolivar, Tenn.Bolivar, Tenn.
#10 Collin Edwards#10 Collin EdwardsRHP • 6-2 • 225 • Sr.RHP • 6-2 • 225 • Sr.
Arnold, Mo.Arnold, Mo.
#11 Caleb Brewer#11 Caleb BrewerIf/OF • 6-0 • 190 • Sr.If/OF • 6-0 • 190 • Sr.Hohenwald, teNN.Hohenwald, teNN.
#12 Robert Worley#12 Robert Worleyif/RHP • 6-4 • 220 • So.if/RHP • 6-4 • 220 • So.
Hornbeak, Tenn.Hornbeak, Tenn.
#13 Sam Folks#13 Sam FolksLHP • 5-11 • 170 • So.LHP • 5-11 • 170 • So.
Franklin, Tenn.Franklin, Tenn.
#14 JoJo Allen#14 JoJo Allenif • 6-0 • 195 • So.if • 6-0 • 195 • So.
clarksville, tenn.clarksville, tenn.
#15 Peyton Cain#15 Peyton CainRHP • 6-1 • 190 • Sr.RHP • 6-1 • 190 • Sr.
Hickory, Miss.Hickory, Miss.
#17 Casey Harford#17 Casey HarfordIF • 5-11 • 165 • Fr.IF • 5-11 • 165 • Fr.Cordova, Tenn.Cordova, Tenn.
#18 Blake Williams#18 Blake WilliamsoF • UTL • 180 • Jr.oF • UTL • 180 • Jr.Clarksville, Tenn.Clarksville, Tenn.
#19 Ethan Whitley#19 Ethan WhitleyIf • 6-1 • 210 • Fr.If • 6-1 • 210 • Fr.
Mason, tenn.Mason, tenn.
#21 Carson Shrode#21 Carson ShrodeC/OF • 6-2 • 210 • Jr.C/OF • 6-2 • 210 • Jr.
Nashville, tenn.Nashville, tenn.
#22 Winston Cannon#22 Winston CannonRhp • 6-3 • 200 • So.Rhp • 6-3 • 200 • So.Cookeville, Tenn.Cookeville, Tenn.
#24 Austin Buzick#24 Austin BuzickRHP • 6-2 • 230 • Jr.RHP • 6-2 • 230 • Jr.
Granite City, Ill.Granite City, Ill.
#28 Jordan Stoner#28 Jordan Stonerof • 5-10 • 170 • Jr.of • 5-10 • 170 • Jr.Puyallup, Wash.Puyallup, Wash.
#29 Anthony Adduci#29 Anthony Adducic • 6-0 • 185 • So.c • 6-0 • 185 • So.St. Charles, Ill.St. Charles, Ill.
#30 Jonah Brody#30 Jonah Brodyc • 5-9 • 185 • Jr.c • 5-9 • 185 • Jr.
Hoover, Ala.Hoover, Ala.
#31 Dalton Westfall#31 Dalton WestfallRHPRHP • 6-6 • 225 • sR. • 6-6 • 225 • sR.Buckhannon, W.VA.Buckhannon, W.VA.
#32 Dom Bazzani#32 Dom BazzaniLhp • 6-4 • 225 • Jr.Lhp • 6-4 • 225 • Jr.
Stockbridge, Ga.Stockbridge, Ga.
#33 Nick Wohlbold#33 Nick WohlboldIF • 6-1 • 185 • Fr.IF • 6-1 • 185 • Fr.Columbia, Mo.Columbia, Mo.
#34 Seth Rayburn#34 Seth RayburnRHP • 6-1 • 200 • Jr.RHP • 6-1 • 200 • Jr.Vancouver, Wash.Vancouver, Wash.
#35 Konnor Aherin#35 Konnor AherinLHP • 6-6 • 210 • Sr.LHP • 6-6 • 210 • Sr.
Chatham, Ill.Chatham, Ill.
#37 Micah Hagan#37 Micah HaganOF • 5-9 • 180 • FrOF • 5-9 • 180 • Fr
Springfield, Tenn.Springfield, Tenn.
#39 Jefferey O’Doherty#39 Jefferey O’DohertyRHP • 6-4 • 245 • so.RHP • 6-4 • 245 • so.
Omaha, Neb.Omaha, Neb.
#41 Tyler borski#41 Tyler borskilHP • 6-3 • 175 • Sr.lHP • 6-3 • 175 • Sr.
riverton, ill.riverton, ill.
#42 Austen Bullington#42 Austen BullingtonrHP • 6-2 • 190 • jr.rHP • 6-2 • 190 • jr.
Newburgh, Ind.Newburgh, Ind.
#38 Brian Baxa#38 Brian BaxaRHP • 6-2 • 190 • Fr.RHP • 6-2 • 190 • Fr.
Danville, Ky.Danville, Ky.
#55 zack denney#55 zack denneyrHP • 6-2 • 185 • jr.rHP • 6-2 • 185 • jr.
russelville, ky.russelville, ky.
2018 SKYHAWK BASEBALL2018 SKYHAWK BASEBALL 3
QUICK FACTSQUICK FACTSUNIVERSITY QUICK FACTSUNIVERSITY QUICK FACTSFounded: 1900; Senior College, 1951Enrollment: 6,705Nickname: SkyhawksColors: Navy Blue and OrangeAffi lia on: NCAA Division IConference: Ohio ValleyChancellor: Dr. Keith CarverDirector of Athle cs: Kurt McGuffi nAthle cs Web Site: www.UTMSports.com
UTM BASEBALL PERSONNELUTM BASEBALL PERSONNELInterim Head Coach: Ryan JenkinsAlma Mater: Auburn, 2014Career Record: First seasonRecord at UTM: First seasonE-Mail Address: [email protected] ce Telephone: (731) 881-3691
Assistant Coach: Geoff MurphyAlma Mater: Boston College, 2015E-Mail Address: [email protected] ce Telephone: (731) 881-3691
Assistant Coach: John O’NeilAlma Mater: Colby-Sawyers College, 2008E-Mail Address: [email protected] ce Telephone: (731) 881-3691
UTM BASEBALL QUICK FACTSUTM BASEBALL QUICK FACTS2017 Overall Record: 25-302017 Conference Record (Finish): 12-18 (8th)Postseason: OVC Tournament First RoundPlayers Returning/Lost: 20/11Newcomers: 13Stadium (Capacity): Skyhawk Field (500)Dimensions: Lines 330 feet/Alleys 365 feet/CF 385 feetSurface: Natural GrassFirst Year of Baseball: 1957All-Time Baseball Record: 1044-1308-11All-Time Record at Skyhawk Field: 432-430-3All-Time OVC Record: 164-454-2All-Time OVC Tournament Record: 1-5OVC Tournament Appearances: 3Last OVC Tournament Appearance: 2017
UTM SPORTS INFORMATIONUTM SPORTS INFORMATIONSports Info. Intern/Baseball Contact: Jake RogersE-Mail Address: [email protected] ce Phone: (731) 881-7632Cell Phone: (731) 819-5371Fax Number: (731) 881-7624
CREDITSCREDITSThe 2018 University of Tennessee at Mar n baseball media guide was wri en and produced by sports informa on intern Jake Rogers using Adobe InDesign Crea ve Cloud. Special editorial assistance was provided by Alex Boggis, Ryne Rickman, Jus n Jeff eries and Cade Wilemon. Cover designs by Alex Boggis. Photos by Trevor Ruszkowski, Tyler Holmes, Nathan Morgan, Jus n Jeff eries, Jake Rogers, Alex Boggis
and Raff e Lazarian.
The University of Tennessee at Mar n does not discriminate on the basis of race, sex, color, religion, na onal origin, age, disability or veteran status in provision of educa onal opportuni es or employment opportuni es and benefi ts. UT Mar n does not discriminate on the basis of sex or disability in the educa on programs and ac vi es which it operates, pursuant to requirements of Title VI of the Civil Rights Act of 1964 as codifi ed in 42 U.S.C. 2000D; Title IX of the Educa onal Amendments of 1972, Public Law 92 318; Sec on 504 of the Rehabilita on Act of 1973, Public Law 93-112; the Americans with Disabili es Act of 1990, Public Law 101-336; and the Age Discrimina on in Employment Act. This policy extends to both employment by and admission to the university. Inquiries concerning Title VI, Title IX, Sec on 504, the Americans with Disabili es Act, and the Age Discrimina on in Employment Act should be directed to the Offi ce of Equity and Diversity, 240 Gooch Hall, UT Mar n, Mar n, TN 38238-5002, 731-881-7202. Charges of viola on of the above
policy also should be directed to the Equity and Diversity Offi cer. E05-0416-00-021-18.
TABLE OF CONTENTSTABLE OF CONTENTS Quick Facts ............................................................................................. 3 Media Informa on ................................................................................. 4 Skyhawk Field ......................................................................................... 5 Roster/Squad Breakdown ....................................................................... 6
MEET THE SKYHAWKSMEET THE SKYHAWKS Returner Bios ..................................................................................... 7-27 Newcomer Bios................................................................................ 28-34Support Staff ..................................................................................... 35-36
COACHING STAFFCOACHING STAFF Interim Head Coach Ryan Jenkins ................................................... 37-38 Assistant Coaches ............................................................................ 39-40
2018 PREVIEW2018 PREVIEW Season Outlook ............................................................................... 41-43 Opponents/All-Time vs. OVC ........................................................... 44-51 Ohio Valley Conference Schedule .................................................... 52-55
2017 RECAP2017 RECAP 2017 Accolades and Records ........................................................... 56-57 Season Recap ................................................................................... 58-59 Final Stats ........................................................................................ 60-61
ALL-TIME RECORDSALL-TIME RECORDS Notable Skyhawks/Yearly Division-I Leaders ................................... 62-65 Team/Individual Season/Career Records ......................................... 66-69 Yearly Division-I Results ................................................................... 70-75 All-Time Roster ................................................................................ 76-77
THIS IS UT MARTINTHIS IS UT MARTIN This is UT Mar n................................................................................... 78 Ohio Valley Conference ........................................................................ 79 Athle c Director Kurt McGuffi n ............................................................ 80 Notable Alumni..................................................................................... 81 Skyhawks in the Pros ............................................................................ 82 OVC Championships ............................................................................. 83Strength and Condi oning ............................................................... 84-85OVC Academic Awards .......................................................................... 86Baseball Facili es................................................................................... 872018 Schedule ....................................................................................... 88
2018 UT MARTIN BASEBALL2018 UT MARTIN BASEBALL4
MEDIA INFORMATIONMEDIA INFORMATIONINTERVIEW POLICIESINTERVIEW POLICIES
Media interviews with players and coaches are encouraged, and every eff ort will be made to accommodate media requests. In-person interviews are preferred. Telephone interviews can be arranged through the sports
informa on offi ce. The best me to reach head coach Ryan Jenkins is weekday mornings.
POSTGAME AVAILABILITIESPOSTGAME AVAILABILITIESPlayers and coaches will be available for interviews on the fi eld, a er a brief cooling-off period at the conclusion of each game. Media will be provided full stat packages upon comple on of each game. Skyhawk head coach Ryan Jenkins and selected players will be made available upon request. Requests for players will be taken near the end of each game. Space and phone lines will be made available following post game interviews for fi ling stories.
CREDENTIALSCREDENTIALSAdmission is free to Skyhawk Field, but sea ng in the press box will be reserved for accredited media only. Please no fy baseball sports informa on director Jake Rogers at least 48 hours in advance if a media outlet plans on
covering a game at Skyhawk Field.
PRESS BOXPRESS BOXThe Skyhawk Field press box is located above the spectator sea ng area behind home plate. Press box sea ng is limited and working media will be permi ed in the press box during games. Children and spectators will not be
permi ed in the Skyhawk Field press box.
SKYHAWKS IN PRINTSKYHAWKS IN PRINTThe name of our ins tu on is The University of Tennessee at Mar n and if abbreviated, should be referred to as UT Mar n. The University of Tennessee at Mar n should be used as the fi rst reference in a news story. UT Mar n should be used in subsequent references and UTM is acceptable in headlines. Tennessee-Mar n, UT-Mar n, UT or Mar n should never be used. The descrip on Skyhawks should be used to represent all UT Mar n athle c
teams. Hawks should never be used.
RADIO COVERAGERADIO COVERAGEWUTM 90.3 FM, UT Mar n’s award-winning student radio sta on, broadcasts select dates of the Skyhawk home
schedule. Check the calendar feature on www.UTMSports.com for a direct link to those broadcasts.
ON THE WEBON THE WEBA wealth of resources for the UT Mar n sports informa on department can be found at www.UTMSports.com. The site (pictured below) features updated schedules, rosters, player informa on, scores, sta s cs and game
notes.
Ryne RickmanRyne RickmanSports Info DirectorSports Info Director
Jake RogersJake RogersSports Info InternSports Info Intern
Alex Boggis Alex Boggis Assistant SIDAssistant SID
UT MARTIN SKYHAWKS
2018 BASEBALL
2018 SKYHAWK BASEBALL2018 SKYHAWK BASEBALL 5
SKYHAWK FIELDSKYHAWK FIELD
From I-24 East (Paducah, Ky.)From I-24 East (Paducah, Ky.)Take Exit 7 (Mayfi eld/Paducah) to Hwy. 45 South toward Mayfi eld. At Mayfi eld, turn right on Purchase Parkway (Fulton, Ky. Exit 121). At Fulton, follow Hwy. 45E South Bypass to Mar n. Turn right onto University Street and con nue on to the intersec on of Mt. Pelia road. Turn le on to Mt. Pelia Road, then make the fi rst right at Pat Head Summit Drive. Be ye Giles Field will be at the end of Pat Head Summit Drive.
From I-40 West (Nashville, Tenn.)From I-40 West (Nashville, Tenn.)Take Exit 108 North (Parker’s Crossroads) to Highway 22. Follow Highway 22 to Mar n. Exit onto Skyhawk Parkway and turn right at the fi rst traffi c light onto University Street. Make a right at the fi rst traffi c light on to Mt. Pelia Drive, then make the fi rst right at Pat Head Summit Drive. Be ye Giles Field will be at the
end of Pat Head Summit Drive.
From I-40 East (Memphis, Tenn.)From I-40 East (Memphis, Tenn.)Take Exit 80-B North to Highway 45 By-pass. Follow Highway 45E (Milan Exit) to Mar n. Exit onto Skyhawk Parkway and turn right at the fi rst traffi c light onto University Street. Make a right at the fi rst traffi c light on to Mt. Pelia Drive, then make the fi rst right at Pat Head Summit Drive. Be ye Giles Field will be at the
end of Pat Head Summit Drive.
DIRECTIONS TO SKYHAWK FIELDDIRECTIONS TO SKYHAWK FIELD
The Skyhawk baseball team plays its home games at Skyhawk Field, a neatly constructed park on the southwest side of the UT Mar n campus. The present fi eld was completed in 1974, and has received numerous renova ons over the years, including an outdoor ba ng cage beyond the third base line. In 2005, an outdoor deck was added down the fi rst base line for fans. In 2008, new bleacher type sea ng was added, along with an inning-by-inning scoreboard. Lights were added in 2009, allowing the Skyhawks to play night games for the fi rst me. A fi eldhouse that provides full locker rooms, offi ce space and mee ng rooms among other things for both the Skyhawk baseball and so ball teams was erected in 2010 and opened during the early por on of the 2011 schedule. The fence was replaced during the 2017 season and the long- me iconic pine trees were cut down that year as well. A Skyhawk Park entry gate to welcome fans to both Skyhawk Field and Be ye Giles So ball Field has also been added on Pat Head Summit Drive. The dimensions of Skyhawk Field are 330 feet down the lines, 365 to the power alleys and 385 to straightaway center.
2018 UT MARTIN BASEBALL2018 UT MARTIN BASEBALL6
ROSTER / SQUAD BREAKDOWNROSTER / SQUAD BREAKDOWNNo. Name Posi on B/T Height Weight Class Hometown / Previous School 1 Billy Edwards IF S/R 5-8 165 Fr. Lakeland, Tenn. (Evangelical Chris an School) 3 Ben Asle IF L/R 5-11 180 Sr. Melbourne, Australia (Allen CC) 4 Blake Davis C R/R 6-0 195 Fr. Crandall, Ga. (North Murray HS) 6 Tyler Albright IF R/R 5-11 185 R-Sr. Algonquin, Ill. (Oakton CC) 7 Creighton Eldridge OF L/L 6-0 175 Sr. Mansfi eld, Texas. (McLennan CC) 8 David Hussey RHP R/R 6-2 180 So. Minter, Ala. (Lowndes Academy) 9 Jacob Jones RHP R/R 6-2 190 Fr. Bolivar, Tenn. (McNairy Central HS) 10 Collin Edwards OF R/R 6-2 225 R-Sr. Arnold, Mo. (Wabash Valley College) 11 Caleb Brewer IF/OF R/R 6-0 190 Sr. Hohenwald, Tenn. (Bethel University) 12 Robert Worley IF/RHP L/R 6-4 220 So. Hornbreak, Tenn. (Dyersburg HS) 13 Sam Folks LHP R/L 5-11 170 So. Franklin, Tenn. (Ba le Ground Academy) 14 JoJo Allen IF R/R 6-0 195 So. Clarksville, Tenn. (Kenwood HS) 15 Peyton Cain RHP R/R 6-1 190 Sr. Hickory, Miss. (East Central CC) 17 Casey Harford IF R/R 5-11 165 Fr. Cordova, Tenn. (Harding Academy) 18 Blake Williams UTIL R/R 5-10 180 R-Jr. Clarksville, Tenn. (Rossview HS) 19 Ethan Whitley IF R/R 6-1 210 Fr. Mason, Tenn. (Covington HS) 21 Carson Shrode C/OF R/R 6-2 210 R-Jr. Nashville, Tenn. (Christ Presbyterian Academy) 22 Winston Cannon RHP R/R 6-3 200 So. Cookeville, Tenn. (Upperman HS) 24 Aus n Buzick RHP R/R 6-2 230 Jr. Granite City, Ill. (Kaskaskia College) 28 Jordan Stoner OF R/R 5-10 170 Jr. Puyallup, Wash. (Tacoma CC) 29 Anthony Adduci C R/R 6-0 185 So. St. Charles, Ill. (St. Charles East HS) 30 Jonah Brody C R/R 5-9 185 R-Jr. Hoover, Ala. (Lawson State CC) 31 Dalton Wes all RHP R/R 6-6 225 R-Sr. Buckhannon, W.Va. (Potomac State College) 32 Dom Bazzani LHP L/L 6-4 225 R-Jr. Stockbridge, Ga. (Georgia Perimeter College) 33 Nick Wohlbold IF R/R 6-1 185 Fr. Columbia, Mo. (Rock Bridge HS) 34 Seth Rayburn RHP R/R 6-1 200 R-Jr. Vancouver, Wash (Mt. Hood CC) 35 Konnor Aherin LHP L/L 6-6 210 Sr. Chatham, Ill.. (Lincoln Land CC) 37 Micah Hagan OF R/R 5-9 180 Fr. Springfi eld, Tenn. (Jo Byrnes HS) 38 Brian Baxa RHP R/R 6-2 190 Fr. Danville, Ky. (Danville HS) 39 Jeff erey O’Doherty RHP R/R 6-4 245 So. Omaha, Neb. (Creighton Preparatory HS) 41 Tyler Borski LHP L/L 6-3 175 Sr. Riverton, Ill. (Lincoln Land CC) 42 Austen Bullington RHP R/R 6-2 190 Jr. Newburgh, Ind. (Wabash Valley College) 55 Zack Denney RHP R/R 6-2 185 R-Jr. Russelville, Ky. (Lincoln Trail CC)
25 Ryan Jenkins Interim Head Coach First Season Auburn, 2014 5 Geoff Murphy Assistant Coach Second Season Boston College, 2015 27 John O’Neil Assistant Coach First Season Colby-Sawyers College, 2008
PRONUNCIATION GUIDEPRONUNCIATION GUIDE
Number Pronuncia onNumber Pronuncia on
24 24 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Aus n Buse-ickAus n Buse-ick
29 29 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .Anthony Uhh-do-cheeAnthony Uhh-do-chee
32 32 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Dom Buzz-ahh-neeDom Buzz-ahh-nee
35 35 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Konnor Uhh-hair-inKonnor Uhh-hair-in
38 38 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .Brian Bax-uhBrian Bax-uh
41 41 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Tyler Boar-skiTyler Boar-ski
BREAKDOWN BY BATTING HANDBREAKDOWN BY BATTING HAND
Right (27): Adduci, Albright, Allen, Asle , Baxa, Brewer, Brody, Bullington, Buzick, Cain,
Cannon, Davis, Denney, C. Edwards, Folks, Hagan, Harford, Hussey, Jones, O’Doherty, Rayburn, Shrode, Stoner, Wes all, Whitley,
Williams, WohlboldLe (5): Aherin, Bazzani, Borski, Eldridge,
WorleySwitch (1): B. Edwards
BREAKDOWN BY THROWING HANDBREAKDOWN BY THROWING HAND
Right (28): Adduci, Albright, Allen, Asle , Baxa, Brewer, Brody, Bullington, Buzick,
Cain, Cannon, Davis, Denney, B. Edwards, C. Edwards, Hagan, Harford, Hussey, Jones,
O’Doherty, Rayburn, Shrode, Stoner, Wes all, Whitley, Williams, Wohlbold, Worley
Le (5): Aherin, Bazzani, Borski, Eldridge, Folks
BREAKDOWN BY CLASSBREAKDOWN BY CLASSSeniors (9): Aherin, Albright, Asle , Borski, Brewer, Cain, C. Edwards, Eldridge,
Wes allJuniors (8): Bazzani, Brody, Bullington, Denney, Rayburn, Shrode, Stoner, Williams
Sophomores (7): Adduci, Allen, Cannon, Folks, Hussey, O’Doherty, WorleyFreshmen (8): Baxa, Davis, B. Edwards, Hagan, Harford, Jones, Whitley, Wohlbold
2018 SKYHAWK BASEBALL2018 SKYHAWK BASEBALL 7
MEET THE SKYHAWKSMEET THE SKYHAWKS
2018 UT MARTIN BASEBALL2018 UT MARTIN BASEBALL8
RETURNER BIOSRETURNER BIOS#3 Ben Aslett#3 Ben Aslett
if if •• 5-11 5-11 •• 180 180 •• L/R L/R •• SR. SR. •• Melbourne, Australia Melbourne, Australia •• Allen CC Allen CC
2017Drew a star ng nod in 28 of 33 games played with 27 starts at third base…Sported a .303 ba ng average and .427 slugging percentage…Drove in four RBI’s against Eastern Illinois on May 5…Belted two home runs (Morehead State and Eastern Illinois)…Compiled a 14 game on base streak from April 25-May 18…Provided a good bat out of the bo om of the lineup as he fi lled in at the seven, eight and nine holes.
BEFORE UTMPlayed under head coach Clint Stoy for Allen Community College, located in Iola, Kan….Hit .322 with a .404 on-base percentage and a .539 slugging percentage in 55 games (53 starts) as a sophomore…Compiled eight doubles, two triples, nine
home runs, 47 RBI’s and 41 runs scored to go along with a team-high six stolen bases…Pieced together 13 mul -hit games, including a 5-for-5 performance (three doubles, career-high four runs scored, three RBI’s) against Butler Community College on Feb. 27…Accounted for a dozen mul -RBI eff orts, including career-highs of four RBI’s at Murray State College (Feb. 12) and at Neosho County Community College (April 2)…Played in 37 games (13 starts) as a freshman in 2015, hi ng .333 with three doubles, three triples and two homers…Reached base at a .449 clip and slugged .490, scoring 13 runs while driving in 12 runs…Was hit by a pitch a team-high 13 mes and was a perfect 7-of-7 in stolen base a empts…Was responsible for nine mul -hit games and had a three-RBI ou ng against Kansas City Kansas on April 21…Prepped at Lyndale Secondary College in Dandenong North, Victoria, Australia…Represented Australia in the Under-18 Baseball World Cup in Taichung, Taiwan…Won a Golden Glove at the Australian Baseball Academy.
PERSONALBorn on Aug. 29, 1995...Son of Steve and Sue Asle ...Majoring in sport management.
CAREER STATSCAREER STATS
2018 SKYHAWK BASEBALL2018 SKYHAWK BASEBALL 9
RETURNER BIOSRETURNER BIOS#6 Tyler albright#6 Tyler albright
if if •• 5-11 5-11 •• 185 185•• R/R R/R •• R-Sr. R-Sr. •• Algonquin, ill. Algonquin, ill. •• oakton CC oakton CC
2017Started in 51 of UT Mar n’s 55 games, all at second base…Swung one of the ho est bats on the team, by spor ng a .343 ba ng average to go along with 38 RBI’s…Recorded a .488 slugging percentage, good for third on the team...Drew 26 walks on the year while pacing the Skyhawks in on base percentage (.422)…Boasted a 21 game on base streak from April 1 to May 5…Tallied 22 mul ple hit games and nine mul ple RBI games on the year…Rapped out a personal-best fi ve hits and four RBI’s against Bethel University on March 7…Belted two home runs against Murray State on May 18 as UT Mar n beat the Racers 9-3…Was able to draw two walks in a game on six occasions…Recorded seven assists against Tennessee Tech on March 10...Earned a spot on the OVC Commissioner’s Honor Roll.
2016Played in three games before suff ering a season-ending injury that led to a medical redshirt…Earned a start at second base and made two assists defensively against Buff alo on Feb. 27…Also pinch-hit at Jackson State (Feb. 20) and came in as a defensive replacement at second base against Buff alo on Feb. 28.
BEFORE UTMPlayed at Oakton Community College in Des Plaines, Ill., where he was a 2015 third team NJCAA All-American under head coach Bill Fra o…Helped guide the Raiders to a 41-17 record (12-2 conference), a NJCAA Region IV Tournament appearance and a fi nal No. 19 na onal ranking in 2015…Played in a team-high 55 games as a sophomore, hi ng. 418 with team-highs of 194 at-bats, 52 runs scored, 81 hits, 20 walks and 25 stolen bases…Also added 12 doubles, two triples, a homer, 44 RBI’s, a .515 slugging percentage and a .466 on-base percentage…Struck out only 17 mes in 194 at-bats…Had 24 mul -hit performances, including 10 games with at least three base knocks...Went 5-for-5 with three runs scored and two RBI’s against Schenectady County on March 19…Was a 2014 second team All-Illinois Skyway Collegiate Conference honoree…Helped the Raiders to a na onal NJCAA Division-II ranking and a 30-23 overall record in 2014…Posted a .336 ba ng average with 10 doubles, 23 runs scored and 15 RBI’s in 45 games…Sported a .403 on-base percentage and slugged .414, swiping four stolen bases with six sacrifi ce hits…Had 12 mul -hit ou ngs with three 3-hit performances…Prepped at Huntley High School, playing for head coach Andy Jakubowski…Was a standout performer for the Red Raiders, hi ng .439 with 36 runs scored, 18 RBI’s and 13 stolen bases in 37 games as a senior…Earned Perfect Game Central Region honorable men on accolades in 2013.
PERSONALBorn on June 10, 1995…Son of Sco and Wendy Albright…Majoring in sports management.
CAREER STATSCAREER STATS
2018 UT MARTIN BASEBALL2018 UT MARTIN BASEBALL10
RETURNER BIOSRETURNER BIOS#7 Creighton Eldridge#7 Creighton Eldridge
OF OF •• 6-0 6-0•• 175 175 •• L/L L/L • • Sr. Sr. •• Mansfield, texas Mansfield, texas •• McLennan CC McLennan CC
2017Started in 50 games for the Skyhawks…Led the Ohio Valley Conference as well as the team in triples (6) and paced the Skyhawks in walks (29) while ranking second on the squad in slugging percentage (.548) and home runs (9)…Put together mul -homerun games on back-to-back occasions against Bethel (March 7) and Tennessee Tech (March 9)…Against Bethel he drove in a season-high six runs and the aforemen oned game against Tennessee Tech saw him move fi ve runners across the plate…Tallied a total of nine mul -RBI games…Compiled a 13-game hi ng streak from April 22-May 12, during that me he collected 11 RBIs and 18 runs scored to go along with four home runs…He also put together an 18-game on-base streak from April 18-May 14.
BEFORE UTMWas part of the highly successful McLennan Community College program located in Waco, Texas…Playing for head coach Mitch Thompson, he helped the Highlanders post an 86-32 record and make a pair of Region V Tournament appearances in his two seasons…Posted a .273 ba ng average in 40 games, compiling a .404 on-base percentage and a .500 slugging percentage as a sophomore…Scored 22 runs and collected 21 RBI’s while tying for the team lead with 11 stolen bases (in 12 a empts)…Upped his game against conference compe on, pos ng a slash line of .324/.435/.649 in 21 games…Best game of the season came on Feb. 13 against Midland College when he went 3-for-3 with fi ve RBI’s, two runs scored and a stolen base, fi nishing just a home run shy of hi ng for the cycle…Was a freshman on MCC’s 2015 squad that won the Region V championship for the fi rst me since 1987 before fi nishing in second place at the JUCO World Series…Appeared in 19 games as a true freshman, shaking off a slow start to hit .333 over the season’s fi nal two months…Prepped at Mansfi eld Summit High School, where he played for head coach Chris Peacock…Accumulated a .330 ba ng average with a .463 on-base percentage and a .586 slugging percentage as a senior, tallying 34 runs scored, 20 RBI’s and 16 stolen bases for the Jaguars…Earned All-District 15-4A honors as a junior.
PERSONALBorn on Dec. 18, 1995...Son of Mark and Charlyn Eldridge...Majoring in construc on management.
CAREER STATSCAREER STATS
2018 SKYHAWK BASEBALL2018 SKYHAWK BASEBALL 11
RETURNER BIOSRETURNER BIOS#10 Collin Edwards#10 Collin Edwards
OF OF •• 6-2 6-2 •• 225 225 •• R/R R/R • • R-R-SR. SR. •• Arnold, Mo Arnold, Mo •• Wabash Valley CollegeWabash Valley College
2017Appeared in 10 games for the Skyhawks while recording four scoreless ou ngs in relief…Fanned a total of nine ba ers in 10.2 innings of work on the campaign…Tallied two strikeouts against Buff alo (Feb. 17) and Chris an Brothers (April 19).
2016Began the season as an ou ielder before transi oning into a relief pitcher…Played in 25 games with 18 starts as a posi on player, hi ng .258 with three home runs, 12 RBI’s and 14 runs scored…Posted a .455 slugging percentage and a .390 on-base percentage…Accounted for four mul -hit eff orts and three mul -RBI ou ngs, including a career-high three hits and three RBI’s against Buff alo on Feb. 27…Also had three RBI’s in the fi rst game of a doubleheader while adding a career-high three runs scored in the backend of a doubleheader against Jackson State on Feb. 20…Made two relief appearances, striking out one ba er against Southeast Missouri (March 26) before tossing a shutout inning against Memphis on May 17.
BEFORE UTMA ended Wabash Valley College in Mount Carmel, Ill., where he played under head coach Rob Fournier and alongside current Skyhawk teammate Todd Goldberg…Redshirted in 2015 a er helping lead the Warriors to a 48-13 record as a freshman…Helped WVC fi nish eighth na onally in the NJCAA Division-I rankings a er an appearance in the Northern District championship game and winning a Great Rivers Athle c Conference championship…Hit .333 with three doubles, a home run, 11 RBI’s, a .476 on-base percentage and .515 slugging percentage to go along with a pair of stolen bases in 18 games (six starts) as a true freshman…Had a pair of mul -hit games and had two games with at least three RBI’s (including four RBI’s at Southeastern Illinois College on April 26)…Prepped at Seckman High School, where he was a three- me fi rst team all-conference honoree under head coach Brad Hagedorn…Helped lead the Jaguars to district championships in 2012 and 2013…Was 24-for-25 in stolen base a empts in his prep career…Was selected as one of 50 players to par cipate in the 2013 PNC Bank High School Baseball Showcase at Busch Stadium in St. Louis, Mo.
PERSONALBorn on Aug. 22, 1994…Son of Bill and Karen Edwards…Majoring in business management.
CAREER STATSCAREER STATS
2018 UT MARTIN BASEBALL2018 UT MARTIN BASEBALL12
RETURNER BIOSRETURNER BIOS#11 Caleb Brewer#11 Caleb Brewer
if/of if/of •• 6-0 6-0 •• 190 190 •• R/R R/R • • Sr. Sr. •• Hohenwald, tenn. Hohenwald, tenn. •• Bethel University Bethel University
2017Started in four games for the Skyhawks…Tallied an RBI against Bethel on March 7 while drawing two walks in the contest…Also picked up an RBI against Alabama A&M on May 3 in the 6-0 shutout over the Bulldogs.
BEFORE UTMTransferred to UT Mar n from nearby Bethel University in McKenzie, Tenn., where he played for head coach Rusty Thompson…Helped guide the Wildcats to a 28-21 record in 2016, star ng in 47 of his 48 games played…Hit .250 with a .358 on-base percentage, scoring 26 runs with 19 RBI’s…Successfully stole 10 bases in 13 a empts…Compiled six mul -hit games, including a 4-for-5 performance with three RBI’s and two runs scored against Blue Mountain on April 23…Tallied four
mul -RBI games, three of which were 3-RBI eff orts…Played in 19 games (14 starts) as a freshman, pos ng a .241 ba ng average with nine runs scored and fi ve RBI’s…Went off for fi ve hits (in six at-bats) to go along with two runs scored and an RBI against Middle Georgia State on March 27…Drove in a run in four consecu ve games from March 21-27…Prepped at Lewis County High School, where he was coached by Tim Tiller…Helped the Panthers claim a 24-9 record and make a Region 6-AA semifi nal appearance during his senior season.
PERSONALBorn on Sept. 1, 1995...Son of Robert and Regina Brewer...Majoring in educa on.
CAREER STATSCAREER STATS
2018 SKYHAWK BASEBALL2018 SKYHAWK BASEBALL 13
RETURNER BIOSRETURNER BIOS#12 Robert Worley#12 Robert Worley
if/rhp if/rhp •• 6-4 6-4 •• 220 220 •• L/R L/R •• So. So. •• Hornbeak, tenn. Hornbeak, tenn. •• Dyersburg HS Dyersburg HS
2017Appeared in 30 games while ge ng the star ng nod on 17 occasions…Tallied a career-high three hits against Arkansas-Pine Bluff (Feb. 24) and rapped his fi rst career home run the next day…Compiled two hits against both Tennessee Tech (March 10) and Eastern Kentucky (April 1).
BEFORE UTMWas a two-way star at Dyersburg High School, where he played for head coach Chris Messer…Was named a 2016 Southeast Region honorable men on honoree by Perfect Game…Ranked by Perfect Game as the 43rd best player in Tennessee, No. 3 fi rst baseman in Tennessee and the No. 98 fi rst baseman prospect in the country…Played in the fourth annual North Mississippi vs. West Tennessee All-Star Game in Millington in June 2016…Led the Trojan off ense in ba ng average (.361) and RBI’s (32) while pacing the DHS pitching staff in wins (fi ve) as a junior…Made 11 appearances on the mound as a junior, accumula ng 46 strikeouts to go along with a 3.08 ERA…Earned all-district honors during both his junior and sophomore campaigns…Earned a spot in the 2015 Tennessee Baseball Coaches Associa on Showcase Classic…Was named a 2015 Perfect Game honorable men on All-American…Was an all-state honoree and a Tennessee Coach’s “Super Sophomore” in 2014.
PERSONALBorn on July 5, 1998...Son of Chad and Kim Worley...Majoring in mechanical engineering.
CAREER STATSCAREER STATS
2018 UT MARTIN BASEBALL2018 UT MARTIN BASEBALL14
RETURNER BIOSRETURNER BIOS#13 Sam Folks#13 Sam Folks
Lhp Lhp •• 5-11 5-11 •• 170 170 •• R/L R/L • • So. So. •• Franklin, Tenn. Franklin, Tenn. •• Battleground Academy Battleground Academy
2017Appeared in 15 games while star ng in three matchups…Wrung up 35 ba ers in 36.2 innings of work on the year…Earned the star ng nod against Alabama A&M on April 26, as he tossed six innings and fanned seven ba ers in the process while allowing only one earned run in the 12-2 victory.
BEFORE UTMPitched for head coach Jonathan Hacke at Ba le Ground Academy, where he was a 2016 Perfect Game Southeast Region honorable men on performer…Rated as the No. 41 overall pitching prospect and No. 5 le -handed pitcher in the state of Tennessee by Perfect Game…Tossed a complete game against Friendship Chris an in the opening round of the East-Middle Region tournament, striking
out 13 ba ers with just two walks in a 5-2 win…Went the distance against Ezell-Harding on April 18, snapping their district undefeated streak by going seven shutout innings, allowing four hits with fi ve strikeouts…Was part of the fi h annual MidTN Senior All-Star Classic in June 2016…Garnered all-state honors and all-district accolades for the second straight season in 2015, helping the Wildcats to a 17-10 overall record…Was part of a BGA squad who won district and regional championships in 2014, the same season he was named Region MVP.
PERSONALBorn on March 25, 1997...Son of Sco and Tammy Folks...…Grandfather Charles Folks played baseball at UT Mar n from 1957-59...Majoring in sports business.
CAREER STATSCAREER STATS
2018 SKYHAWK BASEBALL2018 SKYHAWK BASEBALL 15
RETURNER BIOSRETURNER BIOS#14 JoJo Allen#14 JoJo Allen
If If •• 6-0 6-0 •• 195 195 •• R/R R/R • • So. So. •• Clarksville, Tenn. Clarksville, Tenn. •• Kenwood HS Kenwood HS
2017Started in 11 games for the Skyhawks with one of those coming against Vanderbilt on April 4…Tallied 11 hits with a game-high two hits off of Bethel on March 7…Recorded three doubles on the season with one coming against Eastern Illinois on May 6 as the Skyhawks beat the Panthers 15-3.
BEFORE UTMWas a 2016 Perfect Game honorable men on All-American while playing for head coach Charles Ratliff at Kenwood High School…Was ranked by Perfect Game as the No. 18 ranked player in the state of Tennessee, the No. 3 shortstop in Tennessee, the No. 115 shortstop prospect in the na on and a top-500 overall player in the na on…Also earned Perfect Game honorable men on All-American accolades a er the 2015 season…Tabbed as the 21st best player in the state of Tennessee by Prep Baseball Report and was selected to par cipate in the 2015 Prep Baseball Report Preseason All-State Showcase…Earned District 10-AAA all-tournament accolades as a junior…Spent two fall seasons playing for the pres gious Royals Scout Team.
PERSONALBorn on March 26, 1998...Son of Joe Allen III and Shantay Smith-Allen...Majoring in business and sports marke ng management.
CAREER STATSCAREER STATS
2018 UT MARTIN BASEBALL2018 UT MARTIN BASEBALL16
RETURNER BIOSRETURNER BIOS#15 Peyton Cain#15 Peyton Cain
RHP RHP •• 6-1 6-1 •• 190 190 •• R/R R/R • • SR. SR. •• Hickory, Miss. Hickory, Miss.•• East Central CC East Central CC
2017Started 10 games on the rubber with a team third-best 5.45 ERA…Made 22 appearances, enough for second place among Skyhawk pitchers…Struck out 48 ba ers in 72.2 innings…Fanned six Tennessee Tech batsmen on March 10 for a personal best in strikeouts…Recorded one win and one save on the year…Tossed six or more innings fi ve mes over the season...Earned a spot on the OVC Commissioner’s Honor Roll.
BEFORE UTMA ended East Central Community College in Decatur, Miss., where he helped guide the Warriors to a 38-17 record, a state championship and No. 10 na onal ranking under head coach Neal Holliman in 2016…Was a second team MACJC
all-state honoree a er racking up a 10-2 record as a sophomore, logging team-highs in games started (14), innings pitched (72.1), complete games (two) and shutouts (one)…His 10 wins ranked sixth na onally while his 14 games started was the fi h-highest total in the country…Compiled a 4.73 ERA over 18 appearances, striking out 42 ba ers…Best game came on May 19 against Northwest Mississippi, as he hurled a complete game with just one earned run allowed on six hits…Helped the Warriors post a 26-18 record in 2015, appearing in 13 games (one start) while pos ng a 3.58 ERA as a freshman…Went mul ple innings in fi ve appearances, including a career-high four innings twice…Began the season with no earned runs allowed in 12.1 innings over his fi rst fi ve appearances…Prepped at Newton County High School, where he played for head coach Wya Tullos…Helped lead the Cougars to the Class 4A playoff s during his senior season…Earned a spot on the 41st Annual DM Howie High School All-Star Game following his senior campaign…Also helped NCHS to 31 wins and a deep 4A state playoff run as a junior…Pitched a one-hi er with 11 strikeouts while also tallying three hits and three RBI’s in a shutout win over Enterprise Clarke during his junior season.
PERSONALBorn on Oct. 4, 1995...Son of Jason and Anna Cain...Majoring in business marke ng.
CAREER STATSCAREER STATS
2018 SKYHAWK BASEBALL2018 SKYHAWK BASEBALL 17
RETURNER BIOSRETURNER BIOS#18 Blake Wiliams#18 Blake Wiliams
UTIL UTIL •• 5-10 5-10 •• 180 180 •• R/R R/R • • R-R-JR. JR. •• Clarksville, Tenn. Clarksville, Tenn. •• Rossview HS Rossview HS
2017Did not see game ac on due to injury...Earned a spot on the OVC Commissioner’s Honor Roll.
2016Hit .400 in fi ve at-bats spanning over four games, three of which came as a pinch hi er…Tallied a base hit and an ou ield assist against Union on April 12…Also accounted for a hit against Eastern Illinois on May 13…Was named to the OVC Commissioner’s Honor Roll.
2015Redshirted.
BEFORE UTMWas part of the highly successful Rossview High School program under head coach Jason Rice…Williams helped lead the Hawks to the program’s fi rst-ever regional championship as a senior, reaching the Class AAA sec onal for the fourth consecu ve year…Also helped Rossview win three straight District 10 regular season and tournament championships from 2011-13.
PERSONALBorn on Dec. 17, 1995…Son of Roger and Dawn Williams…Majoring in health and human performance.
CAREER STATSCAREER STATS
2018 UT MARTIN BASEBALL2018 UT MARTIN BASEBALL18
RETURNER BIOSRETURNER BIOS#21 Carson Shrode#21 Carson Shrode
C/OF C/OF •• 6-2 6-2 •• 210 210 •• R/R R/R • • R-R-Jr. Jr. •• Nashville, Tenn. Nashville, Tenn. •• Christ Presbyterian Acade- Christ Presbyterian Acade-
2017Appeared in 16 games while ge ng the star ng nod against Vanderbilt (April 4) and Alabama A&M (May 3)...Scored a run apiece against Belmont (March 25) and Jacksonville State (May 14)…Drew a walk against Aus n Peay on April 28...Earned a spot on the OVC Commissioner’s Honor Roll.
2016Appeared in seven games off the bench as a pinch hi er…Collected an RBI double against Alabama A&M on May 10…Was hit by a pitch and scored a run in his collegiate debut against Buff alo on Feb. 28…Drew a walk against Evansville on March 8…Was named to the OVC Commissioner’s Honor Roll.
2015Redshirted.
BEFORE UTMWas a standout catcher and ou ielder for head coach Larry Nesbi at Christ Presbyterian Academy…Graduated as the program’s all- me leader in hits (156), doubles (52), home runs (12) and RBI’s (112) while ranking second in career runs scored (104)…Helped lead the Lions to a 27-13 record in 2014, winning the district, regional and sec onal championships…Was a career .371 hi er with a .464 on-base percentage and .612 slugging percentage in high school…Also posted a 1.89 ERA with 100 strikeouts in 107 career innings at the prep ranks…Earned the mound victory (six strikeouts, two hits allowed in fi ve innings) and tallied the game-winning hit to snap Summertown High School’s 23-game winning streak during his senior season…Earned TBCA Region 5/6 team honors a er hi ng a team-high 15 doubles with a .430 ba ng average during a 28-13 season in 2013…Was named a “Player to Watch” by Tennessee Baseball Report a er an impressive showing in the TopTenn Baseball Super Select Showcase Camp in Feb. 2013…Crushed a three-run homer in the Third Annual MidTN Class AA vs. Class A Senior All-Star Classic at Cumberland on June 7, 2014.
PERSONALBorn on July 13, 1995…Son of Daniel and Charmy Shrode…Has one older sibling, Chandler…Married to the former Madeline Williams of UT Mar n’s equestrian team...Majoring in business management.
CAREER STATSCAREER STATS
2018 SKYHAWK BASEBALL2018 SKYHAWK BASEBALL 19
RETURNER BIOSRETURNER BIOS#22 Winston Cannon#22 Winston Cannon
RHP • 6-3 • 200 • R/R • So. • Cookeville, Tenn. • Upperman HSRHP • 6-3 • 200 • R/R • So. • Cookeville, Tenn. • Upperman HS
2017Got the star ng nod in 10 games for the Skyhawks, ranking second on the team with fi ve victories as a true freshman…Tossed 59 innings with 47 strikeouts on the year…His best ou ng came on April 7 against Morehead State as he threw seven shutout innings and fanned fi ve ba ers in a narrow 1-0 victory over the Eagles…Went six or more innings on four occasions...Earned a spot on the OVC Commissioner’s Honor Roll.
BEFORE UTMEmerged as a staff ace for head coach Brian Johnson at Upperman High School, establishing new school records for shutouts (nine), innings pitched (204.1) and strikeouts (368)…Helped the Bees to a 28-9 record in 2016, earning Tennessee Sports Writers Associa on all-state fi rst team honors and Tennessee Baseball Report all-state fi rst team accolades…Posted a 0.80 ERA with 135 strikeouts and 11 walks in 69.2 innings of work as a senior…Also excelled at the plate, racking up Region 4 Hi er of the Year and a spot on the Region 4 All Two-Way Team…Tossed a complete game (fi ve hits allowed, nine strikeouts, no walks) in a District 8AA win over Livingston Academy on April 26…Was part of the fi h annual MidTN Senior All-Star Classic in June 2016…Was iden fi ed by Perfect Game as the No. 30 overall pitching prospect and the 12th-best right-handed pitcher in the state of Tennessee…Established the UHS school record for lowest ERA in a single season, conceding just two earned runs in 56.1 innings for a miniscule 0.25 ERA as a junior…Fanned 106 ba ers against only 12 walks in 2015, earning all-state, all-region and District 8-AA Pitcher of the Year honors…Was a 2015 Perfect Game honorable men on All-American…Struck out 18 ba ers in a game last year against York Ins tute…Was an all-region and all-district honoree in 2014, pos ng a 1.19 ERA with 84 strikeouts and only 16 walks in 41.1 frames…Established himself as a clutch performer as a freshman, as he was the winning pitcher for the Bees in the Region 4AA championship game...Tallied 42 strikeouts and a 3.65 ERA in 36 innings as a freshman.
PERSONALBorn on Oct. 17, 1997...Son of Jim and Sandi Cannon...Majoring in accoun ng.
CAREER STATSCAREER STATS
2018 UT MARTIN BASEBALL2018 UT MARTIN BASEBALL20
RETURNER BIOSRETURNER BIOS#29 Anthony Adduci#29 Anthony Adduci
C C •• 6-0 6-0 •• 185 185 •• R/R R/R • • so. so. •• St. Charles, Ill. St. Charles, Ill. •• St. Charles East HS St. Charles East HS
2017Started in 22 games for the Skyhawks…Sported at 10-game hit streak between March 7-26…Collected a personal-high two hits on three occasions (Buff alo, Evansville and Alabama A&M)…Drove in 18 RBIs on the year with a game high of four coming in a road game at Evansville on March 21 as the UT Mar n beat the Purple Aces 12-4…Also drove in three RBIs against Alabama A&M on April 26 in the 12-2 rout...Earned a spot on the OVC Commissioner’s Honor Roll.
BEFORE UTMWas a durable backstop at St. Charles East High School, where he played under head coach Len Asquini…Selected as the 104th best overall player and the No. 19 catching prospect in the state of Illinois by Perfect Game…Helped St. Charles
East go 23-15 during his senior campaign, as the Saints won its fi rst regional tle since 2013…One of best games in 2016 came against Streamwood on May 4, driving in four runs in a fi ve-inning, 11-1 win…Caught a complete game three-hi er in the Saints’ Class 4A Regional semifi nals…Was an all-area and All-Upstate Eight Conference River Division honoree as a junior, helping the Saints post a 22-9 record…Hit .364 with nine doubles and 18 RBI’s as a junior, striking out just three mes in 120 at-bats in 2015.
PERSONALBorn on Aug. 1, 1997...Son of Joe and Jill Adduci...Majoring in mechanical engineering.
CAREER STATSCAREER STATS
2018 SKYHAWK BASEBALL2018 SKYHAWK BASEBALL 21
Returner biosReturner bios#30 Jonah Brody#30 Jonah Brody
c c •• 5-9 5-9 •• 185 185 •• R/R R/R • • R-Jr. R-Jr. •• Hoover, Ala. Hoover, Ala. •• Lawson State cc Lawson State cc
2017Did not see game ac on due to injury.
BEFORE UTMSpent his freshman season playing for head coach Blake Lewis at Lawson State Community College, located in Birmingham, Ala….Posted a .316 ba ng average with nine runs scored, seven RBI’s and a .443 on-base percentage over 25 games for a team that went 29-22 in 2016…Hit safely in 13 games, including a career-best 3-for-3 eff ort with two RBI’s and a run scored against Southern Union State on April 30…Ripped a pair of doubles and had two RBI’s against LaGrange College on March 9…Prepped at Hoover High School, where he played for head coach Adam Moseley…Helped the Buccaneers go 30-14 and make a 7A playoff appearance as a senior, hi ng .375 with eight doubles and 15 RBI’s in 28 games.
PERSONALBorn on Dec. 2, 1996...Son of David and Laura Brody...Majoring in history and poli cal science.
2018 UT MARTIN BASEBALL2018 UT MARTIN BASEBALL22
Returner biosReturner bios#31 Dalton Westfall#31 Dalton Westfall
RHP RHP •• 6-6 6-6 •• 225 225 •• r/R r/R • • R-SR. R-SR. •• Buckhannon, W.va. Buckhannon, W.va. •• Potomac State Col- Potomac State Col-
2017Ranked in the Top-10 in the OVC in innings pitched (80.2), strikeouts (81) and opponent ba ng average (.261)...Paced the OVC in least doubles allowed (6) and least home runs allowed (2)...Led the Skyhawks in innings pitched , strikeouts, games started (14) and opponent ba ng average…Fanned a season-high 15 ba ers (most for the program since 2003 and ranked in the top-fi ve all- me in a single game) in the 14-0 rout of Buff alo (Feb. 18) and recorded 12 strikeouts just one week later against Arkansas-Pine Bluff (Feb. 25)…His 11 strikeout performance against SIUE was one of the best by any pitcher on the staff in conference play… Allowed zero earned runs three mes, all coming when he recorded double-digit strikeouts…Pitched six or more innings on 10 occasions with six quality starts in the mix…Gave up a paltry eight extra base hits over the course of the season...Was named OVC Pitcher of the Week on two diff erent occasions (Feb. 27 and
April 24)...Earned a spot on the OVC Commissioner’s Honor Roll.
2016Was one of the team’s best hurlers before a season-ending injury limited him to just four appearances (three starts) as a medical redshirt…Went 2-1 with a 4.32 ERA, fanning 13 ba ers while allowing just 11 hits in 16.2 innings…Won his collegiate debut with seven innings of two hits and two runs with seven strikeouts at Jackson State on Feb. 20…Also won his start against IPFW on March 6…Held right-handed ba ers to a paltry .118 ba ng average (4-of-34) while also excelling with runners on base (.167, 5-of-30).
BEFORE UTMPlayed for head coach Doug Li le and alongside former Skyhawk teammate Daniel Kerwin at Potomac State College in Keyser, W.Va.…Helped the Catamounts to a 37-10 record, a Region XX championship and an Eastern District runner-up fi nish in 2015…Went 5-2 with a 4.01 ERA in 13 appearances (11 starts) as a sophomore, striking out 51 ba ers and allowing 54 hits over 60.2 innings…Allowed two or fewer earned runs in nine ou ngs…Tossed seven innings in four starts, including his best ou ng of the season (seven shutout innings, fi ve hits, season-best nine strikeouts against Harford on May 10)…Helped PSC post a 38-13-1 record and runner-up fi nish in Region XX play during his freshman campaign…Led PSC in appearances (14), games started (12), wins (seven), complete games (four) and innings pitched (65) in 2014…Posted a 7-3 record with a 4.15 ERA, allowing only 61 hits to go along with 47 strikeouts…Conceded two or fewer earned runs in nine appearances…Went the distance in back-to-back starts (nine innings, four hits, two runs at Hagerstown Community College on May 3; nine innings, nine hits, one run against Chesapeake College on May 9) late in the season…Prepped at Buckhannon-Upshur High School under head coach Adam Squires…Was a two- me all-state special men on selec on (2012-13) and was named all-conference in back-to-back years (fi rst team in 2013, second team in 2012) for the Buccaneers.
PERSONALBorn on Jan. 19, 1995…Son of Mark and Teresa Wes all…Majoring in psychology.
CAREER STATSCAREER STATS
2018 SKYHAWK BASEBALL2018 SKYHAWK BASEBALL 23
Returner biosReturner bios#32 Dom Bazzani#32 Dom Bazzani
LHP LHP •• 6-4 6-4 •• 225 225 •• l/l l/l • • R-JR. R-JR. •• Stockbridge, Ga. Stockbridge, Ga. •• Georgia Perimeter Col- Georgia Perimeter Col-
2017Started six games on the mound before suff ering a season ending injury…Struck out 24 opponents over 23 innings of work…His strongest appearance came against Presbyterian as he went eight innings and eight strikeouts, allowing only two runs.
2016Stepped in and immediately became one of the leaders of the pitching staff as a redshirt freshman, ranking 10th in the OVC in innings pitched (81.0)…Made a team-high 14 starts while making 15 overall appearances, going 2-10 with one save and a 6.67 ERA…Also led the team with 71 strikeouts, the fi h-highest single-season tally in program history…Went at least six innings in eight of his starts, including a career-high 8.2 innings against IPFW on March 5…Boasted eight games with three or fewer earned runs allowed…Fanned at least fi ve ba ers in seven appearances, including a career-best nine punchouts in 7.2 innings against SIUE on April 30…Led the team in opponent ba ng average against le -handed hi ers (.250, 28-for-112).
BEFORE UTMSpent a year under head coach Jeremy Brotherton at Georgia Perimeter College but did not play, redshir ng while rehabbing a torn ACL he suff ered in the fall of 2014…Was teammates with current Skyhawk Shane Seckinger at GPC…Prep career was spent playing for head coach Jason Borcherding at Heritage High School, where the Patriots won 18 games and made an appearance in the Class AAAAA state playoff s in 2014…Earned second team all-region honors as both a pitcher and an infi elder and was named an all-area fi rst team honoree a er pos ng a .407 on-base percentage and a team-high 25 RBI’s…Had mul ple dominant eff orts on the mound, including a complete game, 10-strikeout, one earned run performance against Winder-Barrow during his senior year…Also fanned nine ba ers and allowed only one run over four innings against Rockdale County in his senior campaign.
PERSONALBorn on Dec. 20, 1995…Son of Tony and Lori Bazzani…Has a brother, Anthony, who played for fellow Ohio Valley Conference school Eastern Kentucky from 2010-13 and pitched in the Arizona Diamondbacks organiza on…Majoring in health and human performance.
CAREER STATSCAREER STATS
2018 UT MARTIN BASEBALL2018 UT MARTIN BASEBALL24
Returner biosReturner bios#34 Seth Rayburn#34 Seth Rayburn
RHP RHP •• 6-1 6-1 •• 200 200 •• r/R r/R •• R-JR. R-JR. •• Vancouver, Wash. Vancouver, Wash. •• Mt. Hood CC Mt. Hood CC
2017Did not see game ac on due to injury.
BEFORE UTMWas part of a successful run at Mt. Hood Community College, which is located in Gresham, Oregon…Playing for head coach Bryan Donohue, he was part of a Saints squad that went 26-19 and won the 2016 Southern Region championship…Posted a 6-3 record with a 2.46 ERA in 12 appearances (11 starts), walking only 16 ba ers in 73 innings…Tossed three complete games, including nine-inning performances against Clackamas on April 23 and at Southwest Oregon on May 13, not conceding an earned run in either appearance…Struck out a season-high 11 ba ers with zero walks in the aforemen oned game at SWOCC…Piled up
eight shutout frames at Linn-Benton on April 8…Went 5-4 with a 2.77 ERA in 13 appearances (12 starts) as a freshman for a team that racked up a 35-14 record…Allowed just 79 hits and 11 walks while fanning 60 ba ers in 90.2 innings…Went the distance in fi ve games, including a stretch where he pitched the full nine innings in three straight starts from April 4-17…Dialed up 11 strikeouts in nine innings in the win over Southwest Oregon on April 17…Prepped at Columbia River High School, where he went 19-2 in his career under head coach Stephen Donohue…Went 7-1 with a microscopic 0.20 ERA (one earned run in 46 innings) to go along with 43 strikeouts…Two of his wins came in the 2014 postseason, as he anchored the Chie ans to the Class 3A state tournament quarterfi nals…Was named the Columbian All-Region Player of the Year and to the Washington State Baseball Coaches Associa on Class 3A all-state second team as a senior…Started his sophomore season with an 8-0 record to help Columbia River make a deep postseason run.
PERSONALBorn on March 16, 1996...Son of Tony and Jodi Rayburn...Majoring in natural resources and park administra on.
2018 SKYHAWK BASEBALL2018 SKYHAWK BASEBALL 25
Returner biosReturner bios#35 Konnor Aherin#35 Konnor Aherin
LHP LHP •• 6-6 6-6 •• 210 210 •• L/L L/L • • SR. SR. •• Chatham, Ill. Chatham, Ill. •• Lincoln Land CC Lincoln Land CC
2017Appeared in eight games for UT Mar n…Struck out seven ba ers in 7.2 innings of work…Fanned three Southeast Missouri batsmen on March 17 in two innings pitched.
BEFORE UTMPitched for head coach Ron Riggle at Lincoln Land Community College in Springfi eld, Ill.…Helped guide Lincoln Land to a 39-20 record (23-9 in conference play) in 2016…Went 1-0 with a 3.98 ERA in six appearances (four starts)…Compiled a remarkable 24:4 strikeout-to-walk ra o in 20.1 innings of work…Threw 7.2 innings of two-run ball in a win at Parkland on April 9, allowing only six hits while fanning nine ba ers against one walk…Posted a 4-3 record with a 3.23 ERA in 12 appearances (six starts) as a freshman, helping the Loggers to a 42-16 overall record their second consecu ve berth in the NJCAA Division-II World Series…Allowed only six extra-base hits (zero home runs) in 47.1 innings of work…Best game of the season came on April 21 at Parkland, when he allowed only one run over 8.1 innings…A ended Chatham Glenwood High School, where he tallied a 4-2 record with a 2.79 ERA while dialing up 40 strikeouts as a senior…Was a Central State Eight all-conference selec on during both his senior and junior years, earning Illinois Class 3A all-state accolades in 2013.
PERSONALBorn on April 25, 1996...Son of Kevin and Marci Aherin...Majoring in business management.
CAREER STATSCAREER STATS
2018 UT MARTIN BASEBALL2018 UT MARTIN BASEBALL26
Returner biosReturner bios#41 Tyler Borski#41 Tyler Borski
lhp lhp •• 6-3 6-3 •• 175 175 •• L/l L/l • • SR. SR. •• Riverton, Ill. Riverton, Ill. •• Lincoln Land CC Lincoln Land CC
2017Fanned 11 ba ers in 8.1 innings of work…Posted two shutout innings of relief against Tennessee Tech on March 9 with one strikeout in the process…Put up a team best 0.00 ERA in conference play as the righty tossed 2.2 innings of shutout baseball with three strikeouts along the way...Earned a spot on the OVC Commissioner’s Honor Roll.
BEFORE UTMPlayed under head coach Ron Riggle at Lincoln Land Community College in Springfi eld, Ill.…Helped Lincoln Land post a 39-20 record (23-9 in conference play) as a two-way player in 2016…Went 3-1 with a team-best 2.42 ERA in six appearances (fi ve starts), allowing only 17 hits while striking out 17 ba ers in
22.1 innings of work…Allowed just one earned run all six appearances…Allowed only two hits in fi ve innings against Lewis and Clark on March 20…Dialed up a season-best six strikeouts (in 2.2 innings) at Southeastern on March 7…Hit .280 with 15 doubles, 59 runs scored, 24 RBI’s and a .412 on-base percentage in 55 games...Pieced together 15 mul -hit games (including a trio of 3-hit games)…Scored at least two runs on 14 diff erent occasions, including a season-best four runs scored at Lincoln on April 3…Drove in a season-high three runs in wins at Webber Interna onal (March 12) and at Parkland (April 9)…Drew four walks in two diff erent contests…Was a member of the 2015 Loggers squad who went 42-16 overall while making their second straight trip to the NJCAA Division-II World Series…Made four starts on the season, tossing a season-high 4.2 innings against Kalamazoo Valley on March 13…Was an integral part of the 2014 LLCC team who went 44-17 and fi nished ninth at the NJCAA Tournament, earning Region 24 Tournament Most Valuable Player honors…Was responsible for a 4-2 record with a 4.38 ERA and a save in 11 appearances, fi ve of which were starts...Piled up 40 strikeouts while only divvying out 15 walks with 31 hits allowed in 39 innings…Best game on the mound came on May 18 at Heartland, when he went the distance, allowing one earned run on four hits with 12 strikeouts in nine innings…Amassed a .336 ba ng average with 38 runs scored, 16 RBI’s and a .455 on-base percentage in 58 games…Led the team with 19 stolen bases while he was only caught stealing four mes…Boasted 13 mul -hit games, which included four 3-hit games and a 4-hit ou ng (at Webber Interna onal on March 10)…A ended Riverton High School, where he played for head coaches Bo Gum and Kurt Cuffl e…Earned all-state accolades during his senior campaign and was a three- me All-Sangamon Conference fi rst team honoree…Helped direct the Hawks to a 24-10 record in 2012, reaching the Class 2A Athens Regional championship game.
PERSONALBorn on July 30, 1995...Son of Jeff Borski and Ron and Lisa Atkins...Majoring in civil engineering.
CAREER STATSCAREER STATS
2018 SKYHAWK BASEBALL2018 SKYHAWK BASEBALL 27
Returner biosReturner bios#55 Zack Denney#55 Zack Denney
RHP RHP •• 6-2 6-2 •• 185 185 •• R/R R/R • • R-JR. R-JR. •• Russellville, Ky. Russellville, Ky. •• Lincoln Trail CC Lincoln Trail CC
2017Did not see game ac on due to injury.
BEFORE UTMComes to UT Mar n from Lincoln Trail College, located in Robinson, Ill….Playing for head coach Kevin Bowers, he made 17 appearances (three starts) in 2016, pos ng a 4.73 ERA while striking out 28 ba ers in 40 innings of work…Accounted for a 2.21 ERA in 20.1 innings over his last 11 appearances of the season…Picked up the win in a dominant performance against Shawnee on April 1, throwing a season-high fi ve shutout innings, allowing just one hit and one walk while fanning fi ve ba ers…Struck out a season-best six ba ers over 5.2 innings against Iowa Central on March 3 and also dialed up fi ve strikeouts (in only two innings) at Rose Hulman on May 2…Helped the Statesmen post a 28-24 record with a 16-8 conference mark in 2015…Tied for the team lead with two saves while adding one win in six appearances (three starts) as a freshman…Received the win a er going a season-high fi ve innings with only two runs allowed against Southeastern Illinois on March 9…Conceded just one run on three hits in four innings of relief against Rend Lake on March 14…Prepped at Russellville High School under the direc on of head coaches Greg Shelton and Lou Kendall…Had a memorable game against Butler County during his senior year, striking out 12 ba ers in a complete game three-hi er while also homering at the plate…Went 4-for-4 with a pair of doubles against na onally ranked top-10 team and defending Ohio state champion Reynoldsburg in the Florida Beach Bash during his junior season…Hurled a pair of complete games in a one-week span in 2013, throwing a two-hi er against Todd Central before defea ng Owensboro Senior…Helped the Panthers to a 29-10 overall record in 2012.
PERSONALBorn on June 3, 1996...Son of Angela and Dale Brooks...Majoring in health and human performance.
2018 UT MARTIN BASEBALL2018 UT MARTIN BASEBALL28
newcomer biosnewcomer bios#1 Billy Edwards#1 Billy Edwards
IF IF •• 5-8 5-8 •• 165 165 •• s/r s/r • • FR. FR. •• Lakeland, Tenn. Lakeland, Tenn. •• Evangelical Christian School Evangelical Christian School
BEFORE UTMShowed his versa lity defensively as he was called upon to play mul ple posi ons at Evangelical Chris an School while also being able to hit from both sides of the plate…Spent me playing shortstop, second base, and third base with the Eagles as the UT Mar n coaching staff hopes to capitalize on that versa lity.
PERSONALBorn on June 8, 1998…Son of Bill and Lisa Edwards…Has two siblings, Kris and Ka e…Majoring in accoun ng.
#4 Blake Davis#4 Blake DavisC C •• 6-0 6-0 •• 195 195 •• R/R R/R • • fR. fR. •• Crandall, Ga. Crandall, Ga. •• North Murray HS North Murray HS
BEFORE UTMServed as a talented pitcher and backstop while under the guidance of head coach Preston Doag at North Murray High School…Tallied a 6-1 record on the mound with a 1.54 ERA as well as pos ng a .343 ba ng average, seven home runs, 10 doubles and 31 RBI’s as a Mountaineer…Pitched a no hi er in the fi rst round of the state playoff s…Garnered First Team all-state, all-area and all-region in 2017 while also being named to the First Team Cha anooga Times Free Press…Other accolades include being name First Team All-Region and Second Team All-State in 2016 as well as First Team All-Area and First Team All-Region in 2015.
PERSONALBorn on Oct. 10, 1998…Son of Michael and Chris na Davis…Majoring in physical educa on.
2018 SKYHAWK BASEBALL2018 SKYHAWK BASEBALL 29
newcomer biosnewcomer bios#8 David Hussey#8 David Hussey
RHP RHP •• 6-2 6-2 •• 180 180 •• R/R R/R • • So. So. •• Minter, Ala. Minter, Ala. •• Georgia Highlands College Georgia Highlands College
BEFORE UTMHelped guide Georgia Highlands College to a GCAA Championship in 2017 while under the tutelage of Dash O’Neil…Garnered 2016 All-State Team honors for football, basketball and baseball while at Lowndes Academy…Won the 2016 State Championships in the high jump…Was a member of a Rebel baseball squad that was two- me State Runner Up (2013 and 2016).
PERSONALBorn on Feb. 19, 1998…Son of Russ and Robin Hussey…Has three siblings, Paige, Laiken and Clayton…Grandfather Rusty Hussey played baseball at Florida State…Majoring in interdisciplinary studies.
#9 Jacob Jones#9 Jacob JonesRHP RHP •• 6-2 6-2 •• 190 190 •• R/R R/R • • fR. fR. •• Bolivar, tenn. Bolivar, tenn. •• McNairy Central HS McNairy Central HS
BEFORE UTMWas the leader of the McNairy Central High School pitching staff for head coach Brian Franks…Received team accolades such as the Bobcat Award and also the Perfect Game Award…Held hi ers to a .229 average, notching 101 strikeouts in 25 career appearances for the Bobcats.
PERSONALBorn on Nov. 1, 1998…Son of Tim and Angela Jones…Has one sister, Anna…Majoring in interdisciplinary studies.
2018 UT MARTIN BASEBALL2018 UT MARTIN BASEBALL30
newcomer biosnewcomer bios#17 Casey Harford#17 Casey Harford
IF IF •• 5-11 5-11 •• 165 165 •• R/r R/r • • fR. fR. •• Cordova, Tenn. Cordova, Tenn. •• Harding Academy Harding Academy
BEFORE UTMAccumulated many awards during his me with Harding Academy Lions, including 2016 TSSAA second team all-state…Won team awards such as the 2016 Gold Glove Award and 2016 Best Defensive Player at Harding Academy…Was chosen for the TSSAA all-district team, All-Region Team for Region 8, and the 2015 Best of Preps All-Metro Team.
PERSONALBorn on Sept. 5, 1998…Son of Bruce and Jamie Harford…Has one brother, Ma …Majoring in health and human performance.
#19 Ethan Whitley#19 Ethan WhitleyIF IF •• 6-1 6-1 •• 210 210 •• R/R R/R • • fR. fR. •• Mason, Tenn. Mason, Tenn. •• Covington HS Covington HS
BEFORE UTMWas named a 2017 Collegiate Baseball Newspaper High School All-American, prepping under head coach David Sage at Covington High School...Helped lead the 2017 Chargers to a 33-9 record as well as the school’s fi rst state tournament appearance since 2012...Was also a fi nalist for The Commercial Appeal Sports Awards for the Greater Memphis High School area...His strong senior campaign led to a spot in the West Tennessee/North Mississippi All-Star Game, which was played at USA Stadium in Millington (he tallied MVP accolades for the West Tennessee squad)...Compiled four consecu ve 15AA First Team All-District selec ons as well being named to the TBCA Region 7 & 8 Showcase Team his
sophomore and junior seasons for the Chargers.
PERSONALBorn on July 30, 1998…Son of Bret and Dorothy Whitley…Majoring in interdisciplinary studies.
2018 SKYHAWK BASEBALL2018 SKYHAWK BASEBALL 31
newcomer biosnewcomer bios#24 Austin Buzick#24 Austin Buzick
RHP RHP •• 6-2 6-2 •• 230 230 •• R/R R/R • • Jr. Jr. •• Granite City, Ill. Granite City, Ill. •• Kaskaskia College Kaskaskia College
BEFORE UTMWas a standout under head coach Mitch Koester at Kaskaskia College…Held opposing hi ers to a .267 average over 26.1 innings pitched while racking up 23 strikeouts for Kaskaskia. In his two wins, Buzick’s ERA was just 2.16 while averaging 9.72 strikeouts per nine innings…Garnered All-Conference honors while at Granite City High School under the tutelage of John Moad.
PERSONALBorn on May 4, 1996…Son of George Bauer and Holly Farnsworth…Has one sibling, Carson…Majoring in criminal jus ce.
#28 Jordan Stoner#28 Jordan StonerOF OF •• 5-10 5-10 •• 170 170 •• R/R R/R • • jr.jr.•• Puyallup, wash. Puyallup, wash. •• Tacoma cc Tacoma cc
BEFORE UTMA valuable member of the of the Tacoma Community College Titans, he was named NWAC Region All-Conference team, NWAC Region Gold Glove and NWAC Academic Excellence award while under head coach Ryan Mummert…Played ou ield as well as shortstop at Emerald Ridge High School where he earned 2014 4A SPSL All League Shortstop and 2013 4A SPSL All League Ou ield honors for the Jaguars.
PERSONALBorn on June 27, 1995…Son of Todd and Dawn Stoner…Has two siblings, Brooke and Jake…Majoring in business management.
2018 UT MARTIN BASEBALL2018 UT MARTIN BASEBALL32
newcomer biosnewcomer bios
#33 Nick Wohlbold#33 Nick WohlboldIF IF •• 6-1 6-1 •• 185 185 •• R/R R/R • • Fr. Fr. •• Columbia, Mo. Columbia, Mo.•• Rock Bridge HS Rock Bridge HS
BEFORE UTMHelped lead Rock Bridge High School to the 2014 state championship…Was a key part of the district championships won by Rock Bridge in 2014, 2015 and 2016…Racked up several individual accolades, including fi rst team all-district in 2015 and 2016, as well as 2016 Perfect Game Preseason All-American.
PERSONALBorn on Nov. 25, 1998…Son of Darin and Christy Wohlbold…Has one brother, Sam…Grandfather Jerry Davis played basketball at Iowa State…Majoring in animal science.
#37 Micah Hagan#37 Micah HaganOF OF •• 5-9 5-9 •• 180 180 •• R/R R/R • • FR. FR. •• Springfield, TENN. Springfield, TENN. •• Jo Byrnes HS Jo Byrnes HS
BEFORE UTMPlayed mul ple posi ons under head coaches John Mark Hendricks and Ronnie Carlisle while at Jo Byrnes High School…Named the 2017 District 10A Off ensive MVP, JBHS Team MVP, All-County MVP and named to the All-Region 5A Team…Garnered 2015 All-County Team accolades en route to a District 10A regular season championship.
PERSONALBorn on Aug. 31, 1999…Son of Eric and Daphne Hagan…Has one sibling, Callie…Majoring in health and human performance.
2018 SKYHAWK BASEBALL2018 SKYHAWK BASEBALL 33
newcomer biosnewcomer bios
#38 Brian Baxa#38 Brian BaxaRhp Rhp •• 6-2 6-2 •• 190 190 •• R/R R/R • • Fr. Fr. •• Danville, Ky. Danville, Ky. •• Danville HS Danville HS
BEFORE UTMRacked up several accolades including 2016 second-team all-state and 2016 All-Area Pitcher of the Year in his region while at Danville High School...Helped lead the Admirals to the 2014 District Championship in which he was named to the All-District team, which sparked a run of three consecu ve years being selected for that award…Also made an appearance on the 45th District of Kentucky All-Tournament Team each season from 2014-2016.
PERSONALBorn on Dec. 30, 1998…Son of Mark and Angela Baxa…Has one sister, Ashley…Uncle Paul Morse played baseball at the University of Kentucky for three years before playing seven years in minor league baseball in the Twins, Dodgers and Angels organiza ons…Majoring in sport management.
#39 Jefferey O’Doherty#39 Jefferey O’DohertyRHP RHP •• 6-4 6-4 •• 245 245 •• r/R r/R • • So. So. •• Omaha, NEb. Omaha, NEb. •• Wabash Valley College Wabash Valley College
BEFORE UTMComes from a well-recognized program out of Wabash Valley College…Was an integral part of the PI Midwest teams that claimed 2013 and 2015 Summer Legion State Championships…Was mentored under head coach Pat Mooney at Creighton Preparatory High School.
PERSONALBorn on Nov. 13, 1996…Son of Tom and Luann O’Doherty…Has one sibling, Shawn…Father played at football at Kansas University…Majoring in health and human performance.
2018 UT MARTIN BASEBALL2018 UT MARTIN BASEBALL34
newcomer biosnewcomer bios
#42 Austen Bullington#42 Austen BullingtonRhp Rhp •• 6-2 6-2 •• 190 190 •• R/R R/R • • Jr. Jr. •• Newburgh, Ind. Newburgh, Ind. •• Wabash Valley College Wabash Valley College
BEFORE UTMAveraged over one strikeout per inning in relief at Wabash Valley College under head coach Rob Fournier…Struck out 40 ba ers while holding opposing hi ers to just a .195 average in 41 appearances while at Castle High School during 2014-15…Boasted a 1.71 ERA, which was one of the best among his team as a dominant force out of the bullpen.
PERSONALBorn on May 15, 1997…Son of Bill and Diane Supper…Has two siblings, Josh and Alyssa…Majoring in health and human performance.
2018 SKYHAWK BASEBALL2018 SKYHAWK BASEBALL 35
Support StaffSupport Staff
Nate Sedergren joined Skyhawk athle cs in the summer of 2015 as a Cer fi ed Strength and Condi oning Trainer. Sedergren works directly with the football and baseball teams.
Sedergren is a Cer fi ed Strength and Condi oning Specialist (CSCS) through the Na onal Strength and Condi oning Associa on. Sedergren also has a Level 1 Performance Coach Cer fi ca on through United States Weightli ing (USAW).
Prior to coming to UT Mar n, worked as an Assistant Strength Coach at Gardner-Webb University under Head Strength Coach Ben Sowders. While at Gardner-Webb, Sedergren assisted with football and men’s basketball. He was responsible for training women’s basketball, men’s and women’s track, men’s and women’s swimming, men’s and women’s golf, and so ball teams.
In 2013, Sedergren worked at D1 Sports Training in Greenville, South Carolina training athletes from youth to professional levels. While in Greenville he also interned at Furman University under Master Strength Coach David Abernethy.
Sedergren played collegiate football at Western Carolina University where he was a linebacker and team captain his senior year. During his me at Western Carolina, Sedergren was coached by Master Strength Coach, Brad Orht, who is now the Head Strength Coach at Northern Illinois University and Jeff Pi man who is currently the Head Strength Coach at Boise State.
Sedergren graduated from Western Carolina in 2012 with a bachelor’s degree in communica ons and a minor in coaching.
NATE SEDERGRENNATE SEDERGRENSTRENGTH AND CONDITIONING COORDINATORSTRENGTH AND CONDITIONING COORDINATOR
2018 UT MARTIN BASEBALL2018 UT MARTIN BASEBALL36
Support StaffSupport Staff
Jake Rogers is in his fi rst year as an intern in the UT Mar n sports informa on offi ce a er serving the previous fi ve years as a student assistant. He serves as the media contact for the baseball, soccer and rifl e teams. Addi onally, he serves on the sta s cian crew at most Skyhawk home events, produces media guides, game day programs, press releases and serves as a media host and coordina ng event opera ons.
While a student assistant at UT Mar n, Rogers served on the sta s cian crew for the Ohio Valley Conference men’s and women’s basketball tournament. At the 2014 NCAA Women’s Basketball Final Four in Nashville, he served as a media
assistant by running sta s cs to on-air media and assis ng with all press conferences.
Rogers has also assisted in various other roles while at UT Mar n including public address announcer and scoreboard operator for baseball, so ball and soccer as well as serving on the sta s cian crew for men’s and women’s basketball, football and volleyball. He assisted with the 2012 and 2013 OVC Women’s Soccer Tournaments both of which were held at UT Mar n.
As a part of an experien al learning experience, Rogers was among several students selected to assist with NFL On-Loca on for Super Bowl LI in Houston, Texas. He worked two shi s for the NFL Experience by managing passing drills for fans and also assisted with fan registra on for the Super Bowl LI app. He also was responsible escor ng NFL Talent for fan appearances before Super Bowl LI.
A na ve of nearby Dresden, Tenn., Rogers graduated from the University of Tennessee at Mar n in May of 2017 with a bachelor’s degree in business administra on with a concentra on in sport management.
JAKE ROGERSJAKE ROGERSSPORTS INFORMATION INTERNSPORTS INFORMATION INTERN
2018 SKYHAWK BASEBALL2018 SKYHAWK BASEBALL 37
COACHING STAFFCOACHING STAFF
2018 UT MARTIN BASEBALL2018 UT MARTIN BASEBALL38
Ryan Jenkins was tabbed as interim head coach for the 2018 season on Dec. 11 by Skyhawk athle c director Kurt McGuffi n.
Jenkins joined the UT Mar n staff in July a er spending the 2017 season at the College of Charleston, where he served as an assistant under head coach Ma Heath working with both hi ers and pitchers. Jenkins coached fi ve All-Colonial Athle c Associa on honorees and also tutored a Major League Baseball dra pick last season.
A Millbrook, Ala. na ve, Jenkins was a four-year le erman for the Auburn Tigers from 2006-10 as a catcher, playing under head coaches Tom Slater and John Pawlowski. Jenkins also learned under former Auburn assistants Link Jarre , Chris Finwood, Jeff Duncan and Butch Thompson – who are all now Division-I head coaches. During his playing days at Auburn, Jenkins shared the diamond with four future MLB players – including 2015 American League Most Valuable Player Josh Donaldson.
Jenkins was named to the All-Southeastern Conference team in 2010 a er hi ng .365 with seven home runs and 34 RBI while making 48 starts behind the plate. He helped lead the Tigers to a 43-21 record as a senior, earning a spot on the NCAA Regional All-Tournament team.
A career .304 hi er over 138 collegiate games, Jenkins currently ranks eighth all- me in Auburn history in caught stealing by with 28 runners thrown out. He also excelled in the classroom, earning a spot on the 2009 All-SEC Academic team.
Jenkins was dra ed by the Kansas City Royals in the 17th round of the 2010 MLB Dra and went on to play in the Royals’ minor league system from 2010-12. He played in 118 games over a three-year span, throwing out 49 would-be base stealers.
In 2013, Jenkins returned to Auburn to complete his bachelor’s degree in sociology while serving as a student assistant during the 2014 season and a strength and condi oning coach in 2015-16.
Interim HEAD COACH Ryan JenkinsInterim HEAD COACH Ryan Jenkins
2018 SKYHAWK BASEBALL2018 SKYHAWK BASEBALL 39
Geoff Murphy is in his second overall season and fi rst season as a full- me assistant coach for the Skyhawk baseball program. He primarily works with the pitching staff .
Last season as a volunteer assistant, Murphy oversaw a Skyhawk pitching staff who recorded several new school records including a new high in strikeouts for a season (429). Murphy was part of UT Mar n’s record-breaking 2017 campaign, as the program recorded its most wins in the Division-I Era (25) as well as the most Ohio Valley Conference wins (12) while reaching the OVC Tournament for the fi rst me since 2011.
UT Mar n pitchers led the OVC in least doubles allowed (83) and least home runs allowed (44) under Murphy’s instruc on in 2017. He mentored Dalton Wes all, whose 81 strikeouts last season ranks second all- me in school history. Murphy also tutored Alex Evans, whose 2017 season included eight victories (third in Skyhawk history) and 73 strikeouts (fourth in school history).
A na ve of Peachtree City, Ga., Murphy began his coaching career as an assistant for the Charlo esville Tom Sox of the Valley Baseball League in the summer of 2016.
Murphy played collegiately at Boston College and Liberty, where he excelled on and off the fi eld. His academic achievements were highlighted by four consecu ve years on the ACC Academic Honor Roll. He was also the recipient of the Athle cs Director Award for Academic Achievement for four years.
As a freshman in 2012, Murphy made a career-high 20 appearances on the mound for the Eagle bullpen. He posted a 2-1 record with an ERA of 3.19 over 36.2 innings. His year was highlighted by a season-high 5.1 inning relief appearance against Duke where he surrendered just three hits and did not allow a run. During Murphy’s senior season at BC, he led the bullpen with 2.05 ERA while allowing just fi ve earned runs on the season. In addi on to his me on the mound at BC, Murphy was one of the most versa le players on the team, as he also played fi rst base, catcher, and ou ield.
A er gradua ng from BC with a bachelor’s degree in communica ons, Murphy elected to con nue his playing career by transferring to Liberty University. Murphy helped lead the Flames to the Big South Conference championship game in 2016. He boasted a record of 2-1 in four starts and eight overall appearances.
Murphy a ended McIntosh High School where he was a standout for the Chiefs. During the summers, Murphy played for the East Cobb Astros where he led them to the 17U AAU Na onal Championship game.
ASSISTANT COACHESASSISTANT COACHES
2018 UT MARTIN BASEBALL2018 UT MARTIN BASEBALL40
John O’Neil joined the UT Mar n baseball staff as an assistant in September 2017.
O’Neil previously served as the associate head coach and recrui ng coordinator at the University of Maryland Eastern Shore, which competes in the Division-I Mid-Eastern Atlan c Conference, where he was responsible for managing all recrui ng eff orts while overseeing team off ense and infi elders during the 2017 season.
O’Neil served as the interim head coach at Maryland Eastern Shore from January 2015 through August 2016, leading the Hawks to the most non-conference wins (nine) in 2016 and most conference wins (14) in 2015. Under his guidance, Maryland Eastern Shore saw its most wins during a two-year span in over two decades. He oversaw the program’s improved fundraising campaigns, playing facility, player equipment, community service involvement and community and media awareness. The Hawks earned consecu ve Male Team Scholar Awards along with 25 MEAC All-Academic Honorees.
O’Neil served as an assistant at Maryland Eastern Shore from August 2011 un l he assumed the role of interim head coach. In 2012, he assisted the Hawks to the most conference wins in program history and a third place fi nish in the Mid-Eastern Athle c Conference Tournament as well as the highest winning percentage in the previous six seasons.
O’Neil coached the Middlesex Rays of the Atlan c Baseball Confedera on Collegiate League during the summer of 2011. He oversaw the expansion team that competed in the collegiate wooden bat league.
During the 2010-11 baseball season, O’Neil served as the top assistant baseball coach at the University of the Sciences, which is located in Philadelphia, Pa. He helped guide the NCAA Division-II team to its most conference
wins, fi rst conference tournament appearance and win, two fi rst team All-CACC players, a fi rst team all-region infi elder and two All-Academic Honorees.
From 2008-10, O’Neil was the lead assistant baseball coach at Colby-Sawyer College, a NCAA Division-III program located in New London, NH. He assisted the team to a conference tournament appearance while coaching three All-CCC players, an all-region selec on and two All-Academic Honorees.
O’Neil played collegiately at Colby-Sawyers College from 2004-08, serving as the team’s star ng catcher and also saw me at designated hi er. At the prep level, he received state awards as an infi elder at Burrillville High School in Rhode Island.
O’Neil received his undergraduate degree in exercise and sport sciences from Colby-Sawyer in 2008, earning his Master’s Degree two years later in sport and recrea on management from New England College.
ASSISTANT COACHESASSISTANT COACHES
2018 SKYHAWK BASEBALL2018 SKYHAWK BASEBALL 41
2017 2017 PREVIEWPREVIEW
2018 UT MARTIN BASEBALL2018 UT MARTIN BASEBALL42
SEASON OUTLookSEASON OUTLookInterim head coach Ryan Jenkins is
ready to lead the program just one year a er the team won 25 games, the most for the program in the Division-I era. The 2018 squad features 20 returners and 11 newcomers. Jenkins feels that the veterans are prepared to lead this team. “The biggest strength of our team is defi nitely the older, more experienced guys on our squad,” Jenkins said. “Especially on the defensive side of the ball and with Dalton Wes all on the mound, I feel that those guys will pull the younger guys in the right direc on.” Elevated to his current role of interim head coach on Dec. 11, Jenkins has learned a lot about his squad in his short me at the helm. “The biggest change has been seeing the younger guys ge ng the at-bats they need and to see how far
along they have come in such a short amount of me,” Jenkins said. “All of the team is really turning a page to be off ensive minds at the plate. We look to start a fairly young infi eld with a freshman backstop, fi rst baseman and middle infi elder. I have been pleasantly surprised with how these younger guys have closed that gap so quickly and the off ense is so seamless that it only plays to our advantage.” On the fi eld, Jenkins and his coaching staff have concocted a lineup that features a mixture of seasoned veterans and young talent. His coaching philosophy is very simple: he wants to shape minds and bodies that are willing to be shaped and are willing to put in the hard work and dedica on required while s ll having plenty of fun on the diamond. “I think the game was intended to be fun and there are people who are lucky enough to play it for a long me,”
Jenkins said. “Everybody’s career will be diff erent as far as the lifespan of it. My goal is to make sure these guys are gradua ng while also having a good me on the fi eld. I don’t want prac ce or games to feel like work. I want to be sure that we have guys coming in here having an apprecia on for the game. We have a lot of guys right now who enjoy learning.”
Ethan Whitley, a 2017 Collegiate Baseball Newspaper High School All-American, has claimed the role of star ng fi rst baseman for the Skyhawks. “First base is a new posi on for Ethan, transferring from shortstop
out of high school to where we need him to play,” Jenkins said. “He’s looked really polished a er fall prac ce, giving us a very athle c guy at fi rst who can also swing the bat.” Tyler Albright led the squad in on-base percentage (.422) and tallied the second highest ba ng average on the team (.343) last season at second base. “Tyler had a lot of success at second base last year,” Jenkins said. “We hope that he will have some of the pressure taken off of him this year since we have plugged in some good guys around him.” A talented defender who won a Gold Glove Award at the high school level, Casey Harford has earned the star ng nod at shortstop. “Casey has been somewhat of a surprise so far,” Jenkins said. “He has done a lot of things to change his body since he got here. He’s go en a lot stronger and has a be er feel of the infi eld now. He has a lot of bat speed as well.” One year a er spor ng a .303 ba ng average, Ben Asle is ready to take on the everyday job of manning the hot corner. “Ben is a guy who will shock a lot of people this year with how he has changed up his swing,” Jenkins said. “He has been really good all fall and during the spring for us.” An outstanding athlete from Crandall, Ga., Blake Davis won the star ng job at catcher a er an impressive showing during spring prac ce. “Blake is a young guy and it may be tough for him at fi rst what with the speed of the game and with the system we have in place,” Jenkins said. “I think he is a great player and his ability to catch and throw will give
J
fi
tg
A
f
Senior second baseman Tyler Albright is looking to build off his stellar 2017 season as
he tallied over a .900 OPS.
2018 SKYHAWK BASEBALL2018 SKYHAWK BASEBALL 43
SEASON OUTLOOKSEASON OUTLOOK
us a great advantage going forward. He has done a good job of handling our pitching staff so far and seems to be ge ng ahold of our system.” A talented transfer out of Tacoma Community College, Jordan Stoner provides UT Mar n with a solid glove in the ou ield to go along with his quick gait. He is expected to start in le fi eld for the Skyhawks. “Jordan is going to be a guy who can help us with his speed,” Jenkins said. “That being said, our ou ield as a whole is going to be very fast this season. Stoner has done a lot this fall to improve himself as a hi er and he’s star ng to understand this level of compe on and the changes he’s had to make coming from junior college.” A er leading the Skyhawks in triples last season (six) and providing one of the biggest pops on the team (.548 slugging percentage), Creighton Eldridge gives UT Mar n an experienced le -handed bat in the
ou ield. “I feel like Creighton will be one of the be er hi ers in the league this season,” Jenkins said. “He has become a li le more consistent from last year by changing his swing and simplifying some things. “ Although Collin Edwards was used as a pitching op on out of the bullpen last year, he gave the Skyhawks good at-bats as he appeared in 25 games in the ou ield in 2016. The all-around athlete looks to make an impact as UT Mar n’s star ng right fi elder this season. “Collin is just a big, physical guy who can move and throw really well from the ou ield,” Jenkins said.
“He’s done a lot of things to change up his swing. He has been really consistent this fall and early spring.” On the mound, Jenkins will turn to Wes all to lead the Skyhawk rota on. Last season, Wes all led UT Mar n in strikeouts (81), innings pitched (80.2) and opposing ba ng average (.261) while snagging fi ve victories. “Dalton is an experienced guy who has had a lot of success in our conference,” Jenkins said. “We’ve done some things to simplify his mechanics so we can get the best out of him at all mes.” Jenkins also expects a trio of hurlers to have big seasons in 2018. Sophomore Winston Cannon tallied fi ve victories last year while ge ng the star ng nod in 10 games, piling up 59 innings and 47 strikeouts. Peyton Cain also brings a lot of experience over from last season as the senior
tossed 72.2 innings of work (good for second on the team), ringing up 48 ba ers while picking up one save during the year. The return of Zack Denney (missed en re 2017 season due to injury) gives the Skyhawks a long-relief arm out of the bullpen. “Winston has done some things to solidify his role in the rota on,” Jenkins said. “Peyton is a workhorse who gained very valuable experience in a variety of roles last season. Zack is going to be a healthy op on for us out of the bullpen and we will see him eat up a lot of innings.” Even though winning is the ul mate ambi on, Jenkins wants to be sure that his players are ready to take on life a er baseball as well. “I just want to make sure the guys have a good experience here at UT Mar n,” Jenkins said. “We want to teach these young guys to improve from game-to-game and week-to-week. I want to be sure to set a ainable goals for our players to be able to build confi dence as they face a new opponent each week. We want to be sure that the kids coming from high school to Division-I baseball can make that transi on. For me, its teaching a winning culture and that we are going to strive to do be er than the day before. We’re not going to measure success through wins and losses. Our goal is to play hard and to be sure we do the basic things right. As we go into the Ohio Valley Conference schedule, we are going to strive to win one game at a me, not go in on Friday and look to win the series before things kick off . I want the guys to feel like they can leave here be er people as well as ball players. We want to teach them life lessons and hopefully we can see guys ge ng dra ed again too.”
w
t
t
fiSenior hurler Dalton Westfall looks to lead the Skyhawk pitching staff after pacing the club in
strikeouts and innings pitched last year.
2018 UT MARTIN BASEBALL2018 UT MARTIN BASEBALL44
OPPONENTSOPPONENTSLocation ..................................................................... Troy, Ala.Conference .................................................................. Sun BeltStadium (Capacity) ...................... Riddle-Pace Field (2,000)Head Coach .........................................................Mark Smartt Alma Mater .............................................................. Troy, 1988Career Record (Years) ............................................ 227-214 (9)School Record (Years) ................................................ 63-51 (3)2017 Record (Conference) ..................................31-25 (16-14)All-Time Series .........................................Trojans lead 16-11Series Streak ....................................................................... N/AUTM vs. TU in Troy/Martin ............................................ N/A
TROYGames 1-4Feb. 16-18
Location .................................................Cape Girardeau, Mo.Conference ............................................................Ohio ValleyStadium (Capacity) .............................. Capaha Field (2,000)Head Coach ......................................................Andy SawyersAlma Mater ..................................................... Nebraska, 1998 Career Record (Years) ................................................ 29-26 (1)School Record (Years) .....................................................Same2017 Record (Conference) ....................................29-26 (16-4)All-Time Series ................................ Redhawks lead 76-22-1Series Streak ..........................................................SEMO W17UTM vs. SEMO in Cape Girardeau/Martin ....5-39-1/12-27
SEMOGameS 17-19March 16-18
Location .............................................................Pine Bluff , ARConference ..........................................Southwestern AthleticStadium (Capacity) Torri Hunter Baseball Complex (1500)Head Coach ........................................................ Carlos JamesAlma Mater ............................................Seminole State, 2002 Career Record (Years) .......................................... 153-279 (11)School Record (Years) ............................................ 124-201 (8)2017 Record (Conference) ..................................15-31 (10-14)All-Time Series ........................................Skyhawks lead 3-0Series Streak .............................................................. UTM W3UTM vs. UAPB in Pine Bluff /Martin......................... 0-0/3-0
Ark.-Pine BluffGameS 5-7Feb. 23-25
Location ...........................................................Evansville, Ind.Conference .....................................................Missouri ValleyStadium (Capacity) ....................................... Braun StadiumHead Coach ...........................................................Wes CarrollAlma Mater .................................................... Evansville, 2001 Career Record (Years) ............................................ 222-230 (8)School Record (Years) .....................................................Same2017 Record (Conference) ....................................18-39 (8-12)All-Time Series ................................... Purple Aces lead 16-5Series Streak .............................................................. UTM W2UTM vs. UE in Evansville/Martin .............................. 2-8/3-8
EvansvilleGames 20, 47MarCH 20, May 8
Location .........................................................Nashville, Tenn.Conference ........................................................... Atlantic SunStadium (Capacity) .........Stephen L. Marsh Stadium (750)Head Coach ....................................................... Jeff ForehandAlma Mater ........................................................Belmont, 1989Career Record (Years) .......................................... 515-473 (17)School Record (Years) .......................................... 304-331 (11)2017 Record (Conference) ....................................28-28 (9-12)All-Time Series ...............................................Bison lead 19-9Series Streak .............................................................. UTM W1UTM vs. LU in Nashville/Martin ............................. 3-9/6-10
LipscombGameS 8, 27Feb. 28, AprIL 3
Location ............................................................. Nashville, TNConference ............................................................Ohio ValleyStadium (Capacity) .............................. ES Rose Park (1,000)Head Coach ........................................................... Dave JarvisAlma Mater ............................................Arkansas State, 1982Career Record (Years) .......................................913-678-2 (27)School Record (Years) .......................................589-526-2 (20)2017 Record (Conference) ..................................31-29 (17-13)All-Time Series ...........................................Bruins lead 42-27Series Streak .................................................................. BU W1UTM vs. BU in Nashville/Martin ....................... 10-24/18-15
BelmontGameS 21-23March 23-25
Location ........................................................ Cincinnati, OhioConference .................................................American AthleticStadium (Capacity) ..............Marge Schott Stadium (3,085)Head Coach .......................................................Scott GooginsAlma Mater ........................................... Ohio Wesleyan, 1991 Career Record (Years) .......................................... 341-357 (12)School Record (Years) .........................................First Season2017 Record (Conference) ..................................28-30 (10-14)All-Time Series ................................................. First MeetingSeries Streak ...................................................... First MeetingUTM vs. UC in Cincinnati/Martin..................First Meeting
CincinnatiGameS 9-12March 2-4
Location ............................................................Richmond, Ky.Conference ............................................................Ohio ValleyStadium (Capacity) ................Turkey Hughes Field (1,200)Head Coach ............................................... Edwin ThompsonAlma Mater .........................................................Webber, 2003 Career Record (Years) ................................................ 85-96 (5)School Record (Years) ................................................ 48-63 (2)2017 Record (Conference) ..................................24-21 (10-20)All-Time Series .......................................Colonels lead 51-21Series Streak ............................................................... EKU W5UTM vs. EKU in Richmond/Martin .................... 11-25/9-26
Eastern KentuckyGameS 24-26March 29-31
Location .......................................................Cookeville, Tenn.Conference ............................................................Ohio ValleyStadium (Capacity) .............................Bush Stadium (1,100)Head Coach ..........................................................Matt BraggaAlma Mater ..................................................... Kentucky, 1994Career Record (Years) .......................................... 392-380 (14)School Record (Years) .....................................................Same2017 Record (Conference) ....................................41-21 (23-7)All-Time Series ............................ Golden Eagles lead 51-24Series Streak ................................................................TTU W7UTM vs. TTU in Cookeville/Martin ...................... 5-28/9-23
Tennessee TechGameS 13-15March 9-11
Location ............................................................ Morehead, Ky.Conference ............................................................Ohio ValleyStadium (Capacity) ...... Charles Hawkins Stadium (3,626)Head Coach .....................................................Mike McGuireAlma Mater ........................................... South Carolina, 1992Career Record (Years) ............................................ 293-229 (9)School Record (Years) ............................................ 151-140 (5)2017 Record (Conference) ..................................36-23 (18-11)All-Time Series ........................................... Eagles lead 57-19Series Streak .............................................................. UTM W3UTM vs. MSU in Morehead/Martin .................... 7-27/12-30
Morehead StateGames 28-30
April 6-8Location .............................................................Jackson, Tenn.Conference ............................................................. Gulf SouthStadium (Capacity) .................................Fesmire Field (700)Head Coach .........................................................Lee DriggersAlma Mater ..................................................... Central FloridaCareer Record (Years) .......................................... 593-480 (24)School Record (Years) ................................................ 46-80 (4)2017 Record (Conference) ..................................33-20 (19-13)All-Time Series .................................Skyhawks lead 29-25-2Series Streak .............................................................. UTM W1UTM vs. UU in Jackson/Martin ..........................4-12-1/8-4-1
UnionGameS 16, 36MarCH 13, AprIL 17
Location ..........................................................Knoxville,Tenn.Conference .......................................................... SoutheasternStadium (Capacity) ......... Lindsey Nelson Stadium (4,283)Head Coach .........................................................Tony VitelloAlma Mater .......................................................Missouri, 2002Career Record (Years) ..............................................First YearSchool Record (Years) ..............................................First Year2017 Record (Conference) ....................................27-25 (7-21)All-Time Series ................................................. First MeetingSeries Streak ...................................................... First MeetingUTM vs. UT in Knoxville/Martin ................. First Meeting
TennesseeGameS 31-32
April 10-11
2018 SKYHAWK BASEBALL2018 SKYHAWK BASEBALL 45
OPPONENTSOPPONENTSLocation .............................................................. Conway, Ark.Conference ...............................................................SouthlandStadium (Capacity) ..............................Bear Stadium (1,007)Head Coach ........................................................... Allan GumAlma Mater ........................................Crowder College, 1991Career Record (Years) .......................................... 441-226 (12)School Record (Years) ............................................ 215-160 (7)2017 Record (Conference) ..................................34-26 (17-13)All-Time Series .................................................Bears lead 4-1Series Streak ...............................................................UCA W3UTM vs. UCA in Conway/Martin .............................. 1-3/0-1
Central ArkansasGames 33-35
April 13-15
Location ......................................................... Memphis, Tenn.Conference .................................................American AthleticStadium (Capacity) ..................................FedEx Park (2,000)Head Coach .............................................. Daron SchoenrockAlma Mater ...........................................Tennessee Tech, 1984Career Record (Years) .......................................... 387-446 (15)School Record (Years) .......................................... 362-394 (13)2017 Record (Conference) ....................................30-29 (8-16)All-Time Series ............................................. Tigers lead 33-6Series Streak .................................................................UM W7UTM vs. UM in Memphis/Martin ........................... 3-27/3-9
MemphisGame 51May 15
Location ........................................................Edwardsville, Ill.Conference ............................................................Ohio ValleyStadium (Capacity) .........................Roy E. Lee Field (1,000)Head Coach ........................................................... Sean LyonsAlma Mater ........................................... Eastern Illinois, 1999 Career Record (Years) ................................................ 23-29 (1)School Record (Years) .....................................................Same2017 Record (Conference) ..................................23-29 (11-19)All-Time Series ........................................Cougars lead 14-16Series Streak .............................................................. UTM W3UTM vs. SIUE in Edwardsville/Martin................... 8-5/5-10
SIUEGameS 37-39April 20-22
Location .................................................................Murray, Ky.Conference ............................................................Ohio ValleyStadium (Capacity) ..................................Reagan Field (800)Head Coach ....................................................Kevin MoulderAlma Mater ............................................... Murray State, 2004Career Record (Years) ................................................ 72-99 (4)School Record (Years) .....................................................Same2017 Record (Conference) ..................................29-30 (15-15)All-Time Series ...........................................Racers lead 70-34Series Streak .............................................................. MUR W2UTM vs. MSU in Murray/Martin ....................... 15-39/17-29
Murray StateGames 52-54
May 17-19Location ......................................................... Memphis, Tenn.Conference ............................................................. Gulf SouthStadium (Capacity) .......................Nadickbernd Field (500)Head Coach ...............................................................Lee ParksAlma Mater ........................................Mississippi State, 2002 Career Record (Years) ................................................ 15-34 (1)School Record (Years) .....................................................Same2017 Record (Conference) ....................................15-34 (9-24)All-Time Series ........................................Skyhawks lead 9-1Series Streak .............................................................. UTM W7UTM vs. CBU in Memphis/Martin ........................... 1-2/9-1
Christian BrothersGame 40April 24
Location .......................................................Clarksville, Tenn.Conference ............................................................Ohio ValleyStadium (Capacity) .............. Raymond C. Hand Park (777)Head Coach ......................................................Travis JanssenAlma Mater ................................................Kansas State, 1997Career Record (Years) ............................................ 162-252 (6)School Record (Years) ................................................ 58-53 (2)2017 Record (Conference) ..................................28-30 (13-16)All-Time Series ................................ Governors lead 86-32-2Series Streak .............................................................APSU W1UTM vs. APSU in Clarksville/Martin ........ 12-42-1/18-37-1
Austin PeayGameS 41-43April 27-29
Location ............................................................Charleston, Ill.Conference ............................................................Ohio ValleyStadium (Capacity) ..........................Coaches Stadium (500)Head Coach ................................................... Jason AndersonAlma Mater ..........................................................Illinois, 2012Career Record (Years) ................................................ 36-75 (2)School Record (Years) .....................................................Same2017 Record (Conference) ..................................21-35 (12-18)All-Time Series ....................................... Panthers lead 29-22Series Streak .................................................................EIU W1UTM vs. EIU in Charleston/Martin ................... 12-20/10-10
Eastern IllinoisGameS 44-46
May 4-6Location ....................................................... Jacksonville, Ala.Conference ............................................................Ohio ValleyStadium (Capacity) ...................... Choccolocco Park (1,200)Head Coach ................................................................ Jim CaseAlma Mater ........................................... Louisiana Tech, 1983Career Record (Years) .......................................... 515-428 (16)School Record (Years) .....................................................Same2017 Record (Conference) ..................................30-26 (17-13)All-Time Series .................................. Gamecocks lead 63-17Series Streak .............................................................. UTM W1UTM vs. JSU in Jacksonville/Martin ..................... 6-23/5-21
Jacksonville StateGames 48-50
May 11-13
2018 UT MARTIN BASEBALL2018 UT MARTIN BASEBALL46
OVC TournamentOVC TournamentTournament Location ..............................................Oxford, Ala.Stadium (Capacity) ............................ Choccolocco Park (1200)
OVC Commissioner ...........................................Beth DeBaucheOVC Baseball SID ...............................................Kyle Schwartz SID Phone ............................................................... (615) 690-6685SID Email .......................................................kschwartz @ovc.org
UTM All-Time in OVC Tournament ....................................1-5UTM Appearances (Last Appearance).......................... 3 (2017)
Choccolocco ParkChoccolocco Park
OVC TOurnamentmay 23-26
2018 SKYHAWK BASEBALL2018 SKYHAWK BASEBALL 47
ALL-TIME SERIES RESULTSALL-TIME SERIES RESULTSAll-Time Record vs. OpponentsAll-Time Record vs. Opponents
Alabama A&M . . . . . . . . . . . . . . . . 4-0Arkansas . . . . . . . . . . . . . . . . . . . . . 0-1Arkansas-Little Rock. . . . . . . . . . . 8-25Arkansas-Pine Bluff . . . . . . . . . . . . 3-0Arkansas State . . . . . . . . . . . . 15-31-1Augusta College . . . . . . . . . . . . . . . 8-2Austin Peay . . . . . . . . . . . . . . . 32-87-2Bellarmine . . . . . . . . . . . . . . . . . . . 2-0Belmont . . . . . . . . . . . . . . . . . . . 27-42Berea College . . . . . . . . . . . . . . . . 1-0Bethel . . . . . . . . . . . . . . . . . . . . . . 48-7Birmingham-Southern . . . . . . . . . . 0-4Bradley . . . . . . . . . . . . . . . . . . . . . . 5-7Bryant . . . . . . . . . . . . . . . . . . . . . . . 1-0Buffalo. . . . . . . . . . . . . . . . . . . . . . . 2-4Butler . . . . . . . . . . . . . . . . . . . . . . . 2-1Carroll College . . . . . . . . . . . . . . . 28-3Carson-Newman . . . . . . . . . . . . . . 2-0Central Arkansas . . . . . . . . . . . . . . 1-4Chicago State . . . . . . . . . . . . . . . 4-2-1Christian Brothers . . . . . . . . . . . . 21-6Cleveland State . . . . . . . . . . . . . . . 3-0Connecticut . . . . . . . . . . . . . . . . . . 0-1Creighton . . . . . . . . . . . . . . . . . . . . 0-3Dayton . . . . . . . . . . . . . . . . . . . . . . 1-2Delta State . . . . . . . . . . . . . . . . . . 7-26Eastern Illinois . . . . . . . . . . . . . . 22-39Eastern Kentucky . . . . . . . . . . . . 21-51Eastern Michigan . . . . . . . . . . . . . . 1-2Evansville . . . . . . . . . . . . . . . . . . . 5-16Florida State . . . . . . . . . . . . . . . . . . 0-2Freed-Hardeman . . . . . . . . . . . . . 16-2Furman . . . . . . . . . . . . . . . . . . . . . . 0-1George Washington . . . . . . . . . . . . 0-1Georgia Southern . . . . . . . . . . . . . . 0-3Georgia State . . . . . . . . . . . . . . . . . 1-0Grand Valley State . . . . . . . . . . . . . 3-0Harding University . . . . . . . . . . . . . 1-0Houston Baptist . . . . . . . . . . . . . . . 1-0Illinois . . . . . . . . . . . . . . . . . . . . . . . 0-1Illinois-Chicago . . . . . . . . . . . . . . . . 1-3Illinois State . . . . . . . . . . . . . . . . . . 0-1Indiana State . . . . . . . . . . . . . . . . . 3-9IPFW . . . . . . . . . . . . . . . . . . . . . . . 10-3IUPUI . . . . . . . . . . . . . . . . . . . . . . . . 8-1Iowa . . . . . . . . . . . . . . . . . . . . . . . . 0-1Jackson State . . . . . . . . . . . . . . . . . 5-4Jacksonville State . . . . . . . . . . . . 17-63Kentucky . . . . . . . . . . . . . . . . . . . . . 0-6Kentucky Wesleyan . . . . . . . . . 21-3-1King College . . . . . . . . . . . . . . . . . . 1-1Lakeland . . . . . . . . . . . . . . . . . . . . . 4-0Lambuth . . . . . . . . . . . . . . . . . . . 34-17Lane. . . . . . . . . . . . . . . . . . . . . . . 32-2Lawrence University . . . . . . . . . 39-2Lemoyne-Owen . . . . . . . . . . . . . 25-6Lincoln Memorial . . . . . . . . . . . . . . 4-0Lipscomb . . . . . . . . . . . . . . . . . . . . 9-19Livingston . . . . . . . . . . . . . . . . 13-31-1Louisiana-Monroe . . . . . . . . . . . . . 1-5Louisiana Tech . . . . . . . . . . . . . . . . 0-3Louisville . . . . . . . . . . . . . . . . . . . . . 1-0Lyon College . . . . . . . . . . . . . . . . . . 1-0Martin Methodist . . . . . . . . . . . . . 3-2Maryland-Baltimore County . . . . . 1-0McKendree . . . . . . . . . . . . . . . . . . . 2-0Memphis . . . . . . . . . . . . . . . . . . . . 6-33Michigan State . . . . . . . . . . . . . . . . 0-1Mid-Continent . . . . . . . . . . . . . . . . 1-0Middle Tennessee . . . . . . . . . . . . 6-20Millikin University . . . . . . . . . . . . . 2-1
Mississippi College . . . . . . . . . . . 7-6-1 Mississppi Valley State . . . . . . . . . 7-0Missouri . . . . . . . . . . . . . . . . . . . . . 0-1Missouri State . . . . . . . . . . . . . . . . 3-8Missouri-St. Louis. . . . . . . . . . . . . . 2-0Mississippi Industrial . . . . . . . . . . . 2-0Mississippi State. . . . . . . . . . . . . . . 0-1Monmouth . . . . . . . . . . . . . . . . . . . 1-1Morehead State . . . . . . . . . . . . . 19-57Murray State . . . . . . . . . . . . . . . 34-70NJIT . . . . . . . . . . . . . . . . . . . . . . . . . 0-1Nicholls State . . . . . . . . . . . . . . . . . 0-1North Alabama . . . . . . . . . . . . 30-40-2 North Dakota State . . . . . . . . . . . . 1-1North Park . . . . . . . . . . . . . . . . . . . 1-0Northern Illinois . . . . . . . . . . . . . . . 1-4Northern Iowa . . . . . . . . . . . . . . . . 4-5Northern Kentucky . . . . . . . . . . . . 0-1Northwestern State . . . . . . . . . . . . 0-3Notre Dame . . . . . . . . . . . . . . . . . . 1-1Oakland City (Ind.) . . . . . . . . . . . . 15-0Ole Miss . . . . . . . . . . . . . . . . . . . . 1-17Otterbein . . . . . . . . . . . . . . . . . . . . 0-1Parsons College . . . . . . . . . . . . . . . 1-1Presbyterian . . . . . . . . . . . . . . . . . . 0-1Purdue . . . . . . . . . . . . . . . . . . . . . . 1-3Quincy College . . . . . . . . . . . . . . . . 7-2Rhode Island. . . . . . . . . . . . . . . . . . 2-0Rhodes College. . . . . . . . . . . . . . . . 9-2Rockford College . . . . . . . . . . . . . . 6-0Rust College . . . . . . . . . . . . . . . . . 29-2Saint Louis . . . . . . . . . . . . . . . . . 11-13Samford . . . . . . . . . . . . . . . . . . . . 8-20South Alabama . . . . . . . . . . . . . . . . 0-3South Dakota State . . . . . . . . . . . . 2-3Southeast Missouri . . . . . . . . 22-76-1Southeastern Louisiana . . . . . . . . 2-10Southeastern Massachusetts . . . . 1-0 Southern Illinois . . . . . . . . . . . . . 10-24SIU Edwardsville . . . . . . . . . . . . . 14-16Southern Indiana . . . . . . . . . . . . . . 5-5Southern Miss . . . . . . . . . . . . . . . . 2-1 St. Procopius College . . . . . . . . . . . 2-0Stephen F. Austin . . . . . . . . . . . . . . 0-3Tennessee . . . . . . . . . . . . . . . . . . . . 0-6Tennessee State . . . . . . . . . . . . . 17-10Tennessee Tech . . . . . . . . . . . . . 24-51Texas-Rio Grande Valley . . . . . . . . 1-1Trevecca . . . . . . . . . . . . . . . . . . . . . 5-0Troy . . . . . . . . . . . . . . . . . . . . . . . 11-16Tulane . . . . . . . . . . . . . . . . . . . . . . . 0-3UAB . . . . . . . . . . . . . . . . . . . . . . . . 0-10Union . . . . . . . . . . . . . . . . . . . 29-25-2USC Upstate . . . . . . . . . . . . . . . . . . 0-1Valdosta State . . . . . . . . . . . . . . . . 0-2Vanderbilt . . . . . . . . . . . . . . . . . . . 1-14Viterbo (Wis.) . . . . . . . . . . . . . . . . . 3-2Wake Forest . . . . . . . . . . . . . . . . . . 0-1Washington Univ. (Mo.) . . . . . . . . 1-0West Georgia . . . . . . . . . . . . . . . . . 1-0Western Illinois . . . . . . . . . . . . . . . 6-2Western Kentucky . . . . . . . . . . . . . 0-6Western Michigan . . . . . . . . . . . . . 0-3Wisconsin-Kenosha . . . . . . . . . . . . 4-0Wisconsin-La Crosse . . . . . . . . . . . 7-5Wisconsin-Milwaukee . . . . . . . . . . 2-0Wisconsin-Platterville . . . . . . . . . . 2-0Wisconsin-Superior . . . . . . . . . . . . 1-1Wooster College . . . . . . . . . . . . . . . 3-0Wright State . . . . . . . . . . . . . . . . . . 3-3
Aus n PeayAus n Peay leads 87-32-2
Home: 18-37-1Away: 12-42-1
Neutral: 0-1 Date ............ H/A/N...........Result 1960 ............... N/A ............. L, 12-9 1960 ............... N/A ............. L, 10-5 1961 ............... N/A ............. L, 13-5 1961 ............... N/A .............. L, 7-4 4/14/62 .............. A ................ L, 6-2 5/9/62 ............... H ............... W, 6-2 5/4/63 ............... A ................ L, 5-2 5/4/63 ............... A ............... W, 6-5 4/26/65 .............. A ................ L, 7-0 5/8/65 ............... H ..............W, 13-6 4/5/67 ............... A ............... W, 9-8 1967 ................. H ................ L, 4-2 1968 ............... N/A ............. W, 5-3 1968 ............... N/A ............. W, 5-4 1969 ............... N/A .............. L, 8-6 1969 ............... N/A ............. L, 17-5 4/11/70 .............. H ................ L, 2-1 4/11/70 .............. H ................ L, 3-0 5/9/70 ............... A ............... W, 8-4 5/9/70 ............... A ............... W, 8-3 4/27/77 .............. A ................ L, 6-1 4/7/80 ............... H ............... L, 10-5 4/7/81 ............... H ............... W, 8-3 4/14/81 .............. A ................ L, 9-7 4/27/82 .............. H ............... W, 2-1 4/27/82 .............. H ................ L, 4-1 4/26/83 .............. A ................ L, 5-4 4/26/83 .............. A ................ L, 6-1 3/9/85 ............... H ............... W, 7-1 3/9/85 ............... H ............... W, 3-1 3/1/86 ............... A .................T, 9-9 4/6/86 ............... H ............... W, 9-5 4/1/87 ............... H ................ L, 7-6 4/22/87 .............. A ............... W, 6-3 3/23/88 .............. A ............. L, 11-10 4/27/88 .............. H ................ L, 5-4 4/26/89 .............. H ................ L, 9-2 4/26/89 .............. H ............... L, 11-2 4/19/90 .............. A ............... L, 11-7 4/19/90 .............. A ............... L, 11-1 4/25/91 .............. H ..............W, 15-9 3/17/92 .............. H ..............W, 11-3 4/15/92 .............. A ............... W, 8-2 3/20/93 .............. A ............... L, 13-3 3/20/93 .............. A ................ L, 7-3 3/21/93 .............. A ................ L, 8-1 4/20/93 .............. A ................ L, 9-4 5/7/94 ............... H ............... W, 2-1 5/8/94 ............... H ................ L, 5-3 5/8/94 ............... H ............... W, 3-2 4/29/95 .............. A ................ L, 6-4 4/29/95 .............. A ...........W, 8-6(10) 4/30/95 .............. A ................ L, 3-2 4/13/96 .............. H ................ L, 4-0 4/13/96 .............. H ............... W, 1-0 4/14/96 .............. H ................ L, 8-1
5/3/96* .............. A ............... L, 16-1 5/10/97 .............. A ................ L, 2-1 5/10/97 .............. A ............... L, 10-1 5/11/97 .............. A ............... L, 14-2 5/2/98 ............... H ............... L, 12-0 5/2/98 ............... H ............... W, 8-4 5/3/98 ............... H ................ L, 8-3 5/1/99 ............... A ............... L, 11-3 5/1/99 ............... A ................ L, 2-1 5/2/99 ............... A ............... W, 8-6 4/21/00 .............. H ............... L, 13-3 4/21/00 .............. H ................ L, 6-2 4/22/00 .............. H ................ L, 7-3 3/17/01 .............. H ................ L, 1-0 3/17/01 .............. H ................ L, 9-4 3/18/01 .............. H ................ L, 8-6 5/18/02 .............. A ................ L, 4-1 5/18/02 .............. A ................ L, 2-1 5/19/02 .............. A ...........W, 7-5(11) 4/5/03 ............... H ............... L, 11-3 4/5/03 ............... H ..............T, 10-10 4/24/04 .............. A ............... L, 23-2 4/24/04 .............. A ............... L, 13-4 4/25/04 .............. A ............... L, 13-1 4/23/05 .............. H ............... L, 14-3 4/23/05 .............. H ................ L, 2-0 4/24/05 .............. H ................ L, 6-1 4/29/06 .............. A ................ L, 7-1 4/29/06 .............. A ................ L, 7-4 4/30/06 .............. A ................ L, 4-3 4/28/07 .............. H ................ L, 4-0 4/28/07 .............. H ............... L, 15-3 4/29/07 .............. H ................ L, 4-2 5/3/08 ............... A ............... L, 13-3 5/4/08 ............... A ............... W, 4-2 5/4/08 ............... A ............... L, 12-3 5/2/09 ............... H ................ L, 6-3 5/2/09 ............... H ................ L, 8-6 5/3/09 ............... H ............... W, 6-1 5/21/10 .............. A ................ L, 9-7 5/22/10 .............. A ................ L, 9-3 5/22/10 .............. A ............... L, 11-9 5/20/11 .............. H ............... L, 11-6 5/20/11 .............. H ............... L, 14-3 5/21/11 .............. H ............... W, 6-7 3/30/12 .............. A ............... L, 10-2 3/31/12 .............. A ................ L, 4-0 4/1/12 ............... A ............... L, 12-8 5/10/13 .............. H ................ L, 9-5 5/11/13 .............. H ................ L, 5-1 5/12/13 .............. H ................ L, 8-0 5/10/14 .............. A ...........W, 6-3(12) 5/11/14 .............. A ............... L, 10-2 5/12/14 .............. A ............. L, 13-12 3/11/15 .............. A ................ L, 5-2 5/1/5 ................ H ............... L, 11-3 5/2/15 ............... H ..............W, 16-7 5/3/15 ............... H ............... W, 9-7 5/6/16 ............... A ................ L, 8-3 5/7/16 ............... A ............... W, 9-7 5/8/16 ............... A ................ L, 6-5 4/28/17 .............. H ............... L, 19-4
2018 UT MARTIN BASEBALL2018 UT MARTIN BASEBALL48
ALL-TIME VS. OVC SCHOOLSALL-TIME VS. OVC SCHOOLS 4/29/17 .............. H .................. W, 10-8 4/29/17 .............. H .....................L, 8-5 5/23/17* .............N .....................L, 6-2
BelmontBelmont leads 42-27
Home: 17-16Away: 10-24
Date ............ H/A/N...............Result 1957 ............... N/A ................. L, 22-3 1957 ............... N/A ................. L, 11-7 4/23/62 .............. A ................... L, 11-2 4/22/63 .............. H .....................L, 6-2 5/7/63 ............... A ....................W, 5-4 4/16/68 .............. H .................. W, 11-6 1969 ................. A ....................W, 3-2 5/9/69 ............... A .....................L, 6-1 4/18/70 .............. H ....................W, 9-7 5/12/70 .............. A .....................L, 6-5 4/13/71 .............. H ....................W, 8-5 5/4/71 ............... A ....................W, 5-2 3/4/98 ............... A .....................L, 7-2 3/4/98 ............... A ....................W, 7-4 4/15/98 .............. H ................... L, 14-1 4/15/98 .............. H ....................W, 4-0 2/28/99 .............. H .................. W, 13-6 2/28/99 .............. H .................. W, 13-6 3/20/99 .............. A .....................L, 2-0 3/20/99 .............. A ....................W, 7-6 3/8/00 ............... A .....................L, 8-1 3/8/00 ............... A .....................L, 3-1 3/21/00 .............. H ....................W, 3-2 3/21/00 .............. H ....................W, 9-4 3/6/01 ............... A .....................L, 5-2 3/6/01 ............... A .....................L, 7-2 5/5/01 ............... H ................... L, 17-7 5/5/01 ............... H .....................L, 5-4 5/14/02 .............. H .....................L, 8-0 5/14/02 .............. H ....................W, 2-1 4/29/03 .............. A .....................L, 8-4 4/29/03 .............. A .....................L, 7-1 2/25/04 .............. H ..................L, 16-12 3/2/04 ............... A ....................W, 5-3 4/27/05 .............. H .....................L, 3-2 5/3/05 ............... A .....................L, 5-2 5/3/05 ............... A .................. W, 10-8 3/14/06 .............. A ....................W, 4-3 5/2/06 ............... H ....................W, 4-1 4/24/07 .............. H .................. W, 11-8 5/1/07 ............... A ....................W, 3-1 4/29/08 .............. H ....................W, 6-5 4/29/08 .............. H ................... L, 14-5 5/13/08 .............. A ................... L, 12-5 4/7/09 ............... H .....................L, 6-4 5/13/09 .............. A ................... L, 12-6 5/13/09 .............. A .....................L, 8-4 5/12/10 .............. H ................... L, 16-6 5/18/10 .............. A .................. W, 16-9 4/6/11 ............... H ....................W, 9-8 5/11/10 .............. A ................... L, 42-3 5/11/10 .............. A ................... L, 14-5 4/24/12 .............. A .....................L, 6-3
5/9/12 ............... H .....................L, 5-0 4/5/13 ............... H .....................L, 4-0 4/6/13 ............... H ....................W, 9-8 4/7/13 ............... H ................... L, 11-2 4/4/14 ............... A .....................L, 5-1 4/5/14 ............... A .....................L, 3-1 4/6/14 ............... A .....................L, 6-3 3/27/15 .............. H ....................W, 7-4 3/28/15 .............. H .............. W, 5-4 (10) 3/29/15 .............. H ..................L, 34-10 4/1/16 ............... A ................... L, 10-8 4/2/16 ............... A ................... L, 23-7 4/3/16 ............... A .....................L, 7-3 3/24/17 .............. H .....................L, 8-5 3/25/17 .............. H ....................W, 7-4 3/26/17 .............. H .....................L, 8-6
Eastern IllinoisEastern Illinois leads 39-22
Home: 10-19Away: 12-20
Date ............ H/A/N...............Result 3/15/97 .............. A ....................W, 6-2 3/16/97 .............. A ................... L, 11-8 3/16/97 .............. A .....................L, 5-3 3/7/98 ............... H ................... L, 16-2 3/7/98 ............... H .....................L, 4-2 3/8/98 ............... H .................W, 14-13 5/8/99 ............... A ................... L, 13-6 5/8/99 ............... A .....................L, 4-3 5/9/99 ............... A ................... L, 11-5 4/29/00 .............. H .....................L, 5-2 4/29/00 .............. H ................... L, 11-4 4/30/00 .............. H ................... L, 10-9 3/31/01 .............. H ................... L, 13-6 3/31/01 .............. H ................... L, 10-3 4/1/01 ............... H ................... L, 16-2 3/30/02 .............. A ................... L, 10-1 3/30/02 .............. A ....................W, 4-2 5/16/03 .............. H ..................L, 19-14 5/16/03 .............. H .................. W, 11-2 5/17/03 .............. H ................... L, 13-8 3/27/04 .............. A ....................W, 8-3 3/27/04 .............. A .....................L, 5-1 3/28/04 .............. A ....................W, 8-4 3/25/05 .............. H .................. W, 16-4 3/25/05 .............. H .....................L, 3-1 3/26/05 .............. H .....................L, 7-2 4/1/06 ............... A .....................L, 6-1 4/1/06 ............... A .....................L, 5-4 4/2/06 ............... A ....................W, 8-5 3/31/07 .............. H ....................W, 8-7 4/1/07 ............... H .....................L, 8-5 4/1/07 ............... H .....................L, 8-7 4/5/08 ............... A .....................L, 6-4 4/5/08 ............... A .....................L, 8-6 4/6/08 ............... A ................... L, 13-2 4/10/09 .............. H ................... L, 10-3 4/10/09 .............. H .................. W, 13-3 4/11/09 .............. H .................. W, 30-3 5/1/10 ............... A .....................L, 7-3 5/1/10 ............... A ....................W, 2-1
5/2/10 ............... A .....................L, 5-2 4/30/11 .............. H ....................W, 6-4 4/30/11 .............. H ....................W, 5-4 5/11/12 .............. A ....................W, 5-4 5/12/12 .............. A .....................L, 6-2 5/13/12 .............. A ................... L, 13-4 5/16/13 .............. A ....................W, 4-3 5/17/13 .............. A .....................L, 9-0 5/18/13 .............. A .....................L, 5-3 5/15/14 .............. H .....................L, 3-1 5/16/14 .............. H .....................L, 7-3 5/17/14 .............. H .....................L, 5-1 5/8/15 ............... A .............. W, 2-1 (11) 5/9/15 ............... A ....................W, 4-2 5/10/15 .............. A .....................L, 2-0 5/13/16 .............. H ................... L, 16-2 5/14/16 .............. H ....................W, 2-0 5/15/16 .............. H .................. W, 10-5 5/5/17 ............... A ................ W, 17-14 5/6/17 ............... A .................. W, 15-3 5/7/17 ............... A .....................L, 9-8
Eastern KentuckyEastern Kentucky leads 51-21
Home: 9-26Away: 11-22Neutral: 1-0
Date ............ H/A/N...............Result 4/24/93 .............. A .....................L, 7-6 4/24/93 .............. A .....................L, 9-3 4/25/93 .............. A ....................W, 7-4 3/26/94 .............. H .....................L, 4-0 3/26/94 .............. H ................... L, 13-5 5/6/95 ............... A .....................L, 3-2 5/6/95 ............... A .....................L, 3-1 5/6/95 ............... A .....................L, 5-2 4/20/96 .............. H ....................W, 5-3 4/20/96 .............. H .....................L, 5-4 4/21/96 .............. H .....................L, 5-4 4/12/97 .............. A .....................L, 9-4 4/12/97 .............. A ................... L, 10-7 4/12/97 .............. A ....................W, 7-4 4/4/98 ............... H ....................W, 7-4 4/4/98 ............... H .....................L, 9-4 4/4/98 ............... H ................... L, 10-7 4/2/99 ............... A .....................L, 2-1 4/2/99 ............... A .....................L, 3-1 4/3/99 ............... A .....................L, 4-3 3/25/00 .............. H .....................L, 7-3 3/25/00 .............. H .....................L, 3-1 3/26/00 .............. H .....................L, 8-4 4/28/01 .............. H ................... L, 13-7 4/28/01 .............. H .....................L, 4-2 4/29/01 .............. H ....................W, 9-5 4/28/02 .............. A ................... L, 14-1 4/28/02 .............. A .....................L, 9-7 4/18/03 .............. A ....................W, 7-2 4/18/03 .............. A .....................L, 7-5 4/19/03 .............. A ................... L, 18-8 4/3/04 ............... H ....................W, 4-3 4/3/04 ............... H .....................L, 6-1 4/3/04 ............... H ................... L, 20-4
2018 SKYHAWK BASEBALL2018 SKYHAWK BASEBALL 49
ALL-TIME VS. OVC SCHOOLSALL-TIME VS. OVC SCHOOLS 4/3/05 ............... A ................... L, 11-2 4/3/05 ............... A ....................W, 6-5 4/8/06 ............... H .....................L, 4-2 4/8/06 ............... H .....................L, 6-1 4/9/06 ............... H ................... L, 11-3 4/6/07 ............... A ................... L, 13-8 4/6/07 ............... A ....................W, 6-1 4/12/08 .............. H .....................L, 6-3 4/12/08 .............. H .....................L, 6-0 4/13/08 .............. H ....................W, 6-3 4/4/09 ............... A ................... L, 12-7 4/4/09 ............... A .....................L, 4-2 4/5/09 ............... A .................. W, 10-9 4/24/10 .............. H .................. W, 18-9 4/25/10 .............. H .....................L, 7-3 4/25/10 .............. H .....................L, 7-4 4/22/11 .............. A .................. W, 11-2 4/22/11 .............. A ....................W, 5-3 4/23/11 .............. A ....................W, 4-2 5/26/11* .............N ....................W, 6-2 5/4/12 ............... H .................. W, 11-7 5/5/12 ............... H ................... L, 16-3 5/6/12 ............... H .....................L, 8-7 4/12/13 .............. A ................... L, 30-4 4/13/13 .............. A .....................L, 7-3 4/14/13 .............. A ....................W, 5-1 4/11/14 .............. H .....................L, 9-1 4/12/14 .............. H ..................L, 18-13 4/13/14 .............. H ....................W, 9-4 4/2/15 ............... A ................... L, 10-6 4/4/15 ............... A .....................L, 9-2 4/4/15 ............... A ....................W, 7-3 4/8/16 ............... H .................. W, 20-6 4/9/16 ............... H .....................L, 5-4 4/10/16 .............. H ................... L, 16-1 3/31/17 .............. A .....................L, 3-2 4/1/17 ............... A ................... L, 11-3 4/2/17 ............... A .....................L, 3-0
Jacksonville StateJacksonville State leads 63-17
Home: 5-24Away: 6-20Neutral: 0-1
Date ............ H/A/N...............Result 1972 ............... N/A ...................L, 4-1 1973 ............... N/A ...................L, 3-2 1973 ............... N/A ..................W, 7-5 1973 ............... N/A ...................L, 7-0 1973 ............... N/A ..................L, 8-4 1974 ............... N/A ...................L, 1-0 1974 ............... N/A ...................L, 6-4 1974 ............... N/A ...................L, 7-0 1974 ............... N/A ..................W, 4-2 1975 ............... N/A ...................L, 5-0 1975 ............... N/A ...................L, 4-2 1975 ............... N/A ...................L, 5-3 1975 ............... N/A ..................W, 7-3 1976 ............... N/A ..................W, 6-5 1976 ............... N/A ................. L, 13-5 1976 ............... N/A ...................L, 6-5 1976 ............... N/A ...................L, 6-3
1977 ............... N/A ...................L, 9-5 1977 ............... N/A ..................W, 9-7 1978 ............... N/A ...................L, 5-4 1978 ............... N/A ................ W, 10-2 1978 ............... N/A ...................L, 6-3 1978 ............... N/A ...................L, 9-3 1981 ............... N/A ...................L, 8-5 1983 ................. A .....................L, 3-0 1983 ................. A .....................L, 4-0 4/26/84* ............. H .....................L, 1-0 4/24/86* ............. A .....................L, 7-2 2/24/96 .............. A .....................L, 8-6 2/24/96 .............. A .....................L, 5-2 2/25/96 .............. A .....................L, 6-2 2/22/97 .............. H .....................L, 5-1 2/23/97 .............. H ................... L, 10-2 3/12/97 .............. A ................... L, 13-4 3/18/98 .............. A ................... L, 13-2 3/19/98 .............. A .....................L, 4-2 2/12/00 .............. A ................... L, 15-8 2/13/00 .............. A .....................L, 9-3 5/8/04 ............... H ................... L, 13-4 5/8/04 ............... H ................... L, 10-8 5/9/04 ............... H .................W, 21-16 5/7/05 ............... A .....................L, 8-0 5/7/05 ............... A .....................L, 6-4 5/8/05 ............... A ....................W, 4-3 5/13/06 .............. H .....................L, 7-0 5/13/06 .............. H .....................L, 4-2 5/14/06 .............. H ................... L, 12-1 5/12/07 .............. A ................... L, 13-2 5/12/07 .............. A ....................W, 4-3 5/13/07 .............. A .....................L, 3-1 5/16/08 .............. H ................... L, 10-7 5/16/08 .............. H .....................L, 5-0 5/17/08 .............. H ................... L, 15-8 5/15/09 .............. A .................. W, 11-7 5/15/09 .............. A .................. W, 17-2 5/16/09 .............. A ....................W, 3-2 3/27/10 .............. H ....................W, 9-7 3/27/10 .............. H ................... L, 11-9 3/28/10 .............. H ................... L, 11-6 3/26/11 .............. A ....................W, 9-3 3/26/11 .............. A .....................L, 7-4 3/27/11 .............. A ..................L, 13-12 5/25/11* .............N .....................L, 9-8 4/13/12 .............. H ..................L, 13-10 4/14/12 .............. H ....................W, 7-4 4/15/12 .............. H .....................L, 8-6 3/8/13 ............... H ....................W, 5-3 3/9/13 ............... H ................... L, 10-5 3/9/13 ............... H ................... L, 20-2 3/7/14 ............... A ................... L, 10-5 3/8/14 ............... A .....................L, 6-2 3/9/14 ............... A .....................L, 6-4 5/14/15 .............. H ................... L, 14-2 5/15/15 .............. H ..................L, 13-12 5/19/16 .............. A ................... L, 16-6 5/20/16 .............. A .....................L, 4-0 5/21/16 .............. A .....................L, 9-5 5/12/17 .............. H .....................L, 5-4 5/13/17 .............. H .....................L, 8-5
5/14/17 .............. H ....................W, 7-2
Morehead StateMorehead State leads 57-19
Home: 12-30Away: 7-24Neutral: 0-1
Date ............ H/A/N...............Result 4/3/93 ............... H .....................L, 4-3 4/3/93 ............... H .....................L, 2-1 4/4/93 ............... H .....................L, 5-2 4/9/94 ............... A .....................L, 7-6 4/9/94 ............... A .....................L, 7-3 4/10/94 .............. A .....................L, 7-2 4/1/95 ............... H ................... L, 10-7 4/1/95 ............... H ................... L, 10-3 4/2/95 ............... H .....................L, 6-2 3/16/96 .............. A .....................L, 3-2 3/16/96 .............. A .....................L, 8-2 3/17/96 .............. A ................... L, 12-2 5/4/96* ..............N .....................L, 6-4 3/22/97 .............. H .....................L, 3-0 3/22/97 .............. H .....................L, 4-2 3/23/97 .............. H ....................W, 4-3 3/14/98 .............. H .....................L, 4-1 3/14/98 .............. H .................. W, 17-0 3/15/98 .............. H ................... L, 11-8 5/15/99 .............. H ................... L, 11-1 5/15/99 .............. H .....................L, 9-2 5/16/99 .............. H .....................L, 4-3 5/6/00 ............... A .................. W, 11-3 5/6/00 ............... A .....................L, 9-1 5/7/00 ............... A ..................L, 19-10 4/7/01 ............... A ................... L, 16-3 4/7/01 ............... A .................W, 20-19 4/8/01 ............... A ................... L, 14-7 4/6/02 ............... H .....................L, 6-4 4/6/02 ............... H ................... L, 20-6 4/7/02 ............... H ................... L, 16-8 4/26/03 .............. H ....................W, 8-3 4/26/03 .............. H .................. W, 11-5 4/27/03 .............. H ................... L, 15-9 4/9/04 ............... A ..................L, 13-12 4/9/04 ............... A ................... L, 11-6 4/10/04 .............. A ................... L, 22-5 4/9/05 ............... H .....................L, 8-3 4/9/05 ............... H .....................L, 5-3 4/10/05 .............. H ..................L, 18-11 4/14/06 .............. A ................... L, 10-7 4/14/06 .............. A .....................L, 2-0 4/15/06 .............. A .................. W, 23-7 4/14/07 .............. H ...............W, 7-6(10) 4/15/07 .............. H .....................L, 8-0 4/15/07 .............. H ................ W, 5-4(8) 4/19/08 .............. A ................... L, 16-8 4/19/08 .............. A .................W, 16-12 4/20/08 .............. A ................... L, 13-8 4/18/09 .............. H ................... L, 16-2 4/18/09 .............. H ....................W, 6-5 4/19/09 .............. H ..................L, 17-10 5/8/10 ............... A .................. W, 10-9 5/8/10 ............... A .................. W, 17-8
2018 UT MARTIN BASEBALL2018 UT MARTIN BASEBALL50
ALL-TIME VS. OVC SCHOOLSALL-TIME VS. OVC SCHOOLS 5/9/10 ............... A ................... L, 10-9 5/7/11 ............... H ................... L, 10-9 5/7/11 ............... H ................W, 7-6 (8) 5/8/11 ............... H ....................W, 9-8 5/17/12 .............. A .....................L, 8-2 5/18/12 .............. A .....................L, 8-5 5/19/12 .............. A .....................L, 8-5 4/19/13 .............. H .....................L, 3-1 4/20/13 .............. H .....................L, 7-3 4/21/13 .............. H ................... L, 11-6 4/17/14 .............. A .....................L, 6-3 4/18/14 .............. A ................... L, 14-6 4/19/14 .............. A .....................L, 6-4 4/10/15 .............. H .....................L, 9-5 4/11/15 .............. H .....................L, 8-6 4/12/15 .............. H ................... L, 17-7 4/15/16 .............. A ................... L, 10-4 4/16/16 .............. A ....................W, 6-4 4/17/16 .............. A ................... L, 26-7 4/7/17 ............... H ....................W, 1-0 4/8/17 ............... H ....................W, 9-5 4/9/17 ............... H .................. W, 18-6
Murray StateMurray State leads 70-34
Home: 17-29Away: 15-39Neutral: 2-2
Date ............ H/A/N...............Result 4/13/81 .............. H ...................W, 6-3 3/9/82 ............... A .................. L, 15-3 4/4/82 ............... A .................. L, 10-3 3/8/83 ............... A .....................L, 9-4 4/16/85 .............. H .................. L, 14-9 3/31/86 .............. A .................. L, 18-8 3/4/87 ............... H .....................L, 3-1 4/7/88 ............... H ...................W, 5-3 4/25/89 .............. A ................. W, 18-8 4/5/90 ............... H ....................L, 7-4 4/17/91 .............. H ................... W, 6-5 3/3/92 ............... A ....................L, 9-1 4/14/92 .............. H ................... W, 6-5 4/6/93 ............... H .................... L, 7-2 5/8/93 ............... H ....................L, 8-4 5/8/93 ............... H ................... W, 3-2 5/9/93 ............... H ................... W, 8-2 3/5/94 ............... A ....................L, 5-2 3/6/94 ............... A ....................W, 5-3 4/30/94 .............. A ....................L, 8-3 5/1/94 ............... A ................. W, 10-4 5/1/94 ............... A .....................L, 7-0 5/4/94 ............... H .................. L, 15-3 2/21/95 .............. H ................. W, 11-4 3/19/95 .............. A ...................W, 9-6 4/22/95 .............. H ....................L, 7-2 4/22/95 .............. H ....................L, 8-2 2/21/96 .............. H ................... W, 9-0 4/5/96 ............... A .................. L, 10-1 4/5/96 ............... A ..................W, 2-0 4/6/96 ............... A ....................L, 6-2 4/11/69 .............. A ................. W, 11-7 2/18/97 .............. H .................. L, 17-5
3/8/97 ............... A .....................L, 7-0 3/8/97 ............... A ................. W, 10-1 4/26/97 .............. H ....................L, 5-4 4/26/97 .............. H ................. W, 13-6 4/27/97 .............. H .................... L, 7-4 2/18/98 .............. A ................. W, 16-7 2/18/98 .............. A ....................L, 4-2 4/18/98 .............. A ...................W, 5-2 4/19/98 .............. A ....................L, 5-0 4/19/98 .............. A .................... L, 9-2 2/24/99 .............. H .................... L, 8-5 2/24/99 .............. H ....................L, 7-3 4/17/99 .............. H ....................L, 3-2 4/17/99 .............. H .................... L, 4-3 4/18/99 .............. H ....................L, 5-1 4/28/99 .............. A ................. W, 10-9 4/8/00 ............... A ....................L, 9-5 4/8/00 ............... A .................... L, 8-3 4/9/00 ............... A .................... L, 7-6 4/21/01 .............. A .................. L, 14-6 4/21/01 .............. A ....................L, 5-2 4/22/01 .............. A .................... L, 8-6 4/20/02 .............. H .................L, 12-10 4/20/02 .............. H .................. L, 10-7 4/21/02 .............. H ....................L, 7-5 5/10/03 .............. A .................. L, 12-8 5/10/03 .............. A ...................W, 9-3 5/11/03 .............. A ................. W, 11-6 5/1/04 ............... A .................... L, 9-5 5/2/04 ............... A ....................L, 5-4 5/2/04 ............... A ....................L, 4-3 4/30/05 .............. H ....................L, 4-3 5/1/05 ............... H .................... L, 6-2 5/1/05 ............... H ...................W, 4-2 5/6/06 ............... A ....................L, 6-4 5/6/06 ............... A ....................L, 7-2 5/7/06 ............... A ...................W, 9-4 5/5/07 ............... H .................. L, 10-6 5/5/07 ............... H .................. W, 10-9 5/6/07 ............... H ....................W, 8-5 5/10/08 .............. A ....................L, 5-1 5/10/08 .............. A ....................L, 5-1 5/11/08 .............. A .................. L, 13-4 5/9/09 ............... H .................. L, 12-0 5/9/09 ............... H ....................W, 3-2 5/10/09 .............. H .................. L, 13-4 4/2/10 ............... A .................. L, 20-2 4/2/10 ............... A .................. L, 13-5 4/3/10 ............... A ....................L, 7-5 4/2/11 ............... H .................... L, 6-3 4/2/11 ............... H .................. L, 12-4 4/3/11 ............... H ................W, 14-13 4/6/12 ............... A ....................L, 4-2 4/6/12 ............... A ...................W, 4-3 4/7/12 ............... A .................... L, 7-0 3/15/13 .............. A ....................L, 5-4 3/16/13 .............. A .................L, 15-13 3/17/13 .............. A .................. L, 11-7 3/14/14 .............. H ................... L, 10-2 3/15/14 .............. H .....................L, 7-2 3/15/14 .............. H ....................W, 6-5 3/7/15 ...............N ....................W, 6-3
3/7/15 ...............N .....................L, 2-1 3/8/15 ...............N .....................L, 4-2 4/28/15 ..............N .................. W, 14-3 3/11/16 .............. H ....................W, 6-5 3/12/16 .............. H .....................L, 7-4 3/13/16 .............. H .................. W, 19-6 5/18/17 .............. A ....................W, 9-3 5/19/17 .............. A ................... L, 14-4 5/20/17 .............. A .....................L, 8-5
Southeast MissouriSoutheast Missouri leads 76-22-1
Home: 12-27Away: 5-39-1Neutral: 0-1
Date ............ H/A/N...............Result 1964 ............... N/A ...................L, 7-4 1965 ............... N/A ..................W, 3-2 1967 ............... N/A ...................L, 9-1 1968 ............... N/A ..................W, 3-2 1969 ............... N/A ...................L, 3-2 1969 ............... N/A ................ W, 12-3 1975 ............... N/A ...................L, 8-7 1975 ............... N/A ...................L, 9-3 1976 ............... N/A ...................L, 6-0 1976 ............... N/A ..................W, 3-0 1977 ............... N/A ...................L, 4-3 1977 ............... N/A ...................L, 9-2 1981 ............... N/A ..................W, 5-3 1981 ............... N/A ...................L, 6-4 1983 ................. H ....................W, 5-1 1983 ................. H ................... L, 16-5 4/6/84 ............... A .....................L, 8-7 4/6/84 ............... A ................... L, 10-1 4/10/85 .............. H .....................L, 7-0 4/10/85 .............. H ................... L, 10-2 2/26/92 .............. A ................... W, 9-7 4/1/92 ............... H ....................W, 5-4 3/30/93 .............. H ....................W, 5-1 4/27/93 .............. A ................... L, 12-5 4/16/94 .............. A ...................W, 3-1 4/16/94 .............. A .....................L, 5-3 4/17/94 .............. A .................. L, 10-5 4/8/95 ............... H .................... L, 9-4 4/8/95 ............... H ................. L, 14-12 4/9/95 ............... H .................. L, 15-8 3/23/96 .............. A .................... L, 7-5 3/23/96 .............. A ................... W, 4-2 3/24/96 .............. A .................... T, 5-5 5/3/97 ............... A ................... W, 6-0 5/3/97 ............... A ................... W, 8-7 5/4/97 ............... A .................... L, 5-4 4/25/98 .............. H .................... L, 4-3 4/25/98 .............. H .................. L, 13-0 4/26/98 .............. H .................. L, 11-7 3/12/99 .............. H .................. L, 12-7 3/12/99 .............. H ................... W, 7-6 4/24/99 .............. A .................. L, 11-2 4/24/99 .............. A .................... L, 6-0 4/25/99 .............. A .................. L, 11-2 3/12/00 .............. A .................. L, 13-4 3/12/00 .............. A .................... L, 6-0
2018 SKYHAWK BASEBALL2018 SKYHAWK BASEBALL 51
ALL-TIME VS. OVC SCHOOLSALL-TIME VS. OVC SCHOOLS 4/15/00 .............. A .................... L, 8-7 4/15/00 .............. A .................... L, 8-5 4/16/00 .............. A .................. L, 16-0 4/13/01 .............. H .................... L, 7-0 4/13/01 .............. H .................. L, 18-9 4/14/01 .............. H ................... W, 8-6 4/13/02 .............. A .................. L, 12-8 4/13/02 .............. A .................. L, 16-3 4/14/02 .............. A .................. L, 12-2 5/3/03 ............... H .................... L, 9-1 5/3/03 ............... H .................. L, 14-2 5/4/03 ............... H .................. L, 20-5 5/21/04 .............. H .................. L, 12-4 5/21/04 .............. H .................... L, 9-2 5/21/04 .............. H ................ W, 17-16 5/20/05 .............. A .................... L, 4-2 5/20/05 .............. A .................... L, 6-4 5/21/05 .............. A .................... L, 4-3 3/25/06 .............. H ................... W, 2-1 3/25/06 .............. H ................... W, 3-2 3/26/06 .............. H ................... W, 1-0 3/24/07 .............. A .................... L, 7-5 3/24/07 .............. A .................... L, 7-6 3/25/07 .............. A .................. L, 18-8 3/29/08 .............. H .................. L, 19-6 3/28/09 .............. A ............... L, 6-5(10) 3/28/09 .............. A .................... L, 9-7 3/29/09 .............. A .................. L, 12-8 4/17/10 .............. H ................... W, 6-3 4/17/10 .............. H ................. W, 12-4 4/18/10 .............. H .................. L, 15-1 4/16/11 .............. A .................... L, 8-2 4/16/11 .............. A .................... L, 8-2 4/17/11 .............. A .................... L, 8-4 5/27/11* .............N .................. L, 12-7 4/27/12 .............. H ................... W, 5-4 4/28/12 .............. H .................. L, 13-1 4/29/12 .............. H .................. L, 14-2 3/28/13 .............. A .................... L, 8-5 3/29/13 .............. A .................... L, 9-6 3/30/13 .............. A .................... L, 7-2 3/28/14 .............. H ................... L, 13-0 3/29/14 .............. H .....................L, 9-3 3/30/14 .............. H ................... L, 11-1 3/20/15 .............. A ................... L, 16-2 3/21/15 .............. A ................... L, 13-0 3/22/15 .............. A ............... L, 5-4 (12) 3/24/16 .............. H ................... L, 19-6 3/25/16 .............. H ................... L, 15-6 3/26/16 .............. H ................... L, 26-2 3/17/17 .............. A ................... L, 14-1 3/18/17 .............. A .....................L, 5-4 3/19/17 .............. A ................... L, 13-4
SIU EdwardsvilleSIU Edwardsville leads 16-14
Home: 8-5Away: 5-10
Date ............ H/A/N...............Result 1972 ............... N/A ................. L, 12-4 1972 ............... N/A ..................W, 5-2 4/4/92 ............... H ....................W, 2-1
4/4/92 ............... H ....................W, 6-2 3/21/09 .............. H .....................L, 9-7 3/22/09 .............. H .................. W, 12-5 4/10/10 .............. A ....................W, 7-4 4/10/10 .............. A .....................L, 6-3 4/11/10 .............. A .................. W, 11-7 4/9/11 ............... H ................... L, 13-2 4/9/11 ............... H ....................W, 7-6 4/10/11 .............. H .................W, 20-14 4/20/12 .............. A ................L, 3-2(11) 4/21/12 .............. A ................... L, 10-2 4/22/12 .............. A ................... L, 12-5 5/4/13 ............... A ................... L, 10-1 5/5/13 ............... A .....................L, 5-3 5/6/13 ............... A ................L, 3-2(10) 5/2/14 ............... H ................... L, 14-7 5/3/14 ............... H ....................W, 3-2 5/4/14 ............... H ................... L, 13-8 4/24/15 .............. A .....................L, 4-3 4/25/15 .............. A .....................L, 6-3 4/26/15 .............. A .....................L, 6-2 4/29/16 .............. H ....................W, 5-4 4/30/16 .............. H .....................L, 6-4 4/30/16 .............. H ....................W, 8-7 4/21/17 .............. A ....................W, 9-5 4/22/17 .............. A ....................W, 3-1 4/23/17 .............. A ....................W, 3-2
Tennessee TechTennessee Tech leads 51-24
Home: 19-23Away: 5-28
Date ............ H/A/N...............Result 5/1/93 ............... H ....................W, 4-2 5/1/93 ............... H .....................L, 4-2 5/2/93 ............... H .....................L, 7-6 4/1/94 ............... H .................. W, 11-5 4/1/94 ............... H .................. W, 14-2 4/2/94 ............... H ....................W, 7-6 3/25/95 .............. A .....................L, 6-3 3/25/95 .............. A ....................W, 7-3 3/26/95 .............. A ................... L, 11-3 4/27/96 .............. H .....................L, 9-4 4/27/96 .............. H .....................L, 7-2 4/28/96 .............. H ..................L, 12-10 4/19/97 .............. H ................... L, 10-0 4/19/97 .............. H .....................L, 7-4 4/20/97 .............. H .................. W, 13-7 4/10/98 .............. A ................... L, 12-5 4/10/98 .............. A ................... L, 11-1 4/11/98 .............. A .....................L, 4-3 4/10/99 .............. H ....................W, 2-1 4/10/99 .............. H ....................W, 2-0 4/11/99 .............. H .....................L, 4-3 5/9/00 ............... A ....................W, 6-5 5/9/00 ............... A .....................L, 8-6 5/10/00 .............. A ................... L, 13-3 3/24/01 .............. A .....................L, 6-1 3/24/01 .............. A .....................L, 8-2 3/25/01 .............. A .....................L, 6-1 3/23/02 .............. H .................. W, 10-0 3/23/02 .............. H ................... L, 13-0
3/24/02 .............. H .................. W, 13-8 4/12/03 .............. A .....................L, 3-1 4/12/03 .............. A .....................L, 7-1 4/13/03 .............. A .....................L, 5-4 4/17/04 .............. H .................W, 20-11 4/17/04 .............. H ....................W, 5-4 4/18/04 .............. H ................... L, 12-8 4/16/05 .............. A .....................L, 5-2 4/16/05 .............. A ....................W, 3-2 4/17/05 .............. A .....................L, 8-0 4/22/06 .............. H ....................W, 5-1 4/22/06 .............. H .....................L, 7-5 4/23/06 .............. H ....................W, 6-5 4/20/07 .............. A .....................L, 8-5 4/21/07 .............. A .....................L, 7-3 4/22/07 .............. A .....................L, 9-5 4/26/08 .............. H ....................W, 5-4 4/26/08 .............. H ....................W, 5-0 4/27/08 .............. H .....................L, 8-1 4/25/09 .............. A .................. W, 21-5 4/25/09 .............. A .....................L, 1-0 4/26/09 .............. A ................... L, 12-6 5/15/10 .............. H ................L, 9-7(13) 5/15/10 .............. H .....................L, 6-2 5/16/10 .............. H .................. W, 12-9 5/14/11 .............. A ................... L, 11-5 5/14/11 .............. A ................L, 8-7(12) 5/15/11 .............. A ................L, 8-7(11) 3/23/12 .............. H ....................W, 6-5 3/24/12 .............. H ................... L, 11-1 3/25/12 .............. H .................. W, 13-6 3/22/13 .............. H .....................L, 3-1 3/23/13 .............. H ................... L, 13-8 3/24/13 .............. H .....................L, 8-5 3/21/14 .............. A ................... L, 14-5 3/22/14 .............. A ....................W, 7-5 3/23/14 .............. A .....................L, 2-0 3/14/15 .............. H .....................L, 2-0 3/15/15 .............. H ....................W, 7-5 3/16/15 .............. H .....................L, 9-3 3/18/16 .............. A ................... L, 12-3 3/19/16 .............. A ................... L, 10-2 3/19/16 .............. A .....................L, 5-3 3/9/17 ............... H ................... L, 14-6 3/10/17 .............. H .....................L, 4-3 3/10/17 .............. H .....................L, 9-6
OVC TournamentOverall: 1-4Away: 0-1
Neutral: 1-3 Date ..............Opp. ................Result 5/3/96 .......... @APSU .............. L, 16-1 5/4/96 ..........%MORE ...............L, 6-4 5/25/11 ........... ^JSU ..................L, 9-8 5/26/11 ........... ^EKU .................W, 6-2 5/27/11 ......... ^SEMO .............. L, 12-7 5/23/17 ..........#APSU.................L, 6-2
%Game played in Clarksville, Tenn.^ Game played in Jackson, Tenn.
# Game played in Oxford, Ala.*OVC Tournament Game
2018 UT MARTIN BASEBALL2018 UT MARTIN BASEBALL52
OHIO VALLEY CONFERENCE SCHEDULEOHIO VALLEY CONFERENCE SCHEDULEFriday, February 16Morehead State vs. UMass-Lowell, 2:00 p.m. (Mt. Pleasant, S.C.)Maryland-Eastern Shore at Aus n Peay, 3:00 p.m.Southern Illinois at Jacksonville State, 3:00 p.m.Murray State at Kansas, 3:00 p.m.Eastern Kentucky at UNC Wilmington, 3:00 p.m.Southeast Missouri at College of Charleston, 3:00 p.m.Li le Rock at Tennessee Tech, 3:00 p.m.Youngstown State at Belmont, 4:00 p.m.Eastern Illinois at ULM, 4:00 p.m.SIUE at Southeastern Louisiana, 6:00 p.m.UT Mar n at Troy, 6:00 p.m.
Saturday, February 17Morehead State vs. Ball State, 10:00 a.m. (Mt. Pleasant, S.C.)Murray State at Kansas, 11:00 a.m.Maryland-Eastern Shore at Aus n Peay (2), 12:00 p.m.Youngstown State at Belmont, 1:00 p.m.Southern Illinois at Jacksonville State, 1:00 p.m.Southeast Missouri at College of Charleston, 1:00 p.m.UT Mar n at Troy (2), 1:00 p.m.Morehead State vs. UMass-Lowell, 2:00 p.m. (Mt. Pleasant, S.C.)SIUE at Southeastern Louisiana, 2:00 p.m.Li le Rock at Tennessee Tech, 2:00 p.m.Eastern Illinois at ULM, 4:00 p.m.Eastern Kentucky vs. Lehigh, 5:00 p.m. (Wilmington, N.C.)
Sunday, February 18Eastern Kentucky at Butler, 9:00 a.m. (Wilmington, N.C.)Southeast Missouri at College of Charleston, 12:00 p.m.Youngstown State at Belmont, 1:00 p.m.Southern Illinois at Jacksonville State, 1:00 p.m.Morehead State vs. Ball State, 1:00 p.m. (Mt. Pleasant, S.C.)Murray State at Kansas, 1:00 p.m.SIUE at Southeastern Louisiana, 1:00 p.m.UT Mar n at Troy, 1:00 p.m.Maryland-Eastern Shore at Aus n Peay, 1:00 p.m.Eastern Illinois at ULM, 1:00 p.m.Li le Rock at Tennessee Tech, 1:00 p.m.
Tuesday, February 20Morehead State at Western Carolina, 1:00 p.m.Murray State at Alabama A&M, 2:00 p.m.Belmont at Western Kentucky, 3:00 p.m.Southern Illinois at Aus n Peay, 3:00 p.m.Jacksonville State at Samford, 4:00 p.m.Southeast Missouri at Arkansas State, 4:00 p.m.
Wednesday, February 21Eastern Kentucky at Louisville, 2:00 p.m.
Friday, February 23UT Mar n at Arkansas-Pine Bluff , 1:00 p.m.Western Illinois at Murray State, 2:00 p.m.Eastern Kentucky at Virginia, 2:00 p.m.Radford at Jacksonville State, 3:00 p.m.Morehead State at Alabama A&M, 3:00 p.m.Bowling Green at Southeast Missouri, 3:00 p.m.Toledo at Aus n Peay, 3:00 p.m.Illinois State at Tennessee Tech, 3:00 p.m.Kent State at Belmont, 4:00 p.m.Eastern Illinois at Memphis, 4:00 p.m.SIUE at Louisiana Tech, 6:00 p.m.
Saturday, February 24Eastern Kentucky at Virginia, 12:00 p.m.Toledo at Aus n Peay, 1:00 p.m.Fairleigh Dickinson at Belmont, 1:00 p.m.Radford at Jacksonville State, 1:00 p.m.Western Illinois at Murray State, 1:00 p.m.UT Mar n at Arkansas-Pine Bluff , 1:00 p.m.Bowling Green at Southeast Missouri (2), 2:00 p.m.SIUE at Louisiana Tech, 2:00 p.m.
Eastern Illinois at Memphis, 2:00 p.m.Illinois State at Tennessee Tech, 2:00 p.m.Morehead State at Alabama A&M, 3:00 p.m.
Sunday, February 25Eastern Kentucky at Virginia, 12:00 p.m.Toledo at Aus n Peay, 1:00 p.m.Indiana State at Belmont, 1:00 p.m.Radford at Jacksonville State, 1:00 p.m.Western Illinois at Murray State, 1:00 p.m.SIUE at Louisiana Tech, 1:00 p.m.UT Mar n at Arkansas-Pine Bluff , 1:00 p.m.Bowling Green at Southeast Missouri, 1:00 p.m.Eastern Illinois at Memphis, 1:00 p.m.Illinois State at Tennessee Tech, 1:00 p.m.Morehead State at Alabama A&M, 2:00 p.m.
Tuesday, February 27Lipscomb at Tennessee Tech, 3:00 p.m.Southern Illinois at Belmont, 4:00 p.m.Eastern Illinois at Lindenwood Belleville, 4:00 p.m.Murray State at Ole Miss, 4:00 p.m.Southeast Missouri at Memphis, 4:00 p.m.Aus n Peay at Vanderbilt, 4:00 p.m.Jacksonville State at UAB, 4:00 p.m.
Wednesday, February 28Bowling Green at Eastern Kentucky, 2:00 p.m.Tennessee Tech at Middle Tennessee, 3:00 p.m.UT Mar n at Lipscomb, 4:00 p.m.
Friday, March 2Illinois State at Morehead State, 2:00 p.m.Indiana State at Aus n Peay, 3:00 p.m.Fort Wayne at Murray State, 3:00 p.m.SIUE at Oral Roberts, 3:00 p.m.Cincinna at UT Mar n, 3:00 p.m.Coppin State at Eastern Kentucky, 3:00 p.m.South Dakota State at Southeast Missouri, 3:00 p.m.Bradley at Belmont, 4:00 p.m.Eastern Illinois at Georgia State, 5:00 p.m.Jacksonville State at FIU, 6:00 p.m.Tennessee Tech at Troy, 6:00 p.m.
Saturday, March 3Cincinna at UT Mar n, (2), 12:00 p.m.Fort Wayne at Murray State (2), 12:00 p.m.Indiana State at Aus n Peay, 1:00 p.m.Bradley at Belmont, 1:00 p.m.Illinois State at Morehead State, 1:00 p.m.Coppin State at Eastern Kentucky, 1:00 p.m.Eastern Illinois at Georgia State, 1:00 p.m.SIUE at Oral Roberts, 2:00 p.m.South Dakota State at Southeast Missouri, 2:00 p.m.Tennessee Tech at Troy, 3:00 p.m.Jacksonville State at FIU, 5:00 p.m.
Sunday, March 4Jacksonville State at FIU, 11:00 a.m.Coppin State at Eastern Kentucky, 12:00 p.m.Illinois State at Morehead State, 12:00 p.m.Cincinna at UT Mar n, 12:00 p.m.Eastern Illinois at Georgia State, 12:00 p.m.Indiana State at Aus n Peay, 1:00 p.m.Bradley at Belmont, 1:00 p.m.Fort Wayne at Murray State, 1:00 p.m.SIUE at Oral Roberts, 1:00 p.m.South Dakota State at Southeast Missouri, 1:00 p.m.Tennessee Tech at Troy, 1:00 p.m.
Tuesday, March 6Morehead State at Louisville, 2:00 p.m.SIUE at Wichita State, 2:00 p.m.
2018 SKYHAWK BASEBALL2018 SKYHAWK BASEBALL 53
OHIO VALLEY CONFERENCE SCHEDULEOHIO VALLEY CONFERENCE SCHEDULEEastern Kentucky at Kentucky, 3:00 p.m.Western Kentucky at Belmont, 4:00 p.m.Tennessee Tech at Lipscomb, 4:00 p.m.Kennesaw State at Jacksonville State, 6:00 p.m.Southern Illinois at Southeast Missouri, 6:00 p.m.Aus n Peay at Ole Miss, 6:30 p.m.Eastern Illinois at Missouri, 6:30 p.m.
Wednesday, March 7Eastern Kentucky at East Tennessee State, 3:00 p.m.Southern Illinois at Murray State, 4:00 p.m.Saint Louis at SIUE, 6:00 p.m.Aus n Peay at Samford, 6:00 p.m.
Friday, March 9*SIUE at Murray State, 3:00 p.m.*UT Mar n at Tennessee Tech, 3:00 p.m.*Eastern Kentucky at Belmont, 4:00 p.m.*Morehead State at Southeast Missouri, 6:00 p.m.*Aus n Peay at Jacksonville State, 6:00 p.m.Eastern Illinois at Ole Miss, TBA
Saturday, March 10*Aus n Peay at Jacksonville State, 1:00 p.m.*Eastern Kentucky at Belmont, 2:00 p.m.*Morehead State at Southeast Missouri, 2:00 p.m.*SIUE at Murray State, 2:00 p.m.*UT Mar n at Tennessee Tech, 2:00 p.m.Eastern Illinois at Ole Miss, TBA
Sunday, March 11*Aus n Peay at Jacksonville State, 1:00 p.m.*Eastern Kentucky at Belmont, 1:00 p.m.*SIUE at Murray State, 1:00 p.m.*Morehead State at Southeast Missouri, 1:00 p.m.*UT Mar n at Tennessee Tech, 1:00 p.m.Eastern Illinois at Ole Miss, TBA
Monday, March 12Lipscomb at Belmont, 4:00 p.m.
Tuesday, March 13Eastern Kentucky at Western Kentucky, 3:00 p.m.Jackson State at Morehead State, 3:00 p.m.Murray State at Kentucky, 4:00 p.m.Samford at Jacksonville State, 6:00 p.m.Southeast Missouri at Central Arkansas, 6:00 p.m.SIUE at Saint Louis, 6:00 p.m.Middle Tennessee at Aus n Peay, 6:00 p.m.UT Mar n at Union, 6:00 p.m.West Virginia at Tennessee Tech, 6:00 p.m.Eastern Illinois at Mississippi Valley State, TBA
Wednesday, March 14Jackson State at Morehead State, 3:00 p.m.Kentucky State at Murray State, 3:00 p.m.Southeast Missouri at Central Arkansas, 3:00 p.m.West Virginia at Tennessee Tech, 3:00 p.m.SIUE at Evansville, 6:00 p.m.Eastern Kentucky at Vanderbilt, 6:30 p.m.Eastern Illinois at Mississippi Valley State, TBA
Friday, March 16*Belmont at Morehead State, 2:00 p.m.*Jacksonville State at Eastern Illinois, 3:00 p.m.Eastern Kentucky at Mercer, 5:00 p.m.*Tennessee Tech at SIUE, 6:00 p.m.*Murray State at Aus n Peay, 6:00 p.m.*Southeast Missouri at UT Mar n, 6:00 p.m.
Saturday, March 17*Belmont at Morehead State, 1:00 p.m.*Jacksonville State at Eastern Illinois, 1:00 p.m.
*Tennessee Tech at SIUE, 1:00 p.m.Eastern Kentucky at Mercer, 1:00 p.m.*Murray State at Aus n Peay, 2:00 p.m.*Southeast Missouri at UT Mar n, 3:00 p.m.
Sunday, March 18Eastern Kentucky at Mercer, 12:00 p.m.*Belmont at Morehead State, 12:00 p.m.*Jacksonville State at Eastern Illinois, 1:00 p.m.*Tennessee Tech at SIUE, 1:00 p.m.*Southeast Missouri at UT Mar n, 1:00 p.m.*Murray State at Aus n Peay, 1:00 p.m.
Monday, March 19Brescia at Murray State, 4:00 p.m.
Tuesday, March 20Alabama State at Morehead State, 2:00 p.m.Indiana State at Eastern Illinois, 3:00 p.m.Northern Kentucky at Eastern Kentucky, 3:00 p.m.Southeast Missouri at Missouri State, 3:00 p.m.Southern Illinois at SIUE, 4:00 p.m.UT Mar n at Evansville, 6:00 p.m.Alabama A&M at Tennessee Tech, 6:00 p.m.Belmont vs. Vanderbilt, 6:30 p.m. (First Tennessee Park)Aus n Peay at Kansas State, 6:30 p.m.
Wednesday, March 21Aus n Peay at Kansas State, 12:00 p.m.Alabama State at Morehead State, 2:00 p.m.Xavier at Eastern Kentucky, 3:00 p.m.Murray State at Missouri State, 3:00 p.m.Tennessee Tech vs. Western Carolina, 4:00 p.m. (Kodak, Tenn.)Jacksonville State at Kennesaw State, 5:00 p.m.
Friday, March 23*Morehead State at Eastern Kentucky, 3:00 p.m.*UT Mar n at Belmont, 4:00 p.m.Jacksonville at Jacksonville State, 6:00 p.m.*Eastern Illinois at Murray State, 6:00 p.m.*SIUE at Southeast Missouri, 6:00 p.m.*Aus n Peay at Tennessee Tech, 6:00 p.m.
Saturday, March 24Jacksonville at Jacksonville State, 1:00 p.m.*UT Mar n at Belmont, 2:00 p.m.*Eastern Illinois at Murray State, 2:00 p.m.*SIUE at Southeast Missouri, 2:00 p.m.*Aus n Peay at Tennessee Tech, 2:00 p.m.*Morehead State at Eastern Kentucky, 3:00 p.m.
Sunday, March 25*Morehead State at Eastern Kentucky, 12:00 p.m.*UT Mar n at Belmont, 1:00 p.m.Jacksonville at Jacksonville State, 1:00 p.m.*Eastern Illinois at Murray State, 1:00 p.m.*SIUE at Southeast Missouri, 1:00 p.m.*Aus n Peay at Tennessee Tech, 1:00 p.m.
Tuesday, March 27Western Kentucky at Eastern Kentucky, 3:00 p.m.Middle Tennessee at Belmont, 4:00 p.m.Ohio at Morehead State, 4:00 p.m.Jacksonville State at Alabama State, 6:00 p.m.Evansville at SIUE, 6:00 p.m.Harris-Stowe at Southeast Missouri, 6:00 p.m.Eastern Illinois at Saint Louis, 6:00 p.m.
Thursday, March 29*Tennessee Tech at Eastern Illinois, 3:00 p.m.*Belmont at SIUE, 6:00 p.m.*Murray State at Jacksonville State, 6:00 p.m.Morehead State at Kansas, 6:00 p.m.
2018 UT MARTIN BASEBALL2018 UT MARTIN BASEBALL54
OHIO VALLEY CONFERENCE SCHEDULEOHIO VALLEY CONFERENCE SCHEDULE*Eastern Kentucky at UT Mar n, 6:00 p.m.*Southeast Missouri at Aus n Peay, 6:00 p.m.
Friday, March 30*Belmont at SIUE, 1:00 p.m.*Tennessee Tech at Eastern Illinois, 1:00 p.m.*Murray State at Jacksonville State, 6:00 p.m.Morehead State at Kansas, 6:00 p.m.*Eastern Kentucky at UT Mar n, 6:00 p.m.*Southeast Missouri at Aus n Peay, 6:00 p.m.
Saturday, March 31*Belmont at SIUE, 1:00 p.m.*Tennessee Tech at Eastern Illinois, 1:00 p.m.*Murray State at Jacksonville State, 1:00 p.m.Morehead State at Kansas, 1:00 p.m.*Southeast Missouri at Aus n Peay, 1:00 p.m.*Eastern Kentucky at UT Mar n, 2:00 p.m.
Tuesday, April 3Eastern Kentucky at Xavier, 2:00 p.m.Marshall at Morehead State, 4:00 p.m.Lipscomb at UT Mar n, 4:00 p.m.Aus n Peay at Southern Illinois, 5:00 p.m.Belmont at Tennessee, 5:30 p.m.Alabama at Jacksonville State, 6:00 p.m.Eastern Illinois vs. Illinois State, 6:00 p.m. (Ma oon, Ill.)Western Kentucky at Murray State, 6:00 p.m.Arkansas State at Southeast Missouri, 6:00 p.m.
Wednesday, April 4Morehead State at Marshall, 2:00 p.m.Eastern Illinois at Indiana State, 3:00 p.m.Tennessee Tech at Kennesaw State, 4:00 p.m.Troy at Jacksonville State, 6:00 p.m.Evansville at Murray State, 6:00 p.m.SIUE at Missouri, 6:30 p.m.
Friday, April 6*Aus n Peay at Belmont, 4:00 p.m.*UT Mar n at Morehead State, 4:00 p.m.*SIUE at Eastern Kentucky, 5:00 p.m.*Eastern Illinois at Southeast Missouri, 6:00 p.m.*Jacksonville State at Tennessee Tech, 6:00 p.m.
Saturday, April 7*UT Mar n at Morehead State, 1:00 p.m.*Aus n Peay at Belmont, 2:00 p.m.*Eastern Illinois at Southeast Missouri, 2:00 p.m.*Jacksonville State at Tennessee Tech, 2:00 p.m.*SIUE at Eastern Kentucky, 3:00 p.m.
Sunday, April 8*UT Mar n at Morehead State, 12:00 p.m.*SIUE at Eastern Kentucky, 12:00 p.m.*Aus n Peay at Belmont, 1:00 p.m.Harris-Stowe at Murray State, 1:00 p.m.*Eastern Illinois at Southeast Missouri, 1:00 p.m.*Jacksonville State at Tennessee Tech, 1:00 p.m.
Tuesday, April 10East Tennessee State at Eastern Kentucky, 3:00 p.m.Eastern Illinois at Southern Illinois, 5:00 p.m.UT Mar n at Tennessee, 5:30 p.m.Belmont at Middle Tennessee, 6:00 p.m.Murray State at Evansville, 6:00 p.m.McKendree at Southeast Missouri, 6:00 p.m.Aus n Peay at Lipscomb, 6:00 p.m.
Wednesday, April 11UT Mar n at Tennessee, 3:00 p.m.Morehead State at Butler, 4:00 p.m.SIUE at Western Illinois, 4:00 p.m.
Aus n Peay at Murray State, 6:00 p.m.Middle Tennessee at Tennessee Tech, 6:00 p.m.
Friday, April 13*Belmont at Eastern Illinois, 3:00 p.m.*Southeast Missouri at Jacksonville State, 6:00 p.m.*Morehead State at SIUE, 6:00 p.m.*Tennessee Tech at Murray State, 6:00 p.m.*Eastern Kentucky at Aus n Peay, 6:00 p.m.UT Mar n at Central Arkansas, 6:00 p.m.
Saturday, April 14*Belmont at Eastern Illinois, 1:00 p.m.*Southeast Missouri at Jacksonville State, 1:00 p.m.*Morehead State at SIUE, 1:00 p.m.*Tennessee Tech at Murray State, 2:00 p.m.*Eastern Kentucky at Aus n Peay, 4:00 p.m.UT Mar n at Central Arkansas, 4:00 p.m.
Sunday, April 15*Belmont at Eastern Illinois, 1:00 p.m.*Southeast Missouri at Jacksonville State, 1:00 p.m.*Morehead State at SIUE, 1:00 p.m.*Tennessee Tech at Murray State, 1:00 p.m.*Eastern Kentucky at Aus n Peay, 1:00 p.m.UT Mar n at Central Arkansas, 1:00 p.m.
Tuesday, April 17Butler at Eastern Illinois, 3:00 p.m.Eastern Kentucky at Dayton, 3:00 p.m.Illinois State at SIUE, 4:30 p.m.Belmont at Southern Illinois, 5:00 p.m.Tennessee Tech at Western Kentucky, 5:00 p.m.Alabama State at Jacksonville State, 6:00 p.m.Union at UT Mar n, 6:00 p.m.Saint Louis at Southeast Missouri, 6:00 p.m.
Wednesday, April 18Illinois College at Eastern Illinois, 3:00 p.m.Tennessee Tech at Alabama A&M, 3:00 p.m.West Virginia Tech at Morehead State, 4:00 p.m.Murray State at Southern Illinois, 5:00 p.m.
Friday, April 20*Aus n Peay at Morehead State, 4:00 p.m.*Jacksonville State at Belmont, 5:00 p.m.*Eastern Illinois at Eastern Kentucky, 5:00 p.m.*Murray State at Southeast Missouri, 6:00 p.m.*SIUE at UT Mar n, 6:00 p.m.Southern Illinois at Tennessee Tech, 6:00 p.m.
Saturday, April 21*Aus n Peay at Morehead State, 1:00 p.m.*Jacksonville State at Belmont, 2:00 p.m.*Murray State at Southeast Missouri, 2:00 p.m.Southern Illinois at Tennessee Tech, 2:00 p.m.*SIUE at UT Mar n, 3:00 p.m.*Eastern Illinois at Eastern Kentucky, 5:00 p.m.
Sunday, April 22*Eastern Illinois at Eastern Kentucky, 12:00 p.m.*Aus n Peay at Morehead State, 12:00 p.m.*Jacksonville State at Belmont, 1:00 p.m.*Murray State at Southeast Missouri, 1:00 p.m.*SIUE at UT Mar n, 1:00 p.m.Southern Illinois at Tennessee Tech, 1:00 p.m.
Tuesday, April 24Saint Louis at Eastern Illinois, 3:00 p.m.Southeast Missouri at Southern Illinois, 5:00 p.m.Tennessee Tech at Tennessee, 5:30 p.m.Belmont at Lipscomb, 6:00 p.m.Memphis at Murray State, 6:00 p.m.
2018 SKYHAWK BASEBALL2018 SKYHAWK BASEBALL 55
OHIO VALLEY CONFERENCE SCHEDULEOHIO VALLEY CONFERENCE SCHEDULEChris an Brothers at UT Mar n, 6:00 p.m.Aus n Peay at Middle Tennessee, 6:00 p.m.
Wednesday, April 25Robert Morris (Ill.) at Eastern Illinois, 3:00 p.m.Morehead State at Kentucky, 5:30 p.m.Western Illinois at SIUE, 6:00 p.m.
Friday, April 27*Morehead State at Eastern Illinois, 3:00 p.m.*Belmont at Murray State, 6:00 p.m.*Eastern Kentucky at Jacksonville State, 6:00 p.m.*UT Mar n at Aus n Peay, 6:00 p.m.*Southeast Missouri at Tennessee Tech, 6:00 p.m.SIUE at Samford, 6:00 p.m.
Saturday, April 28*Morehead State at Eastern Illinois, 1:00 p.m.*Eastern Kentucky at Jacksonville State, 1:00 p.m.*Belmont at Murray State, 2:00 p.m.*Southeast Missouri at Tennessee Tech, 2:00 p.m.SIUE at Samford (2), 2:00 p.m.*UT Mar n at Aus n Peay, 4:00 p.m.
Sunday, April 29*Morehead State at Eastern Illinois, 1:00 p.m.*Belmont at Murray State, 1:00 p.m.*Eastern Kentucky at Jacksonville State, 1:00 p.m.*UT Mar n at Aus n Peay, 1:00 p.m.*Southeast Missouri at Tennessee Tech, 1:00 p.m.
Tuesday, May 1Eastern Kentucky at Northern Kentucky, 2:00 p.m.Morehead State at Tennessee, 5:30 p.m.Jacksonville State at Troy, 6:00 p.m.Alabama A&M at Murray State, 6:00 p.m.Southeast Missouri at Saint Louis, 6:00 p.m.Western Kentucky at Aus n Peay, 6:00 p.m.
Wednesday, May 2Belmont at Evansville, 6:00 p.m.
Friday, May 4*Jacksonville State at Morehead State, 4:00 p.m.*Murray State at Eastern Kentucky, 5:00 p.m.*Tennessee Tech at Belmont, 6:00 p.m.*Aus n Peay at SIUE, 6:00 p.m.*Eastern Illinois at UT Mar n, 6:00 p.m.Southeast Missouri at Lipscomb, 6:00 p.m.
Saturday, May 5*Jacksonville State at Morehead State, 1:00 p.m.*Aus n Peay at SIUE, 1:00 p.m.*Eastern Illinois at UT Mar n, 3:00 p.m.*Murray State at Eastern Kentucky, 3:00 p.m.Southeast Missouri at Lipscomb, 6:00 p.m.*Tennessee Tech at Belmont, 7:00 p.m.
Sunday, May 6*Jacksonville State at Morehead State, 12:00 p.m.*Murray State at Eastern Kentucky, 12:00 p.m.*Aus n Peay at SIUE, 1:00 p.m.*Eastern Illinois at UT Mar n, 1:00 p.m.Southeast Missouri at Lipscomb, 1:00 p.m.*Tennessee Tech at Belmont, 2:00 p.m.
Tuesday, May 8Chicago State at Eastern Illinois, 3:00 p.m.Jacksonville State at Alabama, 6:00 p.m.Evansville at UT Mar n, 6:00 p.m.Lipscomb at Aus n Peay, 6:00 p.m.Belmont at Memphis, 6:30 p.m.Tennessee Tech at Vanderbilt, 6:30 p.m.
Wednesday, May 9SIUE at Bradley, 6:00 p.m.
Friday, May 11*SIUE at Eastern Illinois, 3:00 p.m.Aus n Peay at Clemson, 5:30 p.m.*Belmont at Southeast Missouri, 6:00 p.m.*UT Mar n at Jacksonville State, 6:00 p.m.*Morehead State at Murray State, 6:00 p.m.*Eastern Kentucky at Tennessee Tech, 6:00 p.m.
Saturday, May 12*SIUE at Eastern Illinois, 1:00 p.m.*UT Mar n at Jacksonville State, 1:00 p.m.*Belmont at Southeast Missouri, 2:00 p.m.*Eastern Kentucky at Tennessee Tech, 2:00 p.m.Aus n Peay at Clemson, 4:00 p.m.*Morehead State at Murray State, 6:00 p.m.
Sunday, May 13*SIUE at Eastern Illinois, 1:00 p.m.*Belmont at Southeast Missouri, 1:00 p.m.*UT Mar n at Jacksonville State, 1:00 p.m.*Morehead State at Murray State, 1:00 p.m.*Eastern Kentucky at Tennessee Tech, 1:00 p.m.Aus n Peay at Clemson, 1:00 p.m.
Tuesday, May 15Evansville at Belmont, 5:00 p.m.Southeast Missouri at Georgia Tech, 5:00 p.m.Western Carolina at Eastern Kentucky, 5:30 p.m.UAB at Jacksonville State, 6:00 p.m.Western Kentucky at Tennessee Tech, 6:00 p.m.Murray State vs. Kentucky, 6:00 p.m. (Paducah, Ky.)Bradley at SIUE, 6:00 p.m.UT Mar n at Memphis, 6:30 p.m.
Wednesday, May 16Western Carolina at Morehead State, 3:00 p.m.
Thursday, May 17Belmont at Northwestern, 3:30 p.m.*Tennessee Tech at Morehead State, 4:00 p.m.*Southeast Missouri at Eastern Kentucky, 5:00 p.m.*Jacksonville State at SIUE, 6:00 p.m.*Murray State at UT Mar n, 6:00 p.m.*Eastern Illinois at Aus n Peay, 6:00 p.m.
Friday, May 18*Southeast Missouri at Eastern Kentucky, 3:00 p.m.Belmont at Northwestern, 3:30 p.m.*Tennessee Tech at Morehead State, 4:00 p.m.*Jacksonville State at SIUE, 6:00 p.m.*Murray State at UT Mar n, 6:00 p.m.*Eastern Illinois at Aus n Peay, 6:00 p.m.
Saturday, May 19*Tennessee Tech at Morehead State, 12:00 p.m.*Southeast Missouri at Eastern Kentucky, 12:00 p.m.*Eastern Illinois at Aus n Peay, 1:00 p.m.Belmont at Northwestern, 1:00 p.m.*Jacksonville State at SIUE, 1:00 p.m.*Murray State at UT Mar n, 3:00 p.m.
Tuesday, May 22 – Sunday, May 272018 Ohio Valley Conference Baseball ChampionshipChoccolocco Park – Oxford, Alabama
All Times Central * Indicates OVC Matchup
2018 UT MARTIN BASEBALL2018 UT MARTIN BASEBALL56
20172017RECAPRECAP
2018 SKYHAWK BASEBALL2018 SKYHAWK BASEBALL 57
2017 records 2017 records and accoladesand accolades
25 WINS WERE THE MOST IN THE DIVISION-I ERA25 WINS WERE THE MOST IN THE DIVISION-I ERA
12 OVC WINS SET A SCHOOL RECORD12 OVC WINS SET A SCHOOL RECORD
429 PITCHING STRIKEOUTS SET A SCHOOL RECORD429 PITCHING STRIKEOUTS SET A SCHOOL RECORD
478.2 INNINGS PITCHED SET A PROGRAM HIGH478.2 INNINGS PITCHED SET A PROGRAM HIGH
.967 FIELDING PERCENTAGE IS A SCHOOL RECORD.967 FIELDING PERCENTAGE IS A SCHOOL RECORD
1436 PUTOUTS SET A PROGRAM HIGH1436 PUTOUTS SET A PROGRAM HIGH
10.35 HITS PER GAME WERE THE MOST SINCE 201010.35 HITS PER GAME WERE THE MOST SINCE 2010
569 HITS WERE THE MOST SINCE 2010569 HITS WERE THE MOST SINCE 2010
43 HOME RUNS RANKS THIRD ALL-TIME43 HOME RUNS RANKS THIRD ALL-TIME
CREIGHTON ELDRIDGE’S SIX TRIPLES LED THE OVC AND WERE THE CREIGHTON ELDRIDGE’S SIX TRIPLES LED THE OVC AND WERE THE THIRD MOST IN A SINGLE SEASON IN SCHOOL HISTORYTHIRD MOST IN A SINGLE SEASON IN SCHOOL HISTORY
DALTON WESTFALL’S 81 STRIKEOUTS RANKED SECOND DALTON WESTFALL’S 81 STRIKEOUTS RANKED SECOND ALL-TIME IN PROGRAM HISTORYALL-TIME IN PROGRAM HISTORY
WESTFALL FANNED 15 BUFFALO BULLS FOR THE MOST IN A SINGLE WESTFALL FANNED 15 BUFFALO BULLS FOR THE MOST IN A SINGLE
GAME SINCE 2003, RANKING IN THE TOP FIVE ALL-TIMEGAME SINCE 2003, RANKING IN THE TOP FIVE ALL-TIME
ALEX EVANS’ 73 PUNCHOUTS RANKED FOURTH ALEX EVANS’ 73 PUNCHOUTS RANKED FOURTH ALL-TIME IN PROGRAM HISTORYALL-TIME IN PROGRAM HISTORY
EVANS’ 16 CAREER WINS RANKS FOURTH ALL-TIMEEVANS’ 16 CAREER WINS RANKS FOURTH ALL-TIME
WITH 140 CAREER STRIKEOUTS, EVANS RANKS 10TH WITH 140 CAREER STRIKEOUTS, EVANS RANKS 10TH ALL-TIME IN PROGRAM HISTORYALL-TIME IN PROGRAM HISTORY
18-0 WHEN LEADING AFTER SEVEN INNINGS18-0 WHEN LEADING AFTER SEVEN INNINGS
CONNOR AUBE WAS NAMED AN ALL-OVC FRESHMAN AND BECAME CONNOR AUBE WAS NAMED AN ALL-OVC FRESHMAN AND BECAME JUST THE FOURTH PLAYER IN SCHOOL HISTORY TO EARN FRESHMAN JUST THE FOURTH PLAYER IN SCHOOL HISTORY TO EARN FRESHMAN
ALL-AMERICAN HONORSALL-AMERICAN HONORS
PITCHING STAFF LED THE OVC IN LEAST DOUBLES ALLOWED PITCHING STAFF LED THE OVC IN LEAST DOUBLES ALLOWED AND LEAST HOME RUNS ALLOWEDAND LEAST HOME RUNS ALLOWED
WESTFALL LED THE OVC IN LEAST DOUBLES ALLOWED WESTFALL LED THE OVC IN LEAST DOUBLES ALLOWED AND LEAST HOME RUNS ALLOWEDAND LEAST HOME RUNS ALLOWED
BOTH THE SKYHAWKS AS A WHOLE AND KEYLEN STEEN BOTH THE SKYHAWKS AS A WHOLE AND KEYLEN STEEN LED THE OVC IN BASE STEALERS THROWN OUTLED THE OVC IN BASE STEALERS THROWN OUT
WESTFALL WAS NAMED OVC PITCHER OF THE WEEK ON APRIL 24WESTFALL WAS NAMED OVC PITCHER OF THE WEEK ON APRIL 24
DAN KERWIN WAS SELECTED AS NCBWA DAN KERWIN WAS SELECTED AS NCBWA NATIONAL PLAYER OF THE WEEK ON MAY 9NATIONAL PLAYER OF THE WEEK ON MAY 9
2018 UT MARTIN BASEBALL2018 UT MARTIN BASEBALL58
Th e 2017 Skyhawk baseball program took great strides by shattering several team and individual records on their way to 25 wins on the year (the school’s Division-I high). UT Martin shattered a new program record with 12 Ohio Valley Conference victories while also reaching their fi rst OVC Tournament since 2011. Th e Skyhawks got off to a scorching start despite not being able to play its fi rst two home series of the year at Skyhawk Field due to upgrades to the outfi eld fence. Traveling to nearby Union City to play at Elam Stadium for the fi rst two weekends of the season, UT Martin took fi ve of its fi rst six games – outscoring its opponents by a 42-24 margin during that span to match the best start to a season since 2010. Following a setback on Opening Day, the Skyhawks recovered in a big way by fanning 19 batters in a 14-0 blowout win over Buff alo on Feb. 18. Ace Dalton Westfall tossed seven innings of shutout
baseball and fanned 15 batters while reliever Shane Seckinger wrung up four batters via strikeout over the last two frames. For his eff orts against the visiting Bulls, Westfall was tabbed as College Sports Madness OVC Player of the Week. His 15 strikeouts were the most for the program since 2003 and ranked in the top-fi ve all-time in a single game. Th e Buff alo series fi nale featured a little drama as UT Martin plated two runs in the bottom of the ninth to secure a 4-3 walkoff win and a series victory to open the 2017 campaign. Th e Skyhawks then went on to sweep Arkansas-Pine Bluff at Elam Stadium on Feb. 24-26. UT Martin nearly doubled up the visiting Golden Lions in the run column (21-11) over the three-game set. Th e middle game of that series featured another masterful performance from Westfall, as he pitched into the ninth inning. He fanned 12 batters while conceding only
two hits and one unearned run over 8.1 frames, notching the adidas OVC Pitcher of the Week accolades just two days later. Following a tough three-game set at the First Pitch Invitational to start the month of March, the Skyhawks racked up a season-high 19 runs against regional foe Bethel on March 7, scoring 12 runs in the third inning alone. Tyler Albright (fi ve hits, home run, four RBI’s, three runs scored) and Creighton Eldridge (two home runs, six RBI’s) helped lead the way for UT Martin in the win. Th e Skyhawks battled in their OVC-opening series against Tennessee Tech but ultimately came up short against the eventual league
champions. Eldridge muscled up for another multi-homer game in the opening matchup of the series, giving him four home runs, 11 RBI’s and fi ve runs scored in a 10-plate appearance span. Road midweek victories over local rivals Lipscomb (7-3) and Evansville (12-4) were sandwiched around a three-game setback at OVC foe Southeast Missouri. All three games of the Belmont series on March 24-26 were decided by three runs or less but UT Martin could only manage one victory. Another close OVC series followed at Eastern Kentucky but the Skyhawks would not come out on top in any of the three contests. UT Martin followed with a midweek setback to national power Vanderbilt before fi nding greener pastures against one of the OVC’s best squads. Th e Skyhawks picked up a three-game sweep of conference rival Morehead State on March 31-April 2, slowing down one of the nation’s hottest off enses as the Eagles came into Martin with an 8-1 OVC record. Freshman Winston Cannon showed his promise in Game 1 of the series, tossing seven shutout innings and fanning fi ve in the process to improve to 3-1 on the season. Alex Evans picked up a two-inning save and tallied three punchouts along the way for the save. In Game 2, UT Martin scored eight combined runs in the sixth through eighth innings to produce the 9-5 comeback victory. Th e Skyhawks broke out the bats once again in the fi nal game of the series as 18 runs crossed the plate. Kyle Laberge completed his dominant series with 3.1 shutout innings to pick up the save, one day aft er he tossed two innings to earn the win in Game 2 of the series. A midweek setback at No. 10 Kentucky and three consecutive losses in a nonconference series at Wright State followed before UT Martin recaptured its momentum, reeling off fi ve straight
SSEASON REcapEASON REcap
trtWl
t
t
hf
i
hlt
iAlex Evans’ 28 appearances and eight wins led the staff as the hurler cemented his place in the
Skyhawk baseball record book.
2018 SKYHAWK BASEBALL2018 SKYHAWK BASEBALL 59
victories. Th e Skyhawks put together their season-best fi ve-game winning streak against Evansville (April 18), Christian Brothers (April 19) and SIUE (April 21-23). Th at included back-to-back walk-off wins in as many days as Connor Aube (four hits, including the game-winning double) and Dan Kerwin (game-winning run on a wild pitch against Christian Brothers) were heroes for UT Martin. During the winning streak, Evans recorded a pair of wins and a save to lead the Skyhawk pitching staff , while Peyton Cain also notched a win and a save. Westfall also picked up a victory with yet another lights-out start, this time producing eight innings with one unearned run allowed off four hits and 11 strikeouts in the middle game of the SIUE series. He was once again crowned as the OVC Pitcher of the Week on April 24. Th e sweep of SIUE – combined with the aforementioned Morehead State series result – completed UT Martin’s fi rst back-to-back conference sweeps in their Division-I history (since 1993). Following a disappointing 12-6 loss at Union, the Skyhawks bounced back with a 12-2 victory against Alabama A&M. UT Martin closed out the month of April with one win in a hard-fought three-game series against Austin Peay. Despite the series result against the Governors, Eldridge went yard in each of the three games against Austin Peay. Th e Skyhawks then won four consecutive games, avenging the early loss to Union with a 9-2 win which was followed by a 6-0 road triumph at Alabama A&M as Jake Patzner dialed up eight strikeouts over seven scoreless frames. UT Martin’s bats then exploded for 32 combined runs in winning the fi rst two matchups against OVC rival Eastern Illinois before a narrow 9-8 setback in the series fi nale. Kerwin gained national recognition
following the Eastern Illinois series, as he was named National Collegiate Baseball Writers Association National Player of the Week in addition to OVC Player of the Week. Th e senior slugger produced a .500 batting average (10-for-20) with three homers, three doubles and nine RBI’s and eight runs scored over four games. Th e Skyhawks suff ered a crushing defeat against in-state power Memphis on May 9 as UT Martin could not protect a ninth-inning advantage. Th e Skyhawks led for almost the entire game until the host Tigers pushed across two runs in the bottom of the ninth for the 7-6 walkoff win. Despite outscoring Jacksonville State by a 16-15 in the series, UT Martin was only able to salvage the fi nal game in its last three home games of the season. On May 18, the Skyhawks clinched their fi rst OVC Tournament berth as they eclipsed Murray State 9-3. Cannon picked up his fi ft h win of the year while Laberge picked up his second save of the season to help blaze the trail to the postseason. While in Oxford, Ala. for the OVC Tournament, UT Martin found itself pitted against Austin Peay in the fi rst round on May 23. A four-run fi rst inning was too much for the Skyhawks to overcome but UT Martin would get on the scoreboard in the fi ft h inning, thanks to a two-run single by Albright. Th e junior second baseman would fi nish with three of the Skyhawks’ four hits but Austin Peay claimed a 6-2 win in a game that featured a 3-hour, 33-minute rain delay. Aube, who was selected as Baseball America’s 2017 Preseason OVC Freshman of the Year, cemented that hype by capturing Collegiate Baseball Freshman All-
American honors. He started 52 games, swinging to the tune of a .277 batting average, 15 stolen bases and a team-high 48 runs scored while also earning OVC All-Freshman honors. UT Martin set new school records for pitching strikeouts (429) – leading the nation in that category for a majority of the early season. Th e Skyhawks’ .967 fi elding percentage and 1,436 putouts were also program records. Th e UT Martin pitching staff led the OVC in least doubles allowed (83) and least home runs allowed (44). Eldridge paced the OVC with six triples as part of his stellar debut season while catcher Keylen Steen registered the most would-be basestealers thrown out (23) in the league. Th e 2017 campaign also saw the end of the career of Evans, who ranks in the top-10 in career wins (16, fourth), career saves (fi ve, seventh) and career strikeouts (140, 10th) despite only two seasons in a Skyhawk uniform.
SSEASON REcapEASON REcap
Dan Kerwin garnered National Player of the Week accolades for his performance following
the Eastern Illinois series.
2018 UT MARTIN BASEBALL2018 UT MARTIN BASEBALL60
FINAL STATSFINAL STATSRecord: 25-30 Home: 16-10 Away: 9-16 Neutral: 0-4 Ohio Valley: 12-18
Player avg gp-gs ab r h 2b 3b hr rbi tb slg% bb hp so gdp ob% sf sh sb-att po a e fld%
26 WESSLING, Tanner . 3 5 0 54-54 217 42 76 12 4 3 39 105 . 4 8 4 21 6 43 7 . 4 1 9 2 0 9-10 81 2 4 . 9 5 4
6 ALBRIGHT, Tyler . 3 4 3 52-51 207 46 71 13 1 5 38 101 . 4 8 8 26 6 28 5 . 4 2 2 5 2 4-5 109 138 8 . 9 6 9
28 KERWIN, Dan . 3 3 7 50-48 199 34 67 16 0 10 38 113 . 5 6 8 14 2 55 4 . 3 8 2 2 2 6-8 76 15 2 . 9 7 8
3 ASLETT, Ben . 3 0 3 33-28 89 14 27 5 0 2 14 38 . 4 2 7 8 9 14 1 . 4 0 0 4 4 0-1 9 43 9 . 8 5 2
2 STEEN, Keylen . 2 9 4 51-46 160 21 47 8 1 3 25 66 . 4 1 3 19 11 30 11 . 3 9 9 3 7 3-5 338 58 5 . 9 8 8
1 HAUSER, Josh . 2 9 2 55-55 209 30 61 9 0 1 22 73 . 3 4 9 23 2 37 4 . 3 6 4 2 6 14-18 100 138 9 . 9 6 4
7 ELDRIDGE, Creighton . 2 8 7 50-50 188 40 54 10 6 9 34 103 . 5 4 8 29 5 62 0 . 3 9 5 1 5 7-8 134 2 3 . 9 7 8
20 AUBE, Connor . 2 7 7 52-52 202 48 56 11 1 2 22 75 . 3 7 1 26 5 33 0 . 3 7 3 0 2 15-19 98 0 2 . 9 8 0
17 HELGREN, Ryan . 2 7 4 55-55 219 38 60 12 2 7 35 97 . 4 4 3 24 11 43 4 . 3 6 8 4 0 1-1 291 49 9 . 9 7 4
14 ALLEN, JoJo . 2 4 4 30-11 45 5 11 3 0 0 4 14 . 3 1 1 1 1 16 0 . 2 7 1 1 0 0-0 15 22 2 . 9 4 9
12 WORLEY, Robert . 2 4 2 30-17 66 4 16 3 0 1 9 22 . 3 3 3 3 1 14 0 . 2 8 2 1 0 0-0 104 7 2 . 9 8 2
29 ADDUCI, Anthony . 2 0 4 36-22 93 9 19 1 0 0 18 20 . 2 1 5 6 4 12 2 . 2 7 6 2 1 0-1 40 2 1 . 9 7 7
11 LAMBERT, Jordan . 2 0 0 4-0 5 0 1 1 0 0 1 2 . 4 0 0 0 0 1 1 . 2 0 0 0 0 0-0 0 0 0 . 0 0 0
37 BREWER, Caleb . 1 7 6 13-4 17 2 3 1 0 0 2 4 . 2 3 5 4 0 8 0 . 3 3 3 0 3 0-1 15 2 1 . 9 4 4
21 SHRODE, Carson . 0 0 0 16-2 14 2 0 0 0 0 0 0 . 0 0 0 1 0 8 0 . 0 6 7 0 0 0-0 1 0 1 . 5 0 0
Totals . 2 9 5 55 1930 335 569 105 15 43 301 833 . 4 3 2 205 63 404 39 . 3 7 6 27 32 59-77 1436 563 68 . 9 6 7
Opponents . 2 8 8 55 1870 374 539 83 15 44 335 784 . 4 1 9 293 58 429 43 . 3 9 6 24 22 72-105 1447 542 74 . 9 6 4
LOB - Team (475), Opp (458). DPs turned - Team (50), Opp (44). CI - Team (1), STEEN 1. IBB - Team (2), HAUSER 2, Opp (3).Picked off - HAUSER 2, STEEN 2, WESSLING 2, SHRODE 1, AUBE 1, WORLEY 1, KERWIN 1.
(All games Sorted by Earned run avg)
Player era w-l app gs cg sho sv ip h r er bb so 2b 3b hr b/avg wp hp bk sfa sha
25 EVANS, Alex 5 . 1 1 8-5 28 0 0 0/2 4 68.2 78 42 39 25 73 18 1 8 . 2 8 7 5 4 1 1 331 WESTFALL, Dalton 5 . 2 4 5-6 14 14 0 0/1 0 80.2 77 52 47 62 81 6 0 2 . 2 6 1 17 15 2 2 415 CAIN, Peyton 5 . 4 5 1-6 22 10 0 0/1 1 72.2 88 56 44 23 48 11 3 7 . 2 9 2 2 7 2 2 433 SECKINGER, Shane 5 . 5 7 0-0 19 0 0 0/1 0 32.1 33 22 20 23 27 9 0 1 . 2 7 5 3 1 0 2 332 BAZZANI, Dom 6 . 2 6 1-2 6 6 0 0/0 0 23.0 25 19 16 22 24 4 1 4 . 2 7 8 3 2 0 2 139 PATZNER, Jake 6 . 5 4 2-4 14 9 0 0/1 0 42.2 47 34 31 26 41 6 0 1 . 2 8 7 11 11 4 3 022 CANNON, Winston 6 . 7 1 5-4 13 10 0 0/1 0 59.0 62 48 44 45 47 10 3 5 . 2 8 2 6 3 1 4 213 FOLKS, Sam 7 . 1 2 2-0 15 3 0 0/0 0 36.2 43 35 29 23 35 7 2 7 . 2 9 7 9 6 1 3 223 LABERGE, Kyle 7 . 6 8 1-3 16 3 0 0/0 2 36.1 51 35 31 21 26 4 2 5 . 3 4 0 3 2 0 3 235 AHERIN, Konnor 8 . 2 2 0-0 8 0 0 0/0 0 7.2 15 9 7 3 7 5 1 1 . 4 0 5 1 2 1 1 010 EDWARDS, Collin 8 . 4 4 0-0 10 0 0 0/0 0 10.2 11 10 10 10 9 0 2 1 . 2 6 2 5 1 1 1 041 BORSKI, Tyler 11.88 0-0 7 0 0 0/0 0 8.1 9 12 11 10 11 3 0 2 . 2 6 5 0 4 1 0 1Totals 6 . 1 9 25-30 55 55 0 3/3 7 478.2 539 374 329 293 429 83 15 44 . 2 8 8 65 58 14 24 22
Opponents 5 . 2 4 30-25 55 55 0 4/4 8 482.1 569 335 281 205 404 105 15 43 . 2 9 5 65 63 6 27 32
PB - Team (6), STEEN 5, KERWIN 1, Opp (12). Pickoffs - Team (12), FOLKS 3, LABERGE 3, STEEN 2, SECKINGER 1, CANNON 1, KERWIN1, BAZZANI 1, Opp (10). SBA/ATT - STEEN (63-86), PATZNER (15-19), CANNON (14-18), KERWIN (8-14), LABERGE (12-14), WESTFALL(3-11), CAIN (6-10), FOLKS (7-10), EVANS (4-8), BAZZANI (5-6), SECKINGER (1-4), EDWARDS (3-3), AHERIN (2-2), BREWER (1-1).
2018 SKYHAWK BASEBALL2018 SKYHAWK BASEBALL 61
FINAL OVC STATSFINAL OVC STATSRecord: 12-18 Home: 6-9 Away: 6-9 Ohio Valley: 12-18
Player avg gp-gs ab r h 2b 3b hr rbi tb slg% bb hp so gdp ob% sf sh sb-att po a e fld%
28 KERWIN, Dan . 3 6 9 27-25 111 19 41 10 0 9 26 78 . 7 0 3 6 0 34 4 . 4 0 2 0 0 5-5 36 7 1 . 9 7 7
2 STEEN, Keylen . 3 4 4 29-25 93 13 32 5 0 3 15 46 . 4 9 5 10 5 18 8 . 4 3 5 0 7 2-2 171 21 2 . 9 9 0
6 ALBRIGHT, Tyler . 3 3 3 29-28 117 20 39 7 0 4 21 58 . 4 9 6 12 3 14 4 . 4 0 0 3 0 3-4 71 87 5 . 9 6 9
20 AUBE, Connor . 3 2 1 28-28 109 27 35 7 1 1 12 47 . 4 3 1 16 4 16 0 . 4 2 6 0 0 9-11 56 0 1 . 9 8 2
26 WESSLING, Tanner . 3 2 0 30-30 122 24 39 4 2 2 17 53 . 4 3 4 11 5 26 6 . 3 9 3 2 0 3-3 44 1 1 . 9 7 8
1 HAUSER, Josh . 3 1 5 30-30 108 18 34 7 0 1 13 44 . 4 0 7 12 1 18 4 . 3 8 5 1 3 8-10 52 86 2 . 9 8 6
12 WORLEY, Robert . 2 9 0 15-7 31 2 9 1 0 0 5 10 . 3 2 3 2 0 5 0 . 3 2 4 1 0 0-0 40 3 1 . 9 7 7
17 HELGREN, Ryan . 2 8 5 30-30 123 19 35 8 1 5 20 60 . 4 8 8 9 6 24 4 . 3 6 0 1 0 0-0 200 26 5 . 9 7 8
7 ELDRIDGE, Creighton . 2 7 8 30-30 115 22 32 6 3 6 18 62 . 5 3 9 19 2 35 0 . 3 9 0 0 3 4-5 76 2 3 . 9 6 3
3 ASLETT, Ben . 2 7 7 22-20 65 13 18 2 0 2 11 26 . 4 0 0 5 5 11 0 . 3 5 4 4 4 0-1 4 36 5 . 8 8 9
14 ALLEN, JoJo . 2 3 8 17-6 21 1 5 1 0 0 1 6 . 2 8 6 1 1 8 0 . 2 9 2 1 0 0-0 7 9 1 . 9 4 1
29 ADDUCI, Anthony . 1 7 8 17-11 45 3 8 0 0 0 4 8 . 1 7 8 2 2 7 0 . 2 4 5 0 0 0-1 14 0 0 1.000
37 BREWER, Caleb . 0 0 0 5-0 2 0 0 0 0 0 0 0 . 0 0 0 2 0 1 0 . 5 0 0 0 0 0-0 1 0 0 1.000
21 SHRODE, Carson . 0 0 0 8-0 2 2 0 0 0 0 0 0 . 0 0 0 1 0 2 0 . 3 3 3 0 0 0-0 0 0 0 . 0 0 0
Totals . 3 0 7 30 1064 183 327 58 7 33 163 498 . 4 6 8 108 34 219 30 . 3 8 5 13 17 34-42 786 330 34 . 9 7 0
Opponents . 3 0 2 30 1031 216 311 47 10 28 198 462 . 4 4 8 165 27 207 29 . 4 0 7 13 14 31-44 796 310 34 . 9 7 0
LOB - Team (257), Opp (248). DPs turned - Team (33), Opp (33). IBB - Team (0), Opp (3). Picked off - HAUSER 2, STEEN 2,WESSLING 2, WORLEY 1, AUBE 1, SHRODE 1.
(Ohio Valley games only Sorted by Earned run avg)
Player era w-l app gs cg sho sv ip h r er bb so 2b 3b hr b/avg wp hp bk sfa sha
41 BORSKI, Tyler 0 . 0 0 0-0 2 0 0 0/0 0 2.2 1 0 0 3 3 0 0 0 . 1 1 1 0 1 1 0 031 WESTFALL, Dalton 5 . 4 3 3-3 9 9 0 0/0 0 54.2 53 36 33 44 46 4 0 1 . 2 6 6 7 8 1 2 333 SECKINGER, Shane 5 . 5 6 0-0 8 0 0 0/0 0 11.1 11 7 7 6 7 3 0 1 . 2 6 8 0 1 0 1 223 LABERGE, Kyle 5 . 5 9 1-3 10 3 0 0/0 2 29.0 30 22 18 17 21 2 2 3 . 2 7 5 2 0 0 2 125 EVANS, Alex 5 . 7 5 4-2 15 0 0 0/1 3 36.0 48 24 23 11 37 11 1 6 . 3 2 2 3 3 0 0 222 CANNON, Winston 5 . 8 3 3-3 9 7 0 0/1 0 46.1 47 33 30 36 36 9 2 4 . 2 7 3 5 0 1 3 115 CAIN, Peyton 6 . 3 6 1-5 13 8 0 0/0 1 52.1 65 42 37 19 30 8 3 4 . 3 0 4 2 6 0 2 413 FOLKS, Sam 9 . 0 0 0-0 6 0 0 0/0 0 12.0 18 16 12 10 10 3 1 3 . 3 5 3 3 3 1 1 135 AHERIN, Konnor 11.25 0-0 4 0 0 0/0 0 4.0 8 7 5 1 5 3 0 1 . 3 8 1 0 1 1 0 032 BAZZANI, Dom 14.40 0-1 2 2 0 0/0 0 5.0 10 8 8 7 6 1 0 3 . 4 1 7 2 1 0 0 010 EDWARDS, Collin 15.43 0-0 4 0 0 0/0 0 4.2 7 8 8 6 3 0 1 1 . 3 6 8 1 1 1 1 039 PATZNER, Jake 29.25 0-1 3 1 0 0/0 0 4.0 13 13 13 5 3 3 0 1 . 5 6 5 1 2 0 1 0Totals 6 . 6 6 12-18 30 30 0 1/1 6 262.0 311 216 194 165 207 47 10 28 . 3 0 2 26 27 6 13 14
Opponents 5 . 1 2 18-12 30 30 0 1/1 7 265.1 327 183 151 108 219 58 7 33 . 3 0 7 36 34 5 13 17
PB - Team (2), STEEN 2, Opp (7). Pickoffs - Team (8), LABERGE 3, FOLKS 2, CANNON 1, STEEN 1, BAZZANI 1, Opp (9). SBA/ATT -STEEN (28-34), CANNON (6-10), KERWIN (3-8), LABERGE (7-8), CAIN (4-7), EVANS (2-5), FOLKS (5-5), WESTFALL (2-4), PATZNER(3-3), AHERIN (1-1), BAZZANI (1-1).
2018 UT MARTIN BASEBALL2018 UT MARTIN BASEBALL62
All-TIMEAll-TIMERECORDSRECORDS
2018 SKYHAWK BASEBALL2018 SKYHAWK BASEBALL 63
All-AmericanBryant Jones (2B)................................2004
Freshman All-AmericanWes Patterson (1B) .............................2008Phil Sorensen (DH) .............................2011Ben Upton (DH) ..................................2014Connor Aube (OF) ..............................2017
First Team All-OVCMark Otsby (DH) ................................1993Michael Blount (P) ..............................1996Bryant Jones (2B)................................2004Phil Sorensen (DH) .............................2011
Second Team All-OVCBrett Vander Meeden (2B) ..................1994Steve Gadlage (OF) ..............................1994Bryan Bullington (1B) ..........................1995Brad Warmath (3B) .............................1997Brian Baker (OF) ..................................2000Brady Nighswonger (2B) ......................2003Scott Gladstone (2B)............................2009Mark Hartsfield (3B) ............................2009Miles Hartsfield (OF) ...........................2009Coty Green (P) .....................................2010Ty Nelson (C) .......................................2010Trey Karlen (3B) ...................................2010Jordan Owen (OF)................................2010Jordan Owen (OF)................................2012
OVC All-FreshmenEric Walker (P) ....................................2006Shayne Martin (SS) .............................2007Wes Patterson (1B/P) .........................2008Dan Tobik (P) ......................................2010Brent Morris (OF) ...............................2010Phil Sorensen (DH) .............................2011Sonny Mastromatteo (IF) ...................2012Nico Zych (IF) ......................................2012Ben Upton (DH) ..................................2014Dillon Symon (P) .................................2015Connor Aube (OF) ..............................2017
OVC Medal of HonorTrent Latta .....................................1995-96Joseph Bacon .................................1998-99Joey Price ......................................2001-02Douglas Nicodemus .......................2002-03Micky Dobson ................................2002-03Zach Parham ..................................2003-04Zach Parham ..................................2004-05Zach Parham ..................................2005-06Zach Parham ..................................2006-07Douglas Nicodemus .......................2006-07Cody Terry .....................................2009-10Cody Terry .....................................2010-11Jacob Gansert ................................2012-13Taylor Douglas ...............................2013-14Drew Erie .......................................2013-14Jacob Gansert ................................2013-14Taylor Douglas ...............................2014-15Jacob Gansert ................................2014-15Carter Smith ..................................2014-15Drew Erie .......................................2015-16Winston Cannon ............................2016-17
Division II All-AmericanDon Jackson, 1B..................................1973Richard Craven, SS (2nd Team) ...........1985
Division II Academic All-AmericanDon Jackson, 1B..................................1978Mike Prather, P (3rd Team) .................1984
Division II All-RegionHarry McLead, SS ...............................1977David Couch, RF..................................1977Dale Horn, CF .....................................1977Richard Craven, SS ..............................1985Jim Willis, CF .......................................1985Churchill Moore, CF ............................1986Jimmy Moore, CF ................................1992Hunter McClemore, DH ......................1992Chris Ervin, SS (2nd Team) ..................1992
All-Gulf South ConferenceDon Jackson, 1B..................................1973Walter Glass, OF .................................1975Walter Glass, OF .................................1976David Couch, OF .................................1977Danny Hensley, INF .............................1979Mike Bennett, P ..................................1980Tom Walston, INF ...............................1980Donnie Mitchell, 3B ............................1981Mike Prather, P ...................................1984Richard Craven, INF ............................1985Roger Gum, INF ..................................1987
Gulf South Conference All-DivisionMike Donohue, INF ............................1972Joe Kuchar, P ......................................1972Don Jackson, INF ................................1973Larry Long, INF ...................................1973Jay Johnson, C ....................................1973Dick Windbigler ..................................1973Jim Moloney, P ...................................1974Mike Shambre, OF ..............................1974Walter Glass, OF .................................1975Danny Mitchell, P ...............................1975Mike Moore, UTL ................................1975Mark Stafford, INF ..............................1975Walter Glass, OF .................................1976Dale Horn, OF .....................................1976David Couch, OF .................................1977Dale Horn, OF .....................................1977Mack Moore, C ...................................1977David Couch, OF .................................1978Carey Smith, INF .................................1978Danny Hensley, INF .............................1979Bill Zipp, OF ........................................1979Jim Willis, INF .....................................1983Gary Pitman, C ...................................1983Mike Prather, P ...................................1984Bruce Beckman, P...............................1985Jim Willis, OF ......................................1985Churchill Moore, OF ...........................1986Martin Newby, P .................................1986Roger Gum, INF ..................................1987Churchill Moore, OF ...........................1987Darrel Risberg, OF ..............................1988Scott McMackin, INF ..........................1989Kyle Coleman, 1B ................................1989Greg King, OF......................................1990Richard Matz, UTL ..............................1990Greg King, OF......................................1991
*Eastern Division 1972-79, North Division 1983-86, West Division 1987-A
Gulf South Conference All-DistrictHarry McLead, SS ...............................1977David Couch, RF..................................1977Dale Horn, CF .....................................1977Richard Craven, SS ..............................1985Jim Willis, CF .......................................1985Churchill Moore, CF ............................1986
1993-94Bradley DyerScott EmbryJeff Graves Trent LattaJoseph Lee Jay Trussler
Brett Vander Meeden
1994-95Mitchell Dunn
Trent Latta Jay TrusslerHal Williams
1995-96Scott Haddock
Trent LattaSkipper McGille
Daisuke OdaJohnnie SanfratelloMichael Spaulding
Jay TrusslerBrad Vander Meeden
Randall VannesteMichael Wyatt
1996-97Scott HaddockChad Pritchett
Johnnie Sanfratello
1997-98Casey BevisScott Hall
Charles SeymourJohnathon Smartt
Joseph SmithChristopher Weaver
1998-99Joseph BaconCasey Bevis
Charles SeymourJohnathon Smaett
1999-00Joseph BaconLanier EnglishAdam Gibson
2000-01Joseph AyersWes Bacon
Clay BillingsleyRichard Collins
Kelly DavisLanier EnglishJustin EntrekinAdam GibsonHunter HartJuan Romero
2001-02Justin Bryant
Kelly DavisAdam Gibson
Joey Price
2002-03Justin BryantDonnie Corey
Kelly DavisMicky Dobson
Douglas NicodemusJarrad Robinson
2003-04Nick BrunerJustin Bryant
Micky DodsonMichael FabrizioJeffery McClean
Benjamin MeadorDouglas Nicodemus
Zach ParhamJacob Smothers
2004-05Nick BrunerJustin Bryant
Micky DodsonJeffery McClean
Miles MooreDouglas Nicodemus
Zach ParhamJoe Raccuglia
Jacob SmothersEric Walker
2005-06Zane GresbackNick LatimerDerek Link
Scott McLeanDouglas Nicodemus
Zach ParhamJoe RaccugliaChris Rezabek
Chris SiskJacob Smothers
2006-07Adam BowkerBryce Carden
Jason HockadayScott McLean
Douglas NicodemusZach ParhamLance RentonChris Rezabek
Eric Walker Nate Walters
2007-08Lin Cates
Scott GladstoneMark HartsfieldMiles HartsfieldTanner Hensley
Jay HowardChris Rezabek
Cody Terry Eric Walker
Nate WaltersNick Walters
2008-09Ben Bottoms
Lin CatesDrew Flaniken
Miles HartsfieldTanner Hensley
Kevin HoltJay Howard
Brendan LozuponeCody Terry
2009-10Wes Alsup
Ben BrewerDylan CupplesMatt Haynes
Pat JonesTrey KarlenTy NelsonCody TerryMatt Young
2010-11Ben Brewer
Dylan CupplesMatt HaynesTrey KarlenErik Larsen
Brendan LozuponeHagen Nelson
Eric RansonPhil SorensenJordan Stokes
Cory StooksburyCody TerryDan Tobik
Nick WilsonMatt Young
2011-12Taylor Cox
Matt HaynesDanny Kelley
Brendan LozuponeTrevor Lundgrin
Sonny MastromatteoAlec Mills
Hagen NelsonJordan OwenDalton PottsCarter SmithPhil SorensenJordan Stokes
Dan TobikMatt Young
2012-13Isaac Armstrong
Taylor CoxDrew Erie
Jacob GansertStu Jones
Trevor LundgrinHagen NelsonDalton Potts
Chris RossCarter SmithPhil SorensenJordan Stokes
Dan TobikNico Zych
2013-14Alex Boshers
Taylor CoxTaylor Douglas
Drew ErieJacob Gansert
Stu JonesDalton Potts
Chris RossJohn SkubinaCarter SmithPhil Sorensen
Nico Zych
2014-15Patrick Bernard
Isaac CarrelTaylor Douglas
Drew ErieJacob Gansert
Matt HirschFletcher Johnson
Dalton PottsNick PribbleGary Price
Daniel ShawCarter SmithDillon Symon
Jackson Zarubin
2015-16Patrick Bernard
Drew ErieSadler Goodwin
Matt HirschNick Pribble
Adam RimmerShane SeckingerCarson ShrodeBlake Williams
2016-17Anthony Adduci
Tyler AlbrightTyler BorskiPeyton Cain
Winston CannonRyan Helgren
Shane SeckingerCarson ShrodeBlake WilliamsDalton Westfall
UT MARTIN HALL OF FAME MEMBERSUT MARTIN HALL OF FAME MEMBERS(Year indicates when player was inducted)
OVC Commissioner’s Honor RollOVC Commissioner’s Honor Roll
• Frank Taylor (1983)• Paul Redick (1984)
• Lionel Barrett (1985)• George Horton (1986)
• Don Jackson (1987)• Halladay T. Short (1989)
• Walter Glass (1991) • Jim Swope (1992)
• Dan Bunn (1993)• Eddy Eckert (1994)
• Jim Willis (1996)• Richard Craven (1997)
• Ray Frame (1999)• Jimmy Welch (2003)• Donnie Jones (2004)• Mike Fortune (2005)
• Greg King (2005)• Jody Fuller (2007)
• Randy Horn (2008)• Dick Algire (2009)
• Cliff Sturdivant (2010)• Mike Hayes (2011)• Mack Terry (2013)
• Bryant Jones (2017)
NOTABLE SKYHAWKSNOTABLE SKYHAWKS
2018 UT MARTIN BASEBALL2018 UT MARTIN BASEBALL64
YEARLY DIVISION-I LEADERSYEARLY DIVISION-I LEADERSBatting Average
1993 Mark Ostby .3131994 Jimmy Carey .4321995 Bryan Bullington .3771996 Daisuke Oda .3461997 Erik Morgan .3311998 Sco Hall .3781999 Chuck Seymour .3312000 Heath Doyle .3482001 Brad Meadows .3422002 Kelly Davis .3162003 Brady Nighswonger .3572004 Bryant Jones .4252005 Blake Turner .3042006 Bre Spivy .3212007 Bryce Carden .3292008 Sco Gladstone .3162009 Sco Gladstone .4202010 Ty Nelson .3962011 Drew Mason .3582012 Jordan Owen .3322013 Wade Collins .3142014 Taylor Douglas .3412015 Taylor Douglas .3322016 Ryan Helgren .3212017 Tanner Wessling .350
At Bats1993 Kevin Barger 1541994 Mark Bu rum 147 Mitch Dunn 147 Steve Gadlage 147 Bre VanderMeeden 1471995 Mitch Dunn 1881996 Chad Wya 1641997 Johnnie Sanfratello 1661998 Sco Hall 1801999 Lanier English 1972000 Paul Slack 1742001 Lanier English 1952002 Adam Gibson 2002003 Bryant Jones 1842004 Bryant Jones 2262005 Nick Bruner 2052006 Zach Dean 2032007 Lance Renton 1932008 Sco Gladstone 1962009 Cody Terry 2132010 Cody Terry 2282011 Cody Terry 2282012 Jordan Owen 1992013 Grant Glasser 1922014 Taylor Douglas 1792015 Taylor Douglas 2172016 Aus n Taylor 2042017 Ryan Helgren 219
Runs1993 Chris Ervin 321994 Jimmy Carey 361995 Mitch Dunn 391996 Chad Wya 291997 Johnnie Sanfratello 371998 Chuck Seymour 411999 Chuck Seymour 412000 Brian Baker 382001 Brad Meadows 322002 Adam Gibson 422003 Brian Jordan 432004 Bryant Jones 552005 Zach Dean 372006 Zach Dean 312007 Kyle Dudley 402008 Sco Gladstone 372009 Mark Hartsfi eld 562010 Trey Karlen 612011 Trey Karlen 552012 Jordan Owen 332013 Grant Glasser 29
2014 Taylor Douglas 332015 Taylor Douglas 40 Andrew Cas llo 402016 Andrew Cas llo 372017 Connor Aube 48
Hits1993 Mark Ostby 451994 Bre VanderMeeden 471995 Bryan Bullington 631996 Daisuke Oda 551997 Erik Morgan 50 Johnnie Sanfratello 501998 Sco Hall 681999 Lanier English 612000 Brian Baker 532001 Brad Meadows 552002 Adam Gibson 582003 Brady Nightswonger 652004 Bryant Jones 962005 Nick Bruner 572006 Zach Dean 612007 Kyle Dudley 622008 Sco Gladstone 622009 Sco Gladstone 842010 Ty Nelson 842011 Cody Terry 722012 Jordan Owen 662013 Grant Glasser 532014 Taylor Douglas 612015 Taylor Douglas 722016 Aus n Taylor 612017 Tanner Wessling 76
Doubles1993 Kevin Barger 121994 Ma Bu rum 10 Steve Gadlage 10 Bre VanderMeede 101995 Bryan Bullington 141996 Brad Warmath 151997 Johnnie Sanfratello 111998 Sco Hall 121999 Sco Hall 142000 Brian Baker 122001 Brad Meadows 142002 Dan Stephens 11 Adam Gibson 112003 Kelly Davis 132004 Adam Salter 142005 Chris Rezabek 112006 Bre Spivy 112007 Lance Renton 162008 William Blackmon 112009 Wes Pa erson 152010 Trey Karlen 222011 Trey Karlen 192012 Jordan Owen 112013 Byron Johann 132014 Taylor Douglas 152015 Taylor Douglas 182016 Dan Kerwin 162017 Dan Kerwin 16
Triples1993 Chris Ervin 21994 Steve Gadlage 41995 Bre Young 21996 Troy Crawford 21997 Troy Crawford 31998 Sco Hall 1 Paul Slack 1 Kirk Davison 11999 Lanier English 22000 Heath Doyle 1 Troy Crawford 1 Paul Slack 1 Desmond O’Quine 1 Michael Roof 1
2001 Lanier English 32002 Brian Jordan 32003 Dan Stephens 2 Kelly Davis 22004 Bryant Jones 32005 Zach Dean 42006 Hideaki Sato 2 Zach Dean 22007 Blake Turner 42008 Shayne Mar n 2 Mark Hartsfi eld 22009 Mark Hartsfi eld 32010 Ty Nelson 42011 Cody Terry 32012 Jordan Owen 62013 Brent Morris 22014 Taylor Cox 1 Ben Upton 1 Jake Deason 1 Fletcher Johnson 12015 Taylor Douglas 2 Nico Zych 2 Andrew Massey 22016 Fletcher Johnson 32017 Creighton Eldridge 6
Home Runs1993 Mark Ostby 81994 Bre VanderMeeden 91995 Bryan Bullington 111996 Daisuke Oda 71997 Erik Morgan 101998 Chuck Seymour 111999 Chuck Seymour 82000 Brian Baker 152001 Brad Meadows 72002 Brad Meadows 8 Don Waller 82003 Brian Jordan 92004 Bre Spivy 72005 Bre Spivy 42006 Bre Spivy 82007 Bryce Carden 4 Kyle Dudley 42008 Wes Pa erson 102009 Mark Hartsfi eld 122010 Jordan Owen 182011 Trey Karlen 92012 Jordan Owen 82013 Wade Collins 3 Byron Johann 32014 Taylor Douglas 72015 Taylor Douglas 112016 Ryan Helgren 6 Aus n Taylor 62017 Dan Kerwin 10
Runs Batted In1993 Mark Ostby 271994 Bre VanderMeeder 431995 Bryan Bullington 441996 Daisuke Oda 281997 Erik Morgan 401998 Chuck Seymour 431999 Sco Hall 302000 Brian Baker 382001 Brad Meadows 362002 Adam Gibson 40 Don Waller 402003 Dan Stephens 422004 Bre Spivy 452005 Nick Bruner 332006 Lance Renton 28 Bre Spivy 28 Blake Turner 282007 Lance Renton 342008 Wes Pa erson 29 Miles Hartsfi eld 29 William Blackmon 29
2009 Miles Hartsfi eld 522010 Wes Pa erson 642011 Trey Karlen 462012 Jordan Owen 282013 Wade Collins 252014 Taylor Douglas 292015 Taylor Douglas 472016 Aus n Taylor 392017 Tanner Wessling 39
Total Bases1993 Mark Ostby 761994 Bre VanderMeeden 861995 Bryan Bullington 1121996 Daisuke Oda 921997 Erik Morgan 861998 Sco Hall 881999 Chuck Seymour 882000 Brian Baker 1102001 Brad Meadows 902002 Adam Gibson 852003 Brady Nighswonger 952004 Bryant Jones 1332005 Zach Dean 742006 Zach Dean 842007 Kyle Dudley 892008 Will Blackmon 822009 Mark Hartsfi eld 1312010 Trey Karlen 1452011 Trey Karlen 1142012 Jordan Owen 1132013 Grant Glasser 712014 Taylor Douglas 972015 Taylor Douglas 1272016 Aus n Taylor 932017 Dan Kerwin 113
Slugging Percentage1993 Mark Ostby .5281994 Bre VanderMeeden .5851995 Bryan Bullington .6711996 Daisuke Oda .5791997 Erik Morgan .5701998 Chuck Seymour .6081999 Chuck Seymour .5502000 Brian Baker .6362001 Brad Meadows .5592002 Don Waller .5102003 Luke Parham .6672004 Bryant Jones .5882005 Zach Dean .4092006 Bre Spivy .5772007 Blake Turner .4862008 Wes Pa erson .6022009 Miles Hartsfi eld .6392010 Trey Karlen .6712011 Phil Sorensen .5372012 Jordan Owen .5682013 Wade Collins .4882014 Taylor Douglas .5422015 Taylor Douglas .5852016 Ryan Helgren .5452017 Dan Kerwin .568
Walks1993 Chris Ervin 231994 Jimmy Carey 131995 Randall Harvey 251996 Randall Harvey 261997 Paul Slack 271998 Chuck Seymour 341999 Paul Slack 282000 Paul Slack 212001 Joe Ayers 222002 Adam Gibson 212003 Hunter Hart 352004 Hunter Hart 282005 Brian Berryman 252006 Blake Turner 25
2007 Chad Green 302008 Kyle Dudley 202009 Wes Pa erson 292010 Trey Karlen 312011 Chase Okey 412012 Chase Okey 26 Grant Glasser 262013 Grant Glasser 192014 Chase Young 322015 Ma Hirsch 322016 Ma Hirsch 282017 Creighton Eldridge 29
Stolen Bases1993 Kevin Ray 61994 Jimmy Carey 131995 Mitch Dunn 61996 Brad Warmath 31997 Troy Crawford 61998 Sco Hall 61999 Brad Smith 112000 Brian Baker 162001 Lanier English 132002 Adam Gibson 72003 Hunter Hart 52004 Bryant Jones 182005 Zach Dean 122006 Blake Turner 82007 Chad Green 202008 Bryce Carden 52009 Mark Hartsfi eld 92010 Trey Karlen 302011 Trey Karlen 212012 Sonny Mastroma eo 92013 Grant Glasser 92014 Taylor Douglas 162015 Taylor Douglas 112016 Andrew Cas llo 8 Fletcher Johnson 82017 Connor Aube 15
Stolen Base Percentage(minimum 5 atempts)
1993 Kevin Ray .750 (6-8)1994 Bre VanderMeeden1.000 (6-6)1995 Mitch Dunn .750 (6-8)1996 Johnnie Sanfratello .429 (3-7)1997 Troy Crawford .600 (6-10)1998 Brad Smith .833 (5-6)1999 Brad Smith 1.000 (11-11)2000 Joe Ayers .857 (6-7)2001 Lanier English .929 (13-14)2002 Brad Meadows .714 (5-7)2003 Hunter Hart .500 (5-10)2004 Kayo Anderson 1.000 (5-5)2005 Bre Spivy 1.000 (6-6)2006 Blake Turner .800 (8-10)2007 Bryce Carden 1.000 (5-5)2008 Bryce Carden .555 (5-9)2009 Mark Hartsfi eld .900 (9-10)2010 Brent Morris 1.000 (10-10)2011 Ma Young 1.000 (7-7)2012 Ma Young .857 (6-7)2013 Nico Zych 1.000 (7-7)2014 Fletcher Johnson .889 (8-9)2015 Jake Deason .909 (10-11)2016 Josh Hauser 1.000 (7-7)2017 Tanner Wessling .900 (9-10)
2018 SKYHAWK BASEBALL2018 SKYHAWK BASEBALL 65
Putouts1993 Hunter McLemore 3451994 Chris Clapper 2041995 Bryan Bullington 3401996 Sco VanNeste 2171997 Chad Pritche 1471998 Chuck Seymour 3361999 Chuck Seymour 3622000 Joe Ayers 3142001 Joe Ayers 2922002 Don Waller 2602003 Brian Jordan 3622004 Brian Berryman 3312005 Brian Berryman 3092006 Jason Hockaday 3572007 Sco McLean 3262008 Wes Pa erson 2292009 Wes Pa erson 2752010 Wes Pa erson 4132011 Wes Pa erson 3762012 Phil Sorensen 3382013 Wade Collins 2632014 Phil Sorensen 2122015 Nico Zych 3672016 Nick Pribble 3282017 Keylen Steen 338
Assists1993 Chris Ervin 1411994 Bre VanderMeeden 1191995 Bre Young 1531996 Chad Wya 1231997 Kyle Hodge 1031998 Kyle Hodge 1091999 Brad Smith 1232000 Pual Slack 962001 Bryant Jones 1072002 Brady Nighswonger 1102003 Brady Nighswonger 1072004 Bryant Jones 1212005 Jason Moore 1552006 Lance Renton 1492007 Chad Green 1102008 Sco Gladstone 1332009 Sco Gladstone 1342010 Cody Terry 1642011 Cody Terry 1722012 Sonny Mastroma eo 1452013 Sonny Mastroma eo 125 Nico Zych 1252014 Jake Deason 1162015 Ma Hirsch 1292016 Josh Hauser 1342017 Tyler Albright 138 Josh Hauser 138
Fielding Percentage1993 Hal Williams 1.0001994 Travis Walters .9871995 Randall Harvey .9761996 Skipper McGill .9951997 Johnnie Sanfratello .9791998 Chuck Seymour .9861999 Sco Hall .9802000 Heath Doyle .9832001 Lanier English 1.0002002 Adam Gibson .9772003 Ryan Bethel .9892004 Sco McLean 1.0002005 Blake Turner 1.0002006 Bryan Harvey 1.0002007 Blake Turner 1.0002008 Chris Sisk 1.0002009 Jordan Owen 1.0002010 Ty Nelson .9952011 Wes Pa erson .9922012 Grant Glasser 1.0002013 Ben Brewer .9852014 Fletcher Johnson 1.0002015 Fletcher Johnson 1.0002016 Nick Pribble .986
2017 Keylen Steen .988
Earned Run Average1993 David Strange 4.091994 Jeff Graves 2.451995 Brad VanderMeeden 3.051996 Michael Blount 3.211997 Jason Alford 3.051998 Jody Fuller 5.821999 T. J. Allen 4.302000 Bobby Alford 4.702001 Bobby Alford 3.602002 Brad Meadows 2.822003 Jus n Bryant 5.432004 Ben Meador 5.962005 Sco Massey 3.862006 Eric Walker 3.702007 Travis Webb 4.022008 Calen Su on 4.922009 Travis Webb 4.742010 Dan Tobik 3.632011 Dan Tobik 5.642012 Dan Tobik 2.782013 Stu Jones 3.182014 John Houston 2.182015 Dillon Symon 3.952016 Alan Rickman 5.622017 Alex Evans 5.11
Wins1993 David Strange 81994 David Strange 3 Brad Dyer 31995 Brian Rosbury 41996 Michael Blount 51997 Michael Blount 41998 Michael Blount 51999 Wesley Freeman 52000 Heath Doyle 52001 Brad Meadows 42002 T. J. Allen 52003 Jus n Bryant 52004 Ben Meador 52005 Sco Massey 3 Jus n Bryant 32006 Chadwick Cameron 4 Ryan Rockholt 42007 Ryan Rockholt 4 Chadwick Cameron 42008 Calen Su on 42009 Coty Green 42010 Coty Green 92011 Alec Mills 72012 Alec Mills 42013 Dalton Po s 42014 John Houston 32015 Carter Smith 42016 Alex Evans 82017 Alex Evans 8
Appearances1993 Curt Lee 201994 Tim Frye 171995 Brian Rosbury 17 Jody Fuller 171996 Jody Fuller 201997 Jay Lasley 201998 Jason Alford 171999 Ed Gover 242000 Heath Doyle 212001 Brad Meadows 202002 Jason Venczel 232003 Dus n Summers 252004 Dus n Summers 302005 Dus n Summers 28 Micky Dobson 282006 Chadwick Cameron 252007 Travis Webb 282008 Lin Cates 222009 Drew Flaniken 272010 Drew Flaniken 28
2011 Alec Mills 302012 Dan Tobik 272013 Chris Ross 19 Trevor Lundgrin 192014 John Houston 232015 Patrick Bernard 252016 Adam Rimmer 262017 Alex Evans 28
Complete Games1993 Chris Payne 51994 Chris Payne 51995 Brian Rosbury 51996 Michael Blount 41997 Michael Blount 31998 Jody Fuller 71999 Wesley Freeman 72000 Heath Doyle 42001 Jason Sullivan 72002 Brad Meadows 3 Jason Sullivan 3 T. J. Allen 32003 Donnie Corey 42004 Ben Meador 22005 Sco Massey 42006 Jacob Smothers 32007 William Blackmon 1 Eric Walker 1 Adam Ledlow 12008 Calen Su on 32009 Coty Green 42010 Coty Green 12011 None 2012 None 2013 None 2014 Alex Mar n 12015 Carter Smith 1 Ma Poteete 12016 Dom Bazzani 1 Patrick Bernard 12017 None
Shutouts1993 Chris Payne 11994 Chris Payne 11995 Trent La a 11996 Michael Blount 21997 Chris Meyer 1 Michael Blount 11998 Jody Fuller 11999 Wesley Freeman 12000 None 2001 None 2002 Brad Meadows 1 T. J. Allen 12003 None 2004 None 2005 None 2006 Derek Link 12007 None 2008 Calen Su on 12009 None 2010 None 2011 None 2012 None 2013 None 2014 None2015 None2016 None 2017 None
Saves1993 Curt Lee 21994 Curt Lee 2 Tim Frye 21995 Trent La a 1 Michael Blount 1 Brian Rosbury 1 Jody Fuller 11996 Chad McDowell 2 Jody Fuller 2
1997 Jay Lasley 31998 Jody Fuller 21999 Ed Gover 22000 Luke Rogers 22001 Brad Meadows 1 Casey Bevis 12002 Jason Venczel 32003 Dus n Summers 1 Bre Hall 1 Sco Massey 12004 Adam Ledlow 32005 Dus n Summers 32006 Chadwick Cameron 62007 Chadwick Cameron 22008 Wes Pa erson 42009 Drew Flaniken 22010 Wes Alsup 72011 Alec Mills 32012 Dan Tobik 52013 Stu Jones 42014 John Houston 42015 Patrick Bernard 82016 Dom Bazzani 1 Patrick Bernard 1 Alex Evans 1 Alan Rickman 12017 Alex Evans 4
Innings Pitched1993 David Strange 83.21994 Chris Payne 70.11995 Brian Rosbury 96.01996 Michael Blount 67.11997 Jody Fuller 74.01998 Jody Fuller 85.01999 Wesley Freeman 107.12000 Heath Doyle 90.02001 Brad Meadows 83.12002 Jason Sullivan 96.02003 Donnie Corey 65.02004 Ben Meador 83.02005 Sco Massey 86.12006 Adam Ledlow 89.22007 Eric Walker 73.22008 Calen Su on 71.12009 Coty Green 94.02010 Coty Green 87.22011 Dan Tobik 91.02012 Alec Mills 89.02013 Dalton Po s 62.22014 Alex Mar n 68.02015 Carter Smith 75.22016 Alex Evans 88.12017 Dalton Wes all 80.2
Strikeouts1993 David Strange 641994 David Strange 551995 Brian Rosbury 511996 Jody Fuller 511997 Jody Fuller 661998 Jody Fuller 1181999 Wesley Freeman 722000 Heath Doyle 632001 Brad Meadows 672002 Jason Sullivan 592003 Donnie Corey 542004 Ben Meador 682005 Sco Massey 542006 Ryan Rockholt 532007 William Blackmon 642008 Eric Walker 442009 Coty Green 702010 Coty Green 642011 Dan Tobik 672012 Alec Mills 742013 Dan Tobik 712014 Alex Boshers 502015 Alex Mar n 722016 Dom Bazzani 712017 Dalton Wes all 81
YEARLY DIVISION-I LEADERSYEARLY DIVISION-I LEADERS
2018 UT MARTIN BASEBALL2018 UT MARTIN BASEBALL66
TEAM RECORDSTEAM RECORDSMISCELLANEOUS TEAM RECORDS Opening game records . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .20-26Most consecutive wins to open season . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 7, 1979Most consecutive wins . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 16, 1985Most consecutive losses to open season . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 10, 1993Most consecutive losses . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 13, 2013Most consecutive home wins . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 16, 1989Most consecutive home losses . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .14, 2000 and 2005Most consecutive road wins . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 7, Several TiedMost consecutive road losses . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 16, 2006Most consecutive hits . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 8, Roger Gum vs. Bethel (DH), 1987Most consecutive strikeouts (pitcher) . . . . . . . . . . . . . . . . . . . . . . 10, Joe Kuchar vs. Union, 1972Most consecutive home runs in a game . . . . . . . . . 3, Gary Barfield vs. Christian Brothers, 1991Most consecutive strikeouts to start game . . . . . . . . . . . . . . . . . . . . . . . . . .10 vs. Lawrence, 1972Lowest fielding percentage in a season . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .922, 1976
TEAM OFFENSIVE RECORDS Inning RecordsMost hits . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 8 at Austin Peay, May 12, 2014. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 8 at Eastern Kentucky, April 22, 2011. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .8 at Morehead State, 2005Most runs . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 11 vs. Chicago State, 1997Most home runs . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 4 vs. Jacksonville State, March 27, 2010Most stolen bases . . . . . . . . . . . . . . . . . . . . . . . . 4 (3 times), last vs. Murray State, April 28, 2015
Game RecordsMost at bats . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .72 vs. Rhodes College, 1985Most hits . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 28 vs. Berea College, 2003Most runs . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 32 vs. Berea College, 2003Most doubles . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .9 vs. Murray State, 2003Most triples . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 3 vs. Memphis, April 22, 2009. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 3 vs. Harding, April 6, 2004Most home runs . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .7 at Tennessee Tech, April 25, 2009Most runs batted in . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 30 vs. Berea College, 2003Most stolen bases . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .7 (twice), 1986Most walks . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 16 vs. Christian Brothers, 1991Most strikeouts . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 18 vs. Morehead State, 1999Most left on base . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .17 vs. Austin Peay, May 20, 2011
TEAM PITCHING RECORDS Inning RecordsMost runs allowed . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 20 vs. Belmont, March 29, 2015Most earned runs allowed . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 20 vs. Belmont, March 29, 2015Most home runs allowed . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 7 vs. Belmont, March 29, 2015
Game RecordsMost runs allowed . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 34 vs. Belmont, March 29, 2015Most earned runs allowed . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 32 vs. Belmont, March 29, 2015Most hits allowed . . . . . . . . . . . . . . . . . . . . . . . . . . . . 31 vs. Southeast Missouri, March 26, 2016. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 31 vs. Belmont, March 29, 2015Most home runs allowed . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 12 vs. Belmont, March 29, 2015Most walks . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 15 at Morehead State, April 17, 2016. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 15 vs. Evansville, March 8, 2016. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .15 at Kentucky, 2007. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .15 vs. Bradley, 2004. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 15 at Arkansas-Little Rock, 2003Most strikeouts . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .21 vs. Washington University, 1972. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .21 vs. Arkansas-Little Rock, 2002
TEAM FIELDING RECORDS Game RecordsMost putouts . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 46 at Memphis, May 12, 2015Most assists . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 21 vs. Northern Illinois, 2001Most errors . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 9 vs. Illinois-Chicago, 2002Most double plays . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .4 vs. Tennessee Tech, 2003. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .4 at Morehead State, 2008
INDIVIDUAL OFFENSIVE RECORDS INDIVIDUAL OFFENSIVE RECORDS Game RecordsGame Records
Most at bats . . . . . . . . . . . . . . . . . . . . . . . . . . 7 on 12 occasions;. . . . . . . . . . . . .last: Creighton Eldridge vs. Eastern Illinois, 2017Most hits . . . . . . . . . . . . . . 6, Scott McLean vs. Lipscomb, 2007Most runs . . . . . . . . . . 6, Trey Karlen vs. Cleveland State, 2010. . . . . . . . . . . . . . . . . . . . . . . . 6, Chad Wyatt vs. Louisville, 1995. . . . . . . . . . . . . . . . . . . . . . 6, Scott McLean vs. Lipscomb, 2007Most doubles . . . . . . . . . . . . . . . . . . . . . . . . . . . .3, Several Tied;. . . . . . . . . . . . . . . last: Josh Hauser, vs. Eastern Kentucky, 2017Most triples . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2, Several TiedMost home runs . . . . . . . . . . . . 3, Gary Barfield vs. CBU, 1991. . . . . . . . . . . . . . . . . . . . . . . . 3, Chad Wyatt vs. Louisville, 1995Most runs batted in . . . . . . . . . . . . . . . . . 8 on three occasions;. . . . . . . . . . . . . . last: Was Patterson vs. Cleveland State, 2010Most stolen bases . . . . . . 4, Churchill Moore (2) vs. Union, 1986Most walks . . . . . . . . . . . . . . 7, Ricky Harris vs. Lambuth, 1977Most strikeouts . . . . . . . . .5, Nick Molina at Austin Peay, 2014Hit by pitch most . . . . . . . . . . . 3, Ryan Bethel vs. Bethel, 2002. . . . . . . . . . . . . . . . .3, Bart Hammack vs. Illinois-Chicago, 2002Most total bases . . . . . . . . 14, Chad Wyatt vs. Louisville, 1995Most extra-base hits . . . . . . . . . . . . . . . . . . . . . . 3, Several TiedMost sacrifice hits . . . . . . . . . . . . . . . . . . . . . . . . 3, Several TiedMost sacrifice flies . . . . . . . . . . . . . . . . . . . . . . . . 2, Several Tied
INDIVIDUAL PITCHING RECORDS INDIVIDUAL PITCHING RECORDS Game RecordsGame Records
Most innings pitched . . . . . . . . . . . . . . . . 12, Eddy Eckert, 1968Most strikeouts . . . . . . . . . 19, Eddy Eckert vs. Lambuth, 1969Most walks . . . . . . . . . . . . . . . . . 10, John Fowler vs. TSU, 1986Most runs allowed . . . . . . . . . . . . . . . . . . . . . . . 12, Several TiedMost earned runs . . . . . . . . . . . . . . . . . . . . . . . 11, Several TiedMost hits . . . . . . . . . . . . . . . . . . . . . . . . . . . 15 on two occasionsConsecutive wild pitches . . . . . . . . . . . . . . . . .3, Cole Schaenzer . . . . . . . . . . . . . . . . . . . . . . . . . . . . vs. Evansville, March 8, 2016Consecutive home runs allowed . . . . . . . . . . 3, Michael Fidler . . . . . . . . . . . . . . . . . . . . . . . . . . . . vs. Belmont, March 29, 2015
INDIVIDUAL FIELDING RECORDS INDIVIDUAL FIELDING RECORDS Game RecordsGame Records
Most putouts . . . . . . .21, Ryan Bethel vs. Ark.-Little Rock, 2002Most assists . . . . . . 9, Sonny Mastromatteo at Murray State, 2012. . . . . . . . . . . . . . . . . . . . . . . . . .9, Cody Terry vs. Belmont, 2010Most errors . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 4, Several Tied
Wes Patt erson
enjoyed an outstanding
day on March 20,
2010 against Cleveland
State, when he tied
a school record with eight runs batt ed in in a 20-11 Skyhawk victory.
2018 SKYHAWK BASEBALL2018 SKYHAWK BASEBALL 67
TEAM RECORDSTEAM RECORDSGAMES PLAYED
1. 2011 Team 56 2. 2017 Team 55 2010 Team 55 2007 Team 55 2006 Team 55 2005 Team 55 1999 Team 55
BATTING AVERAGE1. 1985 Team .3572. 1989 Team .3443. 1981 Team .3394. 1992 Team .3375. 1990 Team .332
AT BATS1.2017 Team 19302. 2011 Team 1910 3. 2010 Team 19014. 2016 Team 18945. 2012 Team 1844
RUNS SCORED1. 1985 Team 3842. 2010 Team 3803. 1986 Team 3434. 2009 Team 3425. 2016 Team 340
HITS1. 2010 Team 5792. 2009 Team 5723. 2017 Team 569 4. 2016 Team 5545. 2004 Team 529
DOUBLES1. 2010 Team 1152. 2003 Team 1073. 2016 Team 1064. 2017 Team 1055. 2011 Team 103
TRIPLES1. 1976 Team 262. 1980 Team 203. 1981 Team 184. 1986 Team 165. 2017 Team 15 2012 Team 15
HOME RUNS1. 2010 Team 752. 2009 Team 573. 2017 Team 434. 1975 Team 425. 2015 Team 39
RUNS BATTED IN1. 2010 Team 347 1985 Team 3473. 1986 Team 3464. 2009 Team 3225. 2016 Team 318
TOTAL BASES1. 2010 Team 9332. 2009 Team 8653. 2017 Team 8334. 2016 Team 7985. 2004 Team 737
SLUGGING PERCENTAGE1. 1981 Team .5402. 1985 Team .5173. 1988 Team .5124. 1992 Team .4955. 2010 Team .491
BASE ON BALLS1. 2016 Team 2312. 1985 Team 2303. 1987 Team 2074. 2017 Team 205 2007 Team 2055. 2003 Team 204
HIT BY PITCH1. 2017 Team 632. 2010 Team 603. 2011 Team 564. 2012 Team 535. 2002 Team 50
STRIKEOUTS1. 2014 Team 442 2. 2012 Team 434 3. 2010 Team 4154. 2016 Team 4115. 2017 Team 404
STOLEN BASES1. 1986 Team 1232. 1989 Team 1043. 1987 Team 964. 1980 Team 865. 2010 Team 84
RUNS PER GAME1. 1981 Team 8.032. 1985 Team 7.683. 1992 Team 7.464. 1980 Team 7.305. 1987 Team 7.15 1986 Team 7.15
HITS PER GAME1. 2009 Team 11.222. 2010 Team 10.533. 2017 Team 10.354. 2016 Team 10.265. 1985 Team 10.16
PUTOUTS1. 2017 Team 14362. 2011 Team 14173. 2016 Team 1394 2012 Team 13945. 2010 Team 1393
ASSISTS1. 2011 Team 5722. 2017 Team 5633. 1995 Team 5594. 2012 Team 5575. 2010 Team 555
ERRORS1. 2002 Team 1202. 2001 Team 1193. 2003 Team 118 1999 Team 1185. 2008 Team 110
FIELDING PERCENTAGE1. 2017 Team .9672. 2009 Team .9663. 2006 Team .9654. 2015 Team .9635. 2016 Team .962
VICTORIES1. 1985 Team 362. 1992 Team 313. 1986 Team 304. 1988 Team 26 1981 Team 26
EARNED RUN AVERAGE1. 1968 Team 2.532. 1980 Team 2.973. 1992 Team 3.424. 1981 Team 3.475. 1988 Team 3.80
SAVES1. 2010 Team 112. 2015 Team 103. 2006 Team 84. 2017 Team 75. 2011 Team 6 2009 Team 6 2008 Team 6 2005 Team 6 1986 Team 6 1985 Team 6
LOSSES1. 2001 Team 462. 2005 Team 433. 2014 Team 424. 2012 Team 41 2008 Team 41
COMPLETE GAMES1. 1976 Team 252. 1985 Team 233. 1992 Team 204. 1990 Team 19 1989 Team 19 1988 Team 19
INNINGS PITCHED1. 2017 Team 478.22. 2011 Team 472.13. 2016 Team 464.2 2012 Team 464.25. 2010 Team 464.1
HITS ALLOWED1. 2004 Team 6892. 2010 Team 6693. 2011 Team 6684. 2007 Team 6365. 2012 Team 626
RUNS ALLOWED1. 2016 Team 4842. 2008 Team 4803. 2004 Team 4794. 2012 Team 4565. 2001 Team 455
HOME RUNS ALLOWED1. 2009 Team 832. 2001 Team 753. 2004 Team 744. 2002 Team 645. 2016 Team 62 1999 Team 62
WILD PITCHES1. 2016 Team 812. 2000 Team 613. 1995 Team 594. 2001 Team 555. 2013 Team 51
EARNED RUNS1. 2016 Team 4302. 2004 Team 4183. 2000 Team 3854. 2008 Team 3815. 2010 Team 373
HIT BATSMEN1. 2013 Team 88 2. 2010 Team 833. 2012 Team 724. 2016 Team 715. 2015 Team 70
WALKS1. 2016 Team 3232. 2015 Team 3103. 2017 Team 2934. 2008 Team 2505. 2014 Team 245
STRIKEOUTS1. 2017 Team 4292. 2016 Team 3693. 2013 Team 364 4. 2012 Team 346 5. 2010 Team 337
2018 UT MARTIN BASEBALL2018 UT MARTIN BASEBALL68
INDIVIDUAL SEASON RECORDSINDIVIDUAL SEASON RECORDSGAMES PLAYED
1. Cody Terry 56 20112. Josh Hauser 55 2017 Ryan Helgren 55 2017 Chase Okey 55 2011 Cory Stooksbury 55 2011 Ty Nelson 55 2010 Trey Karlen 55 2010 Jordan Owen 55 2010 Cody Terry 55 2010 Cory Stooksbury 55 2010 Lanier English 55 1999 Brad Smith 55 1999
BATTING AVERAGE1. David Couch .488 19772. Richie Craven .484 19853. Walter Glass .436 19764. Richard Matz .435 19905. Jimmy Carey .431 19946. Roger Gum .429 19877. Bryant Jones .425 20048. Scott Gladstone .420 20099. Ricky Jackson .416 1985 Scott McMackin .416 1989
AT BATS1. Cody Terry 228 2011 Cody Terry 228 20103. Bryant Jones 226 20044. Trey Karlen 222 20115. Ryan Helgren 219 2017 6. Tanner Wessling 217 2017 Taylor Douglas 217 20157. Trey Karlen 216 20108. Jordan Owen 215 2010 9. Cody Terry 213 2009 Hunter Hart 213 2004
RUNS SCORED1. Richard Craven 74 19852. Churchill Moore 70 19863. Trey Karlen 61 20104. Jim Willis 58 19855. Mark Hartsfield 56 20096. Trey Karlen 55 2011 Bryant Jones 55 2004 8. Ty Nelson 53 20109. Roger Gum 52 198610. Cody Terry 51 2010
HITS1. Bryant Jones 96 20042. Ty Nelson 84 2010 Scott Gladstone 84 20094. Mark Hartsfield 79 20095. Trey Karlen 77 2010 Miles Hartsfield 77 2009 7. Tanner Wessling 76 20178. Cody Terry 74 2010 Richard Craven 74 198510. Taylor Douglas 72 2015 Cody Terry 72 2011
DOUBLES1. Trey Karlen 22 20102. Ty Nelson 20 20103. Trey Karlen 19 20114. Taylor Douglas 18 2015 Walter Glass 18 19856. Darrel Risberg 17 19867. Dan Kerwin 16 2017 Dan Kerwin 16 2016 Lance Renton 16 2007 Richard Craven 16 1985
TRIPLES1. Walter Glass 9 19782. Donnie Mitchell 7 19813. Creighton Eldridge 6 2017 Jordan Owen 6 20124. Tanner Wessling 4 2017 Ty Nelson 4 2010 Blake Turner 4 2007 Zach Dean 4 2005 Steve Gadlage 4 1994 Bill Glass 4 1988 Churchill Moore 4 1987 Roger Gum 4 1986 Churchill Moore 4 1986 Matt Phillips 4 1986 David Smith 4 1980 Dale Horn 4 1976
HOME RUNS1. Jordan Owen 18 20102. Don Jackson 17 19723. Wes Patterson 15 2010 Brian Baker 15 20005. Trey Karlen 14 2010 Jim Willis 14 19857. Mark Hartsfield 12 20098. Taylor Douglas 11 2015 Wes Patterson 11 2009 Chuck Seymour 11 1998 Bryan Bullington 11 1995 Jimmy Carey 11 1992
RUNS BATTED IN1. Wes Patterson 64 20102. Jim Willis 58 19853. Cody Terry 55 20104. Miles Hartsfield 52 20095. Jordan Owen 51 20106. Taylor Douglas 47 2015 Wes Patterson 47 20098. Trey Karlen 46 2011 Jimmy Carey 46 199210. Ty Nelson 45 2010 Trey Karlen 45 2010 Brett Spivy 45 2004
TOTAL BASES1. Trey Karlen 145 20102. Jordan Owen 138 20103. Ty Nelson 136 20104. Bryant Jones 133 2004 5. Mark Hartsfield 131 20096. Taylor Douglas 127 20157. Wes Patterson 126 2010 Richard Craven 126 19859. Miles Hartsfield 124 200910. Cody Terry 116 2010
SLUGGING PERCENTAGE1. Don Jackson 1.224 19722. Richard Craven .818 19853. Jim Willis .748 19854. Donnie Mitchell .743 19815. Jimmy Carey .732 19926. Mike Brown .730 19887. Jim Willis .673 19838. Trey Karlen .671 2010 Bryan Bullington .671 199510. Gary Slayden .670 1982
BASE ON BALLS1. Chase Okey 41 20112. Richard Craven 40 19853. Hunter Hart 35 2003
4. Chuck Seymour 34 19985. Matt Hirsch 32 2015 Chase Young 32 2014 Mike Brown 32 19888. Trey Karlen 31 20109. Kelly Davis 30 2003 Michael York 30 1991 Chad Green 30 2007
HIT BY PITCH1. Bart Hammock 16 20012. Jordan Owen 15 20123. Brad Smith 14 19994. Trey Karlen 13 20105. Chase Okey 12 2011 Brian Jordan 12 2003 Bart Hammock 12 2002 Steve Gadlage 12 19949. Ryan Helgren 11 2017 Keylen Steen 11 2017 Greg McKnight 11 1989
STRIKEOUTS1. Creighton Eldridge 62 2017 2. Trey Karlen 56 20103. Dan Kerwin 55 2017 Brett Spivy 55 20055. Brian Baker 54 20006. Matt Hirsch 53 2016 Cory Stooksbury 53 20108. Grant Glasser 52 2012 Zach Dean 52 200510. Taylor Douglas 51 2015
STOLEN BASES1. Churchill Moore 65 19862. Churchill Moore 33 19873. Trey Karlen 30 20104. Walter Glass 28 19765. Brian Henley 24 19896. Stanley Click 23 19887. Trey Karlen 21 20118. Chad Green 20 20079. Ty Nelson 19 201010. Bryant Jones 18 2004 Greg McKnight 18 1989
PUTOUTS1. Wes Patterson 413 20102. Wes Patterson 376 20113. Nico Zych 367 20154. Chuck Seymour 362 1999 Brian Jordan 362 20036. Jason Hockaday 357 20067. Hunter McLemore 345 19938. Tim Pearcy 343 19859. Ty Nelson 341 201010. Bryan Bullington 340 1995
ASSISTS1. Cody Terry 172 20112. Cody Terry 164 20103. Cody Terry 157 20094. Jason Moore 155 20055. Brett Young 153 19956. Lance Renton 149 2006 Roger Deskins 149 19858. Sonny Mastromatteo 145 20129. Chris Ervin 141 199310. Chad Wyatt 140 1995
ERRORS1. Bryant Jones 31 20012. Jason Moore 27 20053. Bryant Jones 23 2002
Paul Slack 23 1998 Chad Wyatt 23 19956. Cody Terry 22 2011 Trey Karlen 22 2010 Jimmy Davis 22 1988 Shayne Martin 22 200810. Desmond O’Quine 21 2000
PITCHINGVICTORIES
1. Coty Green 9 2010 Mike Hayes 9 19863. Alex Evans 8 2017 Alex Evans 8 2016 David Strange 8 1993 Ray Frame 8 19686. Alec Mills 7 2011 Mike Eatherly 7 1992 Shannon Haggard 7 1992 David White 7 1990 Randy Coffman 7 1988 Bruce Beckman 7 1985 Larry White 7 1981 Mike Bennett 7 1980
EARNED RUN AVERAGE1. Larry White 0.41 19812. Frank Glover 0.96 19873. Ray Frame 1.17 19684. Craig Rogers 1.25 19805. Craig Rogers 1.41 19816. Bill Ridings 1.58 19807. Mike Bennett 1.63 19808. Mike McSwain 1.72 19889. Jeff Kelley 1.86 198010. Mike Williams 2.04 1976
APPEARANCES1. Alec Mills 30 2011 Dustin Summers 30 20043. Alex Evans 28 2017 Drew Flaniken 28 2010 Travis Webb 28 2007 Dustin Summers 28 2005 Micky Dobson 28 20058. Dan Tobik 27 2012 Drew Flaniken 27 200910. Adam Rimmer 26 2016
GAMES STARTED1. Wesley Freeman 17 19992. Dan Tobik 15 2011 Danny Kelley 15 2011 Coty Green 15 2010 Adam Ledlow 15 2006 Jason Venczel 15 2001 Brian Rosbury 15 19958. Dalton Westfall 14 2017 Dom Bazzani 14 2016 Alec Mills 14 2012 Coty Green 14 2009 Jacob Smothers 14 2006 Ryan Rockholt 14 2006 Ben Meador 14 2004
MOST WALKS ALLOWED1. Bret Fanning 65 19952. Dalton Westfall 62 2017 3. Ryan Rockholt 55 20064. Alex Martin 51 2014 Wesley Freeman 51 19996. Alex Martin 48 20157. Shane Seckinger 46 2016
Jason Venczel 46 2001 Jody Fuller 46 199810. Winston Cannon 45 2017 Dom Bazzani 45 2016
STRIKEOUTS1. Jody Fuller 118 19982. Dalton Westfall 81 2017 3. Alec Mills 74 20124. Alex Evans 73 2017 5. Alex Martin 72 2015 Wesley Freeman 72 19997. Dom Bazzani 71 2016 Dan Tobik 71 20139. Coty Green 70 200910 Ben Meador 68 2004
COMPLETE GAMES1. Danny Mitchell 8 19762. Jason Sullivan 7 2001 Wesley Freeman 7 1999 Jody Fuller 7 1998 Mike Hayes 7 1986 Martin Newby 7 1985 Tommy Glass 7 19768. Terry Jackson 6 1990 Alan Reynolds 6 198210. Brian Rosbury 5 1995 Chris Payne 5 1993 Mike Eatherly 5 1992 Randy Coffman 5 1988 John Daniel 5 1988 Bruce Beckman 5 1985 Wade Freeman 5 1985 Mike Prather 5 1984 Mike Prather 5 1983 Bruce Wyatt 5 1981
INNINGS PITCHED1. Wesley Freeman 107.1 19992. Jason Sullivan 96.0 2002 Brian Rosbury 96.0 19954. Coty Green 94.0 20095. Dan Tobik 91.0 20116. Heath Doyle 90.0 20007. Adam Ledlow 89.2 20068. Alec Mills 89.0 20129. Alex Evans 88.1 201610. Coty Green 87.2 2010
SAVES1. Patrick Bernard 8 20152. Wes Alsup 7 20103. Chadwick Cameron 6 20064. Dan Tobik 5 2012 Ray Frame 5 19686. Alex Evans 4 2017 John Houston 4 2014 Stu Jones 4 2013 Wes Patterson 4 2008 Frank Perez 4 1987 Frank Perez 4 1986 Russ Hopper 4 1985
*Records are based upon all available
sta s cs at the me of prin ng.
All seasons at the Division-I level
(1993-present) are fully represented.
2018 SKYHAWK BASEBALL2018 SKYHAWK BASEBALL 69
INDIVIDUAL CAREER RECORDSINDIVIDUAL CAREER RECORDSGAMES PLAYED
1. Jordan Owen 204 2009-122. Cody Terry 199 2008-113. Douglas Nicodemus 195 2003-074. Bryant Jones 191 2001-045. Nico Zych 189 2012-156. Wes Patterson 188 2008-117. Paul Slack 183 1997-008. Lanier English 182 1998-019. Adam Gibson 178 1999-0210. Brian Jordan 174 1999-03
AT BATS1. Cody Terry 750 2008-112. Jordan Owen 742 2009-123. Nico Zych 675 2012-154. Wes Patterson 656 2008-115. Bryant Jones 651 2001-046. Lanier English 626 1998-017. Douglas Nicodemus 622 2003-078. Paul Slack 608 1997-009. Adam Gibson 607 1999-0210. Brian Jordan 542 1999-03
BATTING AVERAGE1. Walter Glass .423 1975-762. David Couch .415 1977-783. Don Jackson .408 1972-734. Greg King .394 1990-91 Richard Matz .394 1990-916. Donnie Mitchell .393 1980-817. Darrel Risberg .392 1986-888. Scott McMackin .385 1989-909. Brian Henley .383 1989-9010. Roger Gum .382 1986-87
RUNS SCORED1. Cody Terry 145 2008-112. Wes Patterson 132 2008-11 3. Darrel Risberg 126 1985-884. Bryant Jones 120 2001-045. Churchill Moore 119 1986-87 Paul Slack 119 1997-007. Trey Karlen 116 2010-118. Jordan Owen 112 2009-129. Jim Willis 105 1983-85 Mark Stafford 105 1972-75
HITS1. Cody Terry 226 2008-112. Jordan Owen 224 2009-123. Bryant Jones 218 2001-044. Wes Patterson 200 2008-115. Nico Zych 182 2012-156. Lanier English 180 1998-017. Paul Slack 172 1997-008. Darrel Risberg 169 1986-889. Adam Gibson 166 1999-0210. Matt Pumo 159 1982-85
DOUBLES1. Cody Terry 47 2008-112. Wes Patterson 45 2008-113. Jordan Owen 43 2009-124. Trey Karlen 41 2010-115. Darrel Risberg 36 1986-886. Adam Gibson 34 1999-02 Brian Jordan 34 1999-03 Dan Stephens 34 2000-039. Taylor Douglas 33 2014-15 Paul Slack 33 1997-00
TRIPLES1. Walter Glass 17 1975-762. Donnie Mitchell 9 1980-813. Churchill Moore 8 1986-874. Jordan Owen 7 2009-125. Creighton Eldridge 6 2017- Present Zach Dean 6 2005-06 Matt Phillips 6 1985-86 Troy Crawford 6 1996-00 Matt Pumo 6 1982-8510. Tanner Wessling 5 2016-17 Matt Young 5 2010-13 Mark Hartsfield 5 2008-09 Lanier English 5 1998-01 Gene Jones 5 1987-89 Roger Gum 5 1986-87
HOME RUNS1. Wes Patterson 39 2008-112. Jordan Owen 35 2009-123. Jim Willis 32 1983-854. Trey Karlen 23 2010-115. Don Jackson 22 1972-736. Brett Spivy 19 2003-06 Chuck Seymour 19 1998-998. Taylor Douglas 18 2014-159. Mark Hartsfield 16 2008-09 David Couch 16 1977-78 Daisuke Oda 16 1994-96
RUNS BATTED IN1. Wes Patterson 171 2008-11 2. Jim Willis 160 1983-853. Jordan Owen 134 2009-124. Cody Terry 124 2008-115. Gene Jones 99 1987-896 Tim James 98 1985-877. Mack Moore 96 1974-788. Darrel Risberg 93 1986-889. Bryant Jones 92 2001-04 Bill Glass 92 1984-88 Adam Gibson 92 1999-02
BASE ON BALLS1. Paul Slack 96 1999-002. Wes Patterson 85 2008-113. Hunter Hart 83 2001-044. Bill Glass 76 1984-885. Jim Willis 75 1983-856. Darrel Riseberg 72 1985-887. Chase Okey 67 2011-128. Bryant Jones 64 2001-04 David Couch 64 1977-7810. Jordan Owen 63 2009-12 Hunter Hart 63 2003-04
STOLEN BASES1. Churchill Moore 98 1986-872. Walter Glass 56 1975-763. Trey Karlen 51 2010-114. Stanley Click 38 1988-89 Brian Henley 38 1989-906. Ricky Jackson 33 1985-887. Lanier English 31 1998-018. Darrel Risberg 30 1986-88 Larry Hudson 30 1978-8110. Ron Harrison 29 1989-90
PUTOUTS1. Wes Patterson 1,293 2008-112. Tim Pearcy 1,030 1984-873. Chuck Seymour 698 1998-994. Brian Berryman 640 2003-055. Jason Hockaday 613 2006-07 6. Brian Jordan 606 1999-03 Joe Ayers 606 2000-018. Chase Okey 580 2011-129. Scott McLean 579 2004-0710. Kyle Coleman 576 1988-89
ASSISTS1. Cody Terry 555 2008-112. Bryant Jones 444 2001-043. Paul Slack 359 1997-004. Douglas Nicodemus 328 2003-075. Nico Zych 302 2012-156. Josh Hauser 272 2016-17 7. Sonny Mastromatteo 270 2012-138. Bill Glass 269 1984-889. Cory Stooksbury 267 2010-11 Scott Gladstone 267 2008-09
PITCHINGVICTORIES
1. Mike Hayes 19 1984-872. Dick Windbigler 17 1971-73 Ray Frame 17 1964-684. Alex Evans 16 2016-17 5. Martin Newby 15 1983-86 Michael Blount 15 1995-987. Coty Green 14 2009-108. Alec Mills 13 2010-12 Randy Coffman 13 1988-89 Mike McSwain 13 1987-90
EARNED RUN AVERAGE1. Larry White 2.00 1980-812. Craig Rogers 2.64 1980-823. Brad Meadows 2.82 20024. Alan Reynolds 2.96 1981-825. Mike McSwain 3.20 1987-906. Mike Eatherly 3.21 1991-927. Bruce Wyatt 3.33 1981-828. Mike Prather 3.53 1983-849. Trent Latta 3.76 1994-9610. Frank Perez 3.92 1986-87
APPEARANCES1. Dustin Summers 96 2002-052. Alex Boshers 82 2010-143. Dan Tobik 80 2010-134. Micky Dobson 70 2003-06 Jody Fuller 70 1995-986. Alec Mills 67 2010-13 Adam Ledlow 67 2004-078. Carter Smith 63 2012-159. Jason Alford 57 1997-00 Eric Walker 57 2005-08
GAMES STARTED1. Michael Blount 49 1995-982. Mike Hayes 38 1984-873. Adam Ledlow 37 2004-074. Jody Fuller 36 1995-985. Brendan Lozupone 33 2009-126. Justin Bryant 32 2003-05
7. Dan Tobik 30 2010-13 Jacob Smothers 30 2003-079. Dalton Potts 29 2012-15 Coty Green 29 2009-10
MOST WALKS ALLOWED1. Jody Fuller 143 1995-982. Michael Blount 129 1995-983. Adam Ledlow 119 2004-074. Martin Newby 113 1983-885. Dan Tobik 112 2010-136. Mike Hayes 110 1984-877. Casey Estill 103 2003-068. Carter Smith 101 2012-159. Bret Fanning 100 1995-9610. Alex Martin 99 2014-15
STRIKEOUTS1. Jody Fuller 267 1995-982. Dan Tobik 263 2010-133. Michael Blount 183 1995-984. Carter Smith 175 2012-155. Mike Hayes 167 1984-876. Alec Mills 165 2010-12 7. Adam Ledlow 156 2004-078. Martin Newby 155 1983-869. Joe Kucher 150 1972-7410. Alex Evans 140 2016-17
COMPLETE GAMES1. Mike Hayes 17 1984-872. Michael Blount 15 1995-983. Martin Newby 14 1983-884. Mike Prather 10 1983-84 Jason Sullivan 10 2001-02 Jody Fuller 10 1995-98 Mike McSwain 10 1987-908. Chris Payne 9 1993-94 Terry Jackson 9 1989-90 Randy Coffman 9 1988-89
INNINGS PITCHED1. Michael Blount 285.0 1995-982. Jody Fuller 276.1 1995-983. Dan Tobik 275.0 2010-134. Adam Ledlow 251.1 2004-075. Alex Boshers 246.2 2010-146. Mike Hayes 218.0 1984-877. Carter Smith 213.1 2012-158. Jacob Smothers 209.0 2003-07 9. Martin Newby 198.2 1983-8610. Alec Mills 192.0 2010-13
SAVES1. Patrick Bernard 9 2015-162. Dan Tobik 8 2010-13 Chadwick Cameron 8 2006-07 Frank Perez 8 1986-875. Wes Alsup 7 2009-10 Russ Hopper 7 1982-857. Alex Evans 5 2016-17 Wes Patterson 5 2008-11 Dustin Summers 5 2002-05 Jody Fuller 5 1995-98 Ray Frame 5 1964-68
2018 UT MARTIN BASEBALL2018 UT MARTIN BASEBALL70
YEARLY DIVISION-I RESULTSYEARLY DIVISION-I RESULTS1993 Results
Vernon PratherOverall:13-28 • OVC:7-13
Home:8-13 • Away:5-15 • Neutral:0-0Date Opponent W/L UTM-OPP Pitcher/Rcd. 2/20 Ole Miss (A) L 0-17 Dyer/0-12/20 Ole Miss (A) L 1-10 Strange/0-1 2/24 Union T 4-4 No Decision2/27 Southwest Missouri L 5-8 Dyer/0-22/27 Southwest Missouri L 4-14 Strange/0-22/28 Southwest Missouri L 1-13 Lee/0-13/2 Tennessee (A) L 0-6 Payne/0-13/3 Tennessee (A) L 7-9 Dyer/0-33/7 Southern Illinois (A) L 1-3 Graves/0-13/9 Samford (A) L 1-3 Toon/0-13/10 Samford (A) W 2-1 Lee/1-13/17 Vanderbilt (A) L 5-11 Dyer/0-43/18 Southern Mississippi W 4-3 Strange/1-23/20 * Aus n Peay (A) L 3-13 Payne/0-23/21 * Aus n Peay (A) L 3-7 Graves/0-2 3/21 * Aus n Peay (A) L 1-8 Dyer/0-53/24 Union (A) W 7-5 Strange/2-23/28 * Tennessee State (A) W 5-0 Payne/1-23/28 * Tennessee State (A) W 5-3 Strange/3-23/30 Southeast Missouri W 5-1 Strange/4-24/3 * Morehead State L 3-4 Payne/1-34/3 * Morehead State L 1-2 Graves/0-34/4 * Morehead State L 2-5 Toon/0-24/6 Murray State L 2-7 Garves/0-44/7 Western Kentucky (A) L 0-4 Payne/1-44/13 Arkansas State (A) L 4-7 Graves/0-54/14 Samford W 12-11 Strange/5-24/17 * Middle Tennessee L 2-4 Graves/0-64/17 * Middle Tennessee L 1-4 Payne/1-54/18 * Middle Tennessee W 9-2 Strange/6-24/20 Aus n Peay (A) L 4-9 Young/0-14/2 * Eastern Kentucky (A) L 6-7 Garves/0-74/2 * Eastern Kentucky (A) L 3-9 Payne/1-64/25 * Eastern Kentucky (A) W 7-4 Strange/7-24/27 Southeast Missouri (A) L 5-12 Graves/0-84/28 Arkansas State W 4-2 Lee/2-15/1 * Tennessee Tech W 4-2 Payne/2-65/1 * Tennessee Tech L 2-4 Graves/0-95/2 * Tennessee Tech L 6-7 Strange/7-35/8 * Murray State L 4-8 Payne/2-75/8 * Murray State W 3-2 Graves/1-95/9 * Murray State W 8-2 Strange/8-3* - OVC Game
1994 ResultsVernon Prather
Overall:13-25 • OVC:8-13Home:9-8 • Away:4-15 • Neutral:0-2
Date Opponent W/L UTM-OPP Pitcher/Rcd. 2/26 Southwest Missouri (A) W 10-7 Strange/1-02/27 Southwest Missouri (A) L 6-7 Harrell/0-12/27 Southwest Missouri (A) L 5-7 Dyer/0-13/2 Ole Miss (A) L 1-7 Payne/0-13/4 Illinois State L 2-3 Starnge/1-13/5 Bradley (at Murray, Ky.) L 4-10 Ayler/0-13/5 Murray State (A) L 2-5 Dyer/0-23/6 Bradley (at Murray, Ky.) L 1-9 Frye/0-13/6 Murray State (A) W 5-3 Payne/1-13/11 Union (A) L 6-7(10) Ayler/0-23/12 Freed-Hardeman W 8-2 Payne/2-13/23 Memphis State (A) L 10-13 Lee/1-1 3/26 * Eastern Kentucky L 0-4 Payne/2-33/26 * Eastern Kentucky L 5-13 Dyer/1-133/30 Western Kentucky (A) L 1-13 Ayler/0-34/1 * Tennessee Tech W 11-5 Payne/3-34/1 * Tennessee Tech W 14-2 Strange/2-14/2 * Tennessee Tech W 7-6 Ayler/1-34/9 * Morehead State (A) L 6-7 Payne/3-44/9 * Morehead State (A) L 3-7 Strange/2-24/10 * Morehead State (A) L 2-7 Dyer/1-44/12 Arkansas State (A) L 2-3 Strange/2-34/13 Bethel W 12-0 Payne/4-44/16 * Southeast Missouri (A) W 3-1 Dyer/2-44/16 * Southeast Missouri (A) L 3-5 Strange/2-44/17 * Southeast Missouri (A) L 5-10 Payne/4-54/20 Samford W 3-2(11) Frye/2-14/20 Samford W 4-1 Dyer/3-4 4/23 * Middle Tennessee L 4-6 Strange/2-5
4/23 * Middle Tennessee L 2-3 Lee/1-2 4/24 * Middle Tennessee W 12-11 Payne/5-54/27 Arkansas State L 7-9(10) Lee/1-34/30 * Murray State (A) L 3-8 Payne/5-65/1 * Murray State (A) W 10-4 Strange/3-55/1 * Murray State (A) L 0-7 Dyer/3-55/4 * Murray State L 3-15 Frye/3-155/7 * Aus n Peay W 2-1 Payne/6-65/8 * Aus n Peay L 3-5 Strange/3-65/8 * Aus n Peay W 3-2 Lee/2-1* - OVC Game
1995 ResultsVernon Prather
Overall:13-34 • OVC:2-18Home:8-13 • Away:5-21 • Neutral:0-0
Date Opponent W/L UTM-OPP Pitcher/Rcd. 2/17 Ole Miss (A) L 0-5 Rosbury/0-12/18 Ole Miss (A) L 0-13 Fanning/0-12/19 Ole Miss (A) L 1-6 Blount/0-12/21 Murray State W 11-4 Rosbury/1-12/24 Tulane (A) L 2-13 Blount/022/25 Tulane (A) L 2-8 Fuller/0-12/26 Tulane (A) L 1-5 Rosbury/1-22/28 Southern Indiana W 2-1 Darby1-03/1 Western Kentucky L 0-5 Blount/0-33/4 Miss. Valley State W 18-3 Rosbury/2-23/10 Southern Illinois W 10-2 Rosbury/3-23/11 Southern Illinois L 7-11 Darby/1-13/13 Saint Louis L 7-12 Fuller/0-23/14 Alabama-Birmingham (A) L 8-11 Blount/0-43/17 Alabama-Birmingham L 3-11 Fanning/0-23/19 Murray State (A) W 9-6 Rosbury/4-23/22 Western Kentucky L 0-10 Fuller/0-33/25 * Tennessee Tech (A) L 3-6 Rosbury/4-33/25 * Tennessee Tech (A) W 7-3 Blount/1-43/26 * Tennessee Tech (A) L 3-11 Fanning/0-33/28 Bethel W 12-0 La a/1-03/29 Arkansas State (A) L 0-4 Rosbury/4-3 4/1 * Morehead State L 7-10 Blount/1-54/1 * Morehead State L 3-10 Fuller/0-44/2 * Morehead State L 2-6 Rosbury/4-54/5 Bethel (A) L 4-8 La a/1-14/6 Memphis (A) L 2-14 Fanning/0-44/8 * Southeast Missouri L 4-9 Fuller/1-54/8 * Southeast Missouri L 12-14 Darby/1-24/9 * Southeast Missouri L 8-15 Rosbury/4-64/12 Union (A) L 0-1 Blount/1-64/13 Memphis W 8-7 Fanning/1-44/15 * Middle Tennessee (A) L 3-11 Fuller/0-64/15 * Middle Tennessee (A) L 2-8 Rosbury/4-74/16 * Middle Tennessee (A) L 3-5 Blount/1-74/18 Trevecca W 15-14 La a/2-14/20 Louisville (A) W 18-10 VanderMeeden/1-04/22 * Murray State L 2-7 Blount/1-84/22 * Murray State L 2-8 Fuller/0-74/26 Lambuth W 11-6 Fuller/1-74/29 * Aus n Peay (A) L 4-6 Rosbury/4-94/29 * Aus n Peay (A) W 8-6(10) VanderMeeden/2-04/31 * Aus n Peay (A) L 2-3 Blount/1-95/3 Vanderbilt (A) W 11-9 Fuller/2-75/6 * Eastern Kentucky (A) L 2-3 Blount/1-105/6 * Eastern Kentucky (A) L 1-3 Rosbury/4-105/7 * Eastern Kentucky (A) L 2-5 Fannings/1-5* - OVC Game
1996 ResultsVernon Prather
Overall:14-30-2 • OVC:6-15-1Home:8-14-1 • Away:6-14-1 • Neutral:0-2
Date Opponent W/L UTM-OPP Pitcher/Rcd. 2/17 Miss. Valley State (A) W 17-6 Rosbury/1-0 2/17 Miss. Valley State (A) W 7-4 Barne /1-02/21 Murray State W 9-0 Blount/1-02/24 Jacksonville State (A) L 6-8 Darby/0-12/24 Jacksonville State (A) L 2-5 Rosbury/1-12/25 Jacksonville State (A) L 2-6 Fanning/0-12/27 Evansville L 4-8 Blount/1-13/2 Northern Iowa W 3-0 Fuller/1-0 3/2 Northern Iowa L 1-2 Barne /1-13/3 Northern Iowa W 7-3 Darby/1-13/9 Chicago State T 2-2 (11) None3/10 Chicago State L 1-5 Blount/1-2
3/11 Chicago State L 1-2 Meyer/0-13/12 Tennessee (A) L 0-19 Fanning/0-23/13 Tennessee (A) L 5-11 Barne /1-2 3/16 * Morehead State (A) L 2-3 Blount/1-33/16 * Morehead State (A) L 2-8 Meyer/0-23/17 * Morehead State (A) L 2-12 Fuller/1-13/23 * Southeast Missouri (A) L 5-7 Fuller/1-23/23 * Southeast Missouri (A) W 4-2(8) Blount/2-33/24 * Southeast Missouri (A) T 5-5 None3/26 Arkansas State L 2-4 Meyer/0-33/27 Bethel (A) W 2-1 Barne /2-23/30 * Middle Tennessee L 3-11 Fuller/1-33/30 * Middle Tennessee W 5-1 Blount/3-33/31 * Middle Tennessee L 4-9 Darby/1-24/2 Memphis W 9-6 Meyer/1-34/5 * Murray State (A) L 1-10 La a/0-14/5 * Murray State (A) W 2-0 Blount/4-34/6 * Murray State (A) L 2-6 Darby/1-3 4/10 Bethel W 8-3 Fanning/1-24/11 * Murray State (A) W 11-7 Meyer/2-34/13 * Aus n Peay L 0-4 Darby/1-3 4/13 * Aus n Peay W 1-0 Blount/5-34/14 * Aus n Peay L 1-8 Fuller/1-44/15 Memphis (A) L 4-5 Fanning/1-34/17 Arkansas State (A) L 5-6 Meyer/2-44/20 * Eastern Kentucky W 7-3 Fanning/2-34/20 * Eastern Kentucky L 3-5(8) Blount/5-44/21 * Eastern Kentucky L 4-5 Fanning/1-34/24 Union L 8-20 Barne /2-34/27 * Tennessee Tech L 4-9 Fanning/2-44/27 * Tennessee Tech L 2-7 Blount/5-54/28 * Tennessee Tech L 10-12 Darby/1-65/4 $ Aus n Peay (A) L 1-16 Blount/5-65/4 $ Morehead State (N) L 4-6 Fanning/2-5* - OVC Game$ - OVC Tournament (Clarksville, Tenn.)
1997 ResultsVernon Prather
Overall:14-31 • OVC:8-16Home:10-14 • Away:4-17 • Neutral:0-0
Date Opponent W/L UTM-OPP Pitcher/Rcd. 2/18 Murray State L 5-17 Bount/0-12/19 Vanderbilt (A) L 3-8 Fuller/0-12/22 Jacksonville State L 2-10 Barne /0-12/23 Jacksonville State L 4-13 Meyer/0-12/28 Chicago State W 15-2 Blount/1-13/6 Memphis (A) L 3-5 Barne /0-23/8 Murray State (A) L 0-7 Fuller/0-23/8 Murray State (A) L 10-1 Blount/2-13/11 Samford (A) L 2-15 Barne /0-3 3/12 Jacksonville State (A) L 1-5 Meyer/0-23/15 * Eastern Illinois (A) W 6-2 Lasley/1-03/16 * Eastern Illinois (A) L 8-11 Blount/2-23/16 * Eastern Illinois (A) L 3-5 Barne /0-43/19 Northern Iowa L 1-11 Rosbury/0-13/19 Northern Iowa W 8-3 Cook/1-03/22 * Morehead State L 0-3 Blount/0-33/22 * Morehead State L 2-4 Barne /0-53/23 * Morehead State W 4-3 Lockhart/1-03/26 Saint Louis (A) L 3-7 Barne /0-63/29 IUPUI W 6-1 Fuller/1-23/29 IUPUI W 8-3 Blount/3-33/30 IUPUI W 11-10 Alford/1-1 4/2 Arkansas State L 0-9 Barne /0-74/5 * Middle Tennessee L 9-12 Lasley/1-14/6 * Middle Tennessee L 2-9 Blount/3-44/6 * Middle Tennessee W 2-0 Meyer/1-24/8 Saint Louis L 7-17 Ozment/0-14/12 * Eastern Kentucky (A) L 4-5 Fuller/1-34/12 * Eastern Kentucky (A) L 4-5 Lasley/1-24/13 * Eastern Kentucky (A) W 5-3 Meyer/2-24/16 Bethel W 17-1 Alford/2-04/19 * Tennessee Tech L 0-10 Fuller/1-44/19 * Tennessee Tech L 4-7 Blount/3-54/20 * Tennessee Tech W 13-7 Meyer/3-24/23 Arkansas State (A) L 4-5 Blount/3-64/26 * Murray State L 4-5 Fuller/1-54/26 * Murray State W 13-6 McDowell/1-04/27 * Murray State L 4-7 Meyer/3-34/29 Ole Miss (A) L 2-13 Lockhart/1-15/3 * Southeast Missouri(A) W 6-0 Blount/4-65/3 * Southeast Missouri (A) W 8-7 Barne /1-7
2018 SKYHAWK BASEBALL2018 SKYHAWK BASEBALL 71
5/4 * Southeast Missouri (A) L 4-5 McDowell/1-15/10 * Aus n Peay (A) L 1-2 Blount/4-75/10 * Aus n Peay (A) L 1-10 Meyer/3-45/11 * Aus n Peay (A) L 2-14 Fuller/1-6* - OVC Game
1998 ResultsVernon Prather
Overall:15-31 • OVC:6-18Home:10-19 • Away:5-12 • Neutral:0-0
Date Opponent W/L UTM-OPP Pitcher/Rcd. 2/18 Murray State (A) W 16-8 Blount/1-02/18 Murray State (A) L 2-4 Fuller/0-12/21 IUPUI W 10-5 Smar /1-02/21 IUPUI L 0-4 Bryant/0-12/22 IUPUI W 14-4 Fuller/1-12/25 Samford W 13-12 Blount/2-02/27 Northern Iowa L 4-5 Smar /1-1 2/27 Northern Iowa W 15-11 Alford/1-02/28 Northern Iowa L 2-15 Barne /0-33/1 Northern Iowa L 1-10 Blount/2-13/4 Belmont (A) L 2-7 Waller/0-13/4 Belmont (A) W 7-4 Parker/1-03/7 * Eastern Illinois L 2-16 Smar /1-23/7 * Eastern Illinois L 2-4 Blount/2-23/8 * Eastern Illinois W 14-13 Waller/1-13/11 Saint Louis L 3-12 Smar /1-33/14 * Morehead State L 1-4 Blount/2-33/14 * Morehead State W 17-0 Fuller/2-23/15 * Morehead State L 8-11 Parker/1-13/18 Jacksonville State (A) L 2-14 Smarrt/1-43/19 Jacksonville State (A) L 2-4 Parker/1-23/25 Arkansas State (A) L 0-4 Parker/1-33/28 * Middle Tennessee (A) W 8-6 Blount/3-33/28 * Middle Tennessee (A) L 8-11 Fuller/2-33/29 * Middle Tennessee (A) L 8-16 Parker/1-43/31 Memphis (A) W 4-2 Fuller/3-34/4 * Eastern Kentucky W 7-4 Blount/4-34/4 * Eastern Kentucky L 4-9 Parker/1-54/5 * Eastern Kentucky L 7-10 Fuller/3-44/7 Arkansas-Li le Rock W 10-7 Smar /2-44/8 Arkansas-Li le Rock L 5-11 Alford/1-14/10 * Tennessee Tech (A) L 5-12 Blount/4-44/10 * Tennessee Tech (A) L 1-11 Bryant/0-24/11 * Tennessee Tech (A) L 3-4 Fuller/3-44/15 Belmont L 1-14 Alford/1-24/15 Belmont W 4-0 Parker/2-54/18 * Murray State (A) W 5-2 Blount/5-44/18 * Murray State (A) L 0-5 Fuller/3-64/19 * Murray State (A) L 2-9 Bryant/0-34/21 Arkansas State L 4-7 Paker/2-64/25 * Southeast Missouri L 3-4 Blount/5-54/25 * Southeast Missouri L 0-13 Parker/2-74/26 * Southeast Missouri L 7-11 Fuller/3-75/2 * Aus n Peay L 0-12 Blount/5-65/2 * Aus n Peay W 8-4 Fuller/4-75/3 * Aus n Peay L 3-8 Alford/1-23* - OVC Game
1999 ResultsVictor (Bubba) Cates
Overall:16-38 • OVC:4-19Home:12-15 • Away:4-23 • Neutral:0-0
Date Opponent W/L UTM-OPP Pitcher/Rcd. 2/6 Arkansas-Li le Rock (A) L 8-11 Washburn/0-12/6 Arkansas-Li le Rock (A) L 1-5 Messero/0-12/7 Arkansas-Li le Rock (A) L 10-16 Allen/0-12/13 Vanderbilt (A) L 2-3 Allen/1-22/20 IUPUI W 13-2 Washburn/1-12/20 IUPUI W 7-3 Allen/1-22/21 IUPUI W 13-2 Freeman/1-12/24 Murray State L 5-8 Washburn/1-22/24 Murray State L 3-7 Allen/1-32/28 Belmont W 13-6 Alford/1-02/28 Belmont W 7-1 Freeman/2-03/2 Southern Indiana (A) L 5-9 Allen/1-43/3 Evansville (A) L 1-10 Washburn/1-33/6 Northern Iowa L 4-5 Freeman/2-13/7 Northern Iowa L 4-10 Messer/0-33/7 Northern Iowa W 13-7 Allen/3-43/9 Samford (A) L 8-9 Allen/2-43/12 Southeast Missouri L 7-12 Alford/1-13/12 Southeast Missouri W 7-6 Messer/0-3
3/16 Tennessee (A) L 3-6 Washburn/1-53/17 Tennessee (A) L 7-8 Allen/3-53/20 Belmont (A) L 0-2 Ozment/0-13/20 Belmont (A) W 7-6 Rogers/1-03/24 Saint Louis (A) W 20-15 Ozment/1-13/27 * Middle Tennessee L 3-15 Washburn/1-63/27 * Middle Tennessee L 3-13 Allen/3-63/28 * Middle Tennessee W 4-2 Freeman/3-14/2 * Eastern Kentucky (A) L 1-2 Freeman/3-24/2 * Eastern Kentucky (A) L 1-3 Washburn/1-74/3 * Eastern Kentucky (A) L 3-4 Gover/0-14/6 Arkansas State W 2-0 Freeman/4-24/7 North Alabama L 4-11 Messer/0-34/10 * Tennessee Tech W 2-1 Freeman/5-24/10 * Tennessee Tech W 2-0 Ozment/0-24/11 * Tennessee Tech L 3-4 Rogers/1-14/17 * Murray State L 2-3 Freeman/5-34/17 * Murray State L 3-4 Ozment/2-24/18 * Murray State W 1-5 Gover/0-24/20 Memphis (A) L 0-4 Alford/1-24/21 Arkansas State (A) L 5-13 Ozment/2-44/24 * Southeast Missouri (A) L 2-11 Holt/0-14/24 * Southeast Missouri (A) L 0-6 Ozment/2-44/25 * Southeast Missouri (A) L 2-11 Freeman/5-44/28 Murray State (A) W 10-9 Gover/1-25/1 * Aus n Peay (A) L 3-11 Freeman/5-55/1 * Aus n Peay (A) L 1-2 Holt/0-25/2 * Aus n Peay (A) W 8-6 Gover/2-25/8 * Eastern Illinois (A) L 6-13 Ozment/2-55/8 * Eastern Illinois (A) L 3-4 Holt/0-25/9 * Eastern Illinois (A) L 5-11 Gover/2-25/12 Saint Louis L 5-7 Washburn/1-85/15 * Morehead State L 1-11 Freeman/5-75/15 * Morehead State L 2-9 Ozment/1-4516 * Morehead State L 3-4 Holt/04* - OVC Game
2000 ResultsVictor (Bubba) Cates
Overall:12-41 • OVC:2-21Home:5-19 • Away:5-22 • Neutral:0-0
Date Opponent W/L UTM-OPP Pitcher/Rcd. 2/12 Jacksonville State (A) L 8-15 Carter/0-12/13 Jacksonville State (A) L 3-9 Holt/0-12/15 Memphis (A) W 6-4 Doyle/1-0 2/20 Southern Illinois L 0-3 Carter/0-22/20 Southern Illinois L 5-9 Holt/0-22/22 Samford (A) L 10-13 Washburn/0-12/23 Samford (A) L 6-12 Ozment/0-12/27 Northern Illinois W 6-5 Carter/1-22/27 Northern Illinois L 8-11 Holt/0-32/29 Southern Indiana W 20-19 Doyle/2-03/1 Arkansas State (A) L 5-8 Doyle/2-13/4 Arkansas-Li le Rock L 0-1 Carter/1-33/4 Arkansas-Li le Rock L 6-16 Alford0-13/5 Arkansas-Li le Rock W 10-7 Doyle/3-13/8 Belmont (A) L 1-8 Bevis/0-13/8 Belmont (A) L 1-3 Carter/1-43/12 Southeast Missouri (A) L 4-13 Alford/0-23/12 Southeast Missouri (A) L 0-6 Doyle/3-23/14 Mississippi State (A) L 1-16 Carter/1-53/15 Mississippi State (A) L 3-14 Doyle/3-33/18 * Middle Tennessee (A) L 3-9 Washburn/0-23/18 * Middle Tennessee (A) L 1-7 Carter/1-63/21 Belmont W 3-2 Doyle/4-33/21 Belmont W 9-4 Holt/1-33/22 Saint Louis L 5-17 Washburn/0-33/25 * Eastern Kentucky L 3-7 Holt/1-43/25 * Eastern Kentucky L 1-3 Doyle/4-43/26 * Eastern Kentucky L 4-8 Washburn/0-43/28 Ole Miss (A) W 8-5 Spiceland/1-04/8 * Murray State (A) L 5-9 Doyle/4-54/9 * Murray State (A) L 3-8 Carter/1-74/9 * Murray State (A) L 6-7 Holt/1-54/11 Southern Illinois (A) L 6-12 Spiceland/1-14/15 * Southeast Missouri L 7-8 Washburn/0-54/15 * Southeast Missouri L 5-8 Carter/1-84/16 * Southeast Missouri L 0-16 Holt/1-74/18 Ole Miss (N) L 5-14 Washburn/0-64/21 * Aus n Peay L 3-13 Holt/1-74/21 * Aus n Peay L 2-6 Carter/1-94/22 * Aus n Peay L 3-7 Doyle/4-64/25 Southeast Missouri (A) L 2-11 Freeman/5-4
4/27 Saint Louis (A) W 6-5 Washburn/1-64/29 * Eastern Illinois L 2-5 Holt/1-84/29 * Eastern Illinois L 4-11 Careter/1-104/30 * Eastern Illinois L 9-10 Washburn/1-75/6 * Morehead State (A) W 11-3 Doyle/5-65/6 * Morehead State (A) L 1-9 Holt/1-95/7 * Morehead State (A) L 10-19 Washburn/1-85/9 * Tennessee Tech (A) W 6-5 Holt/2-95/9 * Tennessee Tech (A) L 6-8 Carter/1-115/10 * Tennessee Tech (A) L 3-13 Doyle/5-7* - OVC Game
2001 ResultsVictor (Bubba) Cates
Overall:8-46 • OVC:3-18Home:5-23 • Away:3-23 • Neutral:0-0
Date Opponent W/L UTM-OPP Pitcher/Rcd. 2/11 Vanderbilt (A) L 0-5 Venczel/0-12/21 Memphis (A) L 1-6 Sullivan/0-12/24 Northern Illinois L 3-13 Venczel/0-22/24 Northern Illinois L 5-12 Entrekin/0-12/25 Northern Illinois L 6-8 Allen/0-12/28 Mississippi State (A) L 1-5 Venczel/0-32/28 Mississippi State (A) L 0-4 Sullivan/0-23/3 Bradley L 1-5 Allen/0-23/3 Bradley W 7-1 Entrekin/1-13/6 Belmont (A) L 2-5 Sullivan/0-33/6 Belmont (A) L 2-7 Venczel/0-43/10 Arkansas-Li le Rock (A) L 1-5 Allen/0-33/10 Arkansas-Li le Rock (A) L 2-15 Entrekin/1-23/11 Arkansas-Li le Rock (A) W 7-4 Spiceland/1-03/11 Arkansas-Li le Rock (A) L 5-6 Meadows/0-13/13 Kentucky (A) L 3-11 Spiceland/1-13/14 Kentucky (A) L 1-8 Entrekin/1-33/17 * Aus n Peay L 0-1 Sullivan/0-43/17 * Aus n Peay L 4-9 Venczel/0-53/18 * Aus n Peay L 6-8 Entrekin/1-43/20 Saint Louis W 6-1 Meadows/1-13/21 Arkansas State (A) L 2-13 Allen/0-43/24 * Tennessee Tech (A) L 1-6 Sullivan0-53/24 * Tennessee Tech (A) L 2-8 Venczel/0-63/25 * Tennessee Tech (A) L 1-6 Meadows/1-23/28 Lambuth L 3-6 Entrekin/1-53/31 * Eastern Illinois L 6-13 Sullivan/0-63/31 * Eastern Illinois L 3-10 Venczel/0-74/1 * Eastern Illinois L 2-16 Meadows/1-3 4/3 Lipscomb L 3-7 Entrekin/1-64/7 * Morehead State (A) L 3-16 Sullivan/0-74/7 * Morehead State (A) W 20-19 Venczel/1-74/8 * Morehead State (A) L 7-14 Meadows/1-44/10 Chris an Brothers W 10-6 Bevis/1-04/13 * Southeast Missouri L 0-7 Sullivan/0-84/13 * Southeast Missouri L 9-18 Alllen/0-54/14 * Southeast Missouri W 8-6 Meadows/2-44/17 Samford L 5-6 Bevis/1-14/18 Samford L 4-6 Spiceland/1-24/21 * Murray State (A) L 6-14 Meadows/2-54/21 * Murray State (A) L 2-5 Sullivan/0-94/22 * Murray State (A) L 6-8 Venczel/1-84/24 Memphis L 4-19 Allen/0-64/25 Lipscomb L 8-18 Meadows/2-64/28 * Eastern Kentucky L 7-13 Allen/0-74/28 * Eastern Kentucky L 2-4 Venczel/1-94/29 * Eastern Kentucky W 9-5 Meadows/3-65/1 Saint Louis (A) L 4-5 Sullivan/0-105/5 Belmont L 7-17 Venczel/1-105/5 Belmont L 4-5 Meadows/3-75/10 Arkansas State L 5-10 Entrekin/1-75/12 Southern Illinois (A) L 3-7 Sullivan/0-115/12 Southern Illinois (A) L 0-1 Venczel/1-115/13 Southern Illinois (A) W 4-2 Meadows/4-7* - OVC Game
2002 ResultsVictor (Bubba) Cates
Overall:18-33 • OVC:4-15Home:11-15 • Away:7-18 • Neutral:0-0
Date Opponent W/L UTM-OPP Pitcher/Rcd. 2/16 Arkansas-Li le Rock (A L 2-14 Sullivan/0-12/16 Arkansas-Li le Rock (A) L 1-5 Venczel/0-12/17 Arkansas-Li le Rock (A) W 8-6 Allen/1-02/20 Memphis L 5-13 Allen/1-13/2 Southeastern Louisiana (A) L 3-4 Venczel/0-2
YEARLY DIVISION-I RESULTSYEARLY DIVISION-I RESULTS
2018 UT MARTIN BASEBALL2018 UT MARTIN BASEBALL72
YEARLY DIVISION-I RESULTSYEARLY DIVISION-I RESULTS3/2 Southeastern Louisiana (A) L 5-6 Allen/1-23/3 Southeastern Louisiana (A) W 14-4 Meadows/1-03/6 Southern Illinois L 10-12 Summers/0-13/8 Illinois-Chicago L 1-27 Venczel/0-33/9 Illinois-Chicago L 3-9 Sullivan/0-23/10 Illinois-Chicago L 0-3 Allen/1-33/10 Illinois-Chicago W 2-1 Meadows/2-03/13 Samford (A) L 3-24 Venczel/0-33/13 Samford (A) L 1-2 Corey/0-13/14 Lipscomb (A) L 5-7 Sullivan/0-33/16 Western Illinois W 6-2 Allen/2-33/16 Western Illinois W 7-0 Meadows/3-03/17 Western Illinois W 10-9 Sullivan/1-33/23 * Tennessee Tech W 10-0 Allen/3-33/23 * Tennessee Tech L 0-13 Meadows/3-13/24 * Tennessee Tech W 13-8 Sullivan/2-33/27 Chris an Brothers W 4-1 Corey/1-133/3 * Eastern Illinois (A) L 1-10 Allen/3-43/30 * Eastern Illinois (A) W 4-2 Meadows/4-14/2 Mississippi State (A) L 5-6 Venczel/0-54/6 * Morehead State L 4-6 Allen/3-5 4/6 * Morehead State L 6-20 Corey/1-24/7 * Morehead State L 8-16 Sullivan/2-44/9 Lipscomb L 6-7 Summers/0-24/10 Saint Louis (A) W 5-2 Allen/4-54/13 * Southeast Missouri (A) L 3-16 Allen/4-64/13 * Southeast Missouri (A) L 8-12 Sullivan/2-54/14 * Southeast Missouri (A) L 2-12 Hite/0-14/16 Mar n Methodist W 13-12 Sullivan/3-64/17 Mississippi Valley State W 16-2 Spiceland/1-24/20 * Murray State L 10-12 Summers/0-34/20 * Murray State L 7-10 Bevis/0-14/21 * Murray State L 1-3 Sullivan/3-64/23 Ole Miss (A) L 1-3 Venczel/0-64/24 Bethel W 21-0 Corey/2-24/28 * Eastern Kentucky (A) L 1-14 Allen/4-74/28 * Eastern Kentucky (A) L 7-9 Venczel/0-75/4 Southern Illinois (A) W 8-6 Allen/5-75/4 Southern Illinois (A) L 7-11 Venczel/0-85/10 Arkansas State L 6-10 Allen/5-85/12 Arkansas State (A) W 2-1 Sullivan/4-75/14 Belmont L 0-8 Allen/5-95/14 Belmont W 2-1 Hite/1-15/18 * Aus n Peay (A) L 1-4 Sullivan/4-75/18 * Aus n Peay (A) L 1-2 Allen/5-105/19 * Aus n Peay (A) W 7-5 Spiceland/2-0* - OVC Game
2003 ResultsVictor (Bubba) Cates
Overall:17-30-1 • OVC:6-13-1Home:13-13-1 • Away:4-17 • Neutral:0-0
Date Opponent W/L UTM-OPP Pitcher/Rcd. 3/1 Arkansas-Li le Rock (A) L 2-9 Corey/0-13/1 Arkansas-Li le Rock (A) L 6-13 Robinson/0-13/2 Arkansas-Li le Rock (A) W 13-6 Bryant/1-03/2 Arkansas-Li le Rock (A) L 2-19 Es ll/0-13/4 Saint Louis W 6-5 Corey/1-13/8 Southeastern Louisiana W 22-6 Robinson/1-13/8 Southeastern Louisiana L 8-14 Summers/0-13/9 Southeastern Louisiana L 12-13 McBride/0-13/11 Birmingham-Southern (A) L 3-9 Spiceland/0-13/12 Birmingham-Southern (A) L 5-21 Robinson/1-23/15 Dayton L 1-3 Corey/1-23/15 Dayton W 7-2 Bryant/2-03/16 Dayton L 7-8 Es ll/0-23/17 Mar n Methodist W 9-8 Summers/1-13/22 Chicago State W 4-3 Corey/2-23/22 Chicago State W 11-5 Summers/2-13/23 Chicago State W 10-4 Robinson/2-23/26 Arkansas State W 6-3 Spiceland/1-13/27 Berea College W 32-9 Es ll/1-24/1 Saint Louis (A) L 7-11 Robinson/2-34/2 Memphis (A) L 1-24 Hall/0-14/5 * Aus n Peay L 3-11 Spiceland/1-24/5 * Aus n Peay T 10-10 None4/8 Chris an Brothers W 5-2 Bryant/3-04/12 * Tennessee Tech (A) L 1-3 Corey/2-34/12 * Tennessee Tech (A) L 1-7 Robinson/2-44/13 * Tennessee Tech (A) L 4-5 Summers/2-24/15 Lipscomb L 4-17 Alford/0-14/18 * Eastern Kentucky (A) W 7-2 Corey/3-34/18 * Eastern Kentucky (A) L 5-7 Bryant/3-1
4/19 * Eastern Kentucky (A) L 8-18 Spiceland/1-34/22 Ole Miss (A) L 0-7 Bryant/3-24/26 * Morehead State W 8-3 Corey/4-34/26 * Morehead State W 11-5 Robinson/3-44/27 * Morehead State L 9-15 Massey/0-14/29 Belmont (A) L 4-8 Es ll/1-34/29 Belmont (A) L 1-7 Dobson/0-15/3 * Southeast Missouri L 1-9 Corey/4-45/3 * Southeast Missouri L 2-14 Bryant/3-35/4 * Southeast Missouri L 5-20 Massey/0-25/7 Arkansas State (A) L 2-7 Summers/2-35/10 * Murray State (A) L 8-12 Robinson/3-55/10 * Murray State (A) W 9-3 Bryant/4-35/11 * Murray State (A) W 11-6 Spiceland/2-35/13 Memphis L 4-7 Summers/2-45/16 * Eastern Illinois L 14-19 Corey/4-55/17 * Eastern Illinois W 11-2 Bryant/5-35/17 * Eastern Illinois L 8-13 Summers/2-5* - OVC Game
2004 ResultsVictor (Bubba) Cates
Overall:16-38 • OVC:7-20Home:10-21 • Away:6-17 • Neutral:0-0
Date Opponent W/L UTM-OPP Pitcher/Rcd. 2/17 Western Kentucky L 2-8 Bryant/0-12/18 Arkansas State (A) L 1-2 Link/0-12/21 Louisiana-Monroe L 0-12 Smith/0-12/21 Louisiana-Monroe W 5-2 Bryant/1-12/22 Louisiana-Monroe L 3-9 Meador/0-12/25 Belmont L 12-16 Summers/0-12/28 Bradley University W 4-2 Meador/1-12/28 Bradley University W 5-2 Bryant/2-12/29 Bradley University L 5-20 Smith/0-23/2 Belmont (A) W 5-3 Link/1-13/4 Viterbo L 6-9 Es ll/0-13/9 Memphis L 4-7 Bryant/2-23/11 # Wake Forest (N) L 1-5 Ledlow/0-13/13 # Western Illinois (N) L 7-10 Dobson/0-13/14 # Missouri (N) L 3-7 Bryant/2-33/16 Vanderbilt (A) L 5-6 Ledlow/0-23/17 Lambuth L 1-13 Robinson/0-23/23 Saint Louis (A) W 8-3 Massey/1-03/27 * Eastern Illinois (A) W 8-3 Meador/2-13/27 * Eastern Illinois (A) L 1-5 Bryant/2-43/28 * Eastern Illinois (A) W 8-4 Massey/2-03/31 Western Kentucky (A) L 7-11 Es ll/0-24/3 * Eastern Kentucky W 4-3 Meador/3-14/3 * Eastern Kentucky L 1-6 Massey/2-14/4 * Eastern Kentucky L 4-20 Bryant/2-54/6 Harding University W 13-4 Es ll/1-24/9 * Morehead State (A) L 12-13 Meador/3-24/9 * Morehead State (A) L 6-11 Massey/2-24/10 * Morehead State (A) L 5-22 Bryant/2-64/14 Saint Louis W 14-4 Robinson/1-24/17 * Tennessee Tech W 20-11 Meador/4-24/17 * Tennessee Tech W 5-4 Dobson /1-14/18 * Tennessee Tech L 8-12 Robinson/1-34/20 Lipscomb (A) L 6-7 Summers/0-24/24 * Aus n Peay (A) L 2-23 Meador/4-34/24 * Aus n Peay (A) L 4-13 Dobson/1-24/25 * Aus n Peay (A) L 1-13 Massey/2-34/27 Miss. Valley State (A) W 8-2 Meador/5-34/27 Miss. Valley State (A) W 2-1 Es ll/2-25/1 * Murray State (A) L 5-9 Es ll/1-35/1 * Murray State (A) L 4-5 Summers/1-35/2 * Murray State (A) L 3-4 Meador/5-45/5 Arkansas State L 2-19 Smothers/0-15/8 * Jacksonville State L 4-13 Dobson/1-35/8 * Jacksonville State L 8-10 Massey/2-45/9 * Jacksonville State W 21-16 Summers/2-35/12 Lipscomb L 1-4 Robinson/1-45/15 * Samford L 2-16 Dobson/2-45/15 * Samford L 2-3 Massey/2-55/16 * Samford L 1-6 Meador/5-55/18 Memphis L 2-9 Ledlow/0-55/21 * Southeast Missouri L 2-9 Massey/2-65/21 * Southeast Missouri L 4-12 Summers/2-45/22 * Southeast Missouri W 17-16 Dobson/2-4# - Easton Challenge (Millington, Tenn.)* - OVC Game
2005 ResultsVictor (Bubba) Cates
Overall:12-43 • OVC:6-20Home:7-21 • Away:5-19 • Neutral:0-3
Date Opponent W/L UTM-OPP Pitcher/Rcd. 2/18 Louisiana-Monroe (A) L 1-6 Massey/0-12/19 Louisiana-Monroe (A) L 0-1 Bryant/0-12/20 Louisiana-Monroe (A) L 4-7 Es ll/0-1 2/23 #16 Vanderbilt (A) L 5-12 Ledlow/0-1 2/25 Mar n Methodist W 5-4 Dobson/1-0 3/1 Arkansas State L 4-18 Es ll/0-2 3/2 Memphis L 1-4 Massey/0-23/5 Western Illinois W 5-4 Ledlow/1-13/5 Western Illinois W 4-3 Bryant/1-1 3/6 Western Illinois W 17-8 Es ll/1-2 3/8 Evansville L 3-4 Massey/0-3 3/9 Evansville L 3-13 Link/0-1 3/12 # Indiana State (N) L 2-4 Bryant/1-23/13 # Connec cut (N) L 0-3 Massey/0-4 3/13 # Arkansas-Li le Rock (N) L 0-3 Es ll/1-33/15 Birmingham-Southern (A) L 1-7 Ledlow/1-23/16 Birmingham-Southern (A) L 7-9 Link/0-23/17 Lipscomb (A) L 4-6 Bryant/1-3 3/25 * Eastern Illinois W 16-4 Massey/1-43/25 * Eastern Illinois L 1-3 Ledlow/1-33/26 * Eastern Illinois L 2-7 Es ll/1-4 3/29 Southern Illinois (A) L 3-4 Summers/0-14/3 * Eastern Kentucky (A) L 2-11 Massey/1-54/3 * Eastern Kentucky (A) W 6-5 Bryant/2-3 4/5 Arkansas State L 1-7 Es ll/1-5 4/9 * Morehead State L 3-8 Ledlow/1-4 4/9 * Morehead State L 3-5 Bryant/2-4 4/10 * Morehead State L 11-18 Es ll/1-64/13 Saint Louis (A) W 9-7 Summers/1-04/16 * Tennessee Tech (A) L 2-5 Ledlow/1-54/16 * Tennessee Tech (A) W 3-2 Bryant/3-4 4/17 * Tennessee Tech (A) L 0-8 Es ll/1-7 4/19 Southern Illinois L 7-12 Smothers/0-14/20 Lipscomb L 3-8 Link/0-3 4/23 * Aus n Peay L 3-14 Ledlow/1-64/23 * Aus n Peay L 0-2 Bryant/3-54/24 * Aus n Peay L 1-6 Es ll/1-84/27 Belmont L 2-3 Smothers/0-24/30 * Murray State L 3-4 Ledlow/1-74/30 * Murray State L 2-6 Bryant/3-65/1 * Murray State W 4-2 Massey/2-55/3 Belmont (A) L 2-5 Link/0-45/3 Belmont (A) W 10-8 Smothers/1-25/7 * Jacksonville State (A) L 0-8 Ledlow/1-85/7 * Jacksonville State (A) L 4-6 Summers/1-25/8 * Jacksonville State (A) W 4-3 Massey/3-55/11 Memphis (A) L 3-7 Smothers/1-35/14 * Samford W 7-6 Summers/2-25/14 * Samford L 0-8 Bryant/3-65/15 * Samford L 1-7 Massey/3-65/17 Mississippi State (A) L 3-17 Es ll/1-95/17 Mississippi State (A) L 3-8 Smothers/1-45/20 * Southeast Missouri (A) L 4-6 Ledlow/1-95/20 * Southeast Missouri (A) L 2-4 Bryant/3-85/21 * Southeast Missouri (A) L 3-4 Massey/3-7# - USA Challenge (Millington, Tenn.) • * - OVC Game
2006 ResultsVictor (Bubba) Cates
Overall:20-35 • OVC:9-18Home:14-10 • Away:6-24 • Neutral:0-1
Date Opponent W/L UTM-OPP Pitcher/Rcd. 2/17 Northwestern State (A) L 1-9 Smothers/0-12/17 Northwestern State (A) L 1-7 Ledlow/0-12/19 Northwestern State (A) L 2-7 Rockholt/0-12/25 Bradley University L 2-7 Smothers/0-22/25 Bradley University W 4-3 Cameron/1-02/26 Bradley University L 6-14 Rockholt/ 0-22/28 Memphis (A) L 7-9 Link/ 0-13/1 Union University W 10-9 Cameron/2-03/4 Freed-Hardeman L 5-10 Rockholt/0-33/4 Freed-Hardeman W 4-3 Cameron/3-03/7 Arkansas State (A) L 3-12 Link/0-23/7 Arkansas State (A) W 5-4 Smothers/1-23/10 Arkansas - Li le Rock (A) L 2-5 Ledlow/0-23/11 Arkansas - Li le Rock (A) L 7-12 Smothers/1-33/11 Arkansas - Li le Rock (A) L 4-5 Es ll/0-13/14 Belmont (A) W 4-3 Dobson/1-0
2018 SKYHAWK BASEBALL2018 SKYHAWK BASEBALL 73
3/15 Lipscomb (A) L 3-4 Ledlow/0-33/16 Middle Tennessee (A) L 11-12 Dobson/1-13/25 * Southeast Missouri W 3-2 Dobson/2-13/25 * Southeast Missouri W 2-1 Smothers/2-33/26 * Southeast Missouri W 1-0 Rockholt/1-33/29 Southern Illinois (A) L 1-7 Link/0-34/1 * Eastern Illinois (A) L 1-6 Ledlow/0-44/1 * Eastern Illinois (A) L 4-5 Dobson/2-24/2 * Eastern Illinois (A) W 8-5 Rockholt/2-34/4 Southern Illinois W 5-4 Es ll/1-14/5 ^ Memphis (N) L 4-5 Dobson/2-34/8 * Eastern Kentucky L 2-4 Ledlow/0-54/8 * Eastern Kentucky L 1-6 Smothers/2-54/9 * Eastern Kentucky L 3-11 Rockholt/2-44/10 Mar n Methodist (A) L 3-4 Cameron/3-14/11 Saint Louis W 12-4 Ledlow/1-54/14 * Morehead State (A) L 7-10 Smothers/2-54/14 * Morehead State (A) L 0-2 Ledlow/1-64/15 * Morehead State (A) W 23-7 Rockholt/3-4 4/18 Arkansas State W 11-5 Walker/1-04/19 Lipscomb W 9-8 Smothers/3-54/22 * Tennessee Tech W 5-1 Ledlow/2-64/22 * Tennessee Tech L 5-7 Cameron/3-24/23 * Tennessee Tech W 6-5 Dobson/3-34/27 Miss. Valley State (A) W 1-0 Link/1-34/29 * Aus n Peay (A) L 1-7 Ledlow/2-74/29 * Aus n Peay (A) L 4-7 Smothers/3-64/30 * Aus n Peay (A) L 3-4 Rockholt/2-55/2 Belmont W 4-1 Link/2-35/6 * Murray State (A) L 4-6 Ledlow/2-85/6 * Murray State (A) L 2-7 Smothers/3-75/7 * Murray State (A) W 9-4 Rockholt/4-55/13 * Jacksonville State L 0-7 Ledlow/2-95/13 * Jacksonville State L 2-4 Smothers/3-85/14 * Jacksonville State L 1-12 Rockholt/4-65/16 Mississippi State (A) L 6-8 Cameron/3-35/19 * Samford (A) L 4-5 Ledlow/2-105/19 * Samford (A) L 0-2 Smothers/3-95/20 * Samford (A) W 9-7 Cameron/4-3^ - in Union City, Tenn. * - OVC Game
2007 ResultsVictor (Bubba) Cates
Overall:19-36 • OVC:7-19Home:16-13 • Away:3-21 • Neutral:0-2
Date Opponent W/L UTM-OPP Pitcher/Rcd. 2/16 Southeastern Louisiana (A) L 6-3 Ledlow/0-12/17 Southeastern Louisiana (A) L 16-1 Smothers/0-12/18 Southeastern Louisiana (A) L 10-3 Rockholt/0-12/25 Bradley University L 14-8 Webb/0-12/25 Bradley University W 3-2 Rockholt/1-12/27 Memphis (A) L 2-1 Webb/0-22/28 Southern Illinois L 12-5 Blackmon/0-13/6 South Dakota State W 5-4 (10) Cameron/1-03/7 South Dakota State L 15-4 Walker/0-13/9 Kentucky (A) L 6-4 Ledlow/0-23/10 Kentucky (A) L 27-0 Walker/0-23/11 Kentucky (A) L 16-7 Smothers/0-23/13 McKendree W 6-0 Blackmon/1-13/14 McKendree W 17-8 Rockholt/2-13/17 IPFW W 4-1 Ledlow/1-23/17 IPFW W 5-2 Walker/1-23/18 IPFW L 7-5 Smothers/0-33/20 Saint Louis (A) L 1-0 Rockholt/2-23/24 * Southeast Missouri (A) L 7-6 Cameron/1-13/24 * Southeast Missouri (A) L 7-5 Walker/1-33/25 * Southeast Missouri (A) L 18-8 Blackmon/1-23/27 Arkansas State W 8-3 Smothers/1-33/28 Southern Illinois (A) L 13-8 Walker/1-43/31 * Eastern Illinois W 8-7 Cameron/2-14/1 * Eastern Illinois L 8-5 Blackmon/1-34/1 * Eastern Illinois L 8-7 Cameron/2-24/4 Lipscomb (A) L 5-3 Cameron/2-34/6 * Eastern Kentucky (A) L 13-8 Ledlow/1-34/6 * Eastern Kentucky (A) W 6-1 Blackmon/2-34/9 & Mar n Methodist (N) L 14-10 (12) Cameron/2-44/11 Saint Louis W 5-1 Rockholt/3-24/14 * Morehead State W 7-6 (10) Cameron/3-44/15 * Morehead State L 8-0 Blackmon/2-44/15 * Morehead State W 5-4 (8) Walker/2-44/17 Arkansas State (A) L 6-1 Walker/2-54/19 Lyon College W 7-3 Rockholt/4-2
4/20 * Tennessee Tech (A) L 8-5 Rockholt/4-34/21 * Tennessee Tech (A) L 7-3 Blackmon/2-54/22 * Tennessee Tech (A) L 9-5 Smothers/1-44/24 Belmont W 11-8 Webb/1-24/25 Lipscomb W 20-15 Smothers/2-44/28 * Aus n Peay L 4-0 Ledlow/1-44/28 * Aus n Peay L 15-3 Blackmon/2-64/29 * Aus n Peay L 4-2 Walker/2-65/1 Belmont (A) W 3-1 Smothers/2-45/5 * Murray State L 10-6 Ledlow/1-55/5 * Murray State W 10-9 Cameron/4-45/6 * Murray State W 8-5 Walker/3-65/12 * Jacksonville State (A) L 13-2 Ledlow/1-65/12 * Jacksonville State (A) W 4-3 Blackmon/3-65/13 * Jacksonville State (A) L 3-1 Walker/3-75/15 ^ - Memphis (N) L 5-3 Smothers/3-55/18 * Samford L 13-5 Walker/3-85/18 * Samford L 11-3 Blackmon/3-75/19 * Samford L 7-1 Smothers/3-6& - in Savannah, Tenn.^ - in Union City, Tenn.* - OVC Game
2008 ResultsVictor (Bubba) Cates
Overall: 10-41 • OVC: 5-25Home: 4-15 • Away: 5-23 • Neutral: 1-3
Date Opponent W/L UTM-OPP Pitcher/Rcd. 2/23 USC Upstate (A) L 5-7 Walker/0-12/23 George Washington (N) L 6-10 McElyea/0-12/14 New Jersy Ins tute of Technology (N) L 4-14 Cates/0-12/27 Memphis (A) L 7-10 Su on/0-12/28 Southern Illinois L 6-10 McElyea/0-23/1 Creighton L 4-9 Blackmon/0-13/1 Creighton L 1-12 Walker/0-23/2 Creighton L 2-8 Lantz/0-13/6 Lambuth L 6-11 Cates/0-23/11 Arkansas-Li le Rock (A) W 2-0 Walker/1-03/12 Arkansas-Li le Rock (A) L 5-19 Lantz/0-23/14 Louisiana Tech (A) L 5-8 Cates/0-33/15 Louisiana Tech (A) L 1-6 Pa erson/0-13/16 Louisiana Tech (A) L 6-11 Lantz/0-33/21 * Samford (A) L 3-5 Walker/1-33/21 * Samford (A) L 1-14 Lantz/0-43/22 * Samford (A) L 5-12 Pa erson/0-23/25 Arkansas State L 6-12 Blackmon/0-23/26 Southern Illinois (A) L 3-6 Cates/0-43/29 * Southeast Missouri L 6-19 Walker/1-44/1 Arkansas State (A) W 9-8 (10) Pa erson/1-24/2 Lipscomb W 9-8 (10) Su on/1-14/5 * Eastern Illinois L 4-6 Walker/1-54/5 * Eastern Illinois L 6-8 Lantz/0-54/6 * Eastern Illinois L 2-13 Pa erson/1-34/8 Evansville L 10-15 Cates/0-54/9 Lipscomb (A) L 9-10 McElyea/0-34/12 * Eastern Kentucky L 3-6 Walker/1-64/12 * Eastern Kentucky L 0-6 Lantz/0-64/13 * Eastern Kentucky W 6-3 Su on/2-14/15 Saint Louis (A) L 4-11 Cates/0-64/16 Memphis (N) L 3-7 McElyea/0-44/19 * Morehead State (A) L 8-16 Walker/1-74/19 * Morehead State (A) W 16-12 Pa erson/2-34/20 * Morehead State (A) L 8-13 Lantz/1-74/22 Evansville (A) W 13-12 Cates/1-64/26 * Tennessee Tech W 5-4 Walker/2-74/26 * Tennessee Tech W 5-0 Su on/3-14/27 * Tennessee Tech L 1-8 Lantz/0-84/29 Belmont W 6-5 Pa erson/3-34/29 Belmont L 5-14 Bixby/0-15/3 * Aus n Peay (A) L 3-13 Walker/2-85/4 * Aus n Peay (A) W 4-2 Su on/4-15/4 * Aus n Peay (A) L 3-12 McElyea/0-55/10 * Murray State (A) L 1-5 Walker/2-95/10 * Murray State (A) L 1-5 Su on/4-25/11 * Murray State (A) L 4-13 McElyea/0-65/13 Belmont (A) L 5-12 Bowker/0-15/16 * Jacksonville State L 7-10 Walker/2-105/16 * Jacksonville State L 0-5 Su on/4-35/17 * Jacksonville State L 8-15 McElyea/0-7* - OVC Game
2009 ResultsVictor (Bubba) Cates
Overall: 21-30 • OVC: 10-14Home: 12-13 • Away: 9-16 • Neutral: 0-1
Date Opponent W/L UTM-OPP Pitcher/Rcd. 2/20 Central Arkansas (A) L 5-11 Green/0-12/21 Central Arkansas (A) W 7-6 Hensley/1-02/22 Central Arkansas (A) L 6-15 Flaniken/0-12/24 Southern Illinois W 6-5 Bowker/1-02/25 Evansville W 13-2 Green/1-13/3 Southern Illinois (A) L 4-5 Green/1-23/4 Bethel W 8-7 Pa erson/1-03/5 Lambuth L 4-8 Flaniken/0-23/10 UAB (A) L 5-13 Green/1-33/11 UAB (A) L 2-13 Cates/0-13/13 Georgia State (A) L 7-10 Hensley/1-13/13 Georgia State (A) W 8-7 (10) Hensley/2-13/17 Memphis (A) W 9-2 Green/2-33/18 Iowa L 6-25 Bowker/1-13/20 Purdue L 7-11 (10) Pa erson/1-13/21 SIU Edwardsville L 7-9 Flaniken/0-33/22 SIU Edwardsville W 12-5 Green/3-33/24 Arkansas-Li le Rock W 20-11 Vesser/1-03/25 Arkansas-Li le Rock W 12-3 Hensley/3-13/28 * Southeast Missouri (A) L 5-6 (10) Hensley/3-23/28 * Southeast Missouri (A) L 7-9 Lozupone/0-13/29 * Southeast Missouri (A) L 8-12 Vesser/1-14/1 Evansville (A) L 1-9 Cates/0-24/4 * Eastern Kentucky (A) L 7-12 Green/3-44/4 * Eastern Kentucky (A) L 2-4 Lozupone/0-24/5 * Eastern Kentucky (A) W 10-9 (10) Owen/1-04/7 Belmont L 4-6 Flaniken/0-44/10 * Eastern Illinois L 3-10 Green/3-54/10 * Eastern Illinois W 13-3 Lozupone/1-24/11 * Eastern Illinois W# 3-30 None4/14 Saint Louis L 3-4 Cates/0-34/15 Lipscomb (A) W 10-6 Pa erson/2-14/18 * Morehead State L 2-16 Green/3-64/18 * Morehead State W 6-5 Flaniken/1-44/19 * Morehead State L 10-17 Pa erson/2-24/21 Arkansas State W 6-2 Cates/1-34/22 $Memphis (N) L 4-6 Hensley/3-34/25 * Tennessee Tech (A) W 21-5 Lozupone/2-24/25 * Tennessee Tech (A) L 0-1 Green/3-74/26 * Tennessee Tech (A) L 6-12 Flaniken/1-55/2 * Aus n Peay L 3-6 Green/3-85/2 * Aus n Peay L 6-8 Flaniken/1-65/3 * Aus n Peay W 6-1 Hensley/4-35/9 * Murray State L 0-12 Lozupone/2-35/9 * Murray State W 3-2 Green/4-85/10 * Murray State L 4-13 Hensley/4-45/13 Belmont (A) L 6-12 Cates/1-45/13 Belmont (A) L 4-8 Flaniken/1-75/15 * Jacksonville State (A) W 11-7 Lozupone/3-35/15 * Jacksonville State (A) W 17-2 Green/5-85/16 * Jacksonville State (A) W 3-2 Webb/1-0* - OVC Game# - Game was forfeited by Eastern Illinois$ - Pringles Park - Jackson, Tenn.
2010 ResultsVictor (Bubba) Cates
Overall: 24-31 • OVC: 8-16Home: 15-11 • Away: 7-20 • Neutral: 2-0
Date Opponent W/L UTM-OPP Pitcher/Rcd. 2/20 IPFW W 5-2 Green/1-02/20 IPFW W 5-1 Lozupone/1-02/21 IPFW W 7-6 (11) Mills/1-02/23 Memphis W 5-4 Cupples/1-02/26 #Houston Bap st W 7-4 Lozupone/2-02/27 #Nicholls State (A) L 2-8 Green/1-1 2/28 #Bryant W 6-3 Mills/2-03/3 Lipscomb L 1-4 Swaringen/0-13/6 Indiana State (A) W 4-3 Green/2-13/6 Indiana State (A) L 4-5 (13) Tobik/0-13/7 Indiana State (A) L 7-12 Flaniken/0-13/10 Vanderbilt (A) L 1-9 Cupples/1-13/12 King College W 8-6 Tobik/1-13/13 King College L 4-5 Mills/2-13/16 Arkansas-Li le Rock (A) L 7-8 Swaringen/0-23/17 Arkansas-Li le Rock (A) L 5-7 Boshers/0-13/19 Cleveland State W 17-6 Green/3-13/20 Cleveland State W 16-9 Tobik/2-1
YEARLY DIVISION-I RESULTSYEARLY DIVISION-I RESULTS
2018 UT MARTIN BASEBALL2018 UT MARTIN BASEBALL74
YEARLY DIVISION-I RESULTSYEARLY DIVISION-I RESULTS3/20 Cleveland State W 20-11 Cupples/2-13/23 Southern Illinois L 3-20 Boshers/0-23/27 * Jacksonville State W 9-7 Green/4-13/27 * Jacksonville State L 9-11 Swaringen/0-33/28 * Jacksonville State L 6-11 Mills/2-23/30 Southern Illinois (A) L 3-15 Boshers/0-34/2 * Murray State (A) L 2-20 Green/4-24/2 * Murray State (A) L 5-13 Lozupone/2-14/3 * Murray State (A) L 5-7 Boshers/0-44/6 Arkansas State W 17-12 Alsup/1-04/10 SIU Edwardsville (A) W 7-4 Boshers/1-44/10 SIU Edwardsville (A) L 3-6 Lozupone/2-24/11 SIU Edwardsville (A) W 11-7 Green/5-24/13 Lambuth W 7-6 Flaniken/1-14/17 * Southeast Missouri W 12-4 Boshers/2-44/17 * Southeast Missouri W 6-3 Green/6-24/18 * Southeast Missouri L 1-15 Lozupone/2-34/21 Lipscomb (A) L 4-7 Floyd/0-14/24 * Eastern Kentucky W 18-9 Green/7-24/25 * Eastern Kentucky L 3-7 Boshers/2-54/25 * Eastern Kentucky L 4-7 Swaringen/0-44/28 Ole Miss (A) L 6-15 Miller/0-15/1 * Eastern Illinois (A) L 3-7 Boshers/2-65/1 * Eastern Illinois (A) W 2-1 Green/8-25/2 * Eastern Illinois (A) L 2-5 Floyd/0-25/4 Arkansas State (A) L 3-8 Flaniken/1-25/8 * Morehead State (A) W 10-9 Tobik/3-15/8 * Morehead State (A) W 17-8 Green/9-25/9 * Morehead State (A) L 9-10 Mills/2-35/12 Belmont L 6-16 Swaringen/0-55/15 * Tennessee Tech L 7-9 (13) Flaniken/1-35/15 * Tennessee Tech L 2-6 Green/9-35/16 * Tennessee Tech W 12-9 Flaniken/2-35/18 Belmont (A) W 16-9 Flaniken/3-35/21 * Aus n Peay (A) L 7-9 Green/9-45/22 * Aus n Peay (A) L 3-9 Tobik/3-25/22 * Aus n Peay (A) L 9-11 Flaniken/3-4* - OVC Game# - Nicholls State Tournament - Thibodaux, La.
2011 ResultsVictor (Bubba) Cates
Overall: 20-36 • OVC: 10-13Home: 14-13 • Away: 5-21 • Neutral: 1-2
Date Opponent W/L UTM-OPP Pitcher/Rcd. 2/18 South Alabama (A) L 1-6 Tobik/0-12/19 South Alabama (A) L 3-4 Pa erson/0-12/20 South Alabama (A) L 10-11 Mills/0-12/22 Southern Illinois W 5-1 Rodgers/1-02/26 Indiana State L 3-11 Tobik/0-22/26 Indiana State L 7-10 Kelley/0-12/27 Indiana State W 9-8 Frederick/1-03/1 Evansville L 3-16 Rodgers/1-13/4 South Dakota State W 14-5 Mills/1-13/6 South Dakota State L 0-2 Kelley/0-23/7 South Dakota State L 3-10 Rodgers/1-23/11 Purdue L 3-4 Tobik/0-33/12 Purdue L 7-8 Frederick/1-13/13 Purdue W 10-9 Jones/1-03/15 Memphis (A) L 5-11 Rodgers/1-33/16 Arkansas State (A) L 3-5 Pa erson/0-23/18 UAB (A) L 2-4 Mills/1-23/19 UAB (A) L 1-2 (12) Mills/1-33/20 UAB (A) L 6-8 C. Young/0-13/23 Evansville (A) L 6-18 Rodgers/1-43/26 * Jacksonville State (A) W 9-3 Tobik/1-33/26 * Jacksonville State (A) L 4-7 Kelley/0-33/27 * Jacksonville State (A) L 12-13 Pa erson/0-33/29 Vanderbilt (A) L 3-10 Skubina/0-14/2 * Murray State L 3-6 Tobik/1-44/2 * Murray State L 4-12 Kelley/0-44/3 * Murray State W 14-13 Mills/2-34/6 Belmont W 9-8 Mills/3-34/9 SIU Edwardsville L 2-13 Tobik/1-54/9 SIU Edwardsville W 7-6 Mills/4-34/10 SIU Edwardsville W 20-14 Frederick/2-14/13 Lipscomb W 7-4 Boshers/1-04/16 * Southeast Missouri (A) L 2-8 Tobik/1-64/16 * Southeast Missouri (A) L 2-8 Kelley/0-54/17 * Southeast Missouri (A) L 4-8 Pa erson/0-44/19 Southern Illinois (A) W 5-3 Boshers/2-04/22 * Eastern Kentucky (A) W 11-2 Tobik/2-64/22 * Eastern Kentucky (A) W 5-3 Kelley/1-5
4/23 * Eastern Kentucky (A) W 4-2 (8) Boshers/3-04/30 * Eastern Illinois W 6-4 Tobik/3-64/30 * Eastern Illinois W 5-4 Boshers/4-05/7 * Morehead State L 9-10 Boshers/4-15/7 * Morehead State W 7-6 (8) Frederick/3-15/8 * Morehead State W 9-8 Mills/5-35/11 Belmont (A) L 3-24 Cupples/0-15/11 Belmont (A) L 5-14 Jones/1-15/14 * Tennessee Tech (A) L 5-11 Tobik/3-75/14 * Tennessee Tech (A) L 7-8 (12) Mills/5-45/15 * Tennessee Tech (A) L 7-8 (11) Boshers/4-25/17 Arkansas (A) L 2-6 Frederick/3-25/20 * Aus n Peay L 6-11 Boshers/4-35/20 * Aus n Peay L 3-14 Kelley/1-65/21 * Aus n Peay W 7-6 Mills/6-45/25 $ Jacksonville State L 8-9 Boshers/4-45/26 $ Eastern Kentucky W 6-2 Mills/7-45/27 $ Southeast Missouri L 7-12 Kelley/1-7* - OVC Game$ - OVC Tournament (Pringles Park - Jackson, Tenn.)
2012 ResultsVictor (Bubba) Cates
Overall: 13-41 • OVC: 7-20Home: 10-14 • Away: 2-26 • Neutral: 1-1
Date Opponent W/L UTM-OPP Pitcher/Rcd. 2/17 Georgia Southern (A) L 5-7 Mills/0-12/18 Georgia Southern (A) L 1-10 Lozupone/0-12/19 Georgia Southern (A) L 2-11 Kelley/0-12/21 Southern Illinois W 9-4 Frederick/1-02/22 Union L 4-9 Boshers/0-12/25 Butler W 5-0 Mills/1-12/25 Butler W 5-4 Smith/1-02/26 Butler L 5-13 Kelley/0-22/29 Evansville L 5-9 Boshers/0-23/2 Arkansas-Li le Rock L 3-11 Mills/1-23/3 Arkansas-Li le Rock L 4-12 Frederick/1-13/4 Arkansas-Li le Rock L 11-12 (10) Lundgrin/0-13/6 Ole Miss (A) L 4-20 Po s/0-13/9 Indiana State (A) L 3-5 Cox/0-13/10 Indiana State (A) L 5-7 Frederick/0-13/11 Indiana State (A) L 4-15 Lozupone/0-23/13 Evansville (A) L 5-6 Tobik/0-13/16 % Air Force W 6-2 Mills/2-23/18 % Saint Louis (A) L 2-3 (10) Lundgrin/0-23/20 Chris an Brothers W 10-1 Smith/2-03/23 * Tennessee Tech W 6-5 Tobik/1-13/24 * Tennessee Tech L 1-11 Frederick/1-33/25 * Tennessee Tech W 13-6 Smith/3-03/27 Lipscomb W 4-3 Tobik/2-13/30 * Aus n Peay (A) L 2-10 Mills/2-33/31 * Aus n Peay (A) L 0-4 Frederick/1-44/1 * Aus n Peay (A) L 8-12 Boshers/0-34/3 Vanderbilt L 2-16 Lozupone/0-34/6 * Murray State (A) L 2-4 Mills/2-44/6 * Murray State (A) W 4-3 Frederick/2-44/7 * Murray State (A) L 0-7 Smith/3-14/11 Lipscomb (A) L 4-15 Lozupone/0-44/13 * Jacksonville State L 10-13 Mills/2-54/14 * Jacksonville State W 7-4 Frederick/3-44/15 * Jacksonville State L 8-14 Smith/3-24/18 Southern Illinois (A) L 3-10 Kelley/0-34/20 * SIU Edwardsville (A) L 2-3 (11) Tobik/2-24/21 * SIU Edwardsville (A) L 2-10 Frederick/3-54/22 * SIU Edwardsville (A) L 5-12 Smith/3-34/24 Belmont (A) L 3-6 Lundgrin/0-34/27 * Southeast Missouri W 5-4 Tobik/3-24/28 * Southeast Missouri L 1-13 Frederick/3-64/29 * Southeast Missouri L 2-14 Kelley/0-45/4 * Eastern Kentucky W 11-7 Mills/3-55/5 * Eastern Kentucky L 3-16 Boshers/0-45/6 * Eastern Kentucky L 7-8 Frederick/3-75/9 Belmont L 0-5 Kelley/0-55/11 * Eastern Illinois (A) W 5-4 Mills/4-55/12 * Eastern Illinois (A) L 2-6 Boshers/0-55/13 * Eastern Illinois (A) L 4-13 Frederick/3-85/15 Memphis (A) L 3-13 Lozupone/0-55/17 * Morehead State (A) L 2-8 Mills/4-65/18 * Morehead State (A) L 5-8 Boshers/0-65/19 * Morehead State (A) L 5-8 Frederick/3-9* - OVC Game% - Saint Louis Tournament
2013 ResultsVictor (Bubba) Cates
Overall: 11-40 • OVC: 4-26Home: 9-17 • Away: 2-23 • Neutral: 0-0
Date Opponent W/L UTM-OPP Pitcher/Rcd. 2/15 Southeastern Louisiana (A) L 4-5 Smith/0-12/16 Southeastern Louisiana (A) L 3-5 Houston/0-12/17 Southeastern Louisiana (A) L 3-9 Boshers/0-12/19 Southern Illinois L 4-8 Houston/0-22/20 Ole Miss (A) L 2-15 Smith/0-22/23 IPFW W 5-4 Ross/1-02/24 IPFW W 1-0 Po s/1-02/24 IPFW W 4-3 Skubina/1-03/3 North Dakota State W 3-2 Ross/2-03/3 North Dakota State L 0-5 Tobik/0-13/4 Mid-Con nent W 14-9 Po s/2-03/5 Arkansas State (A) L 0-9 Houston/0-33/8 * Jacksonville State W 5-3 Tobik/1-13/9 * Jacksonville State L 5-10 Cox/0-13/9 * Jacksonville State L 2-20 Po s/2-13/12 Lipscomb W 4-3 Houston/1-33/15 * Murray State (A) L 4-5 Ross/2-13/16 * Murray State (A) L 13-15 Lundgrin/0-13/16 * Murray State (A) L 7-11 Po s/2-23/19 Memphis L 4-18 Houston/1-43/20 Evansville W 8-3 Po s/3-23/22 * Tennessee Tech L 1-3 Tobik/1-23/23 * Tennessee Tech L 8-13 Cox/0-23/24 * Tennessee Tech L 5-8 Jones/0-13/28 * Southeast Missouri (A) L 5-8 Tobik/1-33/29 * Southeast Missouri (A) L 6-9 Cox/0-33/30 * Southeast Missouri (A) L 2-7 Po s/3-34/2 Evansville (A) L 1-6 Houston/1-54/5 * Belmont L 0-4 Tobik/1-44/6 * Belmont W 9-8 Ross/3-14/7 * Belmont L 2-11 Po s/3-44/9 Vanderbilt (A) L 3-10 Ross/3-24/12 * Eastern Kentucky (A) L 4-30 Tobik/1-54/13 * Eastern Kentucky (A) L 3-7 Ross/3-34/14 * Eastern Kentucky (A) W 5-1 Po s/4-44/16 Southern Illinois (A) L 6-7 Skubina/1-14/19 * Morehead State L 1-3 Smith/0-34/20 * Morehead State L 3-7 Cox/0-44/21 * Morehead State L 6-11 Po s/4-54/23 Central Arkansas (A) L 8-16 Houston/1-65/4 * SIU Edwardsville (A) L 1-10 Tobik/1-65/5 * SIU Edwardsville (A) L 3-5 Cox/0-55/6 * SIU Edwardsville (A) L 2-3 (10) Smith/0-45/7 Lipscomb (A) L 3-12 Ross/3-45/10 * Aus n Peay L 5-9 Tobik/1-75/11 * Aus n Peay L 1-5 Cox/0-65/12 * Aus n Peay L 0-8 Po s/4-65/14 Central Arkansas L 4-16 Lundgrin/0-25/16 * Eastern Illinois (A) W 4-3 Smith/1-45/17 * Eastern Illinois (A) L 0-9 Cox/0-75/18 * Eastern Illinois L 3-5 Po s/4-7* - OVC Game
2014 ResultsBrad Goss
Overall: 9-42 • OVC: 5-25Home: 5-15 • Away: 3-25 • Neutral: 1-2
Date Opponent W/L UTM-OPP Pitcher/Rcd. 2/14 UAB (A) L 0-5 Cox/0-12/15 UAB (A) L 2-3 Jones/0-12/16 UAB (A) L 3-5 Mar n/0-12/19 Ole Miss (A) L 0-6 Boshers/0-12/21 ^ vs. Eastern Michigan L 3-17 Cox/0-22/22 ^ vs. Eastern Michigan L 6-18 Po s/0-12/23 ^ vs. Eastern Michigan W 5-3 Jones/1-12/25 Southern Illinois L 2-6 Smith/0-12/28 Stephen F. Aus n (A) L 4-9 Cox/0-33/1 Stephen F. Aus n (A) L 6-10 Ross/0-13/1 Stephen F. Aus n (A) L 0-1 Mar n/0-23/7 * Jacksonville State (A) L 5-10 Boshers/0-23/8 * Jacksonville State (A) L 2-6 Po s/0-23/9 * Jacksonville State (A) L 4-6 Mar n/0-33/14 * Murray State L 2-10 Po s/0-33/15 * Murray State L 2-7 Cox/0-43/15 * Murray State W 6-5 Houston/1-03/18 Evansville (A) L 2-5 Ross/0-23/18 Evansville (A) L 5-6 (8) Houston/1-13/21 * Tennessee Tech (A) L 5-14 Cox/0-5
2018 SKYHAWK BASEBALL2018 SKYHAWK BASEBALL 75
3/22 * Tennessee Tech (A) W 7-5 Smith/1-13/23 * Tennessee Tech (A) L 0-2 Mar n/0-43/28 * Southeast Missouri L 0-13 Cox/0-63/29 * Southeast Missouri L 3-9 Po s/0-43/30 * Southeast Missouri L 1-11 Mar n/0-54/1 Vanderbilt (A) L 0-5 Ross/0-34/4 * Belmont (A) L 1-5 Cox/0-74/5 * Belmont (A) L 1-3 Po s/0-54/6 * Belmont (A) L 3-6 Mar n/0-64/9 Lipscomb L 2-12 Flores/0-14/11 * Eastern Kentucky L 1-9 Cox/0-84/12 * Eastern Kentucky L 13-18 Po s/0-64/13 * Eastern Kentucky W 9-4 Houston/2-14/15 Southern Illinois (A) L 5-16 Ross/0-44/17 * Morehead State (A) L 3-6 Cox/0-94/18 * Morehead State (A) L 6-14 Smith/1-24/19 * Morehead State (A) L 4-6 Mar n/0-74/22 Saint Louis W 9-2 Ross/1-44/25 Missouri State W 4-3 Smith/2-24/26 Missouri State L 5-7 Po s/0-75/2 * SIU Edwardsville L 7-14 Smith/2-35/3 * SIU Edwardsville W 3-2 Po s/1-75/4 * SIU Edwardsville L 8-13 Ross/1-55/6 Lipscomb (A) W 4-0 Boshers/1-25/10 * Aus n Peay (A) W 6-3 (12) Houston/3-15/11 * Aus n Peay (A) L 2-10 Po s/1-85/12 * Aus n Peay (A) L 12-13 Houston/3-25/13 Memphis (A) L 0-11 Boshers/1-35/15 * Eastern Illinois L 1-3 Po s/1-95/16 * Eastern Illinois L 3-7 Mar n/0-85/17 * Eastern Illinois L 1-5 Boshers/1-4* - OVC Game^ - ES Rose Park - Nashville, Tenn.
2015 ResultsRick Robinson
Overall: 17-35 • OVC: 9-20Home: 8-10 • Away: 6-18 • Neutral: 3-7
Date Opponent W/L UTM-OPP Pitcher/Rcd. 2/13 Texas-Pan American^ W 1-0 Smith/1-02/14 Texas-Pan American^ L 7-8 Schaenzer/0-12/14 Jackson State (A) L 10-20 Flores/0-12/15 Jackson State (A) L 4-9 Douglas/0-12/20 Western Michigan& L 4-6 Bernard/0-12/21 Western Michigan& L 7-11 Bernard/0-22/21 Western Michigan& L 0-10 Mar n/0-12/24 Vanderbilt (A) L 3-16 Shaw/0-13/7 * Murray State! W 6-3 Fidler/1-03/7 * Murray State! L 1-2 Smith/1-13/8 * Murray State! L 2-4 Mar n/0-23/11 Aus n Peay (A) L 2-5 Fidler/1-13/14 * Tennessee Tech L 0-2 Smith/1-23/15 * Tennessee Tech W 7-5 Fidler/2-13/16 * Tennessee Tech L 3-9 Mar n/0-33/17 Southern Illinois W 8-7 Bernard/1-23/18 Saint Louis (A) L 5-6 Schaenzer/0-23/20 * Southeast Missouri (A) L 2-16 Shaw/0-23/21 * Southeast Missouri (A) L 0-13 Smith/1-33/22 * Southeast Missouri (A) L 4-5 (12) Poteete/0-13/24 Chris an Brothers W 10-4 Stevens/1-03/25 Union (A) W 7-1 Flores/1-13/27 * Belmont W 7-4 Poteete/1-13/28 * Belmont W 5-4 (10) Mar n/1-33/29 * Belmont L 10-34 Smith/1-43/31 Evansville L 11-15 Shaw/0-34/2 * Eastern Kentucky (A) L 6-10 Mar n/1-44/4 * Eastern Kentucky (A) L 2-9 Zarubin/0-14/4 * Eastern Kentucky (A) W 7-3 Smith/2-44/8 Bethel W 12-9 Schaenzer/1-24/10 * Morehead State L 5-9 Mar n/1-54/11 * Morehead State L 6-8 Smith/2-54/12 * Morehead State L 7-17 Poteete/1-24/15 Ole Miss (A) L 1-11 Zarubin/0-24/17 Missouri State (A) W 6-2 Poteete/2-24/18 Missouri State (A) L 3-6 Symon/0-14/19 Missouri State (A) L 4-5 Smith/2-64/22 Southern Illinois (A) W 11-9 Mar n/2-54/24 * SIU Edwardsville (A) L 3-4 Smith/2-74/25 * SIU Edwardsville (A) L 3-6 Symon/0-24/26 * SIU Edwardsville (A) L 2-6 Smith/2-84/28 Murray State# W 14-3 Mar n/3-55/1 * Aus n Peay L 3-11 Poteete/2-35/2 * Aus n Peay W 16-7 Smith/3-8
5/3 * Aus n Peay W 9-7 Symon/1-25/6 Evansville (A) L 2-19 Stevens/1-15/8 * Eastern Illinois (A) W 2-1 (11) Bernard/2-25/9 * Eastern Illinois (A) W 4-2 Smith/4-85/10 * Eastern Illinois (A) L 0-2 Mar n/3-65/12 Memphis@ L 1-2 (16) Schaenzer/1-35/14 * Jacksonville State L 2-14 Douglas/0-25/15 * Jacksonville State L 12-13 Smith/4-9* - OVC Game^ - Robert Braddy Field - Jackson, Miss.& - LakePoint Sports Complex - Emerson, Ga.! - Simmons Complex - Edwardsville, Ill.# - Elam Stadium - Union City, Tenn.@ - USA Stadium - Millington, Tenn.
2016 ResultsRick Robinson
Overall: 19-35 • OVC: 9-21Home: 14-14 • Away: 6-18 • Neutral: 3-7
Date Opponent W/L UTM-OPP Pitcher/Rcd. 2/19 Jackson State (A) L 5-8 Evans/0-12/20 Jackson State (A) W 18-9 Bernard/1-02/20 Jackson State (A) W 12-2 Wes all/1-02/21 Jackson State (A) L 2-9 Bazzani/0-12/23 Vanderbilt (A) L 6-11 Patzner/0-12/26 Buff alo L 3-5 Evans/0-22/27 Buff alo L 5-8 Wes all/1-12/28 Buff alo L 8-15 Bazzani/0-23/4 IPFW L 5-6 Bernard/1-13/5 IPFW W 3-2(11) Bernard/2-13/5 IPFW L 2-4 Bazzani/0-33/6 IPFW W 12-7 Wes all/2-13/8 Evansville L 9-29 McKinstry/0-13/11 * Murray State W 6-5 Bernard/3-13/12 * Murray State L 4-7(11) Seckinger/0-13/13 * Murray State W 19-6 Patzner/1-13/15 Alabama A&M (A) W 9-2 Seckinger/1-13/18 * Tennessee Tech (A) L 3-12 Evans/0-33/19 * Tennessee Tech (A) L 2-10 Seckinger/1-33/19 * Tennessee Tech (A) L 3-5 Bazzani/0-43/22 Ole Miss (A) L 2-8 Patzner/1-23/24 * Southeast Missouri L 6-19 Rickman/0-13/25 * Southeast Missouri W 6-15 Evans/0-43/26 * Southeast Missouri L 2-26 Bazzani/0-53/29 Lipscomb (A) L 4-12 Bailey/0-14/1 * Belmont (A) L 8-10 Patzner/1-34/2 * Belmont (A) L 7-23 Evans/0-54/3 * Belmont (A) L 3-7 Bazzani/0-64/5 Mississippi State (A) L 0-14 Rimmer/0-14/8 * Eastern Kentucky W 20-6 Evans/1-54/9 * Eastern Kentucky L 4-5 Bazzani/0-74/10 * Eastern Kentucky L 1-16 Bernard/3-24/12 Union W 10-3 Evans/2-54/15 * Morehead State (A) L 4-10 Bazzani/0-84/16 * Morehead State (A) W 6-4 Evans/3-54/17 * Morehead State (A) L 7-26 Patzner/1-44/22 Jackson State W 13-3 Bazzani/1-84/23 Jackson State W 10-4 Bernard/4-24/24 Jackson State W 11-8 Evans/4-54/29 * SIU Edwardsville W 5-4 Evans/5-54/30 * SIU Edwardsville L 4-6 Bazzani/1-94/30 *SIU Edwardsville W 8-7 Evans/6-55/3 Union (A) L 6-7 Rimmer/0-25/6 * Aus n Peay (A) L 3-8 Bernard/4-35/7 * Aus n Peay (A) W 9-7 Evans/7-55/8 * Aus n Peay (A) L 5-6 Goodwin/0-15/10 Alabama A&M W 11-1 Seckinger/2-25/13 * Eastern Illinois L 2-16 Bernard/4-45/14 * Eastern Illinois W 2-0 Bazzani/2-95/15 * Eastern Illinois W 10-5 Evans/8-55/17 Memphis (A)^ L 4-7 Rimmer/0-35/19 * Jacksonville State (A) L 6-16 Bernard/4-55/20 * Jacksonville State (A) L 0-4 Bazzani/2-105/21 * Jacksonville State (A) L 5-9 Seckinger/2-3* - OVC Game^ - USA Stadium - Millington, Tenn.
2017 ResultsRick Robinson
Overall: 25-30 • OVC: 12-18Home: 16-10 • Away: 9-16 • Neutral: 0-4
Date Opponent W/L UTM-OPP Pitcher/Rcd. 2/17 % Buff alo L 2-10 Bazzani/0-12/18 % Buff alo W 14-0 Wes all/1-02/19 % Buff alo W 4-3 Evans/1-02/24 % Arkansas-Pine Bluff W 10-8 Bazzani/1-12/25 % Arkansas-Pine Bluff W 7-1 Wes all/2-02/26 % Arkansas-Pine Bluff W 4-2 Patzner/1-03/3 ^Presbyterian L 2-3 Evans/1-13/4 ^Furman L 3-11 Wes all/2-13/5 ^Michigan State L 1-6 Patzner/1-13/7 Bethel W 19-13 Cannon/1-03/9 * Tennessee Tech L 6-14 Patzner/1-23/10 * Tennessee Tech L 3-4 Evans/1-23/10 * Tennessee Tech L 6-9 Cain/0-13/15 Lipscomb (A) W 7-3 Cannon/2-03/17 * Southeast Missouri (A) L 1-14 Bazzani/1-23/18 * Southeast Missouri (A) L 4-5 Wes all/2-23/19 * Southeast Missouri (A) L 4-13 Laberge/0-13/21 Evansville (A) W 12-4 Evans/2-23/24 * Belmont L 5-8 Laberge/0-23/25 * Belmont W 7-4 Wes all/3-23/26 * Belmont L 8-6 Evans/2-33/31 * Eastern Kentukcy (A) L 2-3 Cannon/2-14/1 * Eastern Kentucky (A) L 3-11 Wes all/3-34/2 * Eastern Kentucky (A) L 0-3 Cain/0-24/4 Vanderbilt (A) L 0-11 Patzner/1-34/7 * Morehead State W 1-0 Cannon/3-14/8 * Morehead State W 9-5 Laberge/1-24/9 * Morehead State W 18-6 Evans/3-34/12 Kentucky (A) L 0-8 Cain/0-34/13 Wright State (A) L 14-0 Cannon/3-24/14 Wright State (A) L 3-4 Evans/3-44/15 Wright State (A) L 5-12 Wes all/3-44/18 Evansville W 9-8 Evans/4-44/19 Chris an Brothers W 9-8 Evans/5-44/21 * SIUE (A) W 9-5 Cannon/4-24/22 * SIUE (A) W 3-1 Wes all/4-44/23 * SIUE (A) W 3-2 Cain/1-34/25 Union (A) L 12-6 1-44/26 Alabama A&M W 12-2 Folks/1-04/28 * Aus n Peay L 19-4 Cannon/4-34/29 * Aus n Peay W 10-8 Evans/6-44/29 * Aus n Peay L 5-8 Cain/1-45/2 Union W 9-2 Folks/2-05/3 Alabama A&M (A) W 6-0 Patzner/2-45/5 * Eastern Illinois (A) W 17-14 Evans/7-45/6 * Eastern Illinois (A) W 15-3 Wes all/5-45/7 * Eastern Illinois (A) L 8-9 Cain/1-55/9 # Memphis L 7-6 Evans/7-55/12 * Jacksonville State L 4-5 Cannon/4-45/13 * Jacksonville State L 5-8 Wes all/5-55/14 * Jacksonville State W 7-2 Evans/8-55/18 * Murray State W 9-3 Cannon/5-45/19 * Murray State L 4-14 Cain/1-65/20 * Murray State L 5-8 Laberge/1-35/23 $ Aus n Peay L 2-6 Wes all/5-6% - Elam Stadium - Union City, Tenn.^ - Fluor Field - Greenville, SC* - OVC Game# - USA Stadium - Millington, Tenn.$ - Choccolocco Park - Oxford, Ala.
YEARLY DIVISION-I RESULTSYEARLY DIVISION-I RESULTS
2018 UT MARTIN BASEBALL2018 UT MARTIN BASEBALL76
ALL-TIME ROSTERALL-TIME ROSTER• A •
Steve Adcock . . . . . . . . . . . . . . . 1985-89Anthony Adduci . . . . . . . 2017-currentKonnor Aherin . . . . . . . . . 2017-currentTyler Albright . . . . . . . . . . 2016-currentJacob Alexander . . . . . . . . . . . . . . . .2014Bobby Alford . . . . . . . . . . . . . . . 2000-03Jason Alford . . . . . . . . . . . . . . . . 1997-00Dick Algire. . . . . . . . . . . . . . . . . . . . .1971Lance Alsup . . . . . . . . . . . . . . . . 2007-09Wes Alsup . . . . . . . . . . . . . . . . . . 2009-10JoJo Allen . . . . . . . . . . . . . 2017-currentT.J. Allen . . . . . . . . . . . . . . . . . . . 1999-01Kayo Anderson . . . . . . . . . . . . . 2003-04Isaac Armstrong . . . . . . . . . . . . . 2012-13Dee Arnold . . . . . . . . . . . . . . . . 1993-94Ben Aslett . . . . . . . . . . . . 2017-currentConnor Aube . . . . . . . . . . . . . . . . . .2017Simon Auter . . . . . . . . . . . . . . . . . .2001Joe Ayers . . . . . . . . . . . . . . . . . . . . .2001Mark Aylor . . . . . . . . . . . . . . . . . . . .1994
• B •Wes Bacon . . . . . . . . . . . . . . . 1999-2002Hayden Bailey. . . . . . . . . . . . . . . . . .2016Brian Baker . . . . . . . . . . . . . . . . . . . .2000Max Balter . . . . . . . . . . . . . . . . . . . .2014Dale Barbiea . . . . . . . . . . . . . . . . 1986-87Joe Barker . . . . . . . . . . . . . . . . . . 1971-72Gary Barfield . . . . . . . . . . . . . . . 1991-92Kevin Barger . . . . . . . . . . . . . . . . 1992-93Kyle Bargery . . . . . . . . . . . . . . . . 2009-13Justin Barnes . . . . . . . . . . . . . . . 2010-11Barry Barnett . . . . . . . . . . . . . . . 1971-72Matthew Barnett . . . . . . . . . . . . 1996-97Stacy Batey . . . . . . . . . . . . . . . . . . . .1988Brian Baxa . . . . . . . . . . . . . 2018-currentDom Bazzani . . . . . . . . . . . 2016-currentBruce Beckman . . . . . . . . . . . . . 1984-85David Belote . . . . . . . . . . .1972-73, 1976Mike Bennett . . . . . . . . . . . . . . . 1979-80Patrick Bernard . . . . . . . . . . . 2015-2016Brian Berryman . . . . . . . . . . . . . 2004-05Ryan Bethel . . . . . . . . . . . . . . . . 2002-03Lee Bethune . . . . . . . . . . . . . . . . 2000-01Casey Bevis . . . . . . . . . . . . . . . . . 2000-02Kent Billings . . . . . . . . . . . . . . . . . . .1979Andrew Bixby . . . . . . . . . . . . . . . . . .2008William Blackmon . . . . . . . . . . . 2007-08Tyler Borski . . . . . . . . . . . 2017-currentBen Bottoms . . . . . . . . . . . . . . . . 2008-09Adam Bowker . . . . . . . . . . . . . . . 2006-09Michael Blount . . . . . . . . . . . . . . 1995-98Alex Boshers . . . . . . . . . . . . . . . . 2010-14William Bradford . . . . . . . . . . . . . . .1989Brent Bramblett . . . . . . . . . . . . . . . .1976Ricky Bratcher . . . . . . . . . . . . . . . . .1983Ben Brewer . . . . . . . . . . . . . . . . . 2010-13Caleb Brewer . . . . . . . . . . 2017-currentHunter Britcliffe . . . . . . . . . . . . . 2011-12Jonah Brody . . . . . . . . . . . 2017-currentJeff Brooks . . . . . . . . . . . . . . . . . 1989-90Alex Brown . . . . . . . . . . . . . . . . . . . .2016Mike Brown . . . . . . . . . . . . . . . . 1987-88Wally Brown . . . . . . . . . . . . . 1971, 73-74Nick Bruner. . . . . . . . . . . . . . . . . 2004-05Justin Bryant . . . . . . . . . . . . . . . . 2003-05Carney Bryson . . . . . . . . . . . . . . 1979-80Jay Buford . . . . . . . . . . . . . . . . . . . . .1976Austen Bullington. . . . . . . 2018-currentBryan Bullington. . . . . . . . . . . . . 1994-95Pat Bunch . . . . . . . . . . . . . . . . . . . . .2003Mark Buttrum . . . . . . . . . . . . . . . . .1994Austin Buzick . . . . . . . . . . 2018-current
• C •Peyton Cain . . . . . . . . . . . 2017-currentChadwick Cameron . . . . . . . . 2006-2007Ben Campbell . . . . . . . . . . . . . . . . . .2012Winston Cannon . . . . . . . 2017-currentJimmy Carey . . . . . . . . . . . . . . . . . . .1992Isaac Carrel . . . . . . . . . . . . . . . . . 2014-15Josh Carter . . . . . . . . . . . . . . . . . . . .2000Jerron Casey . . . . . . . . . . . . . . . . . . .2010Rodney Cash . . . . . . . . . . . . . . . . 1981-82Tim Cash . . . . . . . . . . . . . . . . . . . . . .1981Andrew Castillo . . . . . . . . . . . 2015-2016Bo Caviness . . . . . . . . . . . . . . . . . . .1986Jimmy Champion . . . . . . . . . . . . 1979-80Jack Chaney . . . . . . . . . . . . . . . . 1977-80Bryce Carden . . . . . . . . . . . . . . . 2006-08Lin Cates . . . . . . . . . . . . . . . . . . . 2008-09Randy Chism . . . . . . . . . . . . . . . . 1985-88Chris Clapper . . . . . . . . . . . . . . . 1993-94Stanley Click . . . . . . . . . . . . . . . . 1988-89Randy Coffman . . . . . . . . . . . . . 1988-89Mike Coggins . . . . . . . . . . . . . . . 1971-74Kyle Coleman . . . . . . . . . . . . . . . 1988-89Wade Collins. . . . . . . . . . . . . . . . 2012-13Donnie Corey . . . . . . . . . . . . . . . 2002-03David Couch . . . . . . . . . . . . . . . . 1977-78Kevin Cowling . . . . . . . . . . . . . . . . . .1994Taylor Cox . . . . . . . . . . . . . . . . . . 2012-14Richie Craven . . . . . . . . . . . . . . . . . .1985Troy Crawford . . . . . . . . . .1995-98, 2000Dylan Cupples . . . . . . . . . . . . . . 2010-11
• D •John Daniel . . . . . . . . . . . . . . . . . 1987-88Tandy Darby . . . . . . . . . . . . . . . . . . .1996Blake Davis . . . . . . . . . . . . 2018-currentBubba Davis . . . . . . . . . . . . . . . . . . .1975Jimmy Davis . . . . . . . . . . . . . . . . 1988-89 Kelly Davis. . . . . . . . . . . . . . . . . . 2000-03Mitch Davis . . . . . . . . . . . . . . . . . 1981-82Kirk Davison . . . . . . . . . . . . . . . . 1998-99Dewitt Day . . . . . . . . . . . . . . . . . 1974-77Zach Dean . . . . . . . . . . . . . . . . . . 2005-06Jake Deason . . . . . . . . . . . . . . . . 2012-15Justin Deere . . . . . . . . . . . . . . . . 1999-00Zack Denney . . . . . . . . . . 2017-currentRoger Deskins . . . . . . . . . . . . . . . 1984-85Albert Destrade . . . . . . . . . . . . . . . .2007Bill Dickerson . . . . . . . . . . . . . . . . . .1979Micky Dobson . . . . . . . . . . . . . . 2003-06Johnny Dodd . . . . . . . . . . . . . . . 1982-83Keith Domino . . . . . . . . . . . . . . . . . .1989Mike Donohue . . . . . . . . . . . . . . 1971-73Taylor Douglas . . . . . . . . . . . . . . 2014-15Heath Doyle . . . . . . . . . . . . . . . . . . .2000Kyle Dudley . . . . . . . . . . . . . . . . . 2007-08Mitch Dunn. . . . . . . . . . . . . . . . . 1994-95Brad Dyer . . . . . . . . . . . . . . . . . . 1992-94
• E •Mike Eatherly . . . . . . . . . . . . . . . 1991-92Eddy Eckert . . . . . . . . . . . . . . . . . 1966-69Al Edmiston . . . . . . . . . . . . . . . . 1971-73Billy Edwards . . . . . . . . . . 2018-currentCollin Edwards . . . . . . . . . 2016-currentCreighton Eldridge . . . . . 2017-currentScott Embry . . . . . . . . . . . . . . . . 1991-92Roger Emory . . . . . . . . . . . . . . . . . . .1974Lanier English . . . . . . . . . . . . . . . 1998-01Justin Entrekin . . . . . . . . . . . . . . . . .2001Drew Erie . . . . . . . . . . . . . . . . 2013-2016Chris Ervin . . . . . . . . . . . . . . . . . 1992-93Freddie Essary . . . . . . . . . . . . . . . . .1974Casey Estill . . . . . . . . . . . . . . . . . 2003-06
Alex Evans . . . . . . . . . . . . . . . . . . 2016-17
• F •Michael Fabrizio . . . . . . . . . . . . . . . .2004Bret Fanning . . . . . . . . . . . . . . . . . . .1996Phil Ferreira-Alves . . . . . . . . . . . . . .2010Michael Fidler . . . . . . . . . . . . . . . . .2015Terry Finney . . . . . . . . . . . . . . . . . . .1978Brian Fisher . . . . . . . . . . . . . . . . . . .2004Drew Flaniken . . . . . . . . . . . . . . 2009-10Chris Flores . . . . . . . . . . . . . . . . . 2013-15Drew Floyd . . . . . . . . . . . . . . . . . . . .2010Sam Folks . . . . . . . . . . . . . 2017-currentMike Fortune . . . . . . . . . . . . . . . 1971-72John Fowler . . . . . . . . . . . . . . . . 1985-87Richard Fowler . . . . . . . . . . . . . . . . .1971Willie Frederick . . . . . . . . . . . . . 2011-12Wesley Freeman . . . . . . . . . . . . . . .1999Wade Freeman . . . . . . . . . . . . . . . . .1985Tim Frye . . . . . . . . . . . . . . . . . . . . . .1994Jody Fuller . . . . . . . . . . . . . . . . . 1995-98Paul Fullerton . . . . . . . . . . . . . . . 1981-83
• G •Steve Gadlage . . . . . . . . . . . . . . . . .1994Jimmy Gann . . . . . . . . . . . . . . . . 2005-06Jacob Gansert . . . . . . . . . . . . . . . 2013-15Curtis Gardner . . . . . . . . . . . . . . 1983-84Tas Gardner . . . . . . . . . . . . . . . . 1990-91Nick Gavello . . . . . . . . . . . . . . 2015-2016Adam Gibson . . . . . . . . . . . . . . . 1999-02Anthony Gilchrist . . . . . . . . . . . . 1973-74Scott Gladstone . . . . . . . . . . . . . 2008-09Bill Glass . . . . . . . . . . . . . . . . . . . 1985-88Henry Glass . . . . . . . . . . . . . . . . 1976-77Walter Glass . . . . . . . . . . . . . . . . 1975-77Grant Glasser . . . . . . . . . . . . . . . 2012-13Frank Glover . . . . . . . . . . . . . . . . 1986-88Danny Goff . . . . . . . . . . . . . . . . . . . .1974Ricky Goforth . . . . . . . . . . . . . . . 1977-78Sadler Goodwin . . . . . . . . . . . . . . . .2016Deryl Gore . . . . . . . . . . . . . . . . . 1981-82Carl Gourgeot . . . . . . . . . . . . . . . . . .1983Terry Graham . . . . . . . . . . . . . . . 1974-75Jeff Graves . . . . . . . . . . . . . . . . . . . .1993Tom Gray . . . . . . . . . . . . . . . . . . 1975-76Chad Green. . . . . . . . . . . . . . . . . 2006-07Coty Green . . . . . . . . . . . . . . . . . 2009-10Troy Green . . . . . . . . . . . . . . . . . . . .1990Zane Gresback . . . . . . . . . . . . . . 2005-06Gene Grubaugh . . . . . . . . . . . . . . . .1971Roger Gum . . . . . . . . . . . . . . . . . 1986-87
• H •Micah Hagan . . . . . . . . . . . 2018-currentShannon Haggard. . . . . . . . . . . . 1991-92Brett Hall. . . . . . . . . . . . . . . . . . . 2002-05Scott Hall . . . . . . . . . . . . . . . . . . 1998-99Barry Hamilton . . . . . . . . . . . . . . 1991-92Keith Hamm . . . . . . . . . . . . . . . . . . .1990Bart Hammack . . . . . . . . . . . . . . 2001-02Tim Haney . . . . . . . . . . . . . . . . . 1982-83Casey Harford . . . . . . . . . . 2018-currentJack Harlow . . . . . . . . . . . . . . . . 1971-72Chad Harrell . . . . . . . . . . . . . . . . . . .1992Rickie Harris . . . . . . . . . . . . . . . . 1977-78Ron Harrison . . . . . . . . . . . . . . . 1989-90Hunter Hart . . . . . . . . . . . . . . . . 2001-04Mark Hartsfield . . . . . . . . . . . . . 2008-09Miles Hartsfield . . . . . . . . . . . . . 2008-09Bryan Harvey . . . . . . . . . . . . . . . 2005-06Randall Harvey . . . . . . . . . . . . . . 1995-96John Hatler . . . . . . . . . . . . . . . . . 1994-95Josh Hauser . . . . . . . . . . . . . . . . 2016-17
Mike Hayes . . . . . . . . . . . . . . . . . 1984-87Matt Haynes . . . . . . . . . . . . . . . . 2010-13Rob Hearnsberger . . . . . . . . . . . . . .2003Ryan Helgren . . . . . . . . . . . . . . . 2016-17Brian Henley . . . . . . . . . . . . . . . . 1989-90Danny Hensley . . . . . . . . . . . . . . . . .1979Tanner Hensley . . . . . . . . . . . . . 2008-09Chris Hicks . . . . . . . . . . . . . . . . . 1983-84Wes Hicks . . . . . . . . . . . . . . . . . . 1987-88Jeff Hill . . . . . . . . . . . . . . . . . . . . . . .1983Ryan Hill . . . . . . . . . . . . . . . . . . . 2005-06Tyler Hilton . . . . . . . . . . . . . . . . . . . .2016Johnny Hines . . . . . . . . . . . . . . . . . .1978Matt Hirsch . . . . . . . . . . . . . . . 2015-2016Jason Hockaday . . . . . . . . . . . . . 2006-07Kyle Hodge . . . . . . . . . . . . . . . . . 1996-98Troy Holland . . . . . . . . . . . . . . . . . . .2012Billy Holt . . . . . . . . . . . . . . . . . . . 1999-00Kevin Holt . . . . . . . . . . . . . . . . . . 2006-09Russ Hopper . . . . . . . . . . . . . . . . 1983-85Dale Horn . . . . . . . . . . . . . . . . . . 1974-77Randy Horn. . . . . . . . . . . . . . . . . . . .1971Terry Hornsby . . . . . . . . . . . . 1981, 83-85John Houston . . . . . . . . . . . . . . . 2013-14Jay Howard . . . . . . . . . . . . . . . . . 2008-09Kevin Hubbard . . . . . . . . . . . . . . 1980-81Larry Hudson . . . . . . . . . . . . . . . 1978-81Cole Huffman . . . . . . . . . . . . . . . . . .1976Kendall Huggins . . . . . . . . . . . . . 1983-84Thomas Hunt . . . . . . . . . . . . . . . . . .2009Greg Hunter . . . . . . . . . . . . . . . . 1980-81David Hussey . . . . . . . . . . 2018-current
• I •Larry Ingle . . . . . . . . . . . . . . . . . . 1978-79Phil Ingram . . . . . . . . . . . . . . . . . . . .1982Joey Ivy . . . . . . . . . . . . . . . . . . . . . . .2011
• J •Don Jackson . . . . . . . . . . . . . . . . 1971-73Ricky Jackson . . . . . . . . . . . . . . . 1985-88Terry Jackson . . . . . . . . . . . . . . . 1989-90Tim James . . . . . . . . . . . . . . . . . . 1984-87Steve Jett . . . . . . . . . . . . . . . . . . 1991-92Byron Johann . . . . . . . . . . . . . . . 2012-13Fletcher Johnson . . . . . . . . . . 2014-2016Jay Johnson . . . . . . . . . . . . . . . . 1971-73Brian Jordan . . . . . . . . . . . . . . . . 1999-03Bryant Jones . . . . . . . . . . . . . . . . 2001-04Gene Jones . . . . . . . . . . . . . . . . . 1987-89Jacob Jones . . . . . . . . . . . . 2018-currentPat Jones . . . . . . . . . . . . . . . . . . . 2009-10Stu Jones. . . . . . . . . . . . . . . . . . . 2011-14Andrew Joslin . . . . . . . . . . . . . . . 1987-88Danny Joyner . . . . . . . . . . . . . . . . . .1979
• K •Trey Karlen . . . . . . . . . . . . . . . . . 2009-11Danny Kelley . . . . . . . . . . . . . . . . 2011-12Jeff Kelley . . . . . . . . . . . . . . . . . . 1979-80Khalil Kendley . . . . . . . . . . . . . . . . . .2014Dan Kerwin . . . . . . . . . . . . . . . . . 2016-17Bob King . . . . . . . . . . . . . . . . . . . 1974-75Greg King . . . . . . . . . . . . . . . . . . 1990-91Jim King . . . . . . . . . . . . . . . . . . . . 1971-73Kenny King . . . . . . . . . . . . . . . . . 2013-14Michael Kirby . . . . . . . . . . . . . . . 1986-87Garrett Kirk . . . . . . . . . . . . . . . . . . . .2010Justin Knees . . . . . . . . . . . . . . . . . . .2003Joe Kuchar . . . . . . . . . . . . . . 1971, 73-74
• L •Kyle Laberge . . . . . . . . . . . . . . . . . . .2017Jordan Lambert . . . . . . . . . . . . . . . .2017
2018 SKYHAWK BASEBALL2018 SKYHAWK BASEBALL 77
ALL-TIME ROSTERALL-TIME ROSTERRyan Lantz . . . . . . . . . . . . . . . . . . . .2008Erik Larsen . . . . . . . . . . . . . . . . . . . .2011Jay Lasley . . . . . . . . . . . . . . . . . . . . .1997Nick Latimer . . . . . . . . . . . . . . . . 2005-06Trent Latta . . . . . . . . . . . . . . . . . 1995-96Jim Van Leach . . . . . . . . . . . . . . . 1974-75Adam Ledlow . . . . . . . . . . . . . . . 2004-07Curt Lee . . . . . . . . . . . . . . . . . . . 1993-94Derek Link . . . . . . . . . . . . . . . . . . 2004-06Lee Lockhart . . . . . . . . . . . . . . . . . . .1996Larry Long . . . . . . . . . . . . . . . . . . 1971-73Brendan Lozupone . . . . . . . . . . . 2009-12Trevor Lundgrin . . . . . . . . . . . . . 2012-13Nick Luper. . . . . . . . . . . . . . . . . . 2004-06
• M •Zack Malone . . . . . . . . . . . . . . . . . . .2014 Jim Maloney . . . . . . . . . . . . . . . . 1974-75Alex Martin . . . . . . . . . . . . . . . . . 2014-15Shayne Martin . . . . . . . . . . . . . . 2007-08Drew Mason . . . . . . . . . . . . . . . . 2008-11Andrew Massey . . . . . . . . . . . . . 2014-15Scott Massey . . . . . . . . . . . . . . . 2003-05Sonny Mastromatteo . . . . . . . . . 2012-13Richard Matz . . . . . . . . . . . . . . . 1990-91Tommy McArthur . . . . . . . . . . . . 1991-92Chad McDowell . . . . . . . . . . . . . 1996-97Charles McClain . . . . . . . . . . . . . . . .1990Shawn McElyea . . . . . . . . . . . . . . . .2008Skipper McGill . . . . . . . . . . . . . . 1996-97Matt McKinstry . . . . . . . . . . . . . . . .2016Greg McKnight . . . . . . . . . . . . . . 1989-90Scott McLean . . . . . . . . . . . . . . . 2004-07Hunter McLemore . . . . . . . . . . . 1991-93Harry McLeod. . . . . . . . . . . . . . . 1975-77Scott McMackin . . . . . . . . . . . . . 1989-90Mike McMahon . . . . . . . . . . . . . . . .1974Delmer McNeil . . . . . . . . . . . . . . . . .2001Mike McSwain . . . . . . . . . . . . . . 1988-90Ben Meador . . . . . . . . . . . . . . . . . . .2004Brad Meadows . . . . . . . . . . . . . . 2001-02Chris Meyer . . . . . . . . . . . . . . . . 1996-97Jeff Meyers . . . . . . . . . . . . . . . . . . . .1974Cody Miller . . . . . . . . . . . . . . . . . 2011-15Matt Milligan . . . . . . . . . . . . . . . 2009-12Matt Miller . . . . . . . . . . . . . . . . . . . .2010Alec Mills . . . . . . . . . . . . . . . . . . 2010-12Danny Mitchell . . . . . . . . . . . . . . 1975-78Donnie Mitchell . . . . . . . . . . . . . 1980-81Nick Molina . . . . . . . . . . . . . . . . . . .2014Churchill Moore . . . . . . . . . . . . . 1986-87Jason Moore . . . . . . . . . . . . . . . . 2005-06Mack Moore . . . . . . . . . . 1974-75, 77-78Stephen Moore . . . . . . . . . . . . . 2008-09Erik Morgan . . . . . . . . . . . . . . . . 1996-97Brent Morris . . . . . . . . . . .2010, 2013-14David Morris . . . . . . . . . . . . . . . . 1984-87Mike Murphy . . . . . . . . . . . . . 2015-2016
• N •Mikey Nantze . . . . . . . . . . . . . . . 2014-15Hagen Nelson . . . . . . . . . . . . . . . 2010-13Ty Nelson . . . . . . . . . . . . . . . . . . 2009-10Mark Newby . . . . . . . . . . . . . . . . 1982-83Martin Newby . . . . . . . . . . . . . . 1983-86Tim Nichols . . . . . . . . . . . . . . . . . . . .1982Douglas Nicodemus . . . . . . . . . . 2004-07Brady Nighswonger . . . . . . . . . . 2002-03Flint Northcutt . . . . . . . . . . . . . . 1991-92Jerry Nusky . . . . . . . . . . . . . . . . . 1981-82
• O •Jefferey O’Doherty . . . . . . 2018-currentDesmond O’Quine . . . . . . . . . . . . . .2000
Daisuke Oda . . . . . . . . . . . . . . . . 1994-96John Odom . . . . . . . . . . . . . . . . . . . .1971George Ogilvie . . . . . . . . . . . . . . 1977-78Chase Okey . . . . . . . . . . . . . . . . . 2011-12Mike Oney . . . . . . . . . . . . . . . . . 1981-82Mike Ostby . . . . . . . . . . . . . . . . . 1992-93Jordan Owen . . . . . . . . . . . . . . . 2009-12Preston Ozment . . . . . . . . . . . . . . . .1999
• P •Luke Parham . . . . . . . . . . . . . . . . . . .2003Zach Parham. . . . . . . . . . . . . . . . 2005-07David Parkerson . . . . . . . . . . . . . 1976-77Danny Patterson. . . . . . . . . . . . . 1972-73Rodney Patterson . . . . . . . . . . . . 1983-84Wes Patterson . . . . . . . . . . . . . . 2008-11Jake Patzner . . . . . . . . . . . . . . . . 2016-17Luis Paublini . . . . . . . . . . . . . . . . 2013-15Chris Payne . . . . . . . . . . . . . . . . . 1993-94Tim Pearcy . . . . . . . . . . . . . . . . . 1984-87Frank Perez . . . . . . . . . . . . . . . . . 1986-87Matt Phillips . . . . . . . . . . . . . . . . 1985-86Zach Phillips . . . . . . . . . . . . . . . . . . .2009Justin Pickle . . . . . . . . . . . . . . . . . . .2017Wes Piersall . . . . . . . . . . . . . . . . . . .2013Adam Pitt . . . . . . . . . . . . . . . . . . . . .2001Clayton Pittman . . . . . . . . . . . . . 2002-04Gary Pittman . . . . . . . . . . . . . . . 1983-84Matt Poteete . . . . . . . . . . . . . . . . . .2015Dalton Potts . . . . . . . . . . . . . . . . 2012-15Mike Prather. . . . . . . . . . . . . . . . 1983-84Nick Pribble . . . . . . . . . . . . 2015-currentGary Price . . . . . . . . . . . . . . . . . . . . .2015Chad Pritchett . . . . . . . . . . . . . . 1997-99Nick Proto . . . . . . . . . . . . . . 2016-currentMatt Pumo . . . . . . . . . . . . . . . . . 1982-85Jim Puryear . . . . . . . . . . . . . . . . . 1980-81
• R •Joe Raccuglia . . . . . . . . . . . . . . . 2006-08Mike Ramsey . . . . . . . . . . . . . . . 1983-84Eric Ranson . . . . . . . . . . . . . . . . . 2011-12Bill Rasbach . . . . . . . . . . . . . . . . . . .1971Kevin Ray . . . . . . . . . . . . . . . . . . 1992-93Steve Ray . . . . . . . . . . . . . . . . . . . . .1986Seth Rayburn . . . . . . . . . . 2017-currentJason Reed . . . . . . . . . . . . . . . . . . . .1988Mike Reese . . . . . . . . . . . . . . . . . 1979-80Lance Renton . . . . . . . . . . . . . . . 2006-08Alan Reynolds . . . . . . . . . . . . . . . 1981-82Chris Rezabek . . . . . . . . . . . . . . . 2005-08Steve Ricciardo . . . . . . . . . . . . . . 1976-78Billy Richardson . . . . . . . . . . . . . . . .1989Rod Rickert . . . . . . . . . . . . . . . . . . . .1974Alan Rickman . . . . . . . . . . . . . . . . . .2016Bill Ridings . . . . . . . . . . . . . . . . . 1979-80Adam Rimmer . . . . . . . . . . . . . . . . .2016Darrel Risberg. . . . . . . . . . . . . . . 1986-88Jarrad Robinson . . . . . . . . . . . . . 2003-04Jack Robinson . . . . . . . . . . . . . . . . . .1979Ryan Rockholt . . . . . . . . . . . . . . 2006-07Jarrell Rodgers . . . . . . . . . . . . . . . . .2011Luke Rodgers . . . . . . . . . . . . . . . 1999-00Chris Roe . . . . . . . . . . . . . . . . . 2014-2016Craig Rogers . . . . . . . . . . . . . . . . 1980-82Michael Roof . . . . . . . . . . . . . . . 2000-02Brian Rosbury . . . . . . . . . . . . . . . . . .1995Chris Ross . . . . . . . . . . . . . . . . . . 2013-14
• S •Adam Salter . . . . . . . . . . . . . . . . 2003-04Mike Sanders . . . . . . . . . . . . . . . . . .1982Johnnie Sanfratelo . . . . . . . . . . . 1996-97Hideaki Sato . . . . . . . . . . . . . . . . 2005-06
Cole Schaenzer . . . . . . . . . . . . 2015-2016Rick Searcy . . . . . . . . . . . . . . . . . 1977-78Shane Seckinger . . . . . . . . . . . . . 2016-17Scott Seward . . . . . . . . . . . . . . . 1984-85Chuck Seymour . . . . . . . . . . . . . 1998-99Mike Shambre . . . . . . . . . . . . . . 1972-75Daniel Shaw . . . . . . . . . . . . . . . . . . .2015Ronnie Shepard . . . . . . . . . . . . . 1984-85Frank Sheppard . . . . . . . . . . . . . . . .1976Carson Shrode . . . . . . . . . 2015-currentRichard Sims . . . . . . . . . . . . . . . . . . .1974Chris Sisk . . . . . . . . . . . . . . . . . . . 2006-08Ric Sisler . . . . . . . . . . . . . . . . . . . . . .1984James Skinner . . . . . . . . . . . . . . 1991-92John Skubina . . . . . . . . . . . . . . . 2011-14Paul Slack . . . . . . . . . . . . . . . . . . 1997-00Gary Slayden . . . . . . . . . . . . . . . . . .1982Brandon Smartt . . . . . . . . . . . . . . . .1998Brad Smith . . . . . . . . . . . . . . . . . 1998-99Carey Smith . . . . . . . . . . . . . . . . 1978-79Carter Smith . . . . . . . . . . . . . . . . 2012-15David Smith . . . . . . . . . . . . . 1977, 78-81Dewayne Smith . . . . . . . . . . . . . . . .1993Jason Smith . . . . . . . . . . . . . . . . . . .2004Jacob Smothers . . . . . . . . . . . 2004-2007Phil Sorensen . . . . . . . . . . . . . . . 2011-14Michael Spaulding . . . . . . . . . . . 1995-96Jonathan Spiceland . . . . . . . . . . 2000-03Brett Spivy . . . . . . . . . . . . . . . . . 2003-06Adam Stacy . . . . . . . . . . . . . . . . . 2008-11Mark Stafford . . . . . . . . . . . . . . . 1973-75Keylen Steen . . . . . . . . . . . . . . . . . . 2017Dan Stephens . . . . . . . . . . . . . . . 2000-03Quinton Stevens. . . . . . . . . . . . . 2014-15D.D. Stewart . . . . . . . . . . . . . . . . . . .1986Jordan Stokes . . . . . . . . . . . . . . . 2010-13Jordan Stoner . . . . . . . . . . 2018-currentCory Stooksbury . . . . . . . . . . . . . 2010-11David Strange . . . . . . . . . . . . . . . 1993-94Cliff Sturdivant . . . . . . . . . . . . . . . . .1971Rod Sturdivant . . . . . . . . . . . . . . 1979-80Jason Sulliivan . . . . . . . . . . . . . . 2001-02Dustin Summers . . . . . . . . . . . . . 2002-05Calen Sutton . . . . . . . . . . . . . . . . 2007-08Shawn Swaringen . . . . . . . . . . . . . . .2010Rick Swayze . . . . . . . . . . . . . . . . . . .1986George Sykes . . . . . . . . . . . . . . . 1973-74Dillon Symon . . . . . . . . . . . . . 2014-2016
• T •Oliver Talley . . . . . . . . . . . . . . . . 1990-92Austin Taylor . . . . . . . . . . . . . . 2015-2016Cody Terry . . . . . . . . . . . . . . . . . 2008-11Monte Thomas . . . . . . . . . . . . . . . . .1982Paul Tinnell . . . . . . . . . . . . . . . . . 1978-80Dan Tobik . . . . . . . . . . . . . . . . . . 2010-13Jim Tracey . . . . . . . . . . . . . . . . . . . . .1978Jess Trask . . . . . . . . . . . . . . . . . . 2009-11Greg Treadway . . . . . . . . . . . . . . . . .1978RC Trussell . . . . . . . . . . . . . . . . . . . .2012Jay Trussler . . . . . . . . . . . . . . . . . 1995-96Kevin Tuck . . . . . . . . . . . . . . . . . . 1982-83Blake Turner . . . . . . . . . . . . . . . . 2005-08Loren Turner . . . . . . . . . . . . . . . . 2002-03
• U •Ben Upton . . . . . . . . . . . . . . . . . . . .2014
• V •Brett VanderMeeden . . . . . . . . . 1993-94Brad VanderMeeden . . . . . . . . . . . .1995Scott VanNeste . . . . . . . . . . . . . . 1996-97Ben Vesser . . . . . . . . . . . . . . . . . 2009-10
• W •Erik Walker . . . . . . . . . . . . . . . . . 2006-08Don Waller . . . . . . . . . . . . . . . . . . . .2002Sean Waller . . . . . . . . . . . . . . . . . . .1998Tommy Walston . . . . . . . . . . . . . 1979-80Nate Walters . . . . . . . . . . . . . . . 2006-09Nick Walters . . . . . . . . . . . . . . . . 2006-08Travis Walters . . . . . . . . . . . . . . . 1993-94Donald Ward . . . . . . . . . . . . . . . 1981-82Brad Warmath . . . . . . . . . . . . . . 1996-97Brian Washburn . . . . . . . . . . . . . 1999-00Ken Waymon . . . . . . . . . . . . . . . 1978-79Bill Weaver . . . . . . . . . . . . . . . . . . . .1979Travis Webb . . . . . . . . . . . . . . . . 2007-09Tanner Wessling . . . . . . . . . . . . . 2016-17Dalton Westfall. . . . . . . . . 2016-currentDavid White . . . . . . . . . . . . . . . . 1989-90Larry White . . . . . . . . . . . . . . . . . . . .1980Ethan Whitley . . . . . . . . . . 2018-currentBlake Williams . . . . . . . . . 2015-currentBrett Williams. . . . . . . . . . . . . . . . . .1993Hal Williams . . . . . . . . . . . . . . . . 1993-95Mike Williams . . . . . . . . . . . . . . . 1975-76Jim Willis . . . . . . . . . . . . . . . . . . . 1983-85Lucas Wilmore . . . . . . . . . . . . . . 2007-09Nick Wilson. . . . . . . . . . . . . . . . . 2011-13Randall Wilson . . . . . . . . . . . . . . 1977-78Dick Windbigler . . . . . . . . . . . . . 1971-73Nick Wohlbold . . . . . . . . . 2018-currentCurtis Wooten . . . . . . . . . . . . . . 2000-02Robert Worley . . . . . . . . . 2017-currentAlbert Winn . . . . . . . . . . . . . . . . . . .1989Derek Wright . . . . . . . . . . . . . . . 2009-10Bruce Wyatt . . . . . . . . . . . . . . . . . . .1981Chad Wyatt . . . . . . . . . . . . . . . . . 1995-96
• Y •Chris Yandell . . . . . . . . . . . . . . . . . . .1990Michael York . . . . . . . . . . . . . . . . 1991-92 Brett Young . . . . . . . . . . . . . . . . . . . .1995Chase Young . . . . . . . . . . . . . . . . . . .2014Colton Young . . . . . . . . . . . . . . . . . .2011Dustin Young . . . . . . . . . . . . . . . . . .1993Matt Young . . . . . . . . . . . . . . . . . 2010-13Greg Youree . . . . . . . . . . . . . . . . 1987-89
• Z •Jackson Zarubin . . . . . . . . . . . . . 2014-15 Bill Zipp . . . . . . . . . . . . . . . . . . . . 1976-79Harold Zonder . . . . . . . . . . . . . . 1981-82Nico Zych . . . . . . . . . . . . . . . . . . 2012-15
2018 UT MARTIN BASEBALL2018 UT MARTIN BASEBALL78
THIS IS THIS IS UT MARTINUT MARTIN
2018 SKYHAWK BASEBALL2018 SKYHAWK BASEBALL 79
Now in its 70th year, the Ohio Valley Conference continues to build on the success that has made it the nation’s eighth-oldest NCAA Division I conference.
In May 2011 the Conference expanded for the second time in four years, adding Belmont University which began competition in the 2012-13 academic year. The addition of Belmont gave the OVC 12 members, the most the league has had at one time in its illustrious history. The move added a second team in the city of Nashville and was the first addition to the league since Southern Illinois University Edwardsville joined in 2008. Subsequently, the league has shown its stability over the past decade, seeing only one member institution depart over the past 17 years.
The 2009-10 school year saw a change in leadership as Beth DeBauche was named the seventh full-time Commissioner in league history
on July 28, 2009. The last three commissioners of the OVC have moved onto jobs as the commissioner of the Big Ten, Big 12 and the Mid-American Conferences.
The OVC’s proud history dates back to 1948, but seeds for the new league were actually planted in 1941. It was then that Roy Stewart, the athletics director at Murray State, Charles “Turkey” Hughes, the athletics director at Eastern Kentucky, and Kelly Thompson, the public relations director at Western Kentucky, first broached the idea of forming a new conference. Discussions were put on hold by World War II, but reemerged February 27-28, 1948 at the Kentucky Hotel in Louisville as the three original institutions combined with Morehead State, Louisville and Evansville to form the OVC.
In the 1950s, the OVC became a pioneer on a much more significant scale socially. During times of racial segregation, league member Morehead State became one of the first non-traditionally black mid-southern institutions to accept a black student. In 1958 Marshall Banks earned athletically-related aid at Morehead, which signed a second black athlete, Howard Murphy, a year later. In 1961 Murphy earned all-conference recognition as a halfback in football. With racial barriers broken, the rest of the institutions in the league began to provide educational and athletic opportunities to African-Americans.
After Title IX legislation passed in 1972, women’s athletics began a rebirth on the national scene as the NCAA began sponsoring and marketing women’s sports. Recognizing the need to provide increased opportunities for female athletes, the OVC began formulating plans for women’s athletics in 1975 and established women’s championships in the sports of basketball, tennis and track in 1977, with cross country and volleyball added over the next four years. Those sports were initially governed by the Association of Intercollegiate Athletics for Women (AIAW), but the overall strength of women’s programs in the league was demonstrated by the automatic bids the OVC instantly received when the NCAA became the governing body in 1982. The conference added women’s golf and softball in 1994 and women’s soccer in 1998.
Over its 69 years, OVC teams have garnered national championships and bowl games in football, along with national team or individual titles in the sports of rifle, cross country, track and golf.
The OVC has also produced several Olympic athletes, including Murray State’s Morgan Hicks, who was a member of the 2004 United States Olympic Rifle Team and Morehead State’s Brian Shimer who competed in five Winter Olympics in bobsled (winning a bronze medal in 2002) and coached the 2010 United States bobsled team to its first gold medal since 1948. Former Morehead State football and Eastern Kentucky track and field athlete Dallas Robinson competed with the U.S. bobsled team during the 2014 Sochi Winter Olympics. In addition, some of the greatest players in professional sports were educated at OVC institutions. The list includes former greats such as football’s Phil Simms (Morehead State), basketball’s Clem Haskins (Western Kentucky) and Bubba Wells (Austin Peay) and two-sport star Steve Hamilton (Morehead State) to present-day standouts like basketball player Kenneth Faried (Morehead State), football players Tony Romo (Eastern Illinois) and Jimmy Garoppolo (Eastern Illinois) and baseball players A.J. Ellis (Austin Peay) and Shawn Kelley (Austin Peay). Hamilton is the only athlete to ever play in the NCAA Basketball Championship, a Major League Baseball World Series (New York Yankees) and a NBA Championship Series (Los Angeles Lakers).
The league’s baseball presence has continued to evolve since its inception. The OVC baseball tournament moved to a neutral site for the first time in 2001 with Paducah, Kentucky and Brooks Stadium hosting the tournament in front of raucous crowds. The success of the tournament led to Jackson, Tennessee and The Ballpark at Jackson (the home of the Seattle Mariner’s Class AA affiliate) – hosting the event for the first time in 2010. The championship moved to Choccolocco Park in Oxford, Alabama in 2017.
The OVC also has made a statement in the NCAA Baseball Championship in recent years, with its teams involved in several memorable contests in the last decade. Tennessee Tech surprised Wake Forest in the opening round of the 2001 tournament and Southeast Missouri stunned host Alabama in the opening round of the 2002 championship. Five years later, Austin Peay captured the collegiate baseball world’s attention by taking Vanderbilt, the 2007 No. 1 overall seed, to extra innings. Eastern Illinois pushed host Nebraska to the limit in 2008 followed by Tennessee Tech’s memorable contest against host Clemson in 2009.
After not making the OVC Tournament field in either 2009 or 2010, Austin Peay, who was picked to finish seventh in the 2011 preseason poll, won the regular season and tournament championships to garner its fourth NCAA Tournament appearance. In the
first game of NCAA Regional play the Govs knocked off host and No. 1 seed Georgia Tech 2-1.
In 2012 Austin Peay completed a “repeat squared” (back-to-back regular season and tournament championships) for the first-time in OVC history. The Govs would go on to top Indiana State and Cal State Fullerton at the Eugene Regional, before falling to host Oregon in the regional final. It marked the first time since 2000 (Middle Tennessee) that an OVC team had won multiple NCAA Tournaments games in the same season.
Austin Peay completed a “3-Peayt” by winning its third-straight OVC Tournament crown in 2013. Along the way the Govs garnered the first nationally-ranking by an OVC team since 2009 (climbing to as high as 21st nationally) and tied the OVC single-season record with 47 victories. The Govs earned the No. 2 seed in the NCAA Bloomington Regional, becoming the first OVC team in the current regional format (since 1999) to earn anything other than a No. 4 seed. The squad topped Florida and Valparaiso to advance to the regional final for the second-straight season before losing to host Indiana. Govs senior closer Tyler Rogers was a big part of his team’s success during the year, setting the NCAA single-season record for saves (23 – a mark that was later eclipsed during the College World Series).
In 2016 six OVC teams reached the 30-win plateau for the first time in league history; the previous single-season high had been four teams.
In 2017 the league could have been named the “Offensive Valley Conference” as teams combined for 753 home runs during the season, the most in league history. That was highlighted by a record 50 combined home runs being hit in 13 games at the OVC Tournament. Included in that was Morehead State sophomore Niko Hulsizer who hit his 27th home run of the season, establishing a new OVC single-season record.
In 2014, for the third-straight year, 12 OVC players were selected in the Major League Baseball First-Year Player Draft. Of those 12 selections five came in the first 10 rounds, setting a new record for most OVC players picked in the first 10 rounds (eclipsing the old mark of three set several times). In 2016 13 OVC players were selected in the draft, tying the all-time record established in 2010; overall the OVC has had 85 players selected over the past eight years (2010-17).
A first in the OVC occurred in 2008, when the league had a first round draft pick in both the NFL (Tennessee State’s Dominique Rodgers-Cromartie) and Major League Baseball (Eastern Kentucky’s Christian Friedrich) Drafts in the same school year. A year later (2009) the league had a Major League Baseball First Round Compensation Round pick (Eastern Illinois’ Tyler Kehrer who was No. 48 overall) and NBA Second Round pick (UT Martin’s Lester Hudson) in the same season.
The playing field is not the only place where OVC athletes are working hard. The league also recognizes excellence in the classroom. Six Scholar-Athlete Awards are presented yearly to male and female athletes, while others are commended for their academic success by being Medal of Honor recipients or earning a spot on the Commissioner’s Honor Roll. Additionally, the league annually presents one institutional Academic Achievement Award, as well as separate team awards in each Conference-sponsored sport. Since the College Sports Information Directors of America (CoSIDA) Academic All-America program began, the Ohio Valley Conference has had 261 student-athletes honored with the award, including 67 over the last seven years (2010-17).
Through the early years of the league, administrators wrestled with fan behavior due to the close proximity of the Conference members and the intense rivalries which developed. Just as it did decades ago, the OVC took the leadership role on what has become a national issue. In 1995, the OVC implemented a first-of-its-kind “Sportsmanship Statement,” a policy which promotes principles of fair play, ethical conduct and respect for one’s opponent. The statement has become a model for others to follow across the nation, and has answered the challenge of the NCAA Presidents Commission to improve sportsmanship in collegiate athletics.
Additionally, the OVC annually presents the Steve Hamilton Sportsmanship Award, in honor of the former Morehead State student-athlete, coach and athletics director, to a junior or senior student-athlete with significant athletic contributions who best exemplifies the characteristics of sportsmanship and citizenship. Most recently, the Conference has also implemented the OVC Institutional and Team Sportsmanship Awards, which are presented to one institution and 18 sport-specific teams voted by their peers to have best exhibited the standards of sportsmanship and ethical conduct as outlined by the OVC and NCAA.
The vision of leadership demonstrated by the Founding Fathers in 1948 remains alive today as the OVC prepares for the future. One example is in regard to the current trend in collegiate athletics administration for increased involvement of university presidents in setting policies and making rules. The presidents of OVC institutions, however, have always governed the Conference, long before presidential governance became a national theme.
The OVC sponsors the following sports: baseball, basketball, cross country, football, golf, tennis and track for men, and basketball, cross country, golf, soccer, softball, tennis, track and volleyball for women. In addition, the OVC also sponsors the combined men’s and women’s sport of rifle.
Now in its seventh decade of competition, the OVC has grown significantly from its humble beginnings while increasing the number of athletics opportunities it provides for students. Current league representatives include charter members Eastern Kentucky University, Morehead State University and Murray State University, along with Austin Peay State University, Belmont University, Eastern Illinois University, Jacksonville State University, Southeast Missouri State University, Southern Illinois University Edwardsville, Tennessee State University, Tennessee Technological University and the University of Tennessee at Martin.
the athletics director at Eastern Kentucky, and Kellyirector at Western Kentucky, first broached the ie iie e iiiiideaeaeadededeadeadd ofooofffoooofoff sions were put on hold by World WaaWaWaWaWaWaWaaWaWaWaWWW r Ir Ir IIr Ir Ir Ir Ir Ir Ir IIr IIIIIII, III,II,I,I,, I, I,I,I,I,,, bbbbbbbbutbutbbbbutbutbutbutbuttbutbutubutubuuub rerereeerreeeereererereememememememeemeememeememmeememergergergrgrgergergerrgrgedddddddddddddddddddddddddcky Hotel in Louisville as thetheheheehehehehhethehhehthh thththhthththththththththhtthhhhhhhhhhhhhhrerereereereereeereeeererrrr orororororrororo igigiigiiigiigiiigiigiggiigiigiigiigiigiigiigigggg lnalnalnalnalnalnalnalnalnalnallalnalnannnn inininininininiinii stiststststistististststiss t tt tt tttt ttt tttutt tionioniiiii nnnnnnnnssss sssss
Louisville and Evansvvvvvvvvvvvillillillillillillillilllilllllllilllli e te te te tte ttte tte te te tttooo foo fo foooo foooooo fo fo fo ffo orororororormormorrmrmo mmrmrmrmmrmrmrmmrmm thththhththththththhthttht e Oe Oe Oe OOOOOOOOOOOOOOOVC.VCVCVCVCCVCVCVCVVCVCVCVCVVCVCVCVCVCVVVVVC e a pioneer on a mmmmmmmmmmmuchuchchuchuchuchuchuchuchuchuchhuchhuchuchucccchhhhu h mmmmmmmomomomommomomomomomomoommmoooorrrrrerrrr siggggggggggggggggggnnnnnnnifnnnnnnnnnnn icant ntntttntttntnttttnntnttttt scascascascascaascascascascacccs leleleleleeelellelelelellllee sosocsosococsocsosocsocococoocococooco ialiaialialiaialiaialialiallalialiiiaaa ly.ly.ly.ly.ly.ly.n, league membmmbmbembmbmbmbmbebembmbbeebebeebebebeeeebeebembmb r Mr Mr Mr Mr Mr Mr Mr Mr MMMMr MMMr MMMMMMoreoreoreoreooreeeeeoreo eeoreo eeeeeeeheaheaheaheaheaheaheaheaheaheaeaheaheaheheheheahhheaheaheheeheheheae d SSSSSSSSSStattttattattattattatattattataaatatatt e bbbe be be be bbe be bbbbe bee bbe be b bbbecaecaecaecaecaecaecaecaaaammemememeemeemememememm oneoneeoneoneneoneoneoneonenennenennonnoo ofofofoffofoffofoffofoofoooof thhhhhhhhhhheee e eeee esouthern inststitstistststistststss iiiiiiitututututtuttututututututututututt iiiiiononioniionononionioniiioniooioononononnionnnnns to aaaaaaaaaaaaaccccccccecceeccecececcccececcceecececccc pt pt ptpt ptpt pt pp a ba ba ba ba ba ba bba bbbbbbbbbbblaclaclaclacaclaclacaclaclalaal kkkkkk skkkkkk tudent. In 1n 1n 1n 11n 1n 1nnn 11nn 1nnnnn 11n 1n 958 y-related aiaiaiaaiaiiaiaiaiiiaaa d dd ad ad d dddd addd aaaaddd atttttt Mt Mt Mt MMMMMt Mt MMMMt MMt MMoreoreoreoreoreoreoreoreoreororeoreoreoreorrorreeoreooreheahheaeaeaheaeaheaeaeaeaeaaaaaeahehee ddd,d,ddddddd,d,d,d,d,d whihiwhwhiwhiwhiwhiwhwhiwhwhhiwhwhwhwhwhw ch signed a second blbblblblblblblblblblbbbb ackaaaaaaaaaaaaa ater. In 1111111111111196199969696961961999696966169616111969 MMMuMMMMMMMMMM rphphhhhhhhhhhhhhhhhhhhhhhy eyy ey ey ey eyyyy ey ey eyyy eyy eararnnarnarrarnrararrraa ed allllllllllll-coo-coco-co-co-co-c-ccoo-co-c--- fnfenferenrencece eeeeeeeeeee recrecrecrecrrrrrrrrreree oognoognoooooooooooogggggg ittitiitittttttt ononnnnnnnnnonncial barararrrrrrrarrrrriririerieiiiierieririeeiiieiriiierrrss sssrsssssrssr brokekenkenkenekenkeenkekenkennennkekekekkk , t, t, t, tt, ttt, , , hhe rest t tt ot ot t oot oooot oot ffffff tff he institutiutiutitititititututuutuuuutuuuuututttuttttt onsonsononononnonnonononnon in ttthhhhthhthtthttttttthee eeeeee eeeeee eenal andndndddndndddnddnd ataatatatattaa hhhhhlehhhhhhh tic opoopopopopopoopoopopopopppppppppppporppppp tunitieees es ees eeeeesees to AfrAfAfrAfrAfAfAfAfAfAfrAAAAAAfAfAfrAfAfAfrfAfrAAA iicaiiicacaicaaaicaaan-An-An-An-An-AAAAn-AAn AAAnnnn Annnnn mermmmmmemeeemmmmmmeeemmemm iiicaicacaaaicaaiii aaiiiiiii nss.ss.sss.sss.sss.sed innnnnnnnnnn 11111999911199919991972, wwowooooowwowwowwwwwwwww mmmmenmmmmmmmm ’s athhhhhhhhlleleeetlleeellleell icsssssssssssssss bbbebbbbbbbbbbbb gggganganannngg nngggggggg nngg a aaa aaaaaaaa rereeebeeeeebe iiiirtirtttti ttirttiiiiii h oooooooooooooonnnnn nn
A begaaaaannnnnaannnn ssspsss onsooororrrirooooror nnnng nnn and mmamaaaaaaammmmmmm rkeeeeeeeeeeeeeetinttttititintinttttittinttit nnnnt nnnnnng wwwwwwomemmmmmmeemmemmmeeemmeennnnn’snnnnnnnnnnnnn ssspsppppssssssspppssspportrtrtrtrtrttrttrtrtssssss. sssssssssssde incccrrrrrcrrrrrccrrrcrcc eeaeaaaasseasssseaeaassassseeased oppopopoppopppppppoopppppoppoppppo ppppppopopppo popopopoppp ortoooooooo unitieeeeeeeeeees s fsss or ororrorrorrororororrrrr femfemfemfemfemfemfemfemfemfemfemmaaaleaaa aaaaaataaaaaaataaaaaaaaaa hhhhhlehhhhhhhhh tesesseseseesssss, , t, hehhheheeehehheeheehehhehhheeeher wommmeeemeeeeememmemmmm n’n’n’n’n’ssn’ssssnn’sn’sssnnn sn sn s athleeeeeeticticicicicticcicicitt ct s issss ssssss n 197777575777777777 annnndd edd d ed eeddd eddddddddddddddd stastattaastaaastaaabbbblibbbb shehshshshshheheshshshshheshshshheheshshs ddd wddddddddddd ommmmmemeememmmmeemmmeen’sn’sn’sn’ssn’sn’sn’s’n’sn’sss asketbaaaaaaaaaaaaall,ll,l,llll,l,,,l ,lllllll ttteteteeeteeteteeeeeeeenninnnnnnnnnnn s aaaaaaaaaaaaandnddnd nd nd nd nndndnnnnnnnnnn tratrtrtrtrttrtrt ck innn nninnnn nn nnn nnn 1971199 7, ,,, witwittitwitwitwitttitttwiwith ch h ch ccccch h ch chh ch cch ch cchh cch rororoosoorooorororoo s couuununnnuuuuuuuuuunnnnu trytryytrytryyrytrytryrytryyy xt four yeyeyeeyeyeyeyeyeyeyyeyeeeaaaarsarsrsrsrsrsarsaaaaaaa sa . T.. . . . hose se se see sse sssssspopoppopoporpororororoporpooroorporrropppppp ts ts tttttttt werwerrrrwwwwwwewwwwwwewwww ie ie ie ie i ititnitnitniti lialalialalialialallllllllylyllly lyly lyyly ly yyylyyyly governededddedddddddddddddd bybbbbybbbbbbybbybybbybybybybbyyyyyyyAthletics foorforrororfofororfofofoorfoororfof rf rrorro WWWoWoWoWWWoWoWWoWWWWWWWoWooW men (AAAA(A(A(AAAAAAAAAAA(A(A(A(AA(A(A(A(AA((A(A(AA(( IAWIAWIAWAWWIAWIAWIAWWWWWWIAWAWWWAWWWIAIIIIIIAIIAAWA )), )))))))))))))) butbbbbbbbb the overall strength ue was demommommmomomooonstnststststnsststnsnsnnnstnnnstratratratratratratratratrataaatraatrrarr eded ed ddd ddedddddddddddddddd bbybybybybbybybyby bybbybybybbybyy thethethethethethethethhehehhhhheeee auauauuuuauuaaaaa tomtotomtomtomtomtomomomomommmmtomtotomttomtomtomtomo atiatiatiaatiatiatatiatiatit c bcc ids the OVCA became the gggggggggggggoveoveoveveveeeovevvvvevevevovevveoooooooo rninininininininininirnirnrnrnrnrniir ng ng ngng ngng ng ng ng ngngng bododododddoddoddodododododododdododdoo y iy iy iy iy y iy iy iy y y y iy y iyy iy iyy yy iy iyy n 11n 1n 111n 1n 1n 1119829828282282222982998299982982998298282222 TTTTTT. T. TTT. . heheheheheheheh conononoonnononnnnconconconconccoconnferfefeferferferferferferfefefererrencencenencencennnnnceeee in 1994 and womeeeeeeen’sn’s’’s’s’s’’’s’’s’s’ssnn’snnnnn snn sososoooooososossssosssosos cceeeeeeeeeeeeeccccccccccccccc r ir ir iir ir ir iiir iiiir iiirrr ir iinnnn 1n 99898988888888888988888888...........ave garnered nationalllllll chhhhhchchchcchchchchcchhampampampampampmpmpampampampampmpmpmpmpmpmamppamamamamaamam ionionionionionionionionio shihihishishishishshishishishihihihshsshssss pspspspspspsps ps pspppps pppspss and bobobobboboboboboboboboboboboboboobbbb wwwwwwwl wwwwwww gamamamammmmmmmmmmmmammmmmamammmammmmmeeseeseseseeeeseseseeeeeeeeeeeeeteam or individual titles iiin tn tn tn tn tn tn tn tn tnnn the hehehhhhhhhehehhehhehhhhhheheheh spospospospospspspospospsposspospopoortsrtrtsrtsrtsrtsrtsrtssrr offffffffffffofofofoofofofof iririririiriiriiiiiririrrrr fleflflflflfleflefleflefleflefleflefleflef e ccccc, cccccc,, rosrosrosrosrosroososssss
several Olympic athletes, including Murray Sta ’’te’s ber of the 2004 United States Olympic Rifle Team andwho cocococompemmmmmp ted in five Winter Olympy ppics in bobsled edeedeed and coooachhchchchchchhhed ed eddeded ddded thethethethethetheeheeh 2020220202020202020010 1010 10 1000010 1 UniniUniUniUniUniiUniiitedededeededdeddd SSStStS ateateateateateateateeateateaa s bbobsoboobobobsbobsobobob ledledledledledledledledledledle tetetetetettttet amamamamam ammmammmam to itititsiiitsittt
er Morrreheeheehehhheheeheead adadad adad ad ad dad Stattatatatatetetete tette tetee foofoofoofoofoofoooofoooofoooffootbabababababbb llllll lll andandandanddandanandandn EaEaEEEEEEEEE stestestestestestestestestess rn rn rnrnrn rnrnrnnrn nrn KenKenKenKenKeKeKeKeKenKeKee tuctuctucttuctuctutuctuctucky kkykyyky kkykyky kyky tracccck ck cccccompe dddtedddd iiwi hhth hhhh thehhhhh U.UUUUUUU SS. SS bobbbb lslelll dddd tddddd eam ddudd irinii g thhhhehhhhh 201111444
on, some of the greatest players in profrorofrororo essesesesesssss ional spoppppppp rts s. The list includes former greats such hhh h h hhh as asssasa foofoofoofoofoofoofoofofooo tbatbatbatbtbatbatbatbattball’ll’l’llll s PPP PPPP PPPPhilhilhilhilhilhilhhilhillh ball’s Clem Haskins (Western Kentuckuckuckuuuuckckcky)yy)y)y)y)yy) andandandaandandandandanda dn BuBuBBuBBuBBuubbabbbbabbbbbbbabbbba t star Steve Hamilton (Morehead State) to present-day
27th home run of the season, establishing a new OVC InInIIInIn n 201202012012012001010010101000114,4,44,,,, for the third-straight year, 12 OVC players w
BasBasBasBasBasBasBasBasBasBasBasBBasBasBBaBasBBaasssassssssss bbbbbbbebabbbbebabebebaebebaebaeballll lllllllllllllllll llll lllll FirFirFirFirFirFirFirFirFirFiFirFirFirirrst-stst-st-st-st-sst-st-tt-t-t-tt YYYeaYeaYeaYeaYeaYeaYeaYeaYeaYeaaaaaYeYYeaYeaYeYeYeYeYeYeYee r Pr Pr Prr Pr Pr Pr Pr Pr Pr Pr PPPPlaylaylalaylaylaylaylaylayayayyyer Draft. Of those 12 selectionsseeteeeeee iitintiiii g aaaaaaaaaaa nnenenenenennenennnnneew rw rww rw rw rww rw rw rw rww rw rw rrrrecoecoccocococococcoecoeceeeecececececoececec rdrddddddddddddrd rdrdrdrddd forforforforforforfforforforoorooo momomommmomomommomoooommmmmmmm st sssssssssssssst OVC players picked inoldldoldldldoldloldoldldololldlloldo dddo markrkkkk kkkkkk kk kkkkkkkkk ofofofoofofofof ofofooooooo thrrrreeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeee setttttttttettt sesesesesesesesesesseseseseeeververververerererererrvvevevevvevvevvevev al llllllal llllal alalalalal l timmmmmmmmtimmmmmtimmtitimtimttimtimtittitiimes)es)es)es)es)ees)es)eeses)eseses)ese . In 2016 13 OVC ptyiiiiiiiing ngnngngng ngnngngngnnngngggg thethethehthethethetheththetheheetheethhht eetheeh alalalalalalalaalallllll-tllllll-tl-tl-tl-t-ttimeimeimemeimeiimiimimmmimimimmmmm rrrrrrerrrrrrrr corrrrrrrrrrrrrrrrd ed ed dddd dd ddddd ddddddd statatataablililiiiliiiiblibliblibbliblbliblibliblibliblibliisheshehheeheeshesheshesheshesheeshshshs d iiiiiiiiid iid id d dddddd dddd d d n 2n nnn nnn nnnnn 010; overall theoveooovovovovooovovv r ttttttttthehehehe heheheeheeheehhh paspapaspapppasppaspapaspasppaspasppaa t eet et et et et et et et eeeighighighighighighighigghighigighigigiggggggg t yt yt yt yt yt yt yyyeareaeareeareareareeararararaararss (sss (ss (s (s (ss (s (s (s (s (((20110111111111110-10-0-0-0-0-0-000-00-0-0-0-00000 7).7)7)7)77)7)77)77)7)))
A fA fA fA fA ffA fAA fA fA fA ffffirirrrsirririrrrr t in the OVCOVCOOOVCOVCOVCOVCOVCOVCOOOVVCVVC ocococcccccoooooooooooo curcururrrrrrrrrcucucucucuu redredredrededededreddreddredddrrrrererrrrerererre in 202022020202002002002020202020202222022222 08,08,08,08,08,008,008,808080800000808 whwhwhwhwhwhwhwhwhwwwhwwhhwwwwhhwww en the leaininin inininninninin n nni botobotbotbotbotb ttbobb tbobobbotoo h hh thhhhhhhhhhhhhhhhhh he NFL (Tennessee eeeeeeeeeeeeeeeeeeeee StaStaaStataaStaStaStaStaState’e’e’’’’’’e’’’’’’te’tetetetteteteteteee s Ds Ds Ds Ds Ds Ds Ds Ds DDs Ds Ds Ds Ds Ds Ds Ds Ds Ds Ds Dss Ds Ds Ds Ds Ds DDDs DDoommmimiimiiiomiiomomimomoommmmm niqniqiqniqniqniqniqiqniqniqiqiqiiniiqninniiqnn quuuue uuuuuuuuuu RodgeBasBasBasBasBasBBasBasBasBaBBasBasBaa bebaebaabbb llll ll (Ea(Ea(EaEaEaEaEaEEaEEEEEaastestetestestestestestestestestestesteestss rnrn KKenKenttuctucky’kykyyykyyyyyyyyyyy s CCCCCCCCCCCCCCChrihrihrihririririhhrrihrrhhrhhhhrhhhhr stistististittittstittitiis isss is ian a FriiriiriiFririFririrrrrrrrrrrr ededdrdrredrdddredreedre reeeeeee ichichchchchchchchiichichiiiiiii hhi h) Draftlatatlalalaaalalalaallalalaaateeeer eeee (20(2(2(22020(20(2(2(220(220(2(2202020(220(22(222 09)09)09)09)9)09)09)09)09)0909)09)09)09)09)00000099090 thththththththhthe leaggggggue hahhhaadadhadhhhadaadhhhah dhhhh ddh dhhadh ddhh ddh a Majororororor orororoororrrrr LeLeLeLeaLeLeLeaLeaaLeaaaeaaaaaaLeaeLLeaLeeLeeeL guegugueueguegueguegueueuguegueguegueueguegueueguegueueeueee BaBaBaBaBaaBaBaaBaaaBBaBaBBBBBaBB seebebebseebssebsebssesessseebeball Fipppipicpicpicpicpicppicippppppppp k (k (k (k (k (k (k ((k (k (k (k (k (k (kk (((EasEEEEasEasEEEEasEEEEasEaasEaEEaaaaa teteterterrrrterterteetetet rrtt n IIIIIIIIIIIIIIIllillillillillilillillillillilliliilllillilililiililiili iiinoinnoinnoinoi ’’’’s’sss TTylylTylTylTTTyllTylyllyy eeeer eeeeeee Kehrer whwhwhwhwhhhhhwhhhwhwhho o wwwwwwwooo woo wwas NNooooo.oNNNNoNNNNNN 4848484848484848444448 over(U(U(U(UTUTT(UUTUT(UUTUTUT(U(UUT(UTUTTUT MMMMMaMaMaMaMaMMaMMaMMMMMM rtttititiittittitttttrt nnnn’snnnnn LeLLLLLeeeLLLLLLLeLLLLLLeeLesssstessssssssss r Hudson) in the sameaammmmmaamaammmamammmmaammmam seassooooosssssossosos nnn.nnnnnnnnnn
TheTheTTTTTheThheTTThheheTTTTThThThhhThTh pppplplppppppppp aaaayiaaaa ngnnnnnnggg g nngnnnnnnngnngnngg field is not the onlyyyyyyyyyyyyy ppplpppppppp ace wwwwhwhhhhhwhhhhheeeree OThThTheThThThhheheThThThheThThhhThhTheTTheeeehheeeT eT ee leaggggguguuuggguuggugue aaaaaaaaaaaaaaaaaallllslsolsoooollsol oollll oooool ol ol o recognizes eses seses eees seseseess exceeeee ellennncncnncnnnnnnnnnccncnceeeee ie eee n thhhe e hhhhhhhe e hhee ehhh cccllalaac acccclaalaclalallac ssroareaaaaareareeaa eaaaa eaaaa ea ea presssseseeessessssennntenn en en ed yddd yd yd yd yddddddddddddd ydd d earearearearly llylylyly yyyyy to ooototooooooooooott malllllllllle and femfffefeeememmffefefefemmmmmmale aaataaaaaaaattttatthlehhlhlhllllellelllehlhhh ehhleeeelleettttestttttttt , wthththhehhhhhhhhhhhhh ir acaaaaaaaaaaaaaaaaddddemdddddedeeeemeeeeemeeeememeemic ic sucsuccesescesesesssesssssessesesessesesseesss s by being Mg MMg Mg Mg MMMMg MMg MMMMMMg MMggg edededeededaedededdededddedeee l of Hf HHHHf Hf HHf HHf f f HHHHHooonnnnoonnnnnoooonooononn r recCCCComCCCCCCC missiossiosiosiosiosiosiosiosiosiosiossisiiooonernernnner’’’s’s s HHoHonHonHonooor or r rrror rrr rrr Roll. AddAddAddAdAddAdAdAdAddddddddddA ddAA iiitititiitiititititiitiitititttttt ooonallyyyyyyyyyyyy,, t, tttttttthhheheheehehe ehehhheeeheheehe lelelelealelelelelelelllll gue aAcademic Achievement AwAwAwAwaAwAwAwAwAwAwwawawawawawaA awaAA rd,rdrdrdrd,rd,rd,rd,rd,ddrd,rd,rd,rd,rd,d,drdrdrdd,rdd,rdd,,,,,,,,, asa weeeeeellllllll lllllll aaaaasasasasasasassassssss ssssesepssssssss arate tesponsored spportt. S. SSS. S. SS SSSSSincincincincincincncncinnncnninccccce te te te te te te tee te hhhehe he hhhhehehe heheeheheheeheeheh CCCColololllCCColllC lC lCC llCC lllllleglegegeglegegeglegleglegegleleglegeglelegleglelelegleglelelegleeegleege SSSSSSSSSSSpopopoporporpoororpopoorororp rororporoo tttsts ttsttss sssss IIIInfIII ormationAcaAcaAcaAcaAAcAcaaaAcaAcaAcaAA dememdemmmdemdemmemdemmdemeed icicicicicicicicic iiiic ic c AlAlAAAAAllAAlllAllAAlAllAllAllAllAllAA -Am-Am-Am-AmAmAm-Am-Am-Am-Ammmmmmmmmmerierieriieriierierierierierrrrreeee ccacaacacacacaacccccc proproproproroproproproproproproproproproproproprprororrprorrrpr ggragggggg m bbbm bm bm bm bm bm bm bm bm bbm bm bbbbbbegegegegaegegegaggagaagagagagagaagaegaggg nnnnn,nnnnnnnnnn,n,n,,n,n,n,, thththththeththhththhttt Ohio Valleyathathathhathhhhhathletleteteletttletetetettletletlelll eseseseseessseses ees honhonhonhonhonhonhonhohhohohonhononhonhonhononononoohooohonnored wd wd wd wwd wd wd wwwd wd wwwwwd wd wwwwwwwwwwwwwwiiiiithiiii thhhhhhhhhhhhhhe aee ae aeee aeeee aeeeeeeee aee aaaaaaawwwwwarwarwarwarwwwarwwararwww rwaa ddddd, d, dddd,d,d, d,d, d,d,d,dd iininincinininininciincncncincncncncccncnn lllludlllllll ing 67 over the
TTTTTThThThThrTThTTTTTTTTTTTTTTTTTTT ougugugugugugugggugugggguugguggguguuguggghhh h h thhh h hh h h hhhhhh hhhhhh hhhhhhhh he eeareeeeareareareareeeeareeeareareararearearearreaeaeareara lylylyylyly lyyyylyyyyyyyy yeayeayeayeayeayeayeayeaayeaaeaears rs rsrs rssrs rsrs srsrsrsrsr ofofoffofofofof oofoof fof of of ofoffofoo thhthththeththhththththhtht league, administradueddddduedduueueuedue toototoototoottotooto ththththhhthththththththththheee cee ce ce ce ce cce cllllllloslosloslosloslosloslosoo eeeee pe pee pe pe pe ppe pe ppe pe e e ee rorororororororoxrorororororoxoxoxxxoxxoxoxxiimiiimiimiimimiimiimiimimimiimiimiimmimimm tty ttt of the Conference mem
hhhwhiwhiiiihhiiwhiwwhichchhhhhchhhhhhhchch h devdevdevdevdevdevdevdeveevevdevdeedd eloeloeloleloeloeloleloelollleloeloeloeloloeloooleloloppedpedpedpedpededededpedpededpedpeeepe JJJJJJJ. JJJJJust as it did decades ago, the Ohhhhhhhhhwhat has become a national issue. In 1995, the OVC
“Sportsmanship Statement,” a policy which promoteconcccccccc duct and respecpp t for one’s oppppp onent. The statementottoto totototto fololoololfolololfolooo lowlowlowwowowowwwoo acacacacacacaa rosrosrosrosrosrosrosrrorrosross ts ts ts ts tssss ttthhehehehhhh naaaatataaata ioiooonoo , aaa a aaaaaandndndndndnndnndnnd hashasashaashashasaasaas anananananannnnnsweswesweswesweeeeswewsws redredredredreredededred thtt e chComComComComComComComComomommommmismismimimismisismimimim siosioiosiioioiosioioon tttn tn tn tn ttto io iiiiiiimprmprmprmprpmprmprmprmprmprmprp oveoveoveoveoveoveooveoveovevevee spspspsppsppsppportortortortortortortortorttsmasmasmasmasmasmamsmasmasmanshnsnsnsnsnsnsnnsnss ipipipipipipippp in iininininninininnn coocolcocoocooo legleggleglleleglleglegiate at
AddAAddAdddAAddAddd iitii ii iionallylllllll , thehhh O COVCOVCOVCVOVVV annuallylllll presents hhhthe Steve in nnn nnnn honhonhooooooo ororoororororr of oof oooooo thehhhehhhhhh fofffffff rmer Morehead State student-athletoo o o a jaa ja ja jja a a unuuuniuniuniuniorororrorrrr or orororrororooror sensensensensensensensennior student-athlete with significantexexxxexxeexeemplmmmplmmmmmplmmplm iffififiififii es sssss thethththeththehhhthe ccchccc aracteristics of sportsmanship andConference has also implemented the OVC Institut
OHIO VALLEY CONFERENCE
Beth DEBaucheOVC C
2018 UT MARTIN BASEBALL2018 UT MARTIN BASEBALL80
Kurt McGuffi n was offi cially named the 15th University of Tennessee at Martin’s director of intercollegiate athletics on May 22, 2017. He is expected to begin his new post on June 28.
McGuffi n brings more than 18 years of experience in the collegiate athletics forum, including nearly six years as athletics director at Missouri Western State University, an NCAA Division II school located in St. Joseph, Mo. Before leading the Griffon athletics department in 2011, he also spent time as an assistant athletics director for development at the University of Colorado (2010-11), as a senior associate athletic director for external operations at Kansas State University (2000-10) and as an assistant director of athletics for development at the University of Idaho-Moscow (1999-2000).
In his time at Missouri Western, McGuffi n achieved the highest student-athlete grade point average in the history of the school while also setting an all-time high for graduation rate and community service hours. He signifi cantly increased revenue generation to annual and endowment giving by 30 percent and he launched a capital campaign that produced fi ve of the top 10 gifts in university history, fi nishing off $13 million in building enhancements in the spring of 2016. In addition, he successfully added six additional sports to bring the total to 16 while collaborating to initiate a Master’s program in Sport Business Management – which added 20 graduate assistants to his staff.
McGuffi n oversaw six Mid-America Intercollegiate Athletics Association championship squads in his tenure at Missouri Western. That includes the Griffon football program winning its fi rst ever outright MIAA championship in 2012, a year where they also made the deepest postseason run in school history into the Division II quarterfi nals. The Missouri Western baseball team claimed its fi rst-ever MIAA title in 2013, the women’s basketball team won the MIAA regular season in 2015-16 while the Griffon softball program racked up three conference championships (2014 tournament, 2016 regular season, 2016 tournament) in McGuffi n’s tenure. Just this past season, the Missouri Western baseball team qualifi ed for the NCAA Tournament in back-to-back seasons (2016-17) for the fi rst time in program history while the Griffon softball program made it to their fourth straight NCAA Regional. The women’s golf program also saw freshman Chong Yong advance to the NCAA Championships, becoming the fi rst individual in school history to accomplish that feat.
McGuffi n also sustained previous successful programs and experienced growth in resources across the board at Missouri Western. He hired head coaches to lead the Griffon volleyball program to its highest win total since the mid-1990’s and earning the most MIAA victories in program history in 2014. The Missouri Western tennis squad also took a new direction under McGuffi n, resulting in its fi rst winning season in more than a decade in 2014-15. The Griffon soccer program has also shattered over 20 school records while making its fi rst ever postseason appearance in 2014 while the women’s golf program advanced to its fi rst ever NCAA Championship berth in 2016. As a direct result, McGuffi n led the Missouri Western charge into the top-100 in the Learfi eld Cup standings, elevating the program from its 287 ranking when he took over.
Facility improvements were also paramount in McGuffi n’s success at Missouri Western. He raised nearly $8 million for a total renovation of Spratt Memorial Stadium while also helping construct a state-of-the-art women’s soccer locker room and the Zack and Mary Workman Academic Success Center in 2014.
The upgrades to Spratt Memorial Stadium were instrumental in Missouri Western remaining as the summer home of the NFL’s Kansas City Chiefs since 2010. McGuffi n led the charge in 2014 as the Chiefs and Missouri Western announced an extension for St. Joseph as the sole training location through the 2017 season.
At Colorado, McGuffi n created and implemented a new annual giving program which increased total giving by 15 percent. He added over 600 new members in the fi rst year by establishing fundraising goals, implementing a new donor database, revamping the process of daily donations and planning special events. He also assisted with fundraising and development of a brand new $12 million sport court practice facility while taking part in a $1.5 billion university capital campaign.
In addition to his title as senior associate athletic director for external operations at Kansas State, McGuffi n also served as the associate athletic director for development, the assistant athletic director for annual giving and the assistant director of athletic development in his decade in Manhattan. He completed over $25 million in facility enhancements while also leading a $90 million “Changing Lives Campaign.” He also increased annual giving by 50 percent and endowments by over 70 percent.
McGuffi n was the sport administrator for the Wildcat men’s basketball, men’s and women’s golf and the men’s and women’s cross country/track and fi eld programs. He led the development and implementation of a department-wide strategic plan while overseeing all external units (including development, ticketing, marketing and communication) responsible for a revenue of over $28 million and budgets of $12 million.
McGuffi n led marketing campaigns that resulted in the largest football season-opening crowd in Kansas State history while also heading a sales group that sold out men’s basketball games in three out of four seasons. In his tenure, the Wildcat women’s basketball and volleyball programs were each in the top-10 nationally in attendance.
Before his fi rst full-time role in athletics administration at Idaho-Moscow, McGuffi n also was a graduate assistant for fundraising at Wichita State University, the director of men’s basketball operations at Eastern Washington University and the head men’s basketball student assistant at Kansas State.
McGuffi n is a proud member of the National Association of College Directors of Athletics (NACDA) and the National Association of Development Directors (NADD). He has also spent time on the NCAA Men’s Golf Ranking Committee and the NCAA Men’s Basketball Committee.
An Iola, Kan. native, McGuffi n graduated from Kansas State with a bachelor of science degree in education in 1996. He obtained his Master of Science degree in education from Wichita State in 1999. He is married to the former Jessica Whisler of Goodland, Kan. and the couple has three children – Bryce, Brett and Brea.
Kurt Kurt
MMCCGuffinGuffindirector of director of
intercollegiate athleticsintercollegiate athletics
2018 SKYHAWK BASEBALL2018 SKYHAWK BASEBALL 81
NOTABLE ALUMNI
• Dr. Margaret Perry (‘61) is chancellor emeritus of the University of Tennessee at Martin and was the fi rst female head of a Tennessee four-year college or university.
• Dr. Shirley Raines (‘67) is president of the University of Memphis.
• Dr. Nick Dunagan (‘68) is chancellor emeritus of The University of Tennessee at Martin.
• Houston Gordon (‘68) is a former UT Board of Trustees member and an attorney in Covington, Tenn.
• Dr. C. Pat Taylor (‘68) is president of Southwest Baptist University in Missouri.
• Lin Dunn (‘69) is the retired head coach for the Indiana Fever, winning a WNBA championship in 2012
• Leonard Hamilton (‘71) is head coach of the Florida State University men’s basketball team.
• Pat Summitt (‘74) is head coach emeritus of the eight-time national champion Lady Vols basketball team.
• Dr. Christy Shaffer (‘81) is president and CEO of Inspire Pharmaceuticals, Inc., in Durham, N.C.
• Stan Bell (‘85) is a well-known radio personality in Memphis.
• Jerry Reese (‘87, ‘88) won two Super Bowls as the senior vice president and general manager of the NFL’s New York Giants.
• •
• Charlie Neese (‘92) is a meteorologist at News Channel 5 in Nashville.
• Bill Rhodes (‘87) is the chairman, president and CEO of AutoZone.
• Tasha Blakney (‘96) is attorney and partner at Eldridge and Blakney, P.C., in Knoxville, Tenn.
• Trent Latta (‘98) is principal and COO at Structural Affi liates International, Inc., in Nashville, Tenn.
• Dr. Amanda Raley Lowery (’02) is the fi rst UT Martin engineering student to earn a doctoral degree and is a research associate in the Vanderbilt University Department of Biomedical Engineering.
–Jerry Reese
Two-Time Super Bowl ChampionFormer New York GiantsSenior VP and General Manager
Pat Head Summitt -Tennessee Lady Vols
Head Coach Emeritus
–Lin Dunn
Retired Indiana FeverHead Basketball Coach
Bill Rhodes -Auto Zone
Chairman, President and CEO
2018 UT MARTIN BASEBALL2018 UT MARTIN BASEBALL82
Above: Lester Hudson became the fi rst Skyhawk in history to be selected in the NBA Draft when he was drafted by the Boston Celtics in 2009. A two-time OVC Male
Athlete of the Year, he led the UT Martin men’s basketball team to its fi rst-ever OVC regular season championship in 2008-09. The only player in NCAA Division-I history to
accumulate a quadruple-double, he has suited up for the NBA’s Boston Celtics (2009-10), Memphis Grizzlies (2009-10, 2011-12), Washington Wizards (2010-11), Cleveland
Cavaliers (2011-12) and Los Angeles Clippers (2014-15) since graduating from UT Martin.
Above: Heather Butler became the fi rst player in UT Martin and Ohio Valley Conference history to play in the WNBA after signing with the San Antonio Stars. She left the Skyhawks as the program and conference’s all-time leading scorer with 2,865 career points, ranking 16th in NCAA history. Her 392 career 3-pointers tied the NCAA all-time record while scoring double fi gures in all 129 games
of her career, ranking as the second longest streak in history.
SKYHAWK ATHLETICSSKYHAWK ATHLETICS
Above: Freshman Ross Mitchell fi nished second nationally in team roping
at the 2017 College National Finals Rodeo, held in Casper, Wyo. He is the latest in a long line of high fi nishers for the UT Martin rodeo team, who was
the 2014 national champions in rodeo.
i UT M ti dAb Heather Butler became the first playth fi t l
Above: Skyhawk defensive lineman Montori Hughes became the 12th UT Martin football player to be drafted after going in the fi fth round at pick 139 overall to the Indianapolis Colts in
2013 and fi rst since 1996.
Right: The Skyhawks retained the annual Sgt. York Trophy presented by Delta
Dental for the third consecutive year. It marks the fi rst time that UT Martin has held
the series trophy for three straight years dating back to 2014.
2018 SKYHAWK BASEBALL2018 SKYHAWK BASEBALL 83
Volleyball (2001)Volleyball (2001)
Volleyball (2002)**Volleyball (2002)**
Women’s Tennis (2005)Women’s Tennis (2005)
Football (2006)Football (2006)
Women’s Tennis (2006)Women’s Tennis (2006)
Men’s Basketball (2009)Men’s Basketball (2009)
Softball (2009)*Softball (2009)*
Soccer (2009)Soccer (2009)
Softball (2010)Softball (2010)
Women’s Basketball (2011)*Women’s Basketball (2011)*
Women’s Tennis (2011)Women’s Tennis (2011)
Soccer (2011)*Soccer (2011)*
Women’s Basketball (2012)**Women’s Basketball (2012)**
Softball (2012)**Softball (2012)**
Soccer (2012)**Soccer (2012)**
Women’s Basketball (2013)*Women’s Basketball (2013)*
Soccer (2013)Soccer (2013)
Women’s Basketball (2014)**Women’s Basketball (2014)**
Women’s Basketball (2015)Women’s Basketball (2015)
Women’s Basketball (2016)Women’s Basketball (2016)
Women’s Tennis (2016)Women’s Tennis (2016)
Men’s Golf (2016)*Men’s Golf (2016)*
*OVC Tournament Championship*OVC Tournament Championship**Team Won OVC Regular-Season **Team Won OVC Regular-Season
and Tournament Titlesand Tournament Titles
Above: Hunter Richardson became the fi rst player in UT Martin history to win back-to-back medalist honors with a tournament title at the 2017 Ohio Valley Conference Golf Championships, earning his second NCAA Tournament berth.
Above: Speedster Ann Asipan became just the fi fth athlete in Ohio Valley Conference history to win back-to-back Athlete of the Championship and individual medalist
honors at the 2017 OVC Cross Country Championships.
2018 UT MARTIN BASEBALL84
Olympic sport student-athletes train in the recently updated Fieldhouse weight room and adjacent multi-purpose room known as “the blue room” The 3,500 square foot weight room’s renovation is highlighted by the Ecore Beast fl ooring that includes fi ve inlay platforms highlighting UTM. In addition, updates included new Hammer Strength equipment, Eleiko barbells and a nutrition area to help support each Skyhawk athlete’s development. Continued upgrades are ongoing to provide UT Martin student-athletes the best possible environment to compete for championships and develop
positive habits to live a healthy active lifestyle.
Mission Statement
The mission of the UTM Skyhawk Strength and Conditioning program is to maximize the potential of the Student-Athletes by teaching work ethic, team values, discipline, and leadership.
The number one goal is to create a safe environment for the Student-Athletes to excel at their sport though scientifi cally based strength and conditioning programs.
The Training programs are designed to increase the Athlete's strength, speed, agility, fl exibility, conditioning, and explosiveness – all components in developing a complete collegiate athlete.
strength and
OlO ic t tudent- thl t trai in thhe ntll u d t dOlOO ymmympip c sppporoo t student-ata hlete esee trainn iin the rer cec ntlyy updatedede FFFiieleldhdhd ouusee weiee ght ror omo and adjaca enent mumm lti-purpose roroooom kkknknknowownn asa “the blb ue room” Thee 3,500 squq are fooootototott wwwwwwweieieieieie ghghght t trrooomom’s’s renovo atioon is highlightede by y tht e Eccccorororororee ee e e BeBBeBBeBeasasasst ttt fl fl flflooooooriririingngng tthhhataa iincnn ludees fi fivev inlay platforo ms hhhhigigigigigggghlhhlhlhlhlh igigigigighththttinining g gg UTUTUTU M.M.M.M IIIn n n adadada dididiitititiononononn,,,uuuupupdadad tetes includudeded nneww HHHammmmmamammemememm r rr r StStStrererengngngththth eeequququipipipmemementntntn ,,, ElElEleieieie kokokokok bbababarbbelee lsls aaandndd aaaa nnnnututututririrititititionononn aaarerereaaa tototo hhhhelelelelelelpppp p sususususus pppppporororoo tt t eaeaeachchchch SSSSkykykkykyhahahaaawkwkwkwkwkwkwk aaattathlhlhletetetete’e’e’e sss s deded veveloloopmmpmmenenene t.t.t. CCCononontititinunun eded uupggpgraaaaaradededeedededesssss ararare e e ee ononononngogogogog ininninininingggggggtttoto pproroviviideded UUT T MaMaMaartrttrtinininin ssstututudededentntn -a-a-aththhleeeteteesss thththeee bebebeststststststst ppppppposososossisisis blblblllb e e e eeenenviviroronmnmenenee t t t totot ccccomomommpepepep tetete fffororor ccchahahampmpmpioioionsnsnshihihipspsps aaandndnd dddevevevvelelelllelele opopopopopopopp
poposisititiveve hhabbabitititi sss tototo lllivivivveee aaa heheheh alalalthththy y y acacactititiveveve lllifififesesestytytyt lelelele...
MMMMMMMMMMiissssiioonnn SStttttttttaatteeemmmmmmmeeeeennnnttttMMMMMMMMMMiiiiiiissssssssssssiiiiiooooooooonnnn SSSSSSttttttttttaaattteeemmmmmeeeeeeeennnnnnnntttttttt
ThThThThThThThThThe ee eeeeeee mimimimimimimimimimm ssssssssioioioioioooooonnnnnnnnn fffffoffofoff ttttttttthehehehheheheheheheheh UUUUUUUUUUUUTMTTMTMTMTMTMTMTMTMTTM SSSSSSkyhahaahahahahahahaawkwkwkwkwkwkwkwkwkwkww SSSSSSStrtrtrtrtrtrtrrenenenenenenennnengggtgtgtgtgtgtg hh h anana ddd CoCoCoooooooondnndndndndndnnditititititititititioioioioioioioioioioniningng ppppprororororororrogrgrgrggggggg amamammmmmmmm iiis totoototototototo mmmmmmmmmmaxaxaxaxaxaxaxaxaxaxximimimimimimimimimimizizizizizizizizizizeeeeeeeeee thtttttttt e potetetetetetetetentnnnnnnnn iallloooooooofofof thehehehehehehhehe SSSSSSSSSStutututututututututudedededededeedededeentntntnttntntntntntnt-Athletes byb tteaeaaaaaaachchchchchchhhhhhiininii gg g wowowowowoww rkrkrkrkrkkrkrk eethic, teteteteteeeamaaaamamamammam vvvvvvvvvvvaaaaalalaaaa ueues,s, dddddddddiisisiiiiii ciciiicicicici lllllplplplininininininininininee,e,e,e,e,e,ee,e, aaaaaaandndnnnn lleaeaaaaaaeaadededededededeededed rsrsrsrsrsrsrsrsrship.
TTTTheheheheheheeheh nnnnnnnnnnumumumummmmbbebebebebeb rrr r rr ononononononeeeeee gogogogogog lllalalalalalal iiiiiiiiis s s ttottototototot ccccccccrerereeeeeatatatatatatatatatatee e eeeeeee aaaaaaaaa sasasasasasasasasaafefefefefefefefeefe eeeeeeeeeenvnvnvnvnvnvnvn irirononooonoo memememememmm nnntntntntntnt fforor ttheheheheheeee SSSSSSSSSStutututututututuuudedededededededededentntntntntntntntntnt-A-A-A-A-A-A-A-A-A-Athtththththththththleleleeeteteteteeeeetessssssssss too eeexcel at their ssspspppps oooorrroroo t t t ththththththththououououououuuoougghghhghhhhg ssssssssciciciciciccc eneneentitiitiifi fi fi fi fi cacacallllllly y y babababaseseseseseddddd ststststststtrerererererererengngngngnggggngth andndndndddddd ccccccccononononnondidididididididid tititittitititit ononononononnononniniinininggggg prprprprprrprrogogogogogogogogogogrararararararararaamsmsmsmsmsmsmsmm .
ThTThThThThThThTThe eeeeeeeeee TrTrTrTrTTTrTTT aiaiaiaaaaaaaa ninininnininninn ngngngngngngngggng ppppppppprorororoooooooggrgrgrgrgrgramamamamamamaamaa sssss sss ararararaaaraaraararare eeeeeee dedededededededesisisigngngngngngnggngng edededededeedeededed tttto ooo inininiinininii crcrcrcrcrcrcrcrcrrreaeaeaeeaeaaaasesesesesee ttheheheheeeeeeee AAAAAAAAAAAththththththththththththleleleleeeeeeeteteteteteteeteet 's'ssss ssstrttrttttrenenenenenenennene gtgtgtgtgtgtgtgtgtgth,h,h,h,h,h,h,h,h,h ssssssspepepepepepeeepeedededededededededed,,,,, agagagagggagaggggagilllllllllititttttty,y,y,y,y flflflflfleeeeexixixixixibibibibibilililililitytytytytyy,ccccccccococococococoocoocondndndnnddditioioioioninininingngngng, anananand explp ossossiiiivennnness –––––––––– allllllllll lllll cocococcoompmpmppmpmpmpmpm onononnononnnenenenenee tst iiiiiiin nnn dedededededededededevevevellololooooopipipipipp ngngngg aaaa ccccomomommmmmmmmplplplplplplplplplpleeetete eeee e ee cocococococococooolllllllllllllllegegegegegegegegegegeggiaaaaaaaatetetetete aaaathththtthhleleleleeteteteettetetetee....
2018 SKYHAWK BASEBALL 85
conditioning
National Strength and Conditioning Association
All-Americans
2015 Renate Meckl, Softball 2017 Carly Gonzales, Softball
2018 UT MARTIN BASEBALL2018 UT MARTIN BASEBALL86
OVC COMMISSIONER’S HONOR ROLL
THE OVC COMMISSIONER’S HONOR ROLL IS PRESENTED ANNUALLY TO STUDENT-ATHLETES WHO HAVE AT LEAST A 3.25 GPA AND WHO HAVE BEEN ELIGIBLE AND ON THE TEAM THROUGHOUT THE COMPETITIVE SEASON IN THEIR CHOSEN NCAA-SPONSORED SPORT OR SPORTS. SINCE JOINING THE OVC IN 1992, A TOTAL OF 1,645 UT MARTIN STUDENT-ATHLETES
HAVE BEEN NAMED TO THE PRESTIGIOUS LIST.
Year Total 1993-94 48 1994-95 62 1995-96 68 1996-97 41 1997-98 38 1998-99 52 1999-00 50 2000-01 58 2001-02 65 2002-03 82 2003-04 81 2004-05 78
Year Total
2005-06 81 2006-07 81 2007-08 85 2008-09 73 2009-10 70 2010-11 93 2011-12 114 2012-13 116 2013-14 109 2014-15 1002015-16 832016-17 116
1994-95 ANNA DAVIS WOMEN’S TENNIS CAROLINE GROVES WOMEN’S TENNIS1996-97 KLAS BRUNSKOG MEN’S TENNIS ANGELA OLSEN WOMEN’S TENNIS1997-98 ARTHUR CASTLE MEN’S BASKETBALL2001-02 KELLY PENDLETON WOMEN’S BASKETBALL2002-03 RACHEL AHLERS VOLLEYBALL2004-05 BRADY WAHLBERG FOOTBALL2005-06 CHAD MCMAHAN FOOTBALL2007-08 ANDREY YESIPOV MEN’S TENNIS2008-09 JAMIE FURSTENBERG SOCCER2009-10 CODY TERRY BASEBALL2010-11 JENNA MILLER VOLLEYBALL2011-12 LEAH TAYLOR SOFTBALL2012-13 HEATHER BUTLER WOMEN’S BASKETBALL2014-15 BEN REEVES GOLF KATIE SCHUBERT WOMEN’S BASKETBALL2016-17 JOE MARTIN RIFLE
OVC ACADEMIC AWARDS
Year Total
1993-94 4 1994-95 4 1995-96 8 1996-97 8 1997-98 7 1998-99 5 1999-00 72000-01 6
Year Total
2001-02 72002-03 122003-04 11
2004-05 72005-06 82006-07 9
2007-08 132008-09 8
Year Total
2009-10 122010-11 152011-12 162012-13 172013-14 222014-15 162015-16 82016-17 20
UT MARTIN SCHOLAR ATHLETES
AWARDED EACH FALL (BUT BASED ON THE PRIOR YEAR’S ACHIEVEMENTS), THE OVC SCHOLAR-ATHLETE AWARD IS THE HIGHEST INDIVIDUAL HONOR THAT CAN BE EARNED BY OVC STUDENT-ATHLETES AND IT IS GIVEN ANNUALLY TO THREE MEN AND THREE WOMEN OF JUNOR OR SENIOR STATUS WHO HAVE ACCOMPLISHMENTS IN BOTH THE CLASSROOM AND ATHLETIC ARENA, AS WELL AS LEADERSHIP QUALITIES.
OVC MEDAL OF HONOR
THE OVC MEDAL OF HONOR IS GIVEN ANNUALLY TO THE STUDENT-ATHLETE(S) WHO ACHIEVE THE HIGHEST GPA (4.0) IN A CONFERENCE-SPONSORED SPORT. SINCE JOINING THE OVC IN 1992, UT MARTIN STUDENT-ATHLETES HAVE CLAIMED 222
MEDALS OF HONOR.
2018 SKYHAWK BASEBALL2018 SKYHAWK BASEBALL 87
BASEBALL FACILITIES
2018 UT MARTIN BASEBALL2018 UT MARTIN BASEBALL88
Date Time Opponent Feb. 16 6 p.m. AT TROY
Feb. 17 1 p.m. AT TROY (DH) Feb. 18 1 p.m. AT TROY
Feb. 23 1 p.m. AT ARKANSAS-PINE BLUFF
Feb. 24 1 p.m. AT ARKANSAS-PINE BLUFF
Feb. 25 1 p.m. AT ARKANSAS-PINE BLUFF
Feb. 28 4 p.m. AT LIBSCOMB
March 2 3 p.m. Cincinnati March 3 Noon Cincinnati (DH) March 4 noon CINCINNATTI March 9 3 p.m. AT TENNESSEE TECH^ March 10 2 p.m. AT TENNESSEE TECH^ March 11 1 p.m. AT TENNESSEE TECH^ March 13 6 p.m. AT UNION
March 16 6 p.m. SOUTHEAST MISSOURI^ March 17 3 p.m. SOUTHEAST MISSOURI^ March 18 1 p.m. SOUTHEAST MISSOURI^ March 20 6 p.m. AT EVANSVILLE
March 23 4 p.m. AT BELMONT^ March 24 2 p.m. AT BELMONT^ March 25 1 p.m. AT BELMONT^ March 29 6 p.m. EASTERN KENTUCKY^ March 30 6 p.m. EASTERN KENTUCKY^ March 31 2 p.m. EASTERN KENTUCKY^ April 3 4 p.m. LIPSCOMB April 6 4 p.m. AT MOREHEAD STATE^ April 7 1 p.m. AT MOREHEAD STATE^ April 8 Noon AT MOREHEAD STATE^ April 10 5:30 p.m. AT TENNESSEE
April 11 3 p.m. AT TENNESSEE
Date Time Opponent April 13 6 p.m. AT CENTRAL ARKANSAS
April 14 4 p.m. AT CENTRAL ARKANSAS
April 15 1 p.m. AT CENTRAL ARKANSAS
April 17 6 p.m. UNION April 20 6 p.m. SIUE^ April 21 3 p.m. SIUE^ April 22 1 p.m. SIUE^ April 24 6 p.m. CHRISTIAN BROTHERS April 27 6 p.m. AT AUSTIN PEAY^ April 28 4 p.m. AT AUSTIN PEAY^ April 29 1 p.m. AT AUSTIN PEAY^ May 4 6 p.m. EASTERN ILLINOIS^ May 5 3 p.m. EASTERN ILLINOIS^ May 6 1 p.m. EASTERN ILLINOIS^ May 8 6 p.m. EVANSVILLE May 11 6 p.m. AT JACKSONVILLE STATE^ May 12 1 p.m. AT JACKSONVILLE STATE^ May 13 1 p.m. AT JACKSONVILLE STATE^ May 15 6:30 p.m. AT MEMPHIS
May 17 6 p.m. MURRAY STATE^ May 18 6 p.m. MURRAY STATE^ May 19 3 p.m. MURRAY STATE^ May 23-26 TBA OVC Tournament+
All times are CST and subject to changeHOME GAMES IN ORANGE AND ALL CAPS#+ Choccolocco Park - oxford, ala.
*^ Ohio Valley Conference Game
2018 Baseball Schedule2018 Baseball Schedule