User Guide for the Transgenomic SURVEYOR Mutation Detection …pharmatech.co.kr/htm/main/download.php?user_file=129... · SURVEYOR Mutation Detection Kit Components The kit is available

www.transgenomic.com

User Guide for the Transgenomic SURVEYOR® Mutation Detection Kit

for Universal PrimerFluorescent Capillary Electrophoresis

For Research Use Only

the Power of Discovery® ®

A Decade of Discovery 1997-2007®

Contents
Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 1
SURVEYOR Mutation Detection Kit Components . . . . . . . . . . . . . . . . . . . . . . . . 2

Detecting Mutations with the Transgenomic SURVEYOR Mutation Detection Kit . . . . . . 3An Overview . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 3Examples of Results . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 4

Factors Affecting the Quality of Results . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 9Signal . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 9Noise (Background) . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 9Signal/Noise . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 10

Preparation of Genomic DNA . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 10

Step-by-Step Instructions Detecting Mutations with SURVEYOR Nuclease . . . . . . . . . 11Step 1 — PCR Amplification of Reference and Test Samples . . . . . . . . . . . . . . . . 11

Amplification of Homogeneous DNA Populations . . . . . . . . . . . . . . . . . . . . 12Amplification of Heterogeneous DNA Populations . . . . . . . . . . . . . . . . . . . . 12Using Universal Fluorescent Primers . . . . . . . . . . . . . . . . . . . . . . . . . . . 12Preparing PCR Products . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 16

Step 2 — DNA Hybridization . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 19Performing Heteroduplex Formation using a Thermocycler . . . . . . . . . . . . . . . . 20Performing Heteroduplex Formation without a Thermocycler . . . . . . . . . . . . . . 20

Step 3 — Treatment with SURVEYOR Nuclease . . . . . . . . . . . . . . . . . . . . . . 20Step 4 — Analysis of DNA Fragments . . . . . . . . . . . . . . . . . . . . . . . . . . . . 21

Fragment Analysis . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 21Instrument Calibration . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 22

Notes on Software Use for Fragment Analysis . . . . . . . . . . . . . . . . . . . . . . . . . . 23

Control Experiments — Using Control FT-G and Control FT-C Plasmid DNA . . . . . . . 23

Appendix A: Troubleshooting . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 28Problem 1 – Low PCR yield or no PCR product using Standard PCR with FKS and TPB Primers . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 28Problem 2 – Multiple PCR products using Standard PCR with FKS and TPB Primers . . . 28Problem 3 – No cleavage products observed upon analysis after SURVEYOR Nuclease treatment of known heteroduplex . . . . . . . . . . . . . . . . . . 29Problem 4 – High background after SURVEYOR Nuclease Treatment . . . . . . . . . . . 29

Appendix B: T4D-FTHR Matrix Standards User Guide . . . . . . . . . . . . . . . . . . . . 30Preparation of Matrix Standards for Use . . . . . . . . . . . . . . . . . . . . . . . . . . . 30Generating a Matrix Standards File . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 31

Appendix C: Reagent Master Mix Calculation Chart . . . . . . . . . . . . . . . . . . . . . . 35Outer PCR of Nested PCR Protocol . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 35Standard PCR Protocol and Inner PCR of Nested PCR Protocol . . . . . . . . . . . . . . . 35

Appendix D: Quick Guide – Nested PCR Version . . . . . . . . . . . . . . . . . . . . . . . . 37

Appendix E: Quick Guide – Standard PCR Version . . . . . . . . . . . . . . . . . . . . . . . 39

References . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 41

Product Information . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 44

US Technical Support US: 888-233-9283 Europe Technical Support: +33 1-30-68-90-00 i

ii US Technical Support US: 888-233-9283 Europe Technical Support: +33 1-30-68-90-00

IntroductionTransgenomic SURVEYOR® Mutation Detection Kits use a mismatch-specific plant DNAendonuclease to scan for known and unknown mutations and polymorphisms in heteroduplex DNA.SURVEYOR Nuclease, the key component of the kit, is a member of the CEL family of plantendonucleases that cleave DNA with high specificity at sites of base-substitution mismatch and otherdistortions1, 2. These DNA endonucleases cut both strands of a DNA heteroduplex on the 3’-side of themismatch site3, 4. Insertion/deletion mismatches and all base-substitution mismatches are recognized,but the efficiency of cleavage varies with the sequence of the mismatch 1, 4.

CEL DNA endonucleases from celery have been used to detect accurately a variety of mutations andpolymorphisms in the human BRCA1 gene1-2, 5. Other applications include high-throughput screeningof induced point mutations (TILLING) in Arabidopsis6-8, wheat9, maize10, Lotus11, Drosophila12,zebrafish13,14, and mouse embryonic stem cell clones15, screening for SNPs in inbred rat strains16,human cells17, and plants18, and scanning of large regions of bacterial genomic DNA for mutations andpolymorphisms (GIRAFF)3, 19.

SURVEYOR Nuclease has been used to verify the presence of known mutations in a number of genesin human peripheral blood DNA20.

SURVEYOR Nuclease has also been used to screen for:

• SNPs in the sugar cane plant21;

• induced point mutations in barley22;

• mutations in drug-resistant genes of M. tuberculosis23;

• germline mutations in the human ATRX gene24;

• mtDNA mutations in patients with respiratory chain defects25,36; and

• somatic mutations in the EGFR gene in human tumors26-29, in the JAK2 tyrosine kinase gene inpatients with myeloproliferative disorders30,31 and in a variety of genes in patients undergoingradiotherapy32 ; and

• error-free clones generated from a plant cDNA library by PCR-based cloning33.

All members of the CEL nuclease family of plant DNA endonucleases have 5’ exonuclease activity thatattacks the ends of double-stranded DNA, leading to the loss of signal with 5’ end-labeled substrates34.In assay design, a tradeoff must be made between cutting potential mismatches to completion andremoval of 5’-end label. This places tight constraints on the reaction conditions used to digest 5’ end-labeled substrates; in particular, the amount of enzyme used must be limited. The SURVEYORNuclease Universal Primer Fluorescent Capillary Electrophoresis Kit removes this constraint throughthe use of Universal Fluorescent Primers for PCR to generate fluorescently labeled DNA fragments forSURVEYOR Nuclease digestion. In contrast to a fluorophore located at the 5’ end of a PCR primer, thefluorophores in the Universal Fluorescent Primers are resistant to removal by SURVEYOR Nuclease.This greatly increases the sensitivity and robustness of mutation detection with fluorophore-labeled substrates.

The SURVEYOR Mutation Detection Kit for Universal Primer Fluorescent Capillary Electrophoresishas been designed to digest DNA amplified with Universal Fluorescent Primers (included in the kit),labeled with either fluorescein or TAMRA™, for subsequent analysis by fluorescent capillary electro-phoresis using an ABI PRISM Genetic Analyzer.

1US Technical Support US: 888-233-9283 Europe Technical Support: +33 1-30-68-90-00

SURVEYOR Mutation Detection Kit ComponentsThe kit is available in three sizes:

• 32-Reaction Kit (Catalog No. 706101)

• 96-Reaction Kit (Catalog No. 706102)

• 384- Reaction Kit (Catalog No. 706103)

Store all components at –20 ºC.Store T4D-FTHR Matrix Standards at 2-8 ºC upon receipt.

Universal Fluorescent Primer labeled with fluorescein (FKS Primer) and Universal Fluorescent Primerlabeled with TAMRA (TPB Primer) are included in the 32-reaction, 96-reaction and 384-reaction kit toperform 40, 120 and 480 PCR reactions, respectively.

The FKS Primer sequence (KS) from the 5’ end is: 5’-TCGAGGTCGACGGTATCGAT-3’.

The TPB Primer sequence (PB) from the 5’ end is: 5’-TGACGAGTAGACGCTGGTAG-3’.

T4D-FTHR Matrix Standards are also included in the 32-reaction, 96-reaction and 384-reaction kitsufficient to calibrate 32, 96 and 96 capillaries, respectively, in ABI PRISM Genetic and DNAAnalyzers (see Appendix B).

Additional T4D-FTHR Matrix Standard (sufficient to calibrate 32 capillaries) can be ordered separatelyusing catalogue number, 560101.

TO USE THIS KIT SUCCESSFULLY, WE STRONGLY RECOMMEND THAT YOU READTHIS MANUAL THOROUGHLY, AND CAREFULLY FOLLOW THE INSTRUCTIONS ANDGUIDELINES PROVIDED. FIRST TIME USERS SHOULD PERFORM THE CONTROLEXPERIMENTS OUTLINED IN THE SECTION ON USING CONTROL FT-C ANDCONTROL FT-G PLASMID DNA.

If you have further questions or need assistance, please contact Transgenomic Technical SupportHotline/Help Desk:

US – Toll Free (888) 233-9283 or 402-452-5400

UK – +44 1670-732-992

Europe – +33 1-30-68-90-00

Technical Support E-mail: [email protected] or [email protected]

Component 32-Reaction Kit (706101)

96-Reaction Kit (706102)

384-Reaction Kit (706103)

Amount Provided Amount Provided Amount Provided

SURVEYOR Nuclease L

0.035 mL 3 x 0.035 mL 2 x 0.2 mL

Stop Solution 0.25 mL 0.25 mL 3 x 0.25 mLControl FT-C 0.02 mL 0.02 mL 0.02 mLControl FT-G 0.02 mL 0.02 mL 0.02 mLFKS Primer; 9 nmoles/mL

0.05 mL 3 x 0.05 mL 3 x 0.2 mL

TPB Primer; 9 nmoles/mL

0.05 mL 3 x 0.05 mL 3 x 0.2 mL

T4D-FTHR Matrix Standards

0.035 mL 3 x 0.035 mL 3 x 0.035 mL

2 US Technical Support US: 888-233-9283 Europe Technical Support: +33 1-30-68-90-00

Because of restrictions imposed by the technology used to synthesize Universal Fluorescent Primers,the primers are not available presently labeled with other fluorophores. For mutation detection in DNAfragments labeled at the 5’ end with other fluorophores, Transgenomic offers two other SURVEYORNuclease mutation detection kits listed in Table 1.

Table 1. SURVEYOR Nuclease Mutation Detection Kits for Digestion of DNA Labeled at 5’ Ends with Fluorophore

Detecting Mutations with the Transgenomic SURVEYOR Mutation Detection Kit

An OverviewMutation detection and confirmation with SURVEYOR Nuclease involves four steps:

Step 1 - Prepare fluorescently labeled PCR amplicons from mutant (test) and wild-type (reference)DNA.

Step 2 - Mix equal amounts of test and reference DNA; hybridize them by heating and cooling themixture to form hetero- and homoduplexes.

Step 3 - Treat the annealed heteroduplex/homoduplex mixture with SURVEYOR Nuclease. Thereference DNA alone, treated similarly, serves as a background control.

Step 4 - Analyze the DNA fragments by fluorescent capillary electrophoresis. The formation of newcleavage products indicates the presence of a mutation, while their size and color (fluorescent tag)indicate the location.

The combination of these four steps is outlined in the flow chart in Figure 1.

Figure 1. A schematic representation of mutation detection using SURVEYOR Nuclease.

Primers Separation Platform SURVEYOR Nuclease Mutation Detection Kit

5’-end labeled with ABI dyes FAM™, NED™, HEX™, VIC®, TET™ or PET®

ABI PRISM Genetic Analyzers For Fluorescent CE (#706010; #706015)

5’-end labeled with WellRED dyes

Beckman CEQ8000 CE Systems

For Fluorescent CE (#706010; #706015)

5’-end labeled with IRDyes® LI-COR 4200 and 4300 PAGE Instruments

For LI-COR 4200 and 4300 Instruments (#706000; #706005)

5’-end labeled with ET Dyes Amersham MegaBACE™ CE Systems

For Fluorescent CE (#706010; #706015)


Examples of ResultsExamples of results obtained using the SURVEYOR Mutation Detection Kit for Universal PrimerFluorescent Capillary Electrophoresis are shown in Figures 2 to 5 below. In the examples, the four-stepprocess outlined in the flowchart on the previous page was followed carefully except that in Figures 2to 4 genomic DNA samples were self hybridized and not cross hybridized with control DNA.

SURVEYOR Nuclease L in combination with an ABI PRISM capillary electrophoresis system can beused to identify single and multiple mutations in fragments <800 bp long. Insertions/deletions and anysingle-base mismatch can be identified and the position of the genetic variation relative to the ends ofthe PCR fragment can be determined. Figure 2 shows SURVEYOR Nuclease applied to the detectionof somatic mutations in an exon of the VHL gene in six different kidney tumor genomic DNA samples.The locations of a variety of point mutations were ascertained and deletions of 8 and 17 bp weredetected. Note that when a deletion of sufficient size was present, two undigested, double-labeledhomoduplex peaks were observed instead of one, and two closely spaced cleavage fragments wereproduced labeled with FKS Primer (fluorescein in blue) and two were produced labeled with TPBPrimer (TAMRA in red). Cleavage product doublets were present because cutting by SURVEYORNuclease at a mismatch produced by a deletion produces fragments with a single-stranded 3’-OHoverhang and fragments missing the overhang.

Note also the background peaks located next to the undigested homoduplex peak in the control sample,as well as in some of the other samples. These peaks are related to capillary overloading. They tend toincrease in intensity as the concentration of the DNA substrate increases and as the size of the substratedecreases (see Figure 3). At a given DNA concentration, a smaller DNA is more efficiently injectedthan a larger DNA, increasing the possibility of overloading.

Figure 3 shows SURVEYOR Nuclease applied to the detection of somatic mutations in a differentVHL gene exon in five different kidney tumor genomic DNA samples. The location of a point mutationwas ascertained, a single-base pair insertion and a 64-bp insertion were detected and 4-bp and 5-bpdeletions were mapped. Note that the digestion products from the very large insertion in sample #9were a cross-section of sizes as the result of SURVEYOR Nuclease attacking the large single-strandedregion present in the heteroduplex at the mismatch site. Note also that the intensities of the backgroundpeaks near the homoduplex peak in all samples were much greater for this substrate (302 bp) than forthe substrate (535 bp) in Figure 2, reflecting more capillary overloading from the smaller substrate.

Mutations can also be found in a background produced by the presence of multiple SNPs. Figure 4shows SURVEYOR Nuclease applied to the detection of germ-line mutations in two overlappingregions of an exon in four genomic DNA samples. Region 1 contained three SNPs and one of these,G>T at 496 bp from the upstream end, was also present in region 2, 124 bp from its upstream end (seethe digestion patterns of Sample #7 DNA in Figure 4). In spite of this background, a G>A germlinemutation at 323 bp in region 1 of Sample # 11 DNA was detected. A 10-bp insertion was detected inregion 2 of Sample #2 DNA starting 503 bp from the upstream end of the amplicon. Again note thatwhen an insertion of sufficient size was present, two undigested, double-labeled homoduplex peakswere produced instead of one, and two closely spaced cleavage fragments were produced labeled withFKS Primer (fluorescein in blue; 503 and 513 bp) and two were produced labeled with TPB Primer(TAMRA in red; 105 and 115 bp). Cleavage product doublets were present because cutting bySURVEYOR Nuclease at a mismatch produced by an insertion produces fragments with a single-stranded 3’-OH overhang and fragments missing the overhang.


Figure 2. SURVEYOR Nuclease digestion products of fluorescently labeled amplicons derived froma VHL gene exon in a normal control DNA (K562 cell line) and six kidney tumor genomic DNAs.The 535-bp amplicons were PCR amplified with Maximase™ Polymerase in nested PCR and labeled inthe second round of PCR with FKS Universal Primer at the upstream end (blue color) and TPBUniversal Primer at the downstream end (red color). Each amplified DNA was self hybridized andapproximately 250 ng of the unpurified amplicon DNA in 5 µL of PCR product mix were digested byadding 1 µL of SURVEYOR Nuclease L directly to the mix, incubating this digestion reaction for 20 minat 42 °C, and adding 1 µL of Stop Solution. An aliquot (1 µL; 38 ng) of digestion mixture was mixedwith 8.5 µL of HiDi formamide and 0.5 µL of ROX™ size standard and digestion products wereanalyzed by capillary electrophoresis on an ABI PRISM 3100 Genetic Analyzer. Samples #1, #4, #5 and#14 had point mutations 410 (T>C), 380 (T>A), 438 (G>C) and 192 bp (C>T) from the upstream endof the amplicon, respectively. Double-labeled undigested homoduplex DNA in sample # 12 wasseparated into two different size populations and one population was smaller in size than full lengthamplicon, suggesting the DNA contained a deletion mutation. Cleavage of heteroduplexes in sample#12 by SURVEYOR Nuclease produced two pairs of digestion products that indicated an 8-bp deletionwas present starting 377 bp from the upstream end. Sample #13 contained a larger deletion of 17 bpstarting 326 bp from the upstream end of the amplicon. The identity was determined and the positionwas confirmed of each mutation by DNA sequencing. Numbers indicate fragment sizes.

Control

#1

#4

#5

#12

#13

#14

535

410125

380155

43897

527 535385377150 158

535518343326

192 209

343192

Control

#1

#4

#5

#12

#13

#14

535

410125

380155

43897

527 535385377150 158

535518343326

192 209

343192

#1

#4

#5

#12

#13

#14

535

410125

380155

43897

527 535385377150 158

535518343326

192 209

343192


Figure 3. SURVEYOR Nuclease digestion products of fluorescently-labeled amplicons derived froma VHL gene exon in a normal control DNA (K562 cell line) and five kidney tumor genomic DNAs.The 302-bp amplicons were PCR amplified with Maximase Polymerase in nested PCR and labeled inthe second round of PCR with FKS Universal Primer at the upstream end (blue color) and TPBUniversal Primer at the downstream end (red color). Each amplified DNA was self hybridized andapproximately 250 ng of the unpurified amplicon DNA in 5 µL of PCR product mix were digested byadding 1 µL of SURVEYOR Nuclease L directly to the mix, incubating this digestion reaction for 20 minat 42 °C, and adding 1 µL of Stop Solution. An aliquot (1 µL; 38 ng) of digestion mixture was mixedwith 8.5 µL of HiDi Formamide and 0.5 µL of ROX size standard and digestion products were analyzedby capillary electrophoresis on an ABI PRISM 3100 Genetic Analyzer. Sample #16 had a pointmutation 165 bp (T>A) from the upstream end of the amplicon. Sample #9 contained a 64-bp insertion152 bp from the upstream end of the amplicon, producing an additional double-labeled homoduplexpeak well separated from the 302-bp peak. The large single-stranded regions in the heteroduplexeswere apparently attacked by SURVEYOR Nuclease, producing fragments with a cross-section ofdifferent sizes. Sample #19 had a single-base insertion 200 bp from the upstream end of the amplicon.Samples #24 and #25 had a 4-bp deletion and a 5-bp deletion 158 bp and 157 bp from the upstream endof the amplicon, respectively. The identity was determined and the position was confirmed of eachmutation by DNA sequencing. Numbers indicate fragment sizes.

Control

#9

#16

#19

#24

#25

302

302366

165137

200

102

302298

302297

158/162140/144

157/162140/145

Control

#9

#16

#19

#24

#25

302

302366

165137

200

102

302298

302297

158/162140/144

157/162140/145


Figure 4. SURVEYOR Nuclease digestion products of fluorescently-labeled amplicons derived fromoverlapping regions of an exon in a control DNA and three human genomic DNA samples. The 621-bp and 608-bp amplicons from regions 1 and 2, respectively, were PCR amplified with MaximasePolymerase in nested PCR and labeled in the second round of PCR with FKS Universal Primer at theupstream end (blue color) and TPB Universal Primer at the downstream end (red color). Eachamplified DNA was self hybridized and approximately 250 ng of the unpurified amplicon DNA in 5 µLof PCR product mix were digested by adding 1 µL of SURVEYOR Nuclease L directly to the mix,incubating this digestion reaction for 20 min at 42 °C, and adding 1 µL of Stop Solution. An aliquot (1µL) of digestion mixture was mixed with 8.5 µL of HiDi Formamide and 0.5 µL of ROX size standardand digestion products were analyzed by capillary electrophoresis on an ABI PRISM 3100 GeneticAnalyzer. The control DNA contained no genetic variations. Sample #7 was heterozygous for threeSNPs located 496 (G>T), 283 (C>G) and 129 bp (C>T) from the upstream end of the region 1amplicon, respectively. Region 2 in sample #7 contained the G>T SNP 124 bp from the upstream end ofthe amplicon. Sample #11 had the same SNP background as sample #7 in region 1, but a point mutationwas also detected 323 bp (G>A) from the upstream end of the amplicon. Sample #2 also had the sameSNP background as sample #7 in region 2. In addition, double-labeled undigested homoduplex DNA insample # 2 could be separated into two different size populations and one population was larger in sizethan full length amplicon, suggesting the DNA contained an insertion mutation. Cleavage ofheteroduplexes in sample #2 by SURVEYOR Nuclease produced the expected digestion products fromthe SNP (124 + 484 bp) and two additional pairs of digestion products that indicated a 10-bp insertionwas present starting 503 bp from the upstream end of region 2. The identity was determined and theposition was confirmed of each variation by DNA sequencing. Numbers indicate fragment sizes.

Region 1

#11

Region 2

#2

#7

Control

#7

Control

621

621

621

496492338283129125

323

496492338283129125

608

608

618608

513

503

484124

484124

298

105 115

Region 1

#11

Region 2

#2

#7

Control

#7

Control

621

621

621

496492338283129125

323

496492338283129125

608

608

618608

513

503

484124

484124

298

105 115


Mutations can also be found in amplified, pooled DNA samples. Figure 5 shows capillary electrophore-sis analysis of SURVEYOR Nuclease digestion products from mixtures of heteroduplex andhomoduplex DNA representing the sensitivity of mutation detection in pooled DNA samples.SURVEYOR Nuclease digestion products derived from annealing two homoduplexes that differ by onebase producing heteroduplex to homoduplex at a ratio of 1 in 50 can still be seen clearly in the electro-pherogram.

Figure 5. SURVEYOR Nuclease digestion products of fluorescently-labeled amplicons derived froman ABCC6 gene exon in normal control DNA (K562 cell line) annealed at different ratios to agenomic DNA homozygous for a single-base mutation. The 445-bp amplicon was PCR amplified withMaximase Polymerase in Nested PCR and labeled in the second round of PCR with FKS UniversalPrimer at the upstream end (blue color) and TPB Universal Primer at the downstream end (red color).Heteroduplexes were formed by annealing different amounts of mutant DNA with normal DNA.Approximately 200 ng of the unpurified amplicon DNA in 5 µL of PCR product mix were digested byadding 1 µL of SURVEYOR Nuclease L directly to the mix, incubating this digestion reaction for 20 minat 42 ºC, and adding 1 µL of Stop Solution. An aliquot (1 µL) of digestion mixture was mixed with 8.5µL of HiDi Formamide and 0.5 µL of ROX size standard and digestion products were analyzed bycapillary electrophoresis on an ABI PRISM 3100 Genetic Analyzer. Numbers indicate fragment sizes.

Mutant Load

0

50%

20%

10%

5%

3.3%

2.5%

2%

136 309 445


Factors Affecting the Quality of ResultsThe two key factors influencing the quality of results are signal and noise (background).

SignalThe magnitude of the signal depends upon

• The quality of the PCR amplified DNA.

The presence of high concentrations of primer-dimers in PCR products dramatically inhibitsSURVEYOR Nuclease cleavage at mismatch sites. Examine each amplified DNA product beforedigestion by gel electrophoresis to be sure it is a single species of the expected size.

• The relative proportion of mutant (test) to wild-type (reference) DNA in the hybridizedsample.

Whenever possible, test and reference PCR products should be hybridized in equal proportion tomaximize the amount of heteroduplex DNA available for digestion. After hybridization of equalamounts of mutant test and reference DNA, on average half of the resulting DNA molecules willreanneal as homoduplexes and the other half as heteroduplexes; the heteroduplex population willcontain two distinct heteroduplexes, each representing approximately 25% of the total population.

• The efficiency of heteroduplex cleavage.

SURVEYOR Nuclease cleaves heteroduplexes with efficiencies that can vary over a broad range.However, each substrate with a mismatch will have at least one heteroduplex species that will beefficiently cleaved at an ideal rate for analysis as described here.

Noise (Background)• The fragment pattern obtained by digesting heteroduplex DNA can also reveal the presence of

fragments derived from PCR artifacts, e.g. primer-dimers, products from primer mis-priming anderrors introduced by the DNA polymerase itself. A nearly identical background should be presentin the digestion pattern of reference DNA and this background can be identified by visualcomparison of test and reference digestion patterns (see Figures 2 to 5). When the quality of thePCR product is poor, the background after SURVEYOR Nuclease digestion can reach a level highenough to obscure the signal. Examine each amplified DNA product before digestion by gelelectrophoresis to be sure it is a single species of expected size. If it is not, optimize the PCRconditions until you obtain good quality PCR product.

• SURVEYOR Nuclease has 5’-exonuclease activity that gives rise to non-specific backgroundproducts as digestion time is increased and as the ratio of enzyme to DNA is increased. TheSURVEYOR Mutation Detection Kit has been designed to set up optimal reaction conditions thatkeep this background to a minimum.


Signal/Noise• The concentration and size of the DNA injected during capillary electrophoresis impact the

intensity of signal and background. As illustrated in Figure 8, the signal intensities of cleavageproducts are directly proportional to the concentration of the DNA in the SURVEYOR Nucleasereaction mixture. At the same time, if the DNA concentration is too high, capillary overloading canoccur, producing background peaks that migrate near undigested substrate (see for example Figure3). Overloading increases as substrate concentration increases and substrate size decreases. A nearidentical background should be present in the electropherogram of a reference DNA (digested orundigested DNA) and this background can be identified and often excluded by visual inspection.

• The signal to noise ratio is generally high enough to detect mutations present as a low percentageof the total mutant and wild-type DNA4: 2% to 20% mutant DNA depending upon the particularDNA amplicon, its size, the number and type(s) of mutation(s) and the analysis platform. Figure 5shows detection of heteroduplex present in homoduplex at a ratio of 1 in 50 (2% heteroduplex).

Note: If you are a first time user, perform the experiments in the section Control Experiments – UsingControl FT-G and Control FT-C Plasmid DNA after reading and understanding the section Step-by-StepInstructions.

Preparation of Genomic DNADNA from fresh or frozen cells or tissue should be purified by a method that eliminates proteincontamination (such as use of a commercial genomic DNA isolation kit), have an absorbance ratio at260/280 nm of >1.7, be >90% DNA (free of most tRNA and rRNA contamination as judged byappearance on an agarose gel) and be at a concentration of >5 ng/µL as determined by absorbance at260 nm. Store the DNA samples at –20 °C.

The absence of protein contamination is critical as such contaminants can interfere with PCRamplification. The absence of RNA contamination is critical as the presence of RNA contributesdirectly to an overestimation of DNA concentration based upon absorbance at 260 nm.

If the DNA template is extracted from paraffin-embedded tissue, several additional precautions shouldbe taken. The extracted DNA should be treated with uracil DNA glycosylase and a larger amount ofDNA, i.e. ~50 ng versus 10 ng should be used as template35.


Step-by-Step Instructions Detecting Mutations with SURVEYOR NucleaseThis section provides detailed instructions for the detection of mutations using the SURVEYORMutation Detection Kit for Universal Primer Fluorescent Capillary Electrophoresis.

In general, processing of samples should be carried out from start to finish as described in this UserGuide. If processing of a sample is stopped before completion of all steps, the DNA should be stored at–20 °C until the next step is carried out. However, exposure of any frozen sample to repeat freeze-thawcycles should be avoided and storage at -20 °C of PCR amplified DNA or SURVEYOR Nucleasedigestion products for extended periods (>1 week) should be avoided. Once a sample is diluted intoHiDi Formamide, it should be analyzed immediately. Storage even at -20 °C can result in loss of signal.

Step 1 — PCR Amplification of Reference and Test Samples

THIS STEP IS CRITICAL FOR THE SUCCESS OF THE SURVEYOR NUCLEASEDIGESTION. DO NOT PROCEED UNTIL:

• Your PCR yield is sufficiently high (>30 ng/µL).

• Your PCR product has low background (preferably a single species of the correct size).

The first step in the process is to prepare the amplified DNA samples.

Several factors must be considered carefully when preparing PCR amplified DNA to be used as asubstrate for SURVEYOR Nuclease analysis. Primer placement and amplified product quality andyield are crucial to obtaining good results. The following should be considered:

• Amplified DNA fragments in the size range of 200 to 800 bp can be analyzed for mutations withSURVEYOR Nuclease on capillary electrophoresis platforms. Place primers at least 50 bp outsidethe region of interest to ensure cleavage products are longer than 70 bp, since shorter cleavageproducts can be obscured by labeled primers and cleavage too close to the end of a substrateproduces a large cleavage product that can be obscured by capillary overloading.

• For a new PCR amplicon, the PCR parameters must be optimized carefully. At least initially, thequality of the PCR product should be examined by some means. We suggest using agarose gelelectrophoresis. The PCR amplicon should appear as a single sharp band of the expected size whenanalyzed by agarose gel electrophoresis. Mis-priming during PCR amplification can result in theformation of spurious DNA fragments that produce increased background during SURVEYORNuclease digestion. This places a premium on the careful design of primers and optimization ofPCR conditions. Use primers that are at least 20 nucleotides long (25- to 35-base oligomers arepreferred) and have a G-C content of 45-60%.

• Both the amount and concentration of DNA in a SURVEYOR Nuclease reaction mixture influencethe efficiency and specificity of SURVEYOR Nuclease digestion. For the amount of enzymerecommended for use in a reaction mixture (1 µL of SURVEYOR Nuclease L), 150 - 250 ng ofsubstrate at 40 - 50 ng/µL is optimal. Achieving a minimum PCR product concentration (>30 ng/µL) is also critical to maximizing SURVEYOR Nuclease cleavage product signal intensity, sinceduring capillary electrophoresis signal is proportional to DNA concentration.

• Maximase Polymerase is a blend of T-Taq DNA polymerase and the proof-reading DNApolymerase, Optimase® Polymerase. We strongly recommend its use to prepare substrates forSURVEYOR Nuclease. It produces good quality PCR products at relatively high concentrationsfrom human genomic DNA, particularly when used in a nested PCR approach. In addition, the 1XMaximase PCR buffer is an optimal reaction buffer for SURVEYOR Nuclease. This is not the casefor many other PCR reaction buffers.


Amplification of Homogeneous DNA PopulationsIn order to detect a homogeneous mutation in a test sample the PCR product must be hybridized with awild-type reference PCR product to generate mismatches for SURVEYOR Nuclease cleavage. Bothtest sample and wild-type reference DNA are amplified with the same primers. Test sample and wild-type reference PCR products are then mixed in a 1:1 ratio to maximize the formation of heteroduplexesduring hybridization.

Amplification of Heterogeneous DNA PopulationsA DNA sample can be heterogeneous either because it is derived from a heterozygous source orbecause it contains a pool of fragments derived from genetically different homozygous or heterozygoussources. Such heterogeneous samples can be PCR amplified and hybridized without mixing them witha wild-type reference DNA. The proportion of mutant to wild-type DNA in the population should beabove 2% for analysis by universal fluorescent primer capillary electrophoresis. After hybridization,use only a portion of the PCR product for SURVEYOR Nuclease digestion. Retain the remainder of thehybridized PCR product as an undigested reference (control).

Using Universal Fluorescent PrimersTwo Universal Fluorescent Primers, each with a fluorophore covalently attached internally, areincluded in this kit.

The FKS Primer contains a fluorescein fluorophore and the sequence (KS) from the 5’ end is: 5’-TCGAGGTCGACGGTATCGAT-3’.

The TPB Primer contains a TAMRA fluorophore and the sequence (PB) from the 5’ end is: 5’-TGACGAGTAGACGCTGGTAG-3’.

Two PCR procedures are described to generate fluorescently-labeled DNA product for mutationdetection using these primers: If Standard PCR does not give sufficient yield or specificity of PCRproduct then Nested PCR should be considered; Nested PCR should give higher yields of specificproduct that will result in clear SURVEYOR digests. Note that great care must taken over potentialDNA contamination if using Nested PCR.

• Standard PCR with FKS Primer and TPB Primer present in one round of PCR amplification isshown in Figure 6. To perform Standard PCR with FKS Primer and TPB Primer, you must includethe KS sequence at the 5’ end of one gene-specific primer and the PB sequence at the 5’ end of theother gene-specific primer used to PCR amplify the test and reference copies of the sequence ofinterest.

• Nested PCR with FKS Primer and TPB Primer present only in the second round of PCR is shownin Figure 7. To perform Nested PCR with FKS Primer and TPB Primer, you must include the KSsequence at the 5’ end of one gene-specific primer and the PB sequence at the 5’ end of the othergene-specific primer used in the nested second round of PCR. In addition, a second pair of gene-specific primers must be used to carry out the initial PCR reaction in nested PCR.

Some of the features of these methods are summarized in Table 2 and compared with PCR using 5’end-labeled primers.


Standard PCR with the Universal Fluorescent Primers FKS and TPB

Figure 6. Schematic diagram of Standard PCR with the Universal Fluorescent Primers FKS andTPB. Gene-specific portions of the forward and reverse primers are indicated by G1 and G2. TheUniversal Fluorescent Primer sequences and their complements are indicated by KS and KS’ and PBand PB’, respectively. The Universal Fluorescent Primers are indicated by FKS and TPB and have thesame sequence as KS and PB, respectively.

target gene

Universal Fluorescent Primers FKS and TPB amplify from the Universal Priming Sites KS' and PB’ during subsequent PCR cycles

Fluorescent PCR product

G1 KS

G2PB

KS PB'

KS' PB

TPB

FKS

PB'

KS'

forward primer

reverse primer

Initial PCR cycles generate amplicons with universal primer sequences at each end


Nested PCR with the Universal Fluorescent Primers FKS and TPB

Figure 7. Schematic diagram of Nested PCR with the Universal Fluorescent Primers FKS and TPB.Unlabeled outer forward and reverse primers flanking but not overlapping the target sequence ofinterest are used to amplify the genomic DNA template in the first outer PCR run. A small amount (0.5µL) of the product is then used as the template for a second round of inner PCR to generatefluorescently labeled DNA product. The inner PCR run is identical to the Standard PCR in Figure 6,except that the DNA product of the first outer PCR run replaces genomic DNA as the template.

FLUORESCEIN

Fluorescently-labeled amplicon for SURVEYOR Nuclease mutation detection

outer forward primer

outer reverse primer

inner forward primer

inner reverse primer

Outer PCR run

Inner PCR run

target gene

Product (0.5 µL) from the outer PCR run

TPB

FKS

TAMRA


Table 2. Comparison of PCR Techniques for Preparing Fluorescently Labeled DNA for SURVEYOR Nuclease Digestion

Initially we suggest that you carry out Standard PCR with the FKS and TPB Primers (Figure 6). If PCRproduct of good quality and in reasonable yield is not produced, perform Nested PCR. For Nested PCR,carry out PCR with a new outside primer pair as shown in Figure 7 and then use the PCR product toperform a second round of PCR that includes the original primer pair and FKS and TPB Primers. Wehave found that the Nested PCR protocol with FKS and TPB Primers usually generates high qualityPCR products, even when the quality and/or yield of PCR product generated by Standard PCR withFKS Primer are poor.

FEATURE TECHNIQUE

Standard PCR with Universal Fluorescent Primers FKS and TPB

Nested PCR with Universal Fluorescent Primer FKS and TPB

Standard PCR with 5’ End Fluorophore-

Labeled PrimerPrimers supplied by user

One pair of gene- specific primers with the FKS sequence at the 5’ end of one primer and the TPB sequence at the 5’ end of the other primer

Two pairs of gene- specific primers, one pair with the FKS sequence at the 5’ end of one primer and the TPB sequence at the 5’ end of the other primer

One pair of gene- specific primers, each labeled at the 5’ end with the same or a different fluorophore

Advantages • Custom synthesis of fluorescent primer not required (reduced cost)

• Label resistant to loss (increased detection sensitivity)

• Substrate ends can be labeled differently (mutation location relative to substrate ends identified)

• Single PCR run; no need to do Nested PCR with simple templates, e.g. plasmid DNA

• Custom synthesis of fluorescent primer not required (reduced cost)

• Label resistant to loss (increased detection sensitivity)


• Smaller amount of template DNA required (increased flexibility of sample procurement)

• Complex or poor quality templates can be amplified

• PCR product quality and quantity increased (improved signal to noise in SURVEYOR Nuclease assay)

• Many choices of fluorophores (multiplexing possible)


• Single PCR run

Disadvantages • Choice of fluorophore limited

• Longer primers required

• Choice of fluorophore limited

• Longer primers required

• Synthesis of additional primer pair required

• Two PCR runs required

• Custom synthesis of labeled primer required

• Label subject to loss during SURVEYOR Nuclease digestion


Preparing PCR ProductsTwo PCR protocols are described that employ the Universal Fluorescent Primers: Standard PCR andNested PCR. In both protocols, PCR reaction and cycling conditions are described for Maximase™Polymerase (Transgenomic, Inc.; Cat. Nos. 703245 and 703250).

We strongly recommend the use of Maximase Polymerase with this SURVEYOR Nuclease kit. Maximase Polymerase has been specifically formulated and optimized to work with these kits.

Note: If a different PCR DNA polymerase is used, we recommend the use of a DNA polymeraseblend, a mixture of Taq DNA polymerase and a proof-reading DNA polymerase. PCR reactioncomponents should be kept the same except that reaction buffer and enzyme amountsappropriate for the DNA polymerase should be used. The PCR cycling conditions should bekept the same, except the length of the 72 °C elongation step should be appropriate for the DNApolymerase used.

Standard PCR with FKS Primer and TPB Primer1 Primer Design

• Define a target sequence region (200 - 800 bps) containing a putative mutation(s).

• Select forward and reverse gene-specific primer sequences with their 3’ ends approximately 100bp away from the target region. The primers should be 25 to 35 nucleotides long, have a Tm ≥63°C, and have a G-C content of 45-60%.

• Add a universal primer sequence KS (5’-TCGAGGTCGACGGTATCGAT-3’) to the 5’ end ofthe forward primer.

• Add a universal primer sequence PB (5’-TGACGAGTAGACGCTGGTAG-3’) to the 5’ end ofthe reverse primer.

IMPORTANTThe ratio of the amount of forward primer (with KS sequence) and reverse primer (withPB sequence) to FKS Primer and TPB Primer, respectively, is critical. The 1:4.5 ratiospecified must be maintained to obtain optimal labeling of PCR product. Altering theratio by increasing the relative amount of forward or reverse primer or by decreasingthe relative amount of labeled primer will decrease the amount of fluorophoreincorporated into the PCR product, resulting in reduced signal intensity and detectionsensitivity during subsequent SURVEYOR Nuclease cleavage product analysis.

IMPORTANTSome PCR reaction buffers are not optimal for digestion of DNA withSURVEYOR Nuclease. Contact Transgenomic, Inc Technical Support [email protected] or [email protected] for moreinformation and guidance on polymerase compatibility with SURVEYORNuclease.


2 PCR Reaction Conditions

On ice, add the following components to each of two 0.2-mL tubes. One tube will be used for test sample DNA and the other for reference DNA:

• Autoclaved, deionized water sufficient to bring the final volume to 50 µL

• 5 µL 10X Maximase Polymerase Buffer

• 4 µL 25 mM MgSO4 (final concentration 2 mM)

• 4 µL dNTPs (2.5 mM each of dTTP, dATP, dCTP and dGTP; final concentration of each dNTP is0.2 mM)

• 2.5 pmoles forward primer (with KS sequence)

• 1.25 µL FKS Primer (9 pmoles/µL); 11.25 pmoles

• 2.5 pmoles reverse primer (with PB sequence)

• 1.25 µL TPB Primer (9 pmoles/µL); 11.25 pmoles

• Test sample or reference DNA (1-10 ng plasmid DNA or 10-100 ng genomic DNA)

• 0.5 µL Maximase Polymerase (2.5 units)

Perform PCR in a heated-lid thermocycler after preheating to 80 °C using the following program:

Nested PCR with FKS Primer and TPB PrimerA first round of PCR amplification is performed, followed by a second round using DNA from the firstround as template.

1 Primer Design

• The inner primer pair is identical to the forward and reverse primers used for Standard PCR withFKS Primer and TPB Primer

• Select outer forward and reverse gene sequences flanking the amplicon defined by the genespecific portions of the inner primer pair, such that their 3’ ends are in tandem with but notoverlapping the inner primers. The outer primers should be between 25 and 35 nucleotides longand have a G-C content of 45-60%.

94 °C 2 min x 1 cycle94 °C 30 s

x 14 cycles60 °C 30 s68 °C 30 s per 500 bp94 °C 30 s

x 20 cycles55 °C 30 s68 °C 30 s per 500 bp68 °C 5 min4 °C Hold



First PCR






• 10 pmoles forward outer primer

• 10 pmoles reverse outer primer

• Test sample or reference DNA (10 ng genomic DNA)



Determine the annealing temperature (Ta) by calculating the Tm for each primer. Use your favorite method or the method described below.

Tm = 63.728 + (0.41 x %GC) – (600/length)

%GC = percentage GC of the primer

length = length of the primer in nucleotides

Ta calculated from average Tm of each primer-pair -3 °C

Second PCR

Use 0.5 µL of PCR product from the first PCR as the template in a second round of PCR using the same reaction mixture and thermocycling program as used in Standard PCR with FKS Primer and TPB Primer.

Verification of PCR Product Quality and Yield1 Analyze 2-µL aliquots of each product by electrophoresis in a 2% agarose gel, prepared with high-

resolution agarose such as Transgenomic TransOneK Agarose (Catalog No. 556001) and cast in1X TBE [89 mM Tris-Borate (pH 8.3), 1 mM EDTA] + 0.2 µg/mL ethidium bromide. Add 1/6volume of a 6X loading dye buffer [10 mM Tris-HCl (pH 8.0), 10 mM EDTA (pH 8.0), 50% (w/v)sucrose, 0.15% (w/v) bromophenol blue] or your loading dye buffer of choice to the aliquot andmix. Run the gel in 1X TBE at 5 V/cm until the bromophenol blue has run 2/3rd of the length of thegel. Run several different amounts of a DNA mass ladder (e.g. 0.225, 0.45, and 0.9 µg of 100-bpDNA Ladder) as a reference.

2 Visualize the DNA bands using a UV transilluminator at 250 to 300 nm and photograph the gel.

94 °C 2 min x 1 cycle94 °C 30 s

x 30 cyclesTa °C 30 s68 °C 30 s per 500 bp68 °C 5 min

4 °C Hold


3 Use the ladder to estimate the concentration of the amplified DNA by visual inspection. If a singleband is visible in each sample, proceed; if not, consider optimizing the PCR further as alreadydescribed in this section. The DNA concentration is ideally ~50 ng/µL, but should be in the rangeof 30 to 60 ng/µL.

4 The amplified DNA can be used without further purification. Alternatively, the DNA can beconcentrated by ethanol precipitation. To precipitate DNA, transfer the reaction mixtures tomicrocentrifuge tubes that can be centrifuged at high speed. Add 2.5 volumes of ethanol and storethe tubes at –20 °C for 30 min. Centrifuge the tubes at 13,000 rpm for 10 min in a microcentrifuge.Carefully remove the ethanol with a micropipettor, being sure not to disturb the invisible pellet onthe tube sidewall and bottom. Concentrated PCR products are suspended in 1X PCR buffer (seenext section for compatible buffer guidelines). Estimate the DNA concentration on an agarose gelas described above.

Once you have prepared the PCR products successfully, continue with Step 2 – DNA Hybridization.

Step 2 — DNA Hybridization Hybridize the test and reference DNA to form hetero- and homoduplexes. Hybridize the reference DNAalone to form a reference control. The use of a heated-lid thermocycler is recommended.

Because amplified PCR products are hybridized and digested with SURVEYOR Nuclease directly in1X PCR buffer, careful consideration must be given to the 1X PCR buffer composition.

Maximase Polymerase 1X Buffer contains sufficient salt to carry out the hybridization step efficiently,as do most 1X PCR buffers.

Maximase Polymerase 1X PCR Buffer also provides optimal reaction conditions for SURVEYORNuclease. If you choose to use another DNA polymerase, read the manufacturer’s literature todetermine the other constituents of the 1X PCR buffer before carrying out the SURVEYORNuclease digestion step. The constituents of some 1X PCR buffers support efficient digestion ofheteroduplex DNA by SURVEYOR Nuclease. These include 10 to 20 mM Tris-HCl or Tris-SO4 (pH8.7 to 9.3), 50 to 75 mM KCl, 1 to 3 mM MgCl2 or MgSO4, 0.1% to 1% nonionic detergent, and BSAor gelatin. (NH4)2SO4 at 10 to 20 mM is also acceptable as long as any KCl present is ≤50 mM.

PCR additives such as DMSO (>5%), glycerol (>10%), and betaine (>1 M) inhibit SURVEYORNuclease above the concentrations listed. If any of these or other additives is present in the PCRreaction mixture, they should be removed before the PCR product is treated with SURVEYORNuclease.

If additives are present, we suggest using ethanol precipitation to clean up the PCR product before thehybridization step (see Preparing PCR Products section). The precipitated DNA should be dissolved ina 1X PCR buffer compatible with the hybridization and SURVEYOR Nuclease digestion steps, such as10 mM Tris-HCl (pH 8.8), 1.5 mM MgCl2 and 50 mM KCl. If the manufacturer does not reveal thecontents of the PCR buffer, you may wish to precipitate the DNA product and dissolve it in acompatible PCR buffer to ensure efficient digestion of the DNA by SURVEYOR Nuclease. You canthen compare results obtained with SURVEYOR Nuclease using this reconstituted DNA-PCR buffersolution with your original PCR solution to ascertain if any compromise of SURVEYOR Nucleasecleavage is occurring and if buffer replacement is required in the future.

If you are using a thermocycler, go to the Performing Heteroduplex Formation using a Thermocyclersection below. If your thermocycler cannot be programmed appropriately for hybridization or if it lacksa heated lid, go to the Performing Heteroduplex Formation without Thermocycler section below.


Performing Heteroduplex Formation using a ThermocyclerTo perform heteroduplex formation using a thermocycler:

1 Mix equal amounts of test sample and reference PCR products in a 0.2-mL tube. Place referenceDNA alone in a separate 0.2-mL tube. For efficient annealing the final volume should be at least 10µL.

Note the following:• The concentration of test sample DNA and reference DNA should be in the range of 30 to 60 ng/µL. About 150 – 250 ng of hybridized DNA is treated with SURVEYOR Nuclease L, so thateach tube should contain >150 ng total DNA at >30 ng/µL.

• Heterogeneous test sample DNA is hybridized by itself.

2 Place the tube in a thermocycler and run the following program:

The product is now ready to be treated with SURVEYOR Nuclease for heteroduplex analysis. Continuewith Step 3 — Treatment with SURVEYOR Nuclease.

Performing Heteroduplex Formation without a ThermocyclerTo perform heteroduplex formation without a thermocycler:

1 Mix equal masses of the two PCR products intended to generate the heteroduplex as describedabove. Set up reference DNA in a separate tube as above.

2 Incubate the mixture at 95 °C for 5 min in a 1-liter beaker filled with 800 mL of water and thenallow the water to cool naturally to <30 °C.

Note: Because of evaporation of liquid at the tube bottom and condensation inside the tube lid, thevolume in a tube should be ≥20 µL so that sufficient volume is present to prevent theconcentrations of constituents in the mixture from changing substantially during thehybridization step.

3 Spin the tube contents to the bottom of the tube and mix.

The product is now ready to be treated with SURVEYOR Nuclease for heteroduplex analysis. Continuewith the Step 3 — Treatment with SURVEYOR Nuclease.

Step 3 — Treatment with SURVEYOR Nuclease Once you have prepared the test sample/reference hetero/homoduplex mixtures and hybridizedreference control, you must treat them separately with SURVEYOR Nuclease directly in appropriate1X PCR buffer (for details see Step 2 – DNA Hybridization).

1 Digest the test hetero/homoduplex DNA samples and reference control DNA in separate tubes.

2 For each digestion, add the following components in the order shown to a nuclease-free 0.2-mLtube (kept on ice):

• 150 - 250 ng (4 to 8 µL) hybridized DNA

• 1 µL SURVEYOR Nuclease L

3 Mix by vortexing gently, by agitation or by aspiration/expulsion in a pipette tip using amicropipettor.

95 °C 2 min95 °C ramping to 85 °C -2 °C/sec85 °C ramping to 25 °C -0.1 °C/sec

4 °C Hold


4 Incubate at 42 °C for 20 min.

5 Add 1/10 volume of Stop Solution and mix. Store the digestion products at–20 °C if not analyzed immediately.

Note: When a heterogeneous DNA sample is analyzed, a portion of the hybridized heterogeneousDNA is not digested with SURVEYOR Nuclease and is run as a control in Step 4 — Analysis ofDNA Fragments (below).

Continue with Step 4 – Analysis of DNA Fragments.

Step 4 — Analysis of DNA Fragments

Fragment AnalysisDigested samples must be prepared for analysis on an ABI PRISM Genetic Analyzer system. Theprotocol described was developed for a 3100 instrument.

1 Mix 1 µL of a reaction mixture or 1 µL of undigested, hybridized heterogeneous DNA with 0.5 µLof an appropriate ABI ROX size standard and 8.5 µL of ABI HiDi Formamide in a 0.2-mL tube.

2 Heat the tube at 90 ºC for 2 min, and immediately place the tube on ice.

3 Transfer the tube contents to an autosampler plate and run the instrument program.

Note: Desalting digested products increases the efficiency of electrokinetic sample loading.Concentrating digestion products before analysis also increases signal strength. For applicationsrequiring high mutation detection sensitivity, ethanol precipitation of the samples beforedenaturation serves both to concentrate the sample and to reduce salt.

To ethanol precipitate DNA, treat the samples as described below.

1 Transfer the terminated reaction mixture to a 1.5-mL microcentrifuge tube, add 2.5 volumes ofcold ethanol, and place the tube at –20 °C for 30 min.

2 Centrifuge the tube at 13,000 rpm for 10 min in a microcentrifuge.

3 Carefully remove the ethanol without disturbing the invisible pellet and air dry the pellet.

4 Dissolve the pellet in 10 µL of ABI HiDi Formamide and heat at 90 °C for 2 min.

5 DNA concentrations in formamide that are too high will result in capillary overloading, which canproduce background artifacts (see for example Figure 3). Dilutions of the dissolved DNA pellet inHiDi Formamide containing ABI ROX size standard should be done to zero in on the optimalsignal to noise. For example:

6 Transfer the tubes to an autosampler plate and run the instrument program.

Volume of each component in mixture (µL)

Dissolved Pellet HiDi Formamide ROX Size Standard

1 8.5 0.52 7.5 0.54 5.5 0.5


Instrument CalibrationProper generation of a spectral calibration file is critical to calculate and compensate for spectraloverlap between fluorescein, TAMRA and ROX. Transgenomic T4D-FTHR Matrix Standards (Cat.No. 560101) for spectral calibration of the ABI Genetic Analyzer should be used to generate a matrixfile for fragment analysis in four color channels: Blue-fluorescein, Green-HEX, Yellow-TAMRA andRed-ROX before samples labeled with FKS and TPB Primers are run. The T4D-FTHR MatrixStandards are included in this kit and the User Guide is presented in Appendix B.


Notes on Software Use for Fragment AnalysisThe raw data can be displayed and analyzed by using Applied Biosystems GeneScan® AnalysisSoftware. By default, fluorescein emitting green light is acquired in the channel color-coded as blue anddisplayed as a blue electropherogram in GeneScan. TAMRA emitting purple light is acquired in thechannel color-coded as yellow and displayed as black in GeneScan and ROX (size standard) emittingred light is acquired in the channel color-coded as red and displayed as red. Users can choose othercolor schemes with the software. In this User Guide, the fluorescein channel is displayed as blue,TAMRA as red and ROX is not displayed.

Peak height measured in relative light units (RLU) of a fluorescein-labeled fragment is approximately3.5-fold higher than that of a TAMRA-labeled fragment of the same molar amount. GeneScan AnalysisSoftware can set individual dye scales for each color channel for data display and analysis. Set thefluorescein dye scale value to 1 and the TAMRA scale to 3.5 to better display fragment analysis results.Due to inevitable variations in the ratio of fluorescent primer to unlabeled gene-specific primer used forfragment synthesis, the molar ratio of the two incorporated dye labels in an amplicon may deviate from1. Calibrating dye scales using the peak heights of a full-length amplicon in the fluorescein andTAMRA channels ensures peak heights represent fragment molar amounts. For example, if thefluorescein RLU is 9432 and the TAMRA RLU is 2920 for a full-length amplicon, set the fluoresceindye scale (blue display color by default) to 1, and the TAMRA dye scale to 3.23. SURVEYORNuclease digestion fragments are viewed with the Y-axis initially set to 1000. The Y-axis should thenbe adjusted for optimum display of fragment signal and background noise.

Control Experiments — Using Control FT-G and Control FT-C Plasmid DNATwo DNAs, Control FT-G and Control FT-C, are provided in the SURVEYOR Mutation Detection Kit.These two control DNAs are plasmids with inserts that differ at a single base pair.

These controls are provided in separate vials each at a concentration of 5 ng/µL. The forward andreverse primers needed for PCR amplification are included with the plasmid templates. Thesecomprise both the sequence specific primers with the Universal sequence tails and thefluorescein-labeled FKS and TAMRA-labeled TPB Primers.

The sequence of the PCR product for Control FT-G is shown below. Control FT-C differs fromControl FT-G because it has a C in lieu of the G (underlined). Gene specific primer sequences areunderlined at the 5’ and 3’ end of the amplicon sequence in red. The FKS Primer sequence isunderlined at the 5’ end of the amplicon sequence in blue and the complement of the TPB Primersequence is underlined at the 3’ end of the amplicon in sequence in blue.

TCGAGGTCGACGGTATCGATACACCTGATCAAGCCTGTTCATTTGATTACCAGAGAGACTGTCATGATCCACATGGAGGGAAGGACATGTGTGTTGCTGGAGCCATTCAAAATTTCACATCTCAGCTTGGCCATTTCCCGCCATGGAACATCTGATCGTCGATATAATATGACAGAGGCTTTGTTATTTTTATCCCACTTCATGGG AAGATATTCATCAGCCTATGCATGTTGGATTTACAAGTGATATGGGAGGAAACA GTATAGATTTGCGCTGGTTTCGCCACAAATCCAACCTGCACCATGTTTGGGATAGAGAGATTATTCTTACAGCTGCAGCAGATTACCATGGTAAGGAT ATGACTCTCTCCTACAAGACATACAGAGGAACTTTACAGAGGGTAGTTGGTT GCAAGATGTTGAATCCTGGAAGGAATGTGATGATATCTCTACTAGCGCCAATAA GTATGCTAAGGAGAGTATAAAACTAGCCTGTAACTGGGGTTACAAAGATG TTGAATCTGGCGAAACTCTGTCAGATAAATACTTCAACACAAGAATGCCAATTG TCATGAAACGGATAGCTCAGGGTGGAATCCGTTTATCCATGATTTTGAACCGAG TTCTTGGAAGCTCCGCAGATCATTCTTTGGCGATCGATACCGTCGACCTCGA


PCR amplification of 2 µL of each DNA solution in a 50-µL reaction should produce ~50 ng/µL of a673-bp PCR product with Maximase Polymerase. Sufficient DNA is provided to perform ten PCRreactions with each control.

Control FT-G and Control FT-C can be used to troubleshoot the PCR amplification, hybridization andSURVEYOR Nuclease digestion steps of the SURVEYOR Nuclease Kit. Control FT-G and Control FT-C are intended for use with ABI PRISM CE.

WE STRONGLY RECOMMEND THAT FIRST TIME USERS PERFORM THE CONTROLEXPERIMENTS OUTLINED BELOW.

Successful completion of the control experiments will give the user an appreciation for: the yield andquality of PCR product obtained, the optimal amount and concentration of their amplified DNA to usein a reaction and the expected amount and appearance of digestion products on an ABI PRISM 3100Genetic Analyzer.

Use Control FT-G and Control FT-C as follows with an ABI PRISM CE instrument.

1 Amplify 2 µL each of Control FT-G and Control FT-C DNA in 50-µL reactions using the followingprotocol:

On ice, add the following components to each of two 0.2-mL tubes. One tube will be used for Control FT-G and the other for Control FT-C:



• 4 µL 25 mM MgSO4


• 2 µL Control FT-C or Control FT-G (includes both plasmids and Primers)



2 After amplification, analyze a 2-µL aliquot of each amplified DNA and different amounts of aDNA mass ladder (e.g. 0.225, 0.45 and 0.9 µg of 100-bp DNA Ladder) on a 2% high-resolutionagarose gel as described in Step1 – PCR Amplification of Reference and Test Samples; Verificationof PCR Product Quality and Yield. The yield with Maximase Polymerase is in the range of 50-80ng/µL.

3 Hybridize Control FT-G- and Control FT-C-amplified DNA in equal amounts (10 µL of each) asdescribed in Step 2 – DNA Hybridization. This produces a population of molecules containing 50%homoduplex, 25% heteroduplex with a C/C mismatch and 25% heteroduplex with a G/Gmismatch. Also self-anneal 20 µL of the remaining Control FT-G or Control FT-C homoduplex ina separate tube.

94 °C 2 min x 1 cycle94 °C 30 s

x 14 cycles60 °C 30 s68 °C 1 min94 °C 30 s

x 20 cycles55 °C 30 s68 °C 1 min68 °C 5 min4 °C Hold


4 Digest hybridized Control FT-G/C and Control FT-G or Control FT-C homoduplex with 1 µL ofSURVEYOR Nuclease L. In order to determine empirically the best conditions for digesting yourDNA with SURVEYOR Nuclease L, set up four, 0.2-mL reaction tubes on ice with the componentslisted in Table 3. Incubate the tubes at 42 °C for 20 min. Add 1 µL of Stop Solution to the fourtubes.

5 In separate 0.2-mL tubes, dilute 1-µL aliquots of the digestion products from all four tubes in Table3 in 1X PCR buffer containing MgSO4 as described in Table 4. Mix the tube contents thoroughly.

6 Analyze 1-µL aliquots from Tubes 5 – 16 in Table 4 as described in Step 4 – Analysis of DNAFragments. The HiDi Formamide and ROX standard should be added directly to Tubes 5 – 8. New0.2-mL tubes should be numbered for Tubes 9 – 16 to mix the 1-µL aliquots with formamide andROX standard.

Table 3. Reaction Tube Components for Control Experiments

Table 4. Dilution of Reaction Tube Contents from Table 3 in Preparation for Injection

Tube Number Volume Required (µL)

Hybridized Control FT-G/C

Control FT-G or Control FT-C

SURVEYOR Nuclease L

1 - 5 12 - 10 13 5 - 14 10 - 1

New Tube Number Original Tube Number

Volume Required (µL)

From Original Tube 1X PCR Buffer plus MgSO4

5 1 1 -6 2 1 -7 3 1 -8 4 1 -9 1 1 1.510 2 1 1.511 3 1 1.512 4 1 1.513 1 1 414 2 1 415 3 1 416 4 1 4


SURVEYOR Nuclease digestion of hybridized Control FT-G/C PCR products gives rise to twocleavage products, 237 and 436 bp in size, which are clearly distinguishable by ABI PRISM CE asshown in Figure 8. Analysis of different amounts of substrate digested with SURVEYOR Nuclease Lprovides an opportunity to establish the optimal ratio of enzyme to DNA. The optimal ratio producesthe maximum amount of cleavage products while maintaining low background. Analysis of differentconcentrations of digested substrate provides an opportunity to demonstrate the relationship betweendigested DNA concentration and digestion product signal intensity and background. An idealconcentration produces maximum signal with minimum capillary overloading, which is one cause ofbackground.

The results in Figure 8 were produced by carrying out the digestion and analysis of Control FT-G/C andControl FT-C as described in Table 3, Table 4 and the text. Several observations can be made from thedata in Figure 8. The concentration of undiluted, amplified Control FT-G/C and Control FT-C was ~50ng/µL before addition to reaction mixtures and ~4 ng/µL after completing the procedural steps toprepare the DNA for injection (Figure 8, Panels 5 – 8). Cleavage product signal intensities fromdigestion of the DNA in 5 µL (250 ng, Panel 7) and 10 µL (500 ng, Panel 8) were not substantiallydifferent. The DNA concentrations in these reactions were almost the same. Since the proportion ofcleavage products generated from 500 ng of substrate did not increase over that from 250 ng ofsubstrate, the amount of SURVEYOR Nuclease L in 1 µL was limiting in the presence of 250 ng ofsubstrate. To obtain more cleavage product, the amount of enzyme or the length of incubation wouldhave to be increased. Some background peaks (near the 673-bp homoduplex peak) were present,particularly evident in Panel 8, indicating some capillary overloading was beginning to occur.

To demonstrate the impact of reduced DNA concentration on capillary overloading and signal intensity,the digestion reaction mixtures were diluted 1/2.5 (Figure 6, Panels 9 – 12) and 1/5 (Figure 6, Panels 13– 16) before injection. Capillary overloading was eliminated, but digestion product signal intensity wasreduced in proportion to the dilution (DNA concentration).


Figure 8. SURVEYOR Nuclease L digestion products of fluorescently-labeled Control FT-G/Cheteroduplex (HTD) and Control FT-C homoduplex (HMD) prepared as described in Table 3, Table4 and the text were run on an ABI 3100 Genetic Analyzer. From top to bottom, the concentrations ofdigested DNA in the HiDi Formamide injection mixture were estimated to be ~4 ng/µL (Panels 5 - 8),~1.5 ng/µL (Panels 9 - 12) and ~0.75 ng/µL (Panels 13 – 16). DNAs [250 ng for samples marked H(M/T)D5 and 500 ng for samples marked H(M/T)D10] were digested with 1 µL of SURVEYOR Nuclease Lfor 20 min at 42 °C. The expected digestion products of 237 and 436 bp were obtained from a 673-bpamplicon. Aliquots (1 µL) from Tubes 5 - 8 (Table 4) were mixed undiluted with 9 µL of HiDiFormamide plus ROX standard and run in Panels 5 - 8, respectively. Aliquots (1 µL) from Tubes 9 - 12(Table 4) were diluted with 1X PCR buffer 1/2.5 and 1 µL was mixed with 9 µL of formamide and ROXstandard and run in Panels 9 – 12, respectively. Aliquots (1 µL) from Tubes 13 - 16 (Table 4) werediluted with 1X PCR buffer 1/5 and 1 µL was mixed with 9 µL of formamide and ROX standard and runin Panels 13 – 16, respectively.

1/2.5 µL

1/5 µL

1 µL

5

6

7

8

9

10

11

12

13

14

15

16

HMD 5

HMD 10

HTD 5

HTD 10

HMD 5

HMD 10

HTD 5

HTD 10

HMD 5

HMD 10

HTD 5

HTD 10

237 436 673

1/2.5 µL

1/5 µL

1 µL

5

6

7

8

9

10

11

12

13

14

15

16

HMD 5

HMD 10

HTD 5

HTD 10

HMD 5

HMD 10

HTD 5

HTD 10

HMD 5

HMD 10

HTD 5

HTD 10

237 436 673


Appendix A: TroubleshootingEffective use of the SURVEYOR Mutation Detection Kit depends upon successful completion of anumber of steps. One of the most critical is PCR amplification that must result in the production ofspecific, uniform-sized DNAs in sufficient quantity to be detected after hybridization and cleavage.Also critical is matching the amount of DNA and SURVEYOR Nuclease L used. If you are a first-timeuser, you should process the control DNAs provided through all of the steps as described in ControlExperiments – Using Control FT-G and Control FT-C Plasmid DNA.

The control DNAs should also be used to troubleshoot various steps in the procedure.

This appendix section covers a list of issues that you might encounter when using the SURVEYORMutation Detection Kit and how to resolve them.

Problem 1 – Low PCR yield or no PCR product using Standard PCR with FKS and TPB Primers

Problem 2 – Multiple PCR products using Standard PCR with FKS and TPB Primers

POSSIBLE CAUSE SOLUTION

Not enough template Increase the template concentration.Suboptimal PCR parameters Do one of the following:

• Adjust the annealing temperature in increments of 2 °C.

• Increase the extension time. For Maximase Polymerase, use 30 s per 500 bp.

Suboptimal DNA polymerase or MgSO4 concentration for target

Change the polymerase concentration in increments of 0.5 units and/or reduce the MgSO4 concentration in increments of 0.25 µM.

Template of poor quality or in limiting amount

Use Nested PCR.


Poor primer design Redesign the primers to Tm ≥63 °C.Annealing temperature too low

Increase the annealing temperature in increments of 2 °C.

Extension time too long Reduce the extension time. For Maximase Polymerase, use 30 s per 500 bp.

Cycle number too high Reduce cycle number in increments of two.Suboptimal PCR conditions Use Nested PCR.


Problem 3 – No cleavage products observed upon analysis after SURVEYOR Nuclease treatment of known heteroduplex

Problem 4 – High background after SURVEYOR Nuclease Treatment


Proportion of mismatched target too low

When mixing potential targets, if possible increase the proportion of mismatched target.

The cleavage site is too close to the end of PCR product

Redesign the primer set to move the target site away from both ends.

Inactive SURVEYOR Nuclease Perform the Control reaction to verify enzyme performance.Too little enzyme Increase the amount of SURVEYOR Nuclease two-fold and

repeat the digestion.Too little substrate Concentrate the PCR products by ethanol precipitation before

annealing.Incompatible DNA polymerase buffer used

Change DNA polymerase used for PCR (contact Tech. Support).

PCR product contains primer-dimers

Amplify DNA using the Nested PCR protocol.


Suboptimal hybridization step Do the following:• Dilute the DNA concentration to ≤ 50 ng/µL.

• Repeat the hybridization step, taking care to cool the annealing mixture slowly.

• Add 1X PCR reaction buffer to precipitated products before annealing.

Errors introduced by PCR enzyme Use a high-fidelity PCR enzyme, such as Optimase Polymerase. Too many mismatch sites Redesign the amplicon to reduce the number of mismatch sites to

1 to 3 per amplicon. Incubation time too long Reduce the SURVEYOR Nuclease digestion time by 5 min

increments.Too much SURVEYOR Nuclease Reduce the SURVEYOR Nuclease two-fold and repeat digestion.Incompatible DNA polymerase buffer used

Change DNA polymerase used for PCR (see website table).

DNA amount too low Increase the DNA amount to ≥ 150 ng of substrate per 1 µL of SURVEYOR Nuclease L used.

Nonspecific PCR products Amplify DNA using the Nested PCR protocol.Always use an appropriate substrate as a control to identify background.


Appendix B: T4D-FTHR Matrix Standards User GuideCatalog Number: 560101

Package Size: each

Tube Contents: 35 µL

Description: The T4D-FTHR Matrix Standards are used to generate a matrix file required for four-color fluorescent fragment detection using the ABI PRISM® 3100 Genetic Analyzer. Use of thesestandards is required for analysis of DNA cleavage products derived from the TransgenomicSURVEYOR® Mutation Detection Kit for Universal Primer Fluorescent Capillary Electrophoresis(Product Numbers 706101, 706102 and 706103).

Matrix calibration generates mathematical matrices that describe the fluorescence emission spectra offluorescent dyes on the instrument, correct spectral overlap of four different fluorescent dye-labeledsamples in a single capillary and eliminate bleed-through caused by spectral overlap between thedifferent fluorescent dye colors. The standards consist of a mixture of four DNA fragments 100, 120,140 and 160 bp in length labeled with fluorescein (blue), TAMRA™ (yellow), HEX (green) andROX (red), respectively.

A new matrix file must be generated whenever you install a new capillary array, use a different gelpolymer, electrophoresis buffer, dye set or instrument or you begin to see a decrease in spectralseparation (pull-up and/or pull-down peaks).

Normally the matrix from a matrix file is automatically applied during data collection using the selecteddye set. This User Guide describes T4D Matrix calibration using Foundation Data Collection Version 2(Applied Biosystems). Users of other versions of data collection/analysis software, such as ABIPRISM® 3100 GeneScan™ software, should refer to the corresponding user manual for instructions.

Storage Conditions: 10 mM Tris-HCl, pH 8.0 and 1 mM EDTA. The standards are stable for 12months when stored as directed. Store at 2-8 oC upon receipt.

Preparation of Matrix Standards for UseThis example is for a 16-capillary system. For larger systems, e.g. 96-capillary systems, calibrate asappropriate for the number of samples.

1 Mix the tube contents thoroughly and spin down the contents briefly.

2 Add 16 µL of T4D-FTHR Matrix Standards to 160 µL of high quality deionized formamide in a1.5-mL microcentrifuge tube. Mix thoroughly and spin down the contents briefly.

3 Heat the tube at 90 °C for 2 min, and then chill on ice.

4 Dispense 10 µL into each well (16 wells total) of two adjacent columns of a 96-well microtiterplate for ABI 3100 instrument sample loading. The two columns should be positioned for one 16-capillary sample loading injection, e.g. wells A01-H02. Spin the plate briefly to place well contentson the bottom.


Generating a Matrix Standards FileThe procedure is described as for POP-4 polymer in a 36-cm capillary array.

1 In Foundation Data Collection Version 2 under Protocol Manager, create a new protocol forrunning the T4D-FTHR Matrix Standards by entering the appropriate information:

Click the Edit Param… button, enter the following parameters:

Matrix Condition Number Bounds: lower = 4, upper = 7Locate Start Point: After Scan = 2000, Before Scan = 5000Limit Analysis (scans): 4000Sensitivity: 0.1Minimum Quality Score: 0.80

The Run Module “Spect36_POP4_1” comes with the software installation. The parameters can be viewed under the Module Manager:


2 Create a plate template for the Matrix Standards sample loading by clicking the New button underPlate Manager. Select Spectral Calibration as the Application Type and 96-Well as the PlateType.

Fill in the sample names (arbitrary) for the 16 wells containing the matrix dye set. Select SpecT4D, created in Step 1, as the Instrument Protocol 1 associated with the wells. For example, the Matrix Standards in wells A01 to H02 will be injected for analysis.


3 Mount the plate and start the electrophoresis. The status of the calibration can be monitored underInstrument Status>Event Log, which displays success/failure and QC data for each capillary. Thecalibration result and the raw data for each capillary can be examined under Spectral Viewer byclicking the grid representing the well positions after selecting Any4Dyes as the Dye Set and thecurrent run under the List of Calibrations.

4 For successful calibration, the Matrix Standards exhibit four distinct fluorescence emissionmaxima, the Condition C-numbers are between 4 and 7, and the Q-numbers are above 0.80. Formore information on verifying spectral calibration data, please refer to the instrument and softwareuser guide by Applied Biosystems.

The spectral calibration overwrites the old spectral calibration and is automatically set to active for Dye Set “Any4Dye” if QC passes. Protocols selecting “Any4Dye” as the Dye Set will use this calibration.



U

CU

T H

ER

E

Appendix C: Reagent Master Mix Calculation Chart

Outer PCR of Nested PCR ProtocolTotal number of reactions (Rxn) = number of test samples + reference reactions (1 per 50 test samples).

Note: For large sample numbers, consider including additional reactions to the total reaction number to allow forsufficient volumes and pipetting practices.

Vtemplate is the volume (µL) of template DNA in a 50-µL PCR reaction.

Standard PCR Protocol and Inner PCR of Nested PCR ProtocolThis protocol is recommended for both Standard PCR and as the inner PCR protocol of a two-staged Nested PCR.

Total number of reactions (Rxn) = number of test samples + reference reactions (1 per 5 test samples)

For nested PCR, Vtemplate = 0.5 µL.

For standard PCR, Vtemplate is the volume (µL) of template DNA in a 50-µL PCR reaction.

Outer PCR Master Mix Final Concentration

Amount (µL) per Rxn

Amount per Experiment (µL)

Rxn ( )

Water - 28.5 – Vtemplate × Rxn =10X Maximase Buffer 1X 5 × Rxn =25 mM MgSO4 2 mM 4 × Rxn =2.5 mM dNTPs 0.2 mM 4 × Rxn =5 U/µL Maximase Pol 0.05 U/µL 0.5 × Rxn =2.5 µM outer forward primer

0.2 µM 4 × Rxn =

2.5 µM outer reverse primer

0.2 µM 4 × Rxn =

Total volume - 50 – Vtemplate × Rxn =

PCR Master Mix Final Concentration

Amount (µL) per Rxn

Amount per experiment (µL)

Rxn ( )

Water - 32 – Vtemplate × Rxn =10X Maximase Buffer 1X 5 × Rxn =25 mM MgSO4 2 mM 4 × Rxn =2.5 mM dNTPs 0.2 mM 4 × Rxn =5 U/µL Maximase 0.05 U/µL 0.5 × Rxn =9 µM FKS 0.225 µM 1.25 × Rxn =9 µM TPB 0.225 µM 1.25 × Rxn =2.5 µM KS.GSP forward 0.05 µM 1 × Rxn =2.5 µM PB.GSP reverse 0.05 µM 1 × Rxn =Total volume 50 – Vtemplate × Rxn =

35S Technical Support US: 888-233-9283 Europe Technical Support: +33 1-30-68-90-00


CU

T H

ER

E
Appendix D: Quick Guide – Nested PCR Version
SURVEYOR® Mutation Detection Kit for Universal Primer Fluorescent Capillary Electrophoresis

Protocol assumes Transgenomic’s Maximase™ Polymerase is used for PCR and an ABI® PRISM® 3100 Genetic Analyzeris used as the capillary electrophoresis instrument. Please read the User Guide thoroughly before proceeding.

BEFORE BEGINNING – perform all control experiments before using this Quick Guide

• Design and synthesize PCR primers as described in the User Guide.• Prepare test and reference DNA samples as outline in the User Guide.• Instrument Calibration: Refer to Appendix B of the User Guide for calibration details using Transgenomic’s

T4D-FTHR™ Matrix Standard (included), or refer to Appendix C for Master Mix Calculations.Step 1 – DNA Amplification for NESTED PCR with FKS Primer and TPB PrimerProduct of first round PCR used as template for second round.

1 Primer Design

• Inner primer pair identical to forward and reverse primers used for Standard PCR with FKS and TPBPrimers

• Select outer forward and reverse gene sequences flanking amplicon defined by gene specific portions ofinner primer pair, such that their 3’ ends are in tandem with but not overlapping inner primers. Outer primersshould be 25-35-mers of 45-60% G-C content.


First PCROn ice, add the following components to each of two 0.2-mL tubes: one each for test and reference DNA:

• Autoclaved, deionized water sufficient to bring the final volume to 50 µL• 5 µL 10X Maximase Polymerase Buffer• 4 µL 25 mM MgSO4 (final concentration 2 mM)• 4 µL dNTPs (2.5 mM each of dTTP, dATP, dCTP and dGTP; final concentration of each dNTP is 0.2 mM)• 10 pmoles forward outer primer• 10 pmoles reverse outer primer• Test sample or reference DNA (1-10 ng plasmid DNA or 10-100 ng genomic DNA)• 0.5 µL Maximase Polymerase (2.5 units)Perform PCR in a heated-lid thermocycler after preheating to 80 °C using Program #1:

*Ta calculated from average Tm of each primer-pair -3ºC.

Second PCR

Use 0.5 µL of PCR product from first round PCR as template for second round PCR using the same reaction mixture and thermocycling program as used in Standard PCR with FKS Primer and TPB Primer, (Program #2).

PROGRAM #194 °C 2 min x 1 cycle94 °C 30 s

x 30 cycles*Ta °C 30 s68 °C 30 s per 500 bp68 °C 5 min4 °C Hold


Verification of PCR Product Quality and YIELD

Verify quality (clean single band and) and yield of PCR products by agarose gel electrophoresis. DO NOTPROCEED if concentration of PCR product is less than 30 ng/µL. Concentrate PCR product beforeproceeding. Substrate (PCR product) amount of 150 – 250 ng at concentration of ~50 ng/µL is optimal. Pooryields, non-specific bands and excessive primer/dimers compromise SURVEYOR Nuclease digestionreliability.

Step 2 – DNA Hybridization to Form Heteroduplexes• Mix equal amounts (ng;ng) of test and reference amplicon DNA containing 150-250 ng total DNA.• Separately hybridize an equal amount of reference or wild-type amplicon DNA as normal control.• Hybridize in a heated-lid Thermocycler using Program #3.

Step 3 – DNA Digestion with SURVEYOR NucleaseTest and reference DNA amplicons, treated separately with SURVEYOR Nuclease, serve as wild type andbackground controls. Add reagents in the following order whilst keeping on ice:

• To 150–250 ng (~5–10 µL) add 1 µL SURVEYOR Nuclease to each hybridized DNA. Mix gently and spindown briefly.

• Incubated at 42 ºC for 20 min.• Add 1/10 volume of Stop Solution and mix. Store digested products at -20 ºC if not analyzed immediately.

Step 4 – DNA Fragment Analysis and Capillary Electrophoresis• Mix 1 µL of SURVEYOR Nuclease digestion mixture with 8.5 µL of ABI HiDi™ Formamide and 0.5 µL of

ABI ROX 500™ size standard in 0.2-mL tube.• Heat tube at 90 ºC for 2 min and immediately place on ice. • Transfer the tube contents to autosampler plate.• Run instrument program using 36-cm capillary array/POP-4™ polymer, Genescan™/GeneMapper®

application type, Any4Dye dye set, FragmentAnalysis36_POP4 run module. Run-Time of 2,000 seconds hasscan range of about 800 bp. Refer to Appendix B of the User Guide for details.

• Import data files into a GeneScan project. Select Blue (fluorescein), Yellow (TAMRA™) and Red (ROX™)channels for analysis. Select (Control-click) Red (ROX) channel as size standard. Results are displayed withthese initial settings: Blue (fluorescein) dye scale = 1.0, Yellow (TAMRA) dye scale = 3.5, X-axis = auto, Y-axis = 1000. Adjust scales to best display results.

PLEASE REFER TO THE USER GUIDE FOR TROUBLESHOOTING ADVICE

For Technical Support: US – Toll Free (888) 233-9283 or +1 402-452-5400 Europe – +33 1 30-68-90-00Email: [email protected]

This product is manufactured under exclusive license to US Patents 6,391,557; 5,869,245; and other patents pending. Use of SURVEYOR Nucleaserequires a license from Transgenomic. Academic, not-for-profit and for-profit organizations have limited rights to use SURVEYOR Nuclease for researchpurposes with purchase of this product. Resale or other uses are strictly prohibited. Please contact Transgenomic for more information.

“TRANSGENOMIC”, “power of discovery”, “SURVEYOR” and the globe logo are registered trademarks, and “Maximase” and “T4D-FTHR” are trade-marks of Transgenomic, Inc. All other trademarks are trademarks of their respective holders. © 2007 Transgenomic, Inc. All rights reserved. Printed in UK.

Document Part No. 482154-00




PROGRAM #395 °C 2 min

95 °C ramping to 85 °C -2 °C/sec85 °C ramping to 25 °C -0.1 °C/sec

4 °C Hold


CU

T H

ER

E
Appendix E: Quick Guide – Standard PCR Version
SURVEYOR® Mutation Detection Kit for Universal Primer Fluorescent Capillary Electrophoresis

Protocol assumes Transgenomic’s Maximase™ Polymerase is used for PCR and an ABI® PRISM® 3100 Genetic Analyzeris used as the capillary electrophoresis instrument. Please read the User Guide thoroughly before proceeding.

BEFORE BEGINNING – perform all control experiments before using this Quick Guide for test samples.

• Design and synthesize PCR primers as described in the User Guide.• Prepare test and reference DNA samples as outline in the User Guide.• Instrument Calibration: Refer to Appendix B of the User Guide for calibration details using Transgenomic’s

T4D-FTHR™ Matrix Standard (included), or refer to Appendix C for Master Mix Calculations.Step 1 – DNA Amplification for STANDARD PCR with FKS Primer and TPB Primer1 Primer Design

• Define a target sequence region (200-800 bp).• Select forward and reverse primer-pairs with their 3’ ends 100 bp from the target region. Primers should be

25-35-mers with Tm ≥63 °C and 45-60% G-C content.• Add a universal primer sequence KS (5’-TCGAGGTCGACGGTATCGAT-3’) to the 5’ end of the forward

primer.• Add a universal primer sequence PB (5’-TGACGAGTAGACGCTGGTAG-3’) to the 5’ end of the reverse

primer.2 PCR Reaction Conditions





• 4 µL dNTPs (2.5 mM each of dTTP, dATP, dCTP and dGTP; final concentration of each dNTP is 0.2 mM)

• 2.5 pmoles forward primer (with KS sequence)

• 1.25 µL FKS Primer (9 pmoles/µL); 11.25 pmoles

• 2.5 pmoles reverse primer (with PB sequence)

• 1.25 µL TPB Primer (9 pmoles/µL); 11.25 pmoles

• Test sample or reference DNA (1-10 ng plasmid DNA or 10-100 ng genomic DNA)


Perform PCR in a heated-lid thermocycler after preheating to 80 °C using Program #1:





Verification of PCR Product Quality and YIELD

Verify quality (clean single band) and yield of PCR products by agarose gel electrophoresis. DO NOTPROCEED if concentration of PCR product is less than 30 ng/µL. Concentrate PCR product beforeproceeding. Substrate (PCR product) amount of 150 – 250 ng at concentration of ~50 ng/µL is optimal. Pooryields, non-specific bands and excessive primer/dimers compromise SURVEYOR Nuclease digestionreliability.

Step 2 – DNA Hybridization to Form Heteroduplexes• Mix equal amounts (ng;ng) of test and reference amplicon DNA containing 150-250 ng total DNA.• Separately hybridize an equal amount of reference or wild-type amplicon DNA as normal control.• Hybridize in a heated-lid Thermocycler using Program #2.

Step 3 – DNA Digestion with SURVEYOR NucleaseTest and reference DNA amplicons, treated separately with SURVEYOR Nuclease, serve as wild type andbackground controls. Add reagents in the following order whilst keeping on ice:

• To 150–250 ng (~5–10 µL) add 1 µL SURVEYOR Nuclease to each hybridized DNA. Mix gently and spindown briefly.

• Incubated at 42 ºC for 20 min.• Add 1/10 volume of Stop Solution and mix. Store digested products at -20 ºC if not analyzed immediately.

Step 4 – DNA Fragment Analysis and Capillary Electrophoresis• Mix 1 µL of SURVEYOR Nuclease digestion mixture with 8.5 µL of ABI HiDi™ Formamide and 0.5 µL of

ABI ROX 500™ size standard in 0.2-mL tube.• Heat tube at 90 ºC for 2 min and immediately place on ice. • Transfer the tube contents to autosampler plate.• Run instrument program using 36-cm capillary array/POP-4™ polymer, Genescan™/GeneMapper®

application type, Any4Dye dye set, FragmentAnalysis36_POP4 run module. Run-Time of 2,000 seconds hasscan range of about 800 bp. Refer to Appendix B of the User Guide for details.

• Import data files into a GeneScan project. Select Blue (fluorescein), Yellow (TAMRA™) and Red (ROX™)channels for analysis. Select (Control-click) Red (ROX) channel as size standard. Results are displayed withthese initial settings: Blue (fluorescein) dye scale = 1.0, Yellow (TAMRA) dye scale = 3.5, X-axis = auto, Y-axis = 1000. Adjust scales to best display results.

PLEASE REFER TO THE USER GUIDE FOR TROUBLESHOOTING ADVICE

For Technical Support: US – Toll Free (888) 233-9283 or +1 402-452-5400 Europe – +33 1 30-68-90-00Email: [email protected]

This product is manufactured under exclusive license to US Patents 6,391,557; 5,869,245; and other patents pending. Use of SURVEYOR Nucleaserequires a license from Transgenomic. Academic, not-for-profit and for-profit organizations have limited rights to use SURVEYOR Nuclease for researchpurposes with purchase of this product. Resale or other uses are strictly prohibited. Please contact Transgenomic for more information.

“TRANSGENOMIC”, “power of discovery”, “SURVEYOR” and the globe logo are registered trademarks, and “Maximase” and “T4D-FTHR” are trade-marks of Transgenomic, Inc. All other trademarks are trademarks of their respective holders. © 2007 Transgenomic, Inc. All rights reserved. Printed in UK.

Document Part No. 482155-00

PROGRAM #295 °C 2 min

95 °C ramping to 85 °C -2 °C/sec85 °C ramping to 25 °C -0.1 °C/sec

4 °C Hold


References1 Oleykowski, C.A., Bronson Mullins, C.R., Godwin, A.K. and Yeung, A.T. (1998) Mutation

detection using a novel plant endonuclease. Nucleic Acids Res. 26, 4597-4602.

2 Yang, B., Wen, X., Kodali, N.S., Oleykowski, C.A., Miller, C.G., Kulinski, J., Besack, D., Yeung,J.A., Kowalski, D. and Yeung, A.T. (2000) Purification, cloning, and characterization of CEL Inuclease. Biochemistry 39, 3533-3541.

3 Sokurenko, E.V., Tchesnokova, V., Yeung, A.T., Oleykowski, C.A., Trintchina, E., Hughes, K.T.,Rashid, R.A., Brint, J.M., Moseley, S.L. and Lory, S. (2001) Detection of simple mutations andpolymorphisms in large genomic regions. Nucleic Acids Res. 29, e111.

4 Qiu, P., Shandilya, H., D’Alessio, J.M., O’Connor, K., Durocher, J. and Gerard, G.F. (2004)Mutation detection using Surveyor nuclease. BioTechniques 36, 702-707.

5 Kulinski, J. Besack, D., Oleylowski, C.A., Godwin, A.K. and Yeung, A.T. (2000) CEL I enzymaticmutation detection assay. BioTechniques 29, 44-48.

6 Colbert, T., Till, B.J., Tompa, R., Reynolds, S., Steine, M.N., Yeung, A.T., McCallum, C.M.,Comai, L. and Henikoff, S. (2001) High-throughput screening for induced point mutations. PlantPhysiol. 126, 480-484.

7 Till, B.J., Reynolds, S.H., Greene, E.A., Codomo, C.A., Enns, L.C., Johnson, J.E., Burtner, C.,Odden, A.R., Young, K., Taylor, N.E., Henikoff, J.G., Comai, L. and Henikoff, S. (2003) Large-scale discovery of induced point mutations with high-throughput TILLING. Genome Res. 13, 524-530.

8 Greene, E.A., Codomo, C.A., Taylor, N.E., Henikoff, J.G., Till, B.J., Reynolds, S.H., Enns, L.C.,Burtner, C. Johnson, J.E., Odden, A.R., Comai, L. and Henikoff, J.E. (2003) Spectrum ofchemically induced mutations from a large-scale reverse-genetic screen in Arabidopsis. Genetics164, 731-740.

9 Slade, A.J., Fuerstenberg, S.I., Loeffler, D., Steine, M.N. and Facciotti, D. (2005) A reversegenetic, nontransgenic approach to wheat crop improvement by TILLING. Nat. Biotechnol. 23, 75-81.

10 Till, B.J., Reynolds, S.H., Weil, C., Springer, N., Burtner, C., Young, K., Bowers, E., Codomo,C.A., Enns, L.C., Odden, A.R., Greene, E.A., Comai, L. and Henikoff, S. (2004) Discovery ofinduced point mutations in maize genes by TILLING. BMC Plant Biol. 4, 12.

11 Perry, J.A., Wang, T.L., Welham, T.J., Gardner, S., Pike, J.M., Yoshida, S. and Parniske, M. (2003)A TILLING reverse genetics tool and a Web-accessible collection of mutants of the legume Lotusjaponicus. Plant Physiol. 131, 866-871.

12 Winkler, S., Schwabedissen, A., Backasch, D., Bokel, C., Seidel, C., Bonisch, S., Furthauer, M.,Kuhrs, A., Cobreros, L., Brand, M. and Gonzalez-Gaitan, M. (2005) Target-selected mutant screenby TILLING in Drosophila. Genome Res. 15, 718-723.

13 Wienholds, E., van Eeden, F., Kosters, M., Mudde, J., Plasterk, R.H.A. and Cuppen, E. (2003)Efficient target-selected mutagenesis in zebrafish. Genome Res. 13, 2700-2707.

14 Draper, B.W., McCallum, C.M., Stout, J.L., Slade, A.J. and Moens, C.B. (2004) A high-throughputmethod for identifying N-ethyl-N-nitrosourea (ENU)-induced point mutations in zebrafish.Methods Cell Biol. 77, 91-112.

15 Greber, B., Tandara, H., Lehrach, H. and Himmelbauer, H. (2005) Comparison of PCR-basedmutation detection methods and application for identification of mouse Sult1a1 mutant embryonicstem cell clones using pooled templates. Hum. Mutat. 25, 483-490.

16 Smits, B.M.G., van Zutphen, B.F.M., Plasterk, R.H.A. and Cuppen, E. (2004) Genetic variation incoding regions between and within commonly used inbred rat strains. Genome Res. 14, 1285-1290.


17 Till, B.J., Zerr, T., Bowers, E., Greene, E.A., Comai, L. and Henikoff, S. (2006) High-throughputdiscovery of rare human nucleotide polymorphisms by Ecotilling. Nucleic Acids Res. 34, e99.

18 Comai, L., Young, K., Till, B.J., Reynolds, S.H., Greene, E.A., Codomo, C.A., Enns, L.C.,Johnson, J. E., Burtner, C., Odden, A.R. and Henikoff, S. (2004) Efficient discovery of DNApolymorphisms in natural populations by Ecotilling. Plant J. 37, 778-786.

19 Sokurenko, E.V. (2001) Discovering the sweeping power of point mutations using a GIRAFF.Trends Microbiol. 9, 522-525.

20 Scaffino, M.F., Pilotto, A., Papadimitriou, S., Sbalzarini, M., Ansaldi, S., Diegoli, M., Porcu, E.,Grasso, M., Brega, A. and Arbustini, E. (2004) Heteroduplex detection with a plant DNAendonuclease for standard gel electrophoresis. Transgenics 4, 157-166.

21 Cordeiro, G., Eliott, F.G. and Henry, R.S. (2006) An optimized ecotilling protocol for polyploids orpooled samples using a capillary electrophoresis system. Anal. Biochem. 355, 145-147.

22 Caldwell, D.G., McCallum, N., Shaw, P., Muehlbauer, G.J., Marshall, D.F. and Waugh, R. (2004) Astructured mutant population for forward and reverse genetics in Barley (Hordeum vulgare L.).Plant J. 40, 143-150.

23 Shi, R., Otomo, K., Yamada, H., Tatsumi, T. and Sugawara, I. (2006) Temperature-mediatedheteroduplex analysis for detection of drug-resistant gene mutations in clinical isolates ofMycobacterium tuberculosis by denaturing HPLC, SURVEYOR nuclease. Microbes Infect. 8, 128-135.

24 Wada, T., Fukushima, Y. and Saitoh, S. (2006) A new detection method for ATRX gene mutationsusing a mismatch-specific endonuclease. Amer. J. Med. Gen. A 140, 1519-1523.

25 Bannwarth, S., Procaccio, V. and Paquis-Flucklinger, V. (2005) Surveyor Nuclease: A new strategyfor a rapid identification of heteroplasmic mitochondrial DNA mutations in patients withrespiratory chain defects. Hum. Mutat. 25, 575-582.

26 Janne, P.A., Borras, A.M., Kuang, Y., Rogers, A.M., Joshi, V.A., Liyanage, H., Lindeman, N., Lee,J.C., Halmos, B., Maher, E.A., Distel, R.J., Meyerson, M. and Johnson, B.E. (2006) A rapid andsensitive enzymatic method for epidermal growth factor receptor mutation screening. Clin. CancerRes. 12, 751-758.

27 Janne, P.A. and Johnson, B.E. (2006) Effect of epidermal growth factor receptor tyrosine kinasedomain mutations on the outcome of patients with non-small cell lung cancer treated withepidermal growth factor receptor tyrosine kinase inhibitors. Clin. Cancer Res. 12, 4416s-4420s.

28 Engelman, J.A., Mukoharar, T., Zejnullahu, K., Lifshits, E., Borras, A.M., Gale, C.M., Naumov,G.N., Yeap, B.Y., Jarrell, E., Sun, J., Tracy, S., Zhao, X., Heymach, J.V., Johnson, B.E., Cantley,L.C. and Janne, P.A. (2006) Allelic dilution obscures detection of a biologically significantresistance mutation in EGFR-amplified lung cancer. J. Clin. Invest. 116, 2695-2706.

29 Jackman, D.M., Yeap, B.Y., Sequist, L.V., Lindeman, N., Holmes, A.J., Joshi, V.A. Bell, D.W.,Huberman, M.S., Halmos, B., Rabin, M.S., Haber, D.A., Lynch, T.J., Meyerson, M., Johnson, B.E.and Janne, P.A. (2006) Exon 19 deletion mutations of epidermal growth factor receptor areassociated with prolonged survival in non-small cell lung cancer patients treated with gefitinib orerlotinib. Clin. Cancer Res. 12, 3908-3914.

30 Sattler, M., Walz, C., Crowley, B.J., Lengfelder, E., Janne, P.A., Rogers, A.M., Kuang, Y., Distel,R.J., Reiter, A. and Griffin, J.D. (2006) A sensitive high-throughput method to detect activatingmutations of Jak2 in peripheral-blood samples. Blood 107, 1237-1238.

31 Jamieson, C.H.M., Gotlib, J., Durocher, J.A., Chao, M.P., Mariappan, M.R., Lay, M., Jones, C.,Zehnder, J.L., Lilleberg, S.L. and Weissman, I.L. (2006) The JAK2 V617F mutation occurs inhematopoietic stem cells in polycythemia vera and predisposes toward erythroid differentiation.Proc. Nat. Acad. Sci. USA 103, 6224-6229.


32 Ho, A.Y., Atencio, D.P., Peters, S., Stock, R.G., Formenti, S.C., Cesaretti, J.A., Green, S., Haffty,B., Drumea, K., Leitzin, L., Kuten, A., Azria, D., Ozsahin, M., Overgaard, J., Andreassen, C.N.,Trop, C.S., Park, J. and Rosenstein, B.S. (2006) Genetic predictors of adverse radiotherapy effects:the Gene-PARE project. Int. J. Radiat. Oncol. Biol. Phys. 65, 646-655.

33 Qiu, P., Shandilya, H. and Gerard, G.F. (2005) A method for clone confirmation using a mismatch-specific DNA endonuclease. Mol. Biotechnol. 29, 11-18.

34 Gerard, G.F., Shandilya, H., Qiu, P., Shi, Y. and Lo, J. (2006) Genetic variance detection usingSurveyor Nuclease. In Genetic Variance Detection - Technologies for Pharmacogenomics (ed.Hecker, K.H.) DNA Press, Eagleville, PA, pp. 95 – 129.

35 Marchetti, A., Felicioni, L. and Buttitta, F. (2006) Assessing EGFR Mutations. New Eng. J. Med.354, 526-527.

36 Bannwarth, S., Procaccio, V. and Paquis-Flucklinger, V. (2006) Rapid identification of unknownheteroplasmic mutations across the entire human mitochondrial genome with mismatch-specificSurveyor Nuclease. Nat. Protocols 1, 2037-2047.


Product InformationSURVEYOR Mutation Detection Kit for Universal Primer Fluorescent Capillary Electrophoresis

Quantity Catalog No.

32 reactions 706101

96 reactions 706102

384 reactions 706103

SURVEYOR Mutation Detection Kit for Universal Primer Fluorescent Capillary Electrophoresis withMaximase™ Polymerase and dNTPs

Quantity Catalog No.

32 reactions SP2070

96 reactions SP2071

384 reactions SP2072

Taq polymerases introduce errors (i.e. mutations) into the amplicon that contribute to background noise.High-fidelity proofreading polymerase blends are recommended to decrease this background but main-tain yield. Use Maximase Polymerase for high-fidelity PCR.Maximase Polymerase (250 units) for 100 reactions Catalog No. 703245


Corporate Headquarters

Transgenomic, Inc.12325 Emmet StreetOmaha, NE 68164, USAPhone: +1 (888) 233-9283* or +1 (402) 452-5400Fax: +1 (402) 452-5401E-mail: [email protected]

*In North America only

Europe

Transgenomic Ltd.Z.A. de la Clef Saint Pierre10B, Rue Blaise Pascal78990 ELANCOURTFrancePhone: +33 (0) 1 30 68 90 00Fax: +33 (0) 1 30 68 90 01

Technical Support E-mail: [email protected] or [email protected]

the power of discovery®

This product is manufactured under exclusive license to US Patents 6,391,557; 5,869,245; and other patents pending. Use of SURVEYOR Nuclease requires a license from Transgenomic. Academic, not-for-profit and for-profit organizations have limited rights to use SURVEYOR Nuclease for research purposes with purchase of this product. Resale or other uses are strictly prohibited. Please contact Transgenomic for more information.

“TRANSGENOMIC”, “power of discovery”, “Optimase”, “SURVEYOR” and the globe logo are registered trademarks, and “Maximase”, TransOneK” and “T4D-FTHR” are trademarks of Transgenomic, Inc. All other trademarks are trademarks of their respective holders. © 2007 Transgenomic, Inc. All rights reserved. Printed in UK.

Document Part No. 482156-0201/2007

www.transgenomic.com

Documents

User Guide for the Transgenomic SURVEYOR Mutation Detection …pharmatech.co.kr/htm/main/download.php?user_file=129... · SURVEYOR Mutation Detection Kit Components The kit is available